Slashdot Mirror
Dot-Coms Say 'Unions Not Welcome!'
subbiecho writes: "Automotive related e-biz software company, The Cobalt Group, has spoken out against unions forming within their ranks, in this article. Cobalt Group CEO, John Holt sent an un-prompted e-mail to workers, alluding to Amazon.Com and other companies undergoing organizing drives, saying he preferred a "direct dialogue" with employees. This adds more fuel to the fire of pro-union supporters in their attempt to build a cohesive technology workers union."
I like unions better than yer boss!
Example:
Your sitting at your desk on the tech support late shift. Your manager comes to your desk and states:
"Get your stuff.
Get out.
Your fired".
Why you ask?
"Because our a hacker".
No police, no explaination, no job.
Bullocks? F**k you, it happened to me. I had to leave the city I lived in and it took years to pay my debts.
I've read the posts here and you are all pretty much anti-union. Are you lot completely ignorant of labour law?
You'd better learn how to beg.
You're quite correct. Unions are FAR from a perfect solution to the problem of Employer relations.
But I'd still rather be in a union than letting some jerk manager decide who and who isn't the best worker.
See, your Grampa seems to forget that the important thing here is that the families of ALL those people got fed. You're here aren't ya?
Interesting reply. All through the article you tell us how you are spending money then at the end you complain that the original poster was just focusing on money?
The simple truth is this: If you wanted to save a lot of money you could. You dont NEED to live in an apartment on your own, you could have roommates. You dont NEED to eat out several times a week, you could pack a lunch. You dont NEED a quality car, you can get a cheap $500 disposable one.
If you are using your kids and house as an excuse to keep from getting a better job, that is YOUR problem. Life is change. The sooner you realize that and your kids realize that, they better off you will all be.
Labor movements were started as a result of unsafe working conditions, or because of unfair child labor laws. In those days Unions served a very good purpose. No how many tech workers do you have to worry about falling into large vats of molten metal, or having their fingers caught in machinery (daisy wheel printers don't count;D). Very few.
You use the term laissez-faire. One that is almost always linked to Socialism. So what did we really learn from history about Unions and Socialism. Both start out as good and well intentioned concepts, but both suffer greatly from greed. While the needs of leaders of both are oft times met, the needs of those that the leaders serve go unanswered.
Want a good example of why unions are obsolete look at the News Printers Guild that went on strike in Seattle. Boy that sure put a stop to the Seattle Times and Seattle PI. In fact for a while both papers were given away.
History as you can see has proven time and again that "laissez-faire" or cynical ideologues are usually right because they rely on reality and not a fatasy that will never happen so long as greed exhists
If the next big recession hits there will still be a massive need for people to maintain exhisting computer systems, even if the companies that hire those people may be hurting financially.
I am not worried about the influx of foreign labor. I'm not worried about the trend for our universities to put out too many CS majors that will very soon flood the workplace and invariably push down salaries. I'm not worried about huge mega-corporations and their monopolies.
Why?
Because i'm damn good at what i do. I can program a computer as well as anyone i know. If someone can do it better than me, I am glad to learn from that person and assimilate the new material. I can hold my own in any discussion on tech, and add something meaningful to the discussion. I can do things that would blow some people's minds.
In our new computer-centric world people who can make computers do their bidding will always be in demand. Computer technology is not going away, there will ALWAYS be a need for programmers.
I am damn good at what i do, this being the case, if i'm better than 99% of the unwashed masses of other programmers, i will always have a job and i will command the salary i want. This is true no matter what happens.
Anyone who would want to join a union just isn't confident in his or her own skills. If you are confident in yourself and you are absolutely the best you can be, always striving to be better you really have nothing to worry about.
Why on earth would you subject yourself to a set salary and seniority benefits that a union would impose? If you feel that it's good to be you, you shouldn't need that crap.
What do you mean the ONLY way? Nothing is preventing workers from getting together on their own and approaching their employer.
Uh, what exactly do you think a union *is*? I't a group of employees getting together and presenting problems to their employer.
--
There is no sin except stupidity -- Oscar Wilde
Actually, no, very few professional pilots bring in $100,000. The seasoned vetrans with 25+ years of senority might, but the vast majority make at or less than public school teachers. (Coming from someone who has friends who are pilots). It takes 5-10 years for most of them to break $30,000. And it's kinda apples to oranges to compare coding creativity to the potential for stress and the responsibility that comes with being an airline pilot.
I have a friend who works at a California university. There is some kind of union present on campus. He has a tech job, and is not a union member, yet is forced to pay several hundred clams per month in union dues. The reason is that it "isn't fair for him to receive the benefits of union representation without paying."
He has constant disputes with the pointy-haired management, has a hostile workplace and a pack of other problems. Naturally the union does nothing for him, but he can't say, "don't represent me, I want nothing from you, and I don't want to give you any money."
It should be illegal to extort money from non-union members in this way.
It's unfortunate that so many of the people who are responding to this issue are completely ignorant of any history prior to the times of their own lives. The mere fact that we have weekends, vacations, child labor laws, minimum wages, basic safety standards in the workplace etc, etc all stem from the labor movement over the last century.
The notion that a skilled person can always go out and get a different job or create one not usually true. Before the "Great Depression" most skilled craftmen, which is what software engineers are today, were treated very poorly. So were academics.
It's stange to read postings by mostly technically trained people who are so attached simple minded notions like free markets and corporatism! I wonder how many such folks are born again Christians or how many could distinguish between the Vietnam War and the Peloponnesian War.
The pleasant conditions the most software engineers enjoy today are not necessarily going to last forever. The quality of software is generally poor even though we are well paid and engineers have little control over either the quality or purpose of the software they create. I suggest something like a Union of Concerned Programmers, at least for a start.
Many good points mentioned above. But my history with unions is awful.. case in point.
I got a job at a medical manufacturing plant from a buddy of my dad. They put me on a machine that was producing 720 units per shift and i was told that's all it could do from the foreman. So what did I do, I spent that night reading the instruction book for that machine. The next day I had the sucker producing 2700 units in half of my shift time. The foreman patted me on the back and my car window was smashed. My dad's friend told me to slow it down. So what did I do, I got the sucker down to 900 units per shift, got yeld at by the foreman, got my locker broken into ( lost one hell of great book), and had a wiper blade broken. All in 3 days.
So the end of that week I deciede to take my revenge on the entire union. I got the manuels for most of the plants presses and machinery ( plant was closed on sundays ) and wrote a 27 page memo to the president of the company. Come tuesday, I hit my machine and have it running at full speed, the next machine at full speed and 3 other machines running at almost there top speed. Total production I was told was about 13 days worth of output. I was smart enough to leave 1 hour before the shift change. All the while the president, and plant manager watched me behide a glass window.
I was told that most of the employees of the union were required to retrain and they would have to hit my production within 1 month. There were some layoffs from that plant within 2 weeks.
My fathers buddy never spoke to me again and we moved out of the area.
I think unions are good if the union understands that they have to produce at the maximum levels of skills they have and that they also have a good employer that will offer consistant training to improve the knowledge of the union. Better educated workers bring better productions with less stress and long term benifits to the firm.
above email is spam bait so look at my bio.
if you see me, smile and say hello.
My point is that at least every job I've taken has had pretty much the same working conditions and my friends in other parts of the state pretty much agree with me. Maybe things are different in the golden cube-seas of California; Maybe it's time I started looking for a change of scenery.
I really enjoy the work I do, otherwise I'd go do something else. What I don't enjoy is the pervasive corporate culture that seems to think our time is not a resource. I don't believe the companies I've been at are isolated examples of this.
As for your claim of union corruption, yeah it exists. But I think for the most part, unions do more good than harm.
Nobody, that is, except the National Labor Relations Board, the Department of Labor, or any number of state-level similar organizations that pass laws saying e.g. that firms are not allowed to pay less than the union-dictated wage, that firms must hire a certain number of union workers, that firms may not make refusal to join a union a condition of employment, etc etc etc etc.
It looks to me like you are the one who has not read much about the reality of unions and how, like large corporations, they rarely settle for operating in a free market.
-BBB
Giant corporation says "unions not needed"
A blog about stuff.
"The Real Meat of the matter: "* Tech companies expect un-sustainable levels of "work from their employees. "* Tech companies will lay-off people without a "second thought if it helps the bottom line. "* Tech companies will require unfair, new "contracts to be signed by all employees, without "any form of negotiation at all! (This is taken "from real life experience - where a consulting "firm completely revamped all employees stock "option contract, without protection for wrongful "termination / layoffs, and gave us no option but "to sign or resign!) Your first issue with hours puzzels me didn't you find out how many hours you would be expected to work before you accepted the job? Next you complain that a company is going to lay you off for their bottom line. Big deal there is plenty of jobs out there and every year there is more jobs opening up. If you want to roll the dice with start-ups that is your choice. Next Breaking contracts... If anybody breaches a contract with me the end up with a very costly court settelment to pay. Or didn't you set up anything like that for yourself? Wrongful termination himm that is actionable under law. Mabey you need the support when dealing with a company however I do not. And I will keep my pay checks. The government takes enough for entitlement programs thank you very much.
My company is preparing to go to LWE, and we had to ship 5 computers and about 40 boxes of tshirts, as well as some other swag, across country (LA-NYC).
It cost us some $1100 to ship it all.
That's about 3000 miles...the union at the Javits center is charging us almost $1500 to move the SAME boxes less than 1000 feet.
That's nothing but extortion, pure and simple.
We are NOT ALLOWED TO carry in our own stuff...dollies aren't allowed on the show floor unless a union guys pushing it. It's fucking ridiculous.
And the bad thing is that companies and convention centers condone this behaviour.
Another example; we have a popcorn machine at our booths...they won't allow us to dispense it ourselves, we have to pay a union worker over $20 per hour. $20 PER HOUR TO HAND OUT POPCORN!!!
It disgusts me...honest to God.
> Although I am clearly biased on this point, I just dont see any other need for a tech-union, perhaps someone else can enlighten me on
> this issue.
Simple. Consider for a moment that having ``elite" status means that you are one of the top 5% or 10% in your work bracket. Employers fall all over themselves to give you want you want.
But what if you just don't make that bracket. You're in the 10% bracket right below yours. Or you look funny. Or you decide you want to only work 40 hours a week.
Or say you lose out on a raise because your PHB decides to give it instead to one of those slackers who just happens to offer something on the side that the PHB likes. (And it's not always nookie.)
Sure, if that happened to you right now, you could walk off the job & get a better-paying one tomorrow. But recessions happen, & all of the clued bosses who would hire you in a heartbeat have hiring freezes. Or you get into a car accident, sure it's the other guy's fault but he's a deadbeat & your insurance doesn't cover it, AND you are out for six months. Can't code, can't work, can't do anything but count the holes in the ceiling thru a medication haze. And you find your employer laid you off while you were out, & no one wants to hire you.
Don't say this couldn't happen to you. For generations people have been giving loyalty & their strong backs to employers, then something happens & you discover how your boss repays all that loyalty. All it takes is one PHB, one bad break, & your career can get toasted.
And that's why unions get started. Because you can't always trust your boss.
And be glad that there's an interest in unionizing high tech. You'll never see a union at a place like McDonald's or 7-11 (which need unions worse than the high tech industry) because you need some kind of stable workforce that'll be around for at least a couple months at the job. You need jobs that are worth fighting for, that are worth having.
Geoff
I think I see a trend here. Maybe for them it really would be easier to muzzle the entire internet than to produce p
What I've noticed about the union where I work, and I'd imagine its similar elsewhere, is that the aim of the union is to "protect" the "average" employee. This is good for the mediocre employee as they are pretty safe from getting fired for doing mediocre work as long as they meet the minimum acceptable standards. Even if they're below those standards, the union will cry a river for them in their defense and they'll be able to hold onto their job for that much longer.
The bad news is, in their bargaining for better money for the lowest common denominator, they eliminated the possibility for anyone to get a raise based on any factor other than senority. It doesn't matter that one employee works twice as hard as another. He will get paid the exact same amount as the other employee. The raises are also fixed. Its gonna be 50 cents per year. Thats it. No more until the contract is renewed, and even then its not likely to get any better.
Of course, the employees aren't hopeless, but its ironic that the only way they can be truely appreciated for their performance is to move up into management, and therefore OUT of the "protection" of the union.
-Restil
Play with my webcams and lights here
If they turned on that feature, they would be robbing a union worker of his job. A major lawsuit would follow.
Considering my wages were below the lowest tax bracket, this was a ton.
- I don't care if they globalize against free speech. All my best free thoughts are done in my head.
because unions do prevent those people
from squeezing the most of their workforce...
You're right, why should a company expect to get the most out of their employees? Naw, the more lazy and surly, the better.
Programmers need a voice!
The tech corporations have a big
voice in government. Congress,
President, Senate. All of these
branches are tripping over themselves
to do what these corporations want.
Do you think that they are always acting
in our best interest?
Go to business school fool! Bottom-line.
Maximize profits.
Why does the union have to be of the 27-inch
neck variety? Why can't we have a union
that lobbies? Like the CPA's, or the Teachers,
or the Lawyers?
We need a voice! On the capitol! Who
denies this?! Who is representing your
interests? Laws are being passed people!
Can WashTech step in?
Anonymous posts are filtered.
What you are saying is that because you have voluntarily made certain life choices, everyone must change to accomodate you.
That is pretty far from what I'm saying.
What I'm saying is that a 40-hour work week isn't too much to ask of an employer. I'd be happy with a 50-hour week, but that's out of the question as well.
Here's a wacky concept: maybe you shouldn't buy a house or cars if you can't afford them, and maybe you shouldn't have kids if you can't afford to raise them.
I can afford them quite well, actually, but I don't see the need to work 12 hour days 7 days a week to pay for them. I don't drive an expensive car, I don't live in a mansion, and I spend very little money, putting over 40% of my income in the bank. I don't live paycheck to paycheck, and I haven't since I was in college, which I will also be paying for for the next 30 years.
But buying a house is expensive, ongoing bills are expensive, and really, none of this has anything to do with what is reasonable to expect from your employees.
Write back to us when you have kids.
It amazes me that all anyone got out of my post was the economic aspect. In all honesty, it's the least important, and has the most bearing on your married\single status.
I haven't had a chance to sit down to a meal with my wife for weeks now. My cats look at me like I'm the most evil person on the planet. I haven't spoken to my brother, my mother, my sister, or anyone outside of the office and my wife when I wake up in the morning in weeks.
Time is far more important than money. Money is fluid, it can always be found. Time isn't, and it goes by WAY too fast.
I think that employers should have reasonable expectations toward how much of their employees' time they can require. I don't think that this is too much to ask.
I am single, and too work in the tech industry, but understand a very simple principle that most don't ever think of. Look for a new job, get offer, accept offer, and then quit. Not so complicated now is it?
Let's see... I don't have time to spend at home, or to call my family, or to talk to my wife, but somehow I have time to job hunt, interview, second interview, etc.
It was a supermarket, actually — I noticed when I re-read my post that I should've said that instead of "grocery store," but didn't think I'd bother correcting myself with another post. FWIW, it was a "Kroger's," if you're familiar with 'em.
Cheers,
Naw.
Asses are yoked into teams to pull a load together. Like the 'group' mentioned above.
Hay thar.
How much did the screenwriter for Rules of Engagement make? Must have been one of those guys who made the minimum...
seems to me the internet and unions and the democrates all in in the same bed....and maybe thats a good thing....maybe its not...i know we all have to get along or we will get more of this bush crud thats about to hit us. besides whos cars you want a german union made bmw or a kia?...unions have thier good and bad points....just like non union does.....i guess it all depends on who joins what cus the companys will have to follow the skilled employees
The problem is that we see how it's been done in other places. We have to negotiate for us, as opposed to the auto industry... rules like:
No consecutive work weeks with more than 55 hours.
-- One week of 70 hours is fine when there really is a crunch, but when a week drags out to a month to a way of life, code productivity suffers... and often the coder doesn't notice it.
Rest is necessary for creativity. (Yes, you can have that creative spark at 30 hours straight, but you would notice that creativity comes more often with proper sleep.)
OT pay for over 65 hours in a week.
If they don't schedule properly, then it's them who have to pay, not us.
Rights to code written outside of worktime.
(and just think how much open source would flourish if people had time to code out of work!) -- there are still those contracts where an employer can hijack code.
Formalized termination procedures.
Make it possible for them to be fired, but those rules should be posted. It is a nasty restriction that will cause red tape, but it will curb problems such as being fired just before options, etc.
Protection for foreign workers...
--- but that's what a tech union should look like.
Further, there should be separate barganing for call center employees. They do resemble the auto industry in a way. Anyone can work them, but not everyone can work them for long periods of time. -- whereas bad conditions destroyed the physical body, call centers often destroy the mind.
I work in an IT department that is unionized (and my contract is currently under heated negotiation ;). IMHO the union is not a good thing for a fast moving always changing field like the IT field. I see it every day at work. Things have changed from the old dumb terminal days and the workers have not. There is no reason to change. I think you would have to shoot at least three people to get fired. Even then it would still probably be questionable. You could screw things up every day and nothing will happen. When it comes time to let someone go its not the most qualified or hardest working that stay, It is 100% based on seniority and NOTHING ELSE. You could be a complete screwup and not even know what an IP address is for, but you will still have your job when the layoffs come.
I see it every day and it is very frustrating..
This helps NO ONE.
IT/Internet/networking etc is not my company's primary focus (only about 500 IT people for 100k total work force). If it was we would not have a single customer and would have folded when the last dumb terminal was gone years ago.
Any IT/technology company that turns union will loose the ability to adapt to swift changes like a non-union company. When times are not so good and you are forced to downsizing you CAN NOT just keep the hot runners and drop of the not so hot, it does not work that way. If and when the times require you to hire again, more then likely you will be obligated to offering the previous lay-offs back again, even if they transformed from Java programer to brick layer for the 12 months they were laid off.
Bad boys rape our young girls but Violet gives willingly.
Umm. No. Your analogy does not apply. If a seller offers you a price of 10$, and the buyer says "I won't buy your product." the buyer can drop his price, or decide not to sell the product. He is not forced to sell at a lower price. What would be a proper analogy, would be every potential consumer in the world joining together, paying 50$ a month to a group of thugs, who then use their 50 billion$ war chest to make SURE you sell your product for a buck fifty. Unions are evil. They had there place in the 20's and 30's, before numerous civil reforms. Now they are nothing more than organized crime.
signature smigmature
- James
Gee, management of a company doesn't think they need a union? Gosh, that's suprising!
*End Sarcasm Mode*
It seems a lot of the posts have been critical of unions, but please remember that they have been absolutely critical in the development of many nations. There may yet come a day when the number of programmers/admins/technicians in the job market outweighs the number of available jobs. If that day ever comes, unions are going to start looking a lot more attractive to a lot of us.
What's that? Your highly trained, and have a unique skill set? That's what IronWorker Dan thought at the beginning of the Industrial Revolution. Then one day he looked around, and all his friends were trained as iron workers as well. Now, maybe Dan's company recognizes his true skill and value, or maybe they just see 100 other guys who will do Dan's job for half the price.
The phrase, "Those who ignore history are doomed to repeat it" seems relevant right about now...
The problem info-workers have is not the same as labor workers...
In labor the worker depends on that job but the employeer can get rid of him at any time.
In high skill labor the worker can leave and the employeer is stranded...
As such you have NDAs and other such agreements.
Experence is a commodity... if you have an employee who stays with you for 10 years your lucky... and you'll work to keep him...
Unions in high skill labor have been known to trash ideal work conditions...
They can only shoot for just above reasonable. When you allready have that a Union is a sereous problem.
I don't actually exist.
Ironically enough, the pricey BMW/Benz cars are assembled by non-union workers who are paid far better than the union workers employed by the Big Three. Unions are also responsible for the 8 hour day and the weekend off. Sure, they aren't perfect, but who is? I think the place where the computer industry needs unions is tech support. More of a guild system, really, than unions - better wages and so forth, but also better training.
itachi
Labor unions are not usually considered a trust ( in the anti-trust sense), so if they are legal, I don't see why they shouldn't exist. However, the "closed shop," where only union workers are allowed at a particular company is something I object to, at least in my line of work. I want to be able to negotiate my terms of work, without anyone else having anything to say about it.
In a free market, where international talent, and non-local talent can be as valuable as local brick-and-mortar style talent, it makes no sense to stick to the old fashioned "my gang is bigger than your gang" style of unions. In a world where communication is quick and valid, the market can move at a fast enough pace that companies with poor management practices will quickly wither on the vine. Laissez faire!
I want to delete my account but Slashdot doesn't allow it.
I for one would not ever join a union. Sure they had their place in the developing years of labor... now they're just money-makers for their leaders. Why should I waste MY salary paying THEM? No thanks, you backwards morons, I'll not be joining you even if I have to give up my job and revert to being a welder somewhere (I did that once, ya know).
"Nobody forces companies to accept unions"??? Labor laws do exactly that. Once the majority of workers at a company agree to organize, there isn't anything the company (or even the workers who don't want to be represented) can do to stop it; they have to accept the union & begin negotiating. And as for a recession, what's a union going to do about it? Force the company to keep you on the payroll when there's nothing for you to do anymore? Yeah, I'll bet companies just LOVE that.
when the first ceo gets fired because the workers of a company unionized and asked for so much that the company could no longer afford his 3mil + salary, you tell me.
A blog about stuff.
for software companies to move to India? Who need Silicon India when you can BE in India itself?
Oh wait, the union website says Amazon.com was looking at India around September '00, wonder if they acted on that...
Many unions are^H^H^Happear to be run by thugs who don't mind bullying union and non-union members alike... What will prevent a tech alliance from becoming corrupt? Too many egos will be clashing hardcore...
--
Peace,
Lord Omlette
ICQ# 77863057
[o]_O
is like trying to herd cats. At least with the bright ones. For the intelligently challenged, maybe not.
Believe in things of which no person has ever learned
We should take all the lazy union memebers, stick em in a bag and ship em to Cuba
poop.
I work for the Cobalt Group. I am a technical staff member. I am relatively satisfied with my work, and think the best part about the place are the people. That includes John, the CEO. The environment is very open and people communicate across many levels without getting their undies in a knot b/c one may not be following "the chain of command." As long as that is the case, I don't really see a reason for a union at our shop - however, I'm not willing to say that unions are unnecessary for the industry as a whole. I have met people who have it much worse, some at other dot-coms and some at prestigious brick-and-mortars. I am extremely grateful for my workplace dynamics when I hear their stories.
--rc
so dot-com companies don't like unions.
Name me the five companies in "traditional" companies that said "unions? gee, we love unions. you don't even have to vote! Just come in and have a chair, we'll talk".
Why is it news that these companies don't want unions around? Basically, NO company wants unions around. this is news?
Chuq Von Rospach, Internet Gnome = When his IQ reaches 50, he should sell
As more IT workers enter the labor market, an individual's skills and specialites will mean less and less. The people with the most skills will always be in demand and always have it pretty good, but there will always be an underclass of midlevel and entry-level employees. These are the people who stand to gain from unionization.
Even for those who are currently making out pretty well, there are still issues unique to the IT labor market. Maybe labor shortages are so severe that you really do need to work 60-80 hrs. a week, but maybe also you'll finally be able to actually get paid for it.
If you think your salary is really all that great, first compute your real hourly wage by factoring in all the overtime you don't get paid for. Then think about all the things you'll do with all that money when you finally get some time off... oh, wait you don't get any time off until you retire, which will happen when you either burn out or when they fire you for not being in your early 20's. What are you going to do with all that money if you've got no time to enjoy spending it?
Even if everything else is good, there's still the issue of abuses of labor. You're a lot stronger if you've got union backing and have a complaint, assuming that the complaint is valid and you have a strong, non-corrupt union helping you to look after your interests.
Bottom line is, management is already organized. It's only fair for labor to organize itself.
In order for unionization to work, here's what I think will need to happen:
Membership must be voluntary. Management cannot coerce workers not to join, and the Union cannot coerce workers to join.
Individuals who feel they can negotiate better contracts for themselves without the union should be free to do so, but they should enjoy none of the benefits that unions have secured for their members (unless they can somehow successfully negotiate them for themselves).
There must exist some means to stamp out corruption in unions. I think one good way to achieve this would be to have a means for sharing information among union members that bypasses the old-school model of the straight dope being handed down from on high.
Traditionally there have been union newsletters which brainwashed the membership with propaganda and told them what a great job the union was doing, while the corrupt bosses went around and did whatever. Instead of the traditional newsletter, why not have an open-contribution website (much like /. naturally) where union members could speak out? Important issues could be discussed with relative anonymnity and safety, and the highest-modded contributions to the discussion could be used as the basis for the choices the union would have to vote on. Done properly, this would take a bit of effort to implement, but once in place, there would be little need for union bosses, and thus there would be no one at the top to corrupt. The whole decision-making process could be transparent, and any attempts at corruption would be weeded out like bugs in open-source software.
If this isn't effective, several unions could compete with each other. Think one union is corrupt? Dump them and sign on with another! This would at least give you another option besides quitting your job and finding another one.
I don't suppose that there's an easy answer to EVERY problem that unionization brings up, but at least if there's a body in existence that addresses labor issues, new workers who enter the labor market won't have to continually invent the wheel for themselves. I certainly don't have all the answers for all my problems, but maybe a few of my friends do. It wouldn't hurt to ask them, but I might not even think to. The collective power of a union is like having thousands of friends, and you get to benefit from the wisdom of each of their experiences in dealing with management. Unionizing IT jobs could make a real difference.
I rang, you rang, we all rang for orangutang!
You see? You see? Your stupid minds! Stupid! Stupid!
If you're being attacked, the first thing you're supposed to try is to get away. Only when that's not possible does the law permit you to use force. In this case, if your employer is treating you badly, you don't get your AK-47, you get another job.
I'm still wondering why the guy who started this sub-thread can't simply tell his employer that he's not going to work 12-hour days, 7 days a week. The worst that can happen is that he's fired from a job he considers crap anyway.
"If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine
Ah, the wonderful tried and true Social Darwinist ideal. The cream rises to the top, right? And once there, we all know they are extremely moral and take good care of everyone. Of course they don't lobby to the government claiming they don't have enough native IT workers, and get them to pass bills allowing 80,000 IT jobs to be imported each year, driving down wages, right? No, they're far too moral. Of course strict laissez faire capitalism doesn't breed a cycle of poverty, causing even the most talented to have to struggle 10x as much as some dumb kid of a rich CEO, because we all know that the invisible hand guides things to the moral side. Hell, even Adam Smith never claimed it was moral. You're far too idealistic if you believe what i think you're trying to say. The fact of the matter is, once you're at the top, it's not hard to forget what it was like when you weren't. Most people don't give a shit, and will do anything to lower overhead and increase shareholder profits. Our society's far too complex for the libertarian ideals you exude. Communism may only work in a dream world, but the same goes for laissez faire capitalism and strict libertarianism. Social Darwinists are just presumptuous pompous asses who are looking for a reason not to feel guilty about those they exploit. Andrew Carnegie may have been a great philanthropist (founded many libraries, a university...etc) but he sure didn't do too much for his workers. The only reason the average factory worker isn't working 12 hour days and being told the business isn't responsible for their finger being cut off is because of unions, and that alone is good enough reason for me, because I doubt that corporate boards are any more moral than they were 100 years ago, especially when they still use Chinese slave labor and pay Indonesians $1.25 a day (which allows them to buy 2 plates of rice with a small amount of steamed vegetables and live in an 8x15' hut with a tin roof). I wonder what's lacking in those countries...hmm.....unions?
(especially if they help other workers in their industry organize)
It's not dumb unions, it's corrupt unions. I'm not neccessarily talking about Teamsters/mob stuff, either. I mean union bosses acting as another layer between capital and labor.
The AFL-CIO is a labor bureaucracy designed to serve the few, the piecards (paid union officals) by making deals between management and the workers. The structure of the mainstream unions in the US guarantees a structural corruption in unions.
Think about it, what a union is supposed to be: a union should be the workers themselves, united, in solidarity to achieve a common goal.
The working class and the employing class have nothing in common. - IWW Constitution
- Paul in Seattle
Comment removed based on user account deletion
I have been freelancing for over 11 years. I complete the project and leave. Every time. I come back if they have another. And they usually call.
You don't need a job. You merely need to present interested parties with your attractive skills. If you don't have them, get them. Jeez, in the early, lean days I was even a secretary! The most iimportant skill is being able to make their job easier. Tell me that doesn't inspire the business equivalent of love!
Now try conceiving of the sheer justice of a union, while simultaneously holding (at least for a moment) the notion that there is no such thing as a "right" to a job. You can't do it.
A job is created when some industrious soul (who has likely already worked himself silly) conceives of a valuable task that is simply too much for him to do alone. He makes an agreement with someone to exchange value for value, possibly you.
How will a union protect you when the company goes under? Or when the project ends? How will it protect you when the most skilled workers take their ball(s) home? Or when the guy at the top realizes he's stuck with a bunch of losers and closes up shop?
Unions are like the Spanish Armada. They cannot compete with guys like me, who whip around in our tiny boats.
This isn't about insulting those who love unions. It's about indicting a really bad idea. You die-hard socialists go ahead and join the union. I wish you the best of luck. I really do. But get ready to say good-bye to the best and brightest, those benevolent and willing mentors who until now have gladly shown you the ropes. They'll be on to greener pastures, because you've just tried to chain their wallet to the dumbest guy on the staff. The company (or project) that they go to may just eat yours for lunch.
Quit whining about how you're treated: leave!
Quit whining about cube hell: leave!
Quit whining about your wages: learn!
You can do it yourself. Anything. Although you may need to hire someone. Imagine if they wouldn't let you stop paying them when you wanted to end the project. Imagine that they got some thug (say, a fed?) to promise bad things would happen to you if you refused. Imagine that they demanded you pay their useless pal, Wayne, to "help". Oh, it goes on....
-B...
The mere fact that we have weekends, vacations, child labor laws, minimum wages, basic safety standards in the workplace etc, etc all stem from the labor movement over the last century.
:)
Damn - now I go an do this contracting/consulting thing and find that weekends are for working, vacations are a figment of my deranged imagination, my pre-school child is helping me code (and doing a better job of it - little bugger!) not to mention the fact that my desk doesn't sit right and I'm sure the lighting is out of whack.
Still, the $500k per year I'm pulling in more than pays my medical, loss of income protection and other such things.
I figure that when I retire in a couple of years, I might just buy me one of them union things...
*cough cough*
Most of the above is a joke - I'll leave it to you guys to figure which bits are jokes and for what reason(s)
I left my body to science, but I'm afraid they've turned it down...
OK, so back in the past, unions did a lot of good stuff and fought for the right of the worker to not be stomped by nasty employers. Given the situation 100 years ago, I can agree that was a good thing.
:)
:)
:)
:( The classic example mentioned here was the car manufacturers "colluding" on payrates and preventing skilled staff job-hopping.
:)
:)
However, times change and I'm not going to rely on the situation of 100 years ago to justify what I see around me in unions today. Afterall, I'm driving a shit-hot car with great features and flying ace aircraft now - 100 years ago, we didn't have all that. Should I accept shoddy driving/flying environments because a group fought to get them 100 years ago?
Here are some notes from my experience many years ago:
1. Working as a casual hours shop assistant in a KMart (working for pocketmoney while at school) - I was *forced* to take a 15 minute break in the middle of my four hour shift because the union demanded it. They never asked me if I liked having to sit for 15 minutes in the smokey staff area wondering how long it would take to get back into the swing of my work when I returned to the floor.
2. Despite Australia's "voluntary union" status, I was forced to pay union dues (deal between unions & mega-store chain to reduce disruptions).
3. The union supported government parties/delegates that I did not.
4. Votes were conducted as a "show of hands," not a secret ballot. Guess what kind of experience you would have if you voted against the desires of the union/delegate....
Now some current experience from a union that is a client of mine (I do IT/management consulting for them)
1. Fewer people joining the union has resulted in less income which is placing a strain on their out-dated management concepts (little empires, massive duplication of effort, obsolete equipment, etc).
2. Senior union management are realising that they may have to downsize and undergo process review/re-engineering to survive (all the things they complained about when fighting employers
3. One union here is in the middle of a strike with its own admin staff - they are part of a different union and are striking over work conditions at the union's offices. Poetic justice?
Unions once were great, have gone through a period where they got "too big for their boots" and are now being dragged back to reality. Where I see a union excelling is:
1. Where people cannot job-hop to other employers for better conditions, etc (hotshot tech/management staff can get away with it - call centre staff often cannot
2. Where "free" legal advice/service is not available - either contract reviews or fighting for rights - such as the firebrigade staff who were terminated for speaking out. Unions can offer a centralised service to members for free/cheap due to economies of scale.
Reviewing the above two points, isn't this what groups like the IEEE and Australian Computer Society attempt to offer?
One person has noted previously in this discussion that they wouldn't join the IEEE due to their political machinations. Perhaps if sufficient people were to note their disagreement with this direction, the IEEE could:
a) stop their machinations
b) have an "opt-in" political contribution as part of membership - those who agree pay, those who don't do not (nifty way of checking if they really do represent the desires of their members
Organisations such as unions have their benefits, provided they create and maintain a system which is agreed to by their members. One problem here is in the method by which member agreement is obtained. Another problem is getting a large group of people to agree on anything
There is a need for some sort of representation for those in IT who do not have cutting edge skills (eg: those who haven't reinvented themselves every couple of years). Whether a union is the answer or not will be decided by the industry itself over the coming years.
I left my body to science, but I'm afraid they've turned it down...
Before I start on this, I would like to note that I am not currently in a union noe have I ever been in a union. However, I have worked in a "union shop" More on this later.
Most intelegent programmers laugh at the thought of a "tech union"... demand is so high that for most of us we could easily walk and get another job.
Quite right. This is not so much an issue for programmers, project managers, sysadmins and other members of the technical elite. Remember however that amazon.com (for instance) employs a number of less-than-technical people in warehouse jobs, editing positions, tech support, etc. These jobs are not well compensated, and especially when you're down at the bottom of the food chain, the mobility level between companies as not as high as it is for techies.
Now, something which you may not know about unions. When a union comes into an organization, it does not (in most cases) force every single non-management person in the company to join the union. I worked as a design engineer in a marine electrical company at one time. The workplace floor was what we call a "closed shop". If you don't have your union card, you don't pull wire.
The front office had no such restrictions. None of the engineers were unionized, nor were the accountants, sales people, etc. (some of them used to be shop guys, but I don't think they kept their cards up to date. Could be wrong about this).
Having said all of this, working in a unionized shop was not one of the more fun jobs I've had. A nine-to-five attitude permeated the place, and the managers figured that the workers were all out to hump the company. On the other hand, having friends who work at Amazon, some shops really deserve to have a union forced on them. If Jeff Bezos doesn't figure out how to reward employees with something other than 50 hour-weeks, forced overtime near Christmas, and now not-so-valuable stock options, that may be the situation he will face.
Okay. Whoever moderated this down is an idiot. You don't moderate a posting up or down based on whether or not you agree with the point made: you moderate based on the quality of the facts and method in which they're presented.
Yes, read your moderator guidelines.
Regardless, I still have more karma than you do.
Fire and Meat. Yummy.
Like a good trade organization hear in Hollywood in the Biz. A trade organization where the bar to enter the union is your solid skills in your craft. Where an employer will hire union, because for twice the pay they get 3x the work done and done properly. Where the union provides a buffer for those of us who switch jobs frequently - the retirement, medical benefits that we techincal nomads often don't get. It works for film editors, it can work for programers. Not all unions are like the Teamsters. Some try to leverage the skills and professionalism of their members.
It is true that technology companies expect un-sustainable levels of work, but in the vast majority of cases, these companies are fairly compensating their employees.
This is SUCH bullshit.
How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?
How do you compensate someone for the entire months lost due to crunch time, forced by the people who a) have the money to invest in realistic scheduling and b) aren't there with you the whole time?
You are right, there are companies and managers who are reprehensibly bad at scheduling and who feel that a hands-off approach (read golfing) is a proper way to lead a team. However, how long do you expect to work at this place? Are you seriously going to put up with this managerial bullshit for the rest of your life? What keeps you at this particular job? Are you at the only software company in your city?
I'm asking earnestly. I really can't understand why someone would stay at a crappy job when they clearly should be able to get another job at the drop of a hat. I understand that you have bills to pay, I understand that you have mouths to feed, but I don't understand why you would put your own sanity on the line in such a terrible work environment.
Do you think that a union would be able to help you in this bad company? If 'yes', how so? Would they force the company to limit your work hours to 40? Would they make it mandatory for all managers to read Rapid Development or Code Complete?
I don't see
1) Why you would put up with working at a crappy company. and
2) What you expect a union to do for you.
Dancin Santa Searching for answers...
Wow, a comment worth reply. :)
.1 * c, the law of supply and demand stops working well when we move away from ideal free market conditions. Good and bad results that the free market system couldn't predict happen. Somehow, unionized industries are able to have real wage increases without massive layoffs. Somehow, Microsoft has been able to retain control of entire markets with substandard products in the face of substantial competition. Examples of results opposite what supply and demand would predict abound.
I guess if you take my argument to its logical extreme it is Functionalism (which is distinct from Marxism, but now I'm using that philosophy minor to split hairs). But it's really more of a free-market Functionalism - techies are the critical irreplaceable segment of an IT company. They're skills are unique and a finite number of people can do their job at all, therefore, like executives, they should be generously compensated (obviously less so than senior managment - but the point is that both groups are critical). Support departments tend to be a different story. However, techies, like blue-collar folk, tend to be isolated from management and most likely to be subjected to unfair treatment (I don't know any Marketdroids who worked 70 hrs/wk for two weeks to meet a deadline only to get laid off the next morning when the project got done on time). This is where some form of representation comes in.
This sounds racist to me.
There's plenty of documented cases of employers abusing the H1-B system. It has no checks and balances - these people often get fucked. You can read other comments here or the original stories for examples. (I wish to plead laziness for not supplying links.) There was absolutely no attempt by tech workers to lobby Congress on these issues, so suprise, we got shitty, one-sided legistlation. Until we live in a world with absolute free trade with a truly global market (never) restrictions on outsourcing employment are justified.
If they screw you, you leave.
That gets hard if everyone is colluding to screw you. It's true that some software isn't made by a couple oligopolies like cars are - yet. Despite this fact, anti-consumer initiatives like SDMI, CSS, etc. have managed to get universal support. It may only be a matter of time before everybody's management gets their act together to suppress developer wages. I'm not saying they would be wrong in trying to do so - that's their job, minimize expenses. The purpose of a union is to provide a counterbalancing institution - at least in theory. Someone needs to be looking out for your interests.
I'm not gonna play long-term predictor, but the dotcom shakeout indicates we might be seeing a world with relatively few software/networking/whatever companies. Most industries tend to consolidate as they mature, and there's no reason software would be an exception. If and when all software is made by Apple-Microsoft-Intel-NBC or IBM-Redhat-Sun-AOL-TimeWarner and three other companies, leverage would shift substantially away from the workforce to the employers. If you think this is absurd, bear in mind we once had dozens of automakers in America, we now have exactly two (Chrysler doesn't count). Troll-preempt: This an exagerrated example, please don't tell me Apple belongs in the second megacorp or something like that. (Somewhat OT, while I'm not a Marxist, he did predict consolidation decades before it happened. Rest assured, I hate communism as much as you, just should give credit where it's due.)
Three of the five groups you mentioned have recently pulled or are pulling strikes about bullshit issues and making ridiculous demands.
It cuts both ways. Counterexample: Pepsi workers where I live had shitty wages, pension plans, disability pay, etc. The union came up with a proposal that would have compensated Pepsi workers slightly less than local Coke workers with equivalent jobs. The company made a ridiculously low offer and then refused to negotiate "on principle." Who's the idiot here? All a strike indicates is an inability to reach an agreement - it isn't automatically the union's fault.
I may be going out on a limb by suggesting that we trust a system with a rather shady history. But we may have the solution to the problem of advocates who don't advocate well - the Internet. Rank and file union members have set up websites criticizing bad union leadership and company management alike. The NWA flight attendant contract (big issue when you have one airline like we do in Minneapolis) was scuttled by an independent website which claimed it didn't really benefit members.
In the olden days, all organizations had to be hierarchial - you had to have literal "bosses" even in unions. Today, you can set up a discussion site where anyone with a stake in the issues can voice their opinion. If flight attendants can use the net to prevent abuses of the union system tech workers should have no difficulty. It's awfully difficul to bullshit a large group of people who have the ability to communicate on a discussion system. I just can't see a traditional crooked union popping up when all the members can post comments.
It's a basic truth of economics that increased prices will result in decreased demand.
It is also a basic truth of physics that bodies move in accordance with Newton's laws and relations derived from these laws. Any so-called "basic truth" or "law" is valid only under a finite set of circumstances. Just as the laws of classical mechanics only accurately describes the world at relatively low speeds, the law of supply and demand only accurately describes the world in markets where all information is available to all actors, the number of actors is large, all actors meet the formal defition of efficiency, and the barriers to entry and exit approach zero.
Just as Newton's laws stop working well as we approach
These so-called "laws" become become less useful in describing behavior as we move away from the hard sciences to the soft ones, like economics and political science - even the Iron Law of Political Science has two exceptions (1930 and 1998) and social scientists still call it the "Iron Law" because relative to their other laws it's done an awfully good job.
UAW v. JOhnson Controls, US Sup. Ct, 1991 - The majority decision struck down fetal protection policies in the workplace which kept all women of child-bearing age from working in blue-collar jobs...
Johnson controls left a really bad loophole (seems like the court fucked up) which would allow discrimination against an employye if a company can prove that there would be a substantial risk of tort liability --oops. BUt it is proof that the union has the clout to FILE A TITLE 87 SUIT AND FOLLOW THROUGH.
I was at my local library recently and I browsed the computer section for entertainment. It had a 1990 book entitled "The Decline and Fall of the American Programmer" and it claimed that by 2000 all the programmers in America would be unemployed, having been replaced by harder-working Indians. American programmers were supposedly 1)lazy, 2)overpaid, 3)inefficient, 4)overeducated, 5)stupid.
Strangely, US programmers are doing quite well, even though their salaries have been jacked through the roof (albeit not by unions). It appears #4 turned out to be a real benefit - US folk have shown a better ability to adapt to new technology. It looks like the sky has been falling for a while.
I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.
Are there any unions that are pro-immigrant? Anywhere?
Is this so different from a consulting firm that sends workers out for contract assignments? Well, maybe a little. But the idea is still there.
A union is almost like its own contracting firm. Basically you join the union and then the union hires you out to the employer. The union is responsible for getting you a good wage, retirement plan, benefits, etc. If the union fails to provide you with what you want you quit the union and go it on your own.
The problems traditionally associated with union usually stem from violence and government meddling. Most union members are not violent and would never bring violence upon a scab or management they did not like. A small number of union members have attacked scabs or management as a means of negotiating. Historically the problem has been that the local police have looked the other way(much the way they used to look the other way when management would club strikers, seems things don't change I guess) for political or whatever reason.
The government has gotten involved by creating the NLRB(National Labor Relations Board) and various other agencies to deal with unionized labor. Whether you think the government is on the side of unions or management, it doesn't matter they are involved. They do not level the playing field. They get in there and try to interfere with negotiations between two business organizations (unions and management). The only role for government is to make sure that a) no one gets away with using violence as a tool for negotiation, b) no one commits fraud during the negotiation process, and c) contracts are enforced in the courts.
If you want to join a union go for it. But consider your other options like negotiating for yourself, quiting your job, joining a consulting shop, starting your own firm. Also consider that you don't have to join a formal union with government recognition and all the hoopla. You could organize with your co-workers, get legal counsel, and start working on a negotiating plan.
Above all, never lower yourself to use violence to get what you want. If US tech workers become known for violence then all of the IT jobs will head for foreign countries.
Stuart Eichert
Stuart Eichert
First off, my knowledge and expertise on labor unions themselves is very much limited and I do not claim to be an expert or even to know what I'm talking about. But since this is an open forum, I'd like to add my perspective.
I think it can be agreed that unions exist for the protection of the workers against their employers. I do believe (but am not certain) that unions as we know them today started with the auto industry. Henry Ford, while being the innovator he was, pretty gave not a flying shit about his employees. Working conditions were pretty bad and so the workers fought back and went on strike. A union was created somewhere along the lines and workplace quality went up.
But the coin can be flipped. A union can become strong enough that suddenly the employer is the one in the stranglehold. This is when people starts saying that unions are evil, etc.
Right now, I'd say that the IT industry needs no unions. AFAIK, the good programmers are practically babied and so are some of the bad ones. In general, I would guess that IT workers have it made. Until we start approaching a world something like that in Neal Stephenson's _Snow Crash_, an IT union is a bad idea. We don't want our employers to hate us this early in the game.
I worked at a war company (euphemism: "defense contractor") as a mechanical engineer; once upon a time, the machinist's union went on strike. All the engineers not essential to the production line (including me) were put on the production line. It was common for 2 engineers to do the work of 5 collectivist stooges, taking a 2-month backlog of work and putting the line 2 months ahead. In the end, production didn't miss a beat and the union accepted the last, best offer that the company made. Some of the union literature I saw lying around was downright vitriolic: "Management is the Devil", basically.
Slashdot: Failed Car Analogies. Amateur Lawyering. Anecdote Battles.
Hear hear. Tech workers are not like skilled workers doing manual work ... you can only weld so fast, or lay so many bricks/hour, or fix an engine so fast etc.
/.ers are heartless technocrats, but we just don't want our highly specialized and arcane jobs lumped in with someone who inserts Windows-2K CD's in a drive all day and clicks Ok. (no offense to the humble MSCE :) )
OTOH, a tech worker with the right skills can sometimes do a job 1000%-10000% faster/better than someone lacking those skills. And you can't expect training and a bumper sticker to magically teach someone to be the kind of creative problem solver that is valuable in the tech biz.
Maybe the majority of
You'll never see a union at a place like McDonald's or 7-11
Actually, we had one McDonald's here in Vancouver (BC, Canada) organize, or at least they came very close - anyhow, it is possible.
If nobody ever re-invented the wheel, we'd all be pushing around flintstones cars, wouldn't we?
...and I have 6 more to go.
There's only been one day that was less than 12 hours, and I fought like mad to get that one day.
Everywhere you go, you hear "that's how tech is."
Tech burnout, IT madness, whatever you want to call it, it's pervasive and for some unknown reason we're expected to be available 24/7 7 days a week. Beepers, cell phones, etc. totally invade our privacy.
It's got to stop before the tech industry eats itself. The business owners aren't going to do it, as we've seen lately with Amazon and Cobalt, they're going to do whatever they can to keep things as they are.
In any market interaction, there is room for negotiation. Unions are nothing more than workers getting together so that they have as much bargaining power as management. This is a Good Thing. Unions mean weekends, 8 hour days, health care, living wages, and other things that make life possible for approximately 10-15% of the workforce in the U.S. alone, and many more worldwide.
itachi
Yes...exactly...we all know that corporate moguls with huge shares in a corporation truly care about the workers' welfare and wouldn't do anything to hurt them solely for the purpose of raising his stocks a couple points. No that's never happened, because we live in "the greatest country in the world"!!!! Wake up, mon ami, working conditions are only tolerable in this country becuase unions make sure they stay that way. What evidence do you have to show otherwise? That IT jobs have good conditions? That's because at the moment most tech companies need more employees. But when the "revolution" (as the media would call it) is over, and they've got enough people to meet the demand, we'll see who claims they need organization. It wouldnt be the first white collar union....secretaries are often unionized. It's for their own benefit, don't assume it means you're going to spend half your life striking. jjjack
So. If people do bad things to you it is basically your fault, because you didn't shoot them when they started doing those bad things?
I sense wrong values here. Even though I agree to some extent that at least some people can choose where they work at. Sometimes there isn't as much choise just because of families, or some other reasons.
--
when everyone gives everything,
when everyone gives everything, then everyone everything will get
i whole heartedly agree... having a union is kinda like having a communists regiem. The elite are held back because everybody has gone union and no one will hire them. So they have to jump through the hoops and hurdles to get ahead as they should, or they quite the union and risk being blacklisted. Then the "slackers", those sub par techies, are raised par level with the eletists..... hey, if i can't get that 79K/year job, then it's for a few reasons: they offered me something other than money (a pleasent atmosphere, weekends off, no cubicles and no formal wear) or i'm just not that good enough.. i don't need a union to make up for my own failings.
I think someone from overseas pointed us to a better model here . Maybe we could get European style unions for techies in America.
>1. Any group has more power acting cohesively.
Actually, the group cedes power collectively to a few. That has led to union bosses, who are notoriously corrupt. So you end up being a union flunky.
Slashdot: Failed Car Analogies. Amateur Lawyering. Anecdote Battles.
Not everybody wants an extra safety net. Why should it be right for a union to force this safety net on everybody who wants to do a particular kind of job?
Presuming everything you say is true. Does that mean that every union is corrupt? Every union member works for minimum wage and squalor.
The fact is companies hate unions because it empowers the employees. Pretty soon then start asking for more money or better hours and if they stand united the company has to fight them or give in. In the old days the companies broke knees these days they sue you.
The fact remains if you don't like the way a company is behaving the absolute worst action you can take against them is to try to recruit their employees in a union. IF they attempt to stop you you can sic the govt on them and if you succeed they will curse your name every night before they go to sleep.
form a union = Bitchslap a corporation
War is necrophilia.
Tech Support.
Tech Support.
Tech Support.
itachi
Unions are a good thing even in todays econnomy.
Basicly labor workers can not speak for themselfs indivudually. They have to pay rent and the employeer can pay them as little as they like knowing the employee will have to take what ever they give.
Unions enable a workforce to leave when the employeer isn't being reasonable or changes are needed.
I'm an advocate for smaller unions.. not lagger ones.. in the big ones the heads really don't know when the feet are cold. The larg unions invent problems and end up nuking perks.
However info-workers are not in this same fix. They aren't trapped...
I mean when are they gona form a CEOs Union or a Union for elected officals.. hmmm?
There are some jobs that don't need protection... and some that do..
And Unions really really really do themselfs a discredit when they attempt to push themselfs into areas where Unions aren't needed.
I don't actually exist.
In the Post Office, you do not have to be a member of the Union, and so do not have to pay dues, but -are_ provided full access to the union.
I would think that letting anyone have the benefit of the contract is reasonable (I don't really like it, but it isn't that terrible), but they can even register complaints with the union, etc just as a paying member can.
I don't want to work at justa tech company where the boss thinks that I am not an equal part of the company. I work at a small tech company where I personally know the owners. And I like it that way; I want to hear their stories about how it all got started, how the meeting with customer X was, etc. I want to know their side of the story.
But I am not just a friend. I am a highly skilled worker and I'll quit when I'm not happy. Just as they would get rid of me when they're not happy with me.
A union would just be in the way. I want a good relationship with my company. I don't have a union in my marriage either, right?
(Moderate up +1, Funny.)
"Have a look at the auto-industry.. seen any real innovation, anything 'market shattering' there in the last 30 years? No."
Actually, yes. Tremendous innovation. I don't think you're a car buff. But, even anyone who's not a car buff would recognize that there are more reliable, affordable, and gas-efficient cars out there than ever before. This started because of innovation at Toyota and eventually carried over to other manufacturers.
"Havnt we all heard of the WTO? of the WIPO? FTAA? etc etc? What is happening is the Capatalist System is hitting a peak. It takes money to make money, and TransNationals are realizing it is easier to share in profit than really compete. "
Hmm. Last I checked, the WTO promotes global competition and the unions want it stopped because of that.
Nice troll.
-Stu
Why didn't your father quit and find another better job or just start his own company? Sounds like you dad is some kind of looser, you John Gault wannabe.
I see many postings citing the differiation in skill level in the tech industry as a reason not to unionize. The assumption is that either pay will be based on seniority or all workers will be paid the same. I do not see why this must be the case. My parents are both professors with Ph.D's (also high skill level) and belong to the university's faculty union. My Dad however makes a lot more than my Mom because he publishes more and gets promoted more. By the university's standards he is a better professor so he is paid more. Also the pay in different fields for professors history vs. chemistry varies a great deal.
I imagine a union of programmers would negotiate to get standards for minimum pay-level (no HB-1 visa underpaying) and working hours (no 7 days of 14 hours in a row). Beyond this different programmers could be paid different amounts. Why couldn't individuals negotiate their own salaries and still be in the union? I have known some professors at my parents' university that have negotiated special raises.
I it just doesn't seem fair.
About 25 years ago I worked in retail, selling home electronics. I was given the choice of joining the retail clerks union or quitting. I told my boss that I'd rather quit. He didn't want to lose me, so he promoted me to store manager. All the time I worked there, the union employees were making very close to minimum wage and were working in horrible conditions, and the union manager was driving a very expensive car and wearing suits more expensive than any worker could afford. There were no strikes. I'm sure there was lots of corruption.
Thanks
Bruce
Bruce Perens.
Typically, unions and management form a contract.
Sometimes that mutually agreed upon contract spells out a "closed shop", a not ideal but sometimes necessary mechanism to prevent management from circumventing the intent of the contract agreement.
Of course, neither management nor the union is required to agree to add "closed shop" clauses in their agreement. And in most "closed shops" any eligable potential employee can join the union.
Personally, I'm in management and not in a union. But I once worked in management in a poorly operated company, and I completely understand why unions need to exist.
I don't know about other countries, but the labor unions are so powerful in Finland that the employers have formed their own union: The Confederation of Finnish Industry and Employers. Their opponent is a union of labor unions, The Central Organization of Finnish Trade Unions. Every couple of years those two adversaries try to come up with a comprehensive long-term contract. Usually they hold the government hostage by threatening not to agree unless the government chips in with concessions. All in all, I think all parties are pretty happy about the arrangement.
Marko
Is one of them an effort to teach employees how to split impossibly long paragraphs into more manageable pieces?
Just wondering...
they fought the good fight back in the 1800s for everyone to which I'm grateful.V IIVIIIIIIVIII...
III.IIVIVIXIIVIVIIIVVIIIIXVIIIXIIIIIIIIVIIIIVVIII
I'm grateful for everything Bill Gates has done to let corporate America know what is POSSIBLE in the computer industry, but I'm not about to use NT. Sounds like your full of pi
They're skills are unique and a finite number of people can do their job at all, therefore, like executives, they should be generously compensated (obviously less so than senior managment - but the point is that both groups are critical).[snip] However, techies, like blue-collar folk, tend to be isolated from management and most likely to be subjected to unfair treatment (I don't know any Marketdroids who worked 70 hrs/wk for two weeks to meet a deadline only to get laid off the next morning when the project got done on time). This is where some form of representation comes in.
.1 * c, the law of supply and demand stops working well when we move away from ideal free market conditions.
This is sorting itself out on its own, without union help. All the dot-coms that try to get by through slave-driving without a plan are going under. The companies that don't reward their workers are begging on the streets for more VC, and they're not getting it. The companies that do get it will weather this downswing, and come out doing just fine.
There's plenty of documented cases of employers abusing the H1-B system.
I agree with you that the H1-B system is screwed up. The problem lies in its implementation, not the fundamental concept of encouraging immigrant tech workers, though (which is what you had originally seemed to be saying). Once again, I'll make a blatant plug for Canada and point out that our immigration system is generally less screwed up than yours. We don't ship people back after 5 years or any of that crap.
If and when all software is made by Apple-Microsoft-Intel-NBC or IBM-Redhat-Sun-AOL-TimeWarner and three other companies, leverage would shift substantially away from the workforce to the employers.
If that came to pass, yes, it would be time for unions. I don't see it happening any time soon, though. Until it does, I think unions would be more a burden than a benefit.
That gets hard if everyone is colluding to screw you. It's true that some software isn't made by a couple oligopolies like cars are - yet. Despite this fact, anti-consumer initiatives like SDMI, CSS, etc. have managed to get universal support.
These examples are quite different from employee treatment. Employees are generally a lot more informed about their companies than consumers are, for one...
Counterexample: Pepsi workers where I live had shitty wages, pension plans, disability pay, etc. The union came up with a proposal that would have compensated Pepsi workers slightly less than local Coke workers with equivalent jobs. The company made a ridiculously low offer and then refused to negotiate "on principle."
If it was the tech industry, all the Pepsi people could have just left for the nearest Coke plant. Then Pepsi would have been up shit creek without a paddle when they discovered nobody had been commenting their code...
Rank and file union members have set up websites criticizing bad union leadership and company management alike
For now, I think that level of organization is all that's needed--no formal unions necessary. The company I was working at this summer did some nasty bullshit to employees, mainly because of two idiot executives. If we had wanted to, we could have simply told the general manager that X had to change or all his developers would walk. That would have destroyed the company completely, since it would take 6 months for anyone else to figure out our flagship products. I nearly organized such a coup, but, as a lowly co-op student, I didn't quite have the pull needed. All that was really needed was a desire to change things on the part of employees--a union was simply unnecessary.
Just as Newton's laws stop working well as we approach
Yes, but, at least right now, the computer industry is very close to an ideal free market. There are many "sellers" (employees) and many "buyers" (employers), and no one entity or small group has excessive market power. If that were to change, there might be a need for unions... Until then, they're just dead weight.
First, do you think that a union would really fix the H1 Visa problem? I'd assume that a union would just try to decrease the number of H1 Visas. I suppose it might force companies to pay H1 Visa recipiants more since this would make them less attractive, but this just means that only the companies without unionized labor would have lots of H1 Visa holders. I think federal legislation to force fair treatment of H1 Visa holders wopuld be much more effective.
Second, do you think that unions would really do anything to fix the problems with unfair co compeat contracts and NDAs? These issues are much to subtile for your average union and they only effect a minority of emploies (the more intelegent ones). Now, I suppose that a tech union might be a bit smarter then other unions, but I still think that it would ignore it's smarter most importent members in favor of the mass of dues paing html typing idiots.
I think the tech industry would be much better served by having a "tech workers loby" which did not deal with companies, but dealt with congress and the courts instead, i.e. it would try to help show that bad contracts and H1 Visa abuse should be illegal.
Alternativly, one could make an argument that unions would be ineffective since there are many many tech companies, i.e. unions are designed to deal with companies which have "monopolies on work." Now, the solution to this problem would be a more "distributed union" where the workers just discussed the problems they were having at work. It would be possible to look up people's opinions on companies to get a realistic view before joining a company and it would be possible to get help organizing "one time strikes." Actually, maybe we are closer to having such a place then we realize.. maybe a weblog like slashdot or kuro5hin could do this job.
The Christian religion has been and still is the principal enemy of moral progress in the world. -- Bertrand Russell
1. Any group has more power acting cohesively.
I'm not a 'group', dude.
Frankly, I steer clear of people like you who want to harness me onto a team.
I have more power that way.
Hay thar.
It is true that technology companies expect un-sustainable levels of work, but in the vast majority of cases, these companies are fairly compensating their employees.
This is SUCH bullshit.
How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?
How do you compensate someone for the entire months lost due to crunch time, forced by the people who a) have the money to invest in realistic scheduling and b) aren't there with you the whole time?
I think it's interesting that your description of extortion, "either you give me this, or we [sic] wont work," is in fact a description of a market economy, which can be summarized as "either you give me a better price or I won't buy your gizmo."
You wouldn't know a market economy if it bit you in the ass. Markets work best when you have many sellers and many buyers, all operating independently. The tech industry has tens of thousands of competing companies and millions of employees, which is just the way things should be. The tech industry is damn close to an ideal free market.
Adam Smith, the idol of capitalists, would in fact have approved of unions, in my opinion
Do you know anything about Adam Smith? He would have viewed labour unions as market collusion, an evil that distorts prices and creates market inefficiencies. Your statement is about as ridiculous as claiming that Karl Marx would have favoured the AOL-Time Warner merger. Please, take an economics course.
With reasonable labour laws (such as those in Canada), there's really no need for unions in the tech industry. If you don't like your job, get another. When you leave a tech job, the company loses huge amounts of accumulated knowledge, and, whether the company knows it or not (the good ones do), it costs them big-time. This is more true in the tech industry than any other industry I can think of.
Nobody wants to pay you $75,000 for 8 hours a day with 6 weeks vacation? Maybe it's because you're not worth it. Ideal markets do a very good job of paying people what they're worth. Sometimes the truth hurts. If nobody wants to pay you $X, upgrade your skills, look around, and you'll probably get what you want.
Don't try to tell me it's hard to find a new job--it's easy if you don't suck. I'm only a co-op student, and I have no trouble. First co-op term, I had to turn down interviews because I was getting so many, and I got exactly the job I wanted. This time, I only applied to one place, and got the job without even an interview.
Yes, companies pull occasional bullshit like firing people without telling them, but that just means your labour laws need a bit of tweaking. If that happened here in Canada, you could sue their asses for wrongful dismissal.
Sure, unions increase wages in the short-run, but they ultimately harm workers by decreasing the supply of jobs or putting employers out of business or by taking huge chunks of your paycheck. It's simple economics--if you increase the price of something (higher wages), demand will fall (==less jobs). There's a few details (price elasticity of demand increases with time, etc.) that tell you that the reaction won't be immediate, but it will happen.
Historically, unions have been corrupt, anti-democratic organizations. I know this because, during the Cold War, my grandfather was an active member of the Communist Party in the US. He was ordered to infiltrate the UAW, which he successfully did. Maybe it's no longer the Communist party that has their fingers in the union pie--it could be the Mob--but they're not really about protecting workers. Corporations don't have a monopoly on evil...
I know what you're going to say "Aha! Those labour laws are there because of unions! So there!". Yes, very true. Unions did have a useful place in society. They're not needed in today's highly-educated, highly-skilled labour market, though.
Maybe you're thinking "but I deserve to be paid $XXX,000, and I should get 72 weeks of paid vacation a year". Why do you think you are somehow entitled to any of this? You're entitled to what you can negotiate in good faith with your employer, and you're entitled to have your employer honour your employment contract. Nowhere in the Consitution is flex-time, sick leave, or overtime pay guaranteed.
I'm not saying people don't have the right to organize unions--they do (and should) have that right. I'm just saying it would be stupid to do so in the tech industry.
You *can*, however, FTP your source code to another country and have programmers there work on it. India has benefitted greatly from this practice and companies under pressure from stockholders to cut costs/raise profits will certainly be looking at the cost and control differences between an arrogant, demanding US union and cheap foreign labor. It'll all just move offshore.
I read somewhere that a lot of Indian software workers were ridiculously underskilled - people who had learned multimedia animation in one week from less-than-reputable institutes.
Simply put, there's no where to go. In order to even learn to write software, you need the following skills:
1)Literacy
2)Algebra (int a = b)
3)A really good grasp of the elusive concept of a 'function'
4)Logic skills
5)Pre-calc ideas (needed to understand anything about efficiency)
6)Discrete math
7)Calculus
8)etc.
1-4 are absolutely essential for even the most trivial coding. If you want to do anything remotely sophisticated you need more.
You're assuming that there are a sizable number of people in some country with these skills who don't currently have any use for them. Assuming this place exists, a software company has to teach these people how to code and then deal with a crew of novice programmers. Only then it can pay them peanuts to turn out code. Even if you could find large chunks of people inclined to learn to code, the return on investment is just terrible in the short-to-mid-term in teaching someone how to code from scratch who has never seen a computer. Sure, companies will pay to send their coders to a week-long course on JavaWidgets3001.6, but what company could jusify teaching someone C from square zero?
The only thing you can do remotely without these skills is simple HTML. Based on my university experience, I don't think India is up to the task of writing millions of pages of English-language web pages. And less-challenging code is generally more language-based - someone in Elbonia can code a new algorithm up and Americans will use it, but I don't think Elbonians will be writing JavaScript pages or VB GUIs unless they happen to speak English too.
Where do you find a massive number of literate, mathematically trained folks? First-world countries, where governments have invested in compulsory education. There's nowhere you can find people with the requisite background who will work for nothing. Western Europe's out, Japan's out, Canada's out. They all have heavily organized workforces, min wage laws, etc. Eastern Europe and Russia, maybe, but what sane business would want to move its primary production there right now?
Money is power. Employers have it, you don't. Unless you're an employer.
Maybe at McDonalds, that's true, but things are very different in the tech industry. What developers are selling (knowledge and skills) is extremely valuable, and good companies know this.
At the place I was working this summer, if the two most senior developers had walked, the company would have folded. Management could come and go, the market could change, but these developers were the company. The knowledge in their heads was irreplaceable, and management knew it.
That's power.
An intelligent employer will pay employees what they're worth and do everything possible to keep the good ones around. Unions make that harder, because now Joe Slacker has to be paid as much as Jane Ubercoder, just because he's been around as long. When you fuck with the free market, things almost always get worse.
c) accept that collective bargaining can fit very neatly within a free market. If a company can't deal with workers organizing, then it's the company's fault. Nobody forces companies to accept unions, it's sometimes just the best business decision to make.
This is clearly wrong. Companies are forced to accept unions all the times. That is what the NRLB is all about. They force elections for the union and then require that the employer accept the union as the representative of all the workers. Even workers that vote against the union are coerced into accepting union representation.
The current labor laws are incompatible with a free market.
Thanks to unions like the IWW, (an anarcho syndicalist union that people are free to join and leave at anytime) at the turn of the century we all have 2 days off in a week, have 40 hour work weeks and we are not expected to work before the age of 15. If the "free market" capitalists have their way thes and other labor attrocities will increase. Unions are social constructs which can exprees the desires of their constituents very well.As with all social constructs they have negative and positive attributes. I believe that the positives far outweigh the negatives.
Unfortunatly or fortunatly as the case may be unions just DO NOT have a place in todays modern working world. ... Use your own free will, you do not like your working conditions. QUIT. You do not like your payscale? BETTER YOURSELF and get a better job.
This may be fine from your youthful perspective with your whole life ahead of you, but I will share a story from my own perspective.
In the small city where I live, the main industry was a large steelworks (a series of smelters that produce steel). Unfortunately, the steelworks decided to shut down its local operations, because they were no longer viable - with local coal deposits being exhaused, and environmentalists taking a stand against the gross pollution of their outdated smelters.
The workers at the steelworks - about 15% of the city's population - were out of work. Most of them were in their 40s and 50s, and had no choice but to retrain, there were no jobs for them - as their skills with outdated smelter technologies were useless in today's high-tech world. Many motivated individuals decided to retrain in Information Technology, after hearing about the desperate need for workers in the industry. Unfortunately, they found that no companies wanted to hire 50 year old workers with no experience in the IT industry. They wanted young graduates, or workers with years of experience.
Luckily, the steelworks was largely unionized. The Union stepped in, and staged a large campaign to find jobs for the thousands of retrenched workers. Individually, these aged workers stood no chance of finding work in a new career, but together, they were a large force, determined to find work for every last one of the workers. The Union organized university courses and retraining for the younger workers, and tirelessly campaigned to find jobs for the others.
During this difficult time, the Union rallied support from the larger community to support these workers. Those workers that ran into financial difficulty were supported by others, and fundraisers supported their efforts. The 'Union spirit' carried these workers through this turbulent time, and now, four years later, nearly all of them have found work, or formed their own companies - with financial backing organized by the Union. What could have been a massive tragedy for thousands of workers has been averted, and turned into a testament to human compassion and co-operation.
This is why I do not think unions have outlived their purpose. The concept of a large group of workers co-operating for the good of the whole is as relevant today as ever. Many unions have collapsed into autocracy, and the original spirit of unionism has been forgotten by them, but despite these failures, events such as those I descibed above renew my passion for the concept of a group of workers uniting for the good of all.
In the youthful IT industry, the young professional workers take it for granted that changing careers is easy, but this is not so for older workers, with experience in outdated fields of work. Today's young IT workers will discover this as they get older. Information technology unions need not have collective bargaining as their primary goal, but the concept of a union that provides training and employment services for their members is one that could work well. As people relocate from job to job, one thing can stay constant - the Union, and the training, social interaction, and worker advocacy it provides. It would provide a stable lifeline in the tumult of the IT industry
You make several good points. However I am forced to disagre with your basic logic. Unions were formed to protect less skilled labor until they became more skilled. At least that is the idea. Most tech workers have no need for unions. Look at how hard the recruters are chaseing people now. If your not getting paid enough talk to just about any company find the pay your looking for and go there. What possibile need would I have for someone else to be dipping into my paycheck?
Yeah, but the 'Industial Workers of the World' (IWW) are socialist nut-cases. I'm not talking 'creeping socialism' here. I'm talking about the dirty hippies at the protest wearing a 'wobblies' t-shirt.
Hay thar.
What in the world do IT workers, especially in the U.S. need with a union? We are some of the most highly paid, employable group around and possibly ever. When in history has a group wielded so much leverage in negotions with employers?
The only downside is the outfits that expect (err demand) lots of unpaid overtime. Occassionly it is necessary, but if you team morale is good, are given realistic goals and they take pride in their work, you will not have to ask for the overtime when needed.
Imho, I feel the unions see an industry with a TON-OF-MONEY that could go towards paying dues. Unfortunately, they cater to the worst side of people by basically saying: "you will work less, guaranteed bonuses, guaranteed raises and be more difficult to fire if you screw up... just vote yes in the ballot and give us 2% from your paycheck.".
Unions had/have their place and time in several industries, but by large they are doing more harm than good in this country now. If anywhere unions are needed ARE IN THRID world countries where those sweatshops for making clothes, shoes, whatever are....
"If you have the urge to say 'No Offence' before or after... Its best to be quiet" --- Brad Lawrence
People don't realize that a union is a safety net, so that the worse case scenario doesn't happen.
People also don't realize that a union is a ceiling, preventing the best- (or even moderately good-) case scenarios from happening. I can barely keep track of the number of times that qualified people have been turned down for promotions in favor of the union's "strict seniority" policy. One of those senior union members showed up at the beginning of his shift, slept in the breakroom for eight hours, and left at the end of the day. Every day. Did I mention that this was a United Auto Workers shop?
then I'll come running to a union :)
before I take a tech job that requires union membership.
:-) )
(the following might sound like flamebait but it's not intended to be, so at least count to ten before moderating it as such.
I'll start by saying that I fully support the right of people to organize for reasonable pay and better conditions. That was especially necessary about a century ago and still holds plenty of merit.
But today, most unions in America serve one purpose: to siphon money from workers to Democratic campaign coffers.
Sure, you can generally opt out of having your money used for political purposes, but most don't bother. Including conservative Republicans.
I'm sorry, but that is just WRONG and I get steaming mad every time i think of unions. If it isn't blatently illegal, it should be.
Here in Oregon we've had a several year fight between the Oregon Taxpayers United, led by Bill Sizemore, versus the big unions, mainly education and government workers unions.
Sizemore has been trying to get ballot initiatives passed that would make it illegal to withhold money from paychecks to use for political purposes, among other things. The unions counter that that is "silencing the voices of our teachers and public workers."
That is a LOAD OF TRIPE!!!! If anyone wants to give to any campaign, they should be able to do it -- but they should write the check themselves, not have it automatically deducted.
The irony is that the unions take money from workers, and they have a LOT of it, and uses it to advertise big government, high tax liberal candidates and to oppose Sizemore's initiatives. But if it weren't for them, the workers they claim to support would have a lot more money in their pockets, partly because they wouldn't automatically have political funds withheld, and partly because more politicians who support tax cuts would be elected.
They have the gall to say that anyone who supports stoping this practise is unfair. What's unfair is that they have the political advantage because the illegally (or should be illegally) stealing money from unsuspecting workers to support their causes.
God I hate socialists....
>>Of course employers don't want Unions, it compromises their authority.
So, I have a dream. I take my money and create a company to fufill that dream. Now you're going to tell me I shouldn't have authority over how its run?
>>Let me translate for the dense
The term "blind leading the blind" comes to mind.
>>Unions increase your negotiating power which makes wages rise and firing people more difficult.
In other words, basing wages on skill and firing people who slack off goes out the window, replaced by your socialist "screw the skilled to benefit the mediocre" mentality.
>>We like to pay what we feel like paying and fire who we feel like firing.
As a former small business owner, this one just made me laugh. Companies are in business to make money...period. They pay what they can to retain employees and still maintain profitability. Do you have any idea how many companies have closed their doors after employee unionization? Look it up.
>>Employers who respect their employers would encourage their employees to form Unions
No, I preferred to go out and chat to my employees face to face. I enjoyed running a company, and had fun with my employees. If they'd gone union and forced us into an adversarial relationship, I'd have shut the whole thing down.
>>If money is power and businesses are not democracies, where does the power in our society lie?
You know, that's why you leftists will never get anywhere in the tech industry. You try that "poor employee versus the rich boss" mentality that has worked in so many industrial situations, but you overlook the fact that tech workers are QUITE wealthy themselves. I got a good laugh one time watching a union organizer try to sway a bunch of programmers and CS operators to organize and join (he was apparently brought in after a bunch of crummy employees complained after being laid off). It was funny watching the guy rant on and on about the power of "united" workers to finally earn the pay they deserve, and how unions were the only way to show the "rich bastards" who actually controls a company...nobody had the heart to tell him that the company had made them ALL "rich bastards". The presentation ended, the organizer was escorted from the building, and it was never brought up again.
There is nothing so pathetic as seeing a beautiful young theory roughed up by a tough gang of facts.
Yeah, due to unions, if you work at an auto plant, you can: not goto work for 2 weeks, protest in front of your office, and expect to get your job back. How is that good for the economy? I've always thought that unions had a place, but that they were outdated now. Now, it's just extortion (either you give me this, or we wont work). Of course, that's just how I see it
-Bucky
The few, the proud, the conservative.
-Bucky
I am not so sure. It is my experience that where workers are well treated and appreciated by the management, that unions destroy the dialogue that can potentially create a unified and powerful company and community. THe fundamental purpose of a union is to advance the members' causes, and the exclusion of management from this process is not always a good thing.
Don't get me wrong, I think that unionization can also be a good thing where the process has already broken down. But it is neither a panacea nor a road to Utopia. Rather unionization is a reply to bad management decision that create a conflict that never should occur. It is therefore a call to arms in a conflict that never should have happened and for which the management holds entire responisbility.
LedgerSMB: Open source Accounting/ERP
On one side, you have the pro, which says that yes, employers do nothing less than rape the talent of highly skilled workers, all for higher profits, better stock prices, and longer vacations for themselves. All the while, people like you and me are working 80 hour weeks with a vacation a year consisting of a friday-monday weekend vacation. It sucks, plain and simple. I didn't strive to be good at what I do only to have the sales and marketing people who run companies to determine that I am not living up to their f**ked up standards. I say form up, get some tech power organized and watch these sales and marketing mgrs crap themselves when their whole MIS/IT/IS group goes on strike from being given 2 week deadlines for 4 month long projects.
OTOH, I married into a phone family, my in-laws, their parents, and a most of their friends worked for the Bell, when it was just Bell. They were all in the union, and they had their cars trashed, lives threatened and were damn near physically assaulted when they HAD to cross the picket lines just to be able to buy food and pay their utilities in the middle of winter in Minnesota. Where was their strike pay that was in their union contracts? It was gone, nobody knew where, but the only consolation that they received from the union was a picnic with chips and soda.
Unions can be just as corrupt, if not more, than the companies they represent, and there isnt a whole lot to stop them.
I guess there really isnt a way to say whether or not a tech union would turn out alright, but it certainly stands a bigger chance of succeeding with people like us (read /. readers, Linux geeks, and even the occasional Windows user, provided they are really likable) than with that corrupt bunch of criminals called the CWA.
"See, we plan ahead! That way, we never have to do anything now."
There is a tremendous need for the "Steady Eddie" programmer as well -- the people who prefer a 9-to-5 job monitoring and maintaining existing systems; people who don't love their job, but do it for the paycheck and stability. I could understand them finding some appeal to a union, as they are typically not as well paid as other programmers in the industry.
The developers who get "used" by fly-by-night dot-coms and soon-to-go-public companies allow themselves to be used. They're naively chasing a dream that they're going to win some magic IPO lottery, because a few hundred other people in the industry have.
Take a look at the serious professional, and you're far more likely to find someone who has the experience and confidence to say "no" to the unreasonable demands. They're also the people who will present a reasoned, thoughtful explanation of why a schedule is unreasonable, and provide proposals that are reasonable.
Companies and organizations that want to compete in the IT field want the professionals to lead the teams, and a bunch of regular programmers to implement those visions. They want people who are self motivated, self-training, and realistic.
What the industry doesn't need is a skirt for the incompetant to hide behind, nor a mass of average replacable workers who think they "deserve" an unreasonable wage because they've "got experience."
I deal with far too many people already who think that experience relates to their years in the workforce. You can spend ten years working with the same tech and the same tools, and still be inexperienced. All those years won't help you worth squat when that market dries up and you need to shift gears.
I'm far more interested in working with people who are willing to learn on their own, try different tools and technology, and who can see how those alternate viewpoints relate to their job. I like working with the creative code artists who see the commonality and similarity of diverse systems, who do perverse things like use compiler techniques for parsing data files.
Those are not the goals of a union. The union wants everyone to fit in cookie-cutter categories and salary bands. They want pay for years of service, not for breadth and depth of useful experience. And most of all, the union wants their cut of your paycheck.
Unionize IT? Ttthhhpppttt!!! The very idea comes from the same lawyer-driven camps as software patents.
I do not fail; I succeed at finding out what does not work.
Yes. This is something that a lot of people miss about unions; the legal protectection against abuse.
Here i Denmark, the IT-workers has a rather good union called PROSA. When you have to sign a new contract, NDA or noncompete, you just take it to the unions lawyers first, so they can look it over. Since these lawyers are experts on their field, they can give you good advice,like; "this is standard stuff, you can sign it." or "take the contract back, and make them change this line, because..." or "This is a lousy contract, but you can sign it anyway, because if they try to enforce it, we will take it to court, and win."
Especially noncompetes, can be really, really bad for your career. Why learn that the hard way?
I know, smart US IT workers take their contracts to a lawyer too. But if push comes to shove, it is really nice to have a union behind you. It seems that a lot of US citizens, often prefer to drop to take any action against really unfair work treatment, even though they have a really good winning case, simply because, the thought of a long, legal struggle, would grind people down, or that the slight chance of losing the case, would mean personal ruin. So people swallow their defeat, and humiliation.
But if the union is behind you, the picture might change; The corperation can't play the "we grind you down in a long lasting legal struggle" card, since they now deal with an organization.
The employer can't intimidate the worker, with a bunch of lawyers, telling him lies, since the union got lawyers who knows the law.
And the union cover the legal cost too.
Most cases are standard stuff, but if a case is really unjust, the union can throw all its weight behind it. Something you can't get, when it is just you and your lawyer, against a perhaps large company.
I've read a bunch of comments about how unions are only for the lazy, and unskilled, and I had to comment.
Unions were organized to protect individuals. Let me tell you a story:
In the days before unions, a mining company set up a coal(?) mine, quite some distance from any town. Since they needed a lot of workers, they also set up a town, but (of course) the company already owned all of the land, then rented it to the employees. The only stores around were owned by the company, and the only transportation available provided by the company. Also note this was either pre automobile, or at least before they were so common.
Workers were paid exactly enough money to pay for what they needed (nothing more), if it was found that they had been saving money, they either had their pay cut without explanation (there was no legal requirment to say why), if they tried to leave, they had to pay some large amount of money to 'repair' the property.
Eventually the workers tried to organize. The company called out the national guard, and told the national guard that they were heavily armed and very dangerous. They were all killed, and not just the workers, but their wives and children who had taken cover with them.
The company saw nothing wrong with mass murder in order to put down a forming union that was organizing only to demand an end to what amounted to slavery.
Tell me, would a union have protected only the lazy in this circumstance? The company prevented you from leaving, they made sure that you couldn't leave, or if you did that you couldn't reach any other destination alive (remember the transportation problem). Until unions came along, slavery in the United States was still essentially legal. You may have had the legal freedom to leave, but it was plainly made impossible to do so. They might not easily be able to beat you, but hey mining is a high risk occupation.
Moreover, do you think that there would be much in the way of worker safety concern were it not for unions? There wasn't before unions.
It is true that unions have done some stupid things, but they also fought for the rights of workers. Minimum wage is a result of union forces (note that unions also have a big lobby), laws that give you worker compensation if you injure yourself on the job are a result of unions. Laws that give you the right that right to leave a job and get a new one are also the result of unions.
Companies will try to extract the absolute MOST from their workers, often at the expense of the human rights of those workers.
Such things have been done all over the world, and will resume again almost immeadately if unions are done away with.
Now for the subject of unionizing the tech industry:
It probably won't have the desired effect. It is true that many of the more skilled employees can walk away from a job, and go to another one. A strict union would not increase competition for skilled workers.
Besides a universal IT union would be as bad an idea as a universal IT corporation. That is not to say that unions are bad, only that only one union would be a very bad thing indeed.
It is however necessary to have something to keep employeers from using various methods to control people who COULD walk out the door at any time. One example I read about was someone who was told that he would have to agree to certian unplesant conditions, or another worker would be fired. That worker was not int the IT field, and had nothing to do with the task this sysadmin had been given, she was however his friend, and trying to put her life back together after a bitter divorce, and several other problems. He stayed there for quite a while, because the person who would have been fired was a good person, and his conscience wouldn't let him allow the boss to destroy her life, and since he had no proof of the threat, there was nothing that could really be done about it from a legal standpoint.
A better solution would be something a little more like a guild. Guilds are more for specialized individuals, and could operate to ensure the quality of employees. If an employee was a member of a particular guild, the employer could be assured of a certian level of competence.
In return the guild could negociate on behalf of the employee. If an employer breaks the contract, or will not provide what the guild wants, that employer can't get guild members, and has to take his chances elsewhere. If a guild is too inflexible, or demands too much, employers will ignore them, and competeing guilds will be formed.
Since a someone working outside a guild would not be stigmatized as a scab, the danger of crossing picket lines as such is gone. It will be in the employer's best interest to work with the guilds, because they will have quality workers, if one doesn't assure qualiy, it won't be a guild any more.
If any person or group of people is given enough power, they will misuse it. That is the reason the framers of U.S. Constitution were so careful not to give too much power to any one individual. If a company becomes too powerful, the company leadership will use it. If a union becomes too powerful, the union leadership will misuse it.
Unions have done good, they have also done some seriously bad things. I prefer to live in a world where unions exist, I have been told too many stories about what happened before unions, and it wasn't pretty. Many of the laws you cannot concieve of living without were encacted because of the union lobby.
There is a civil war coming in the United States. Remember which side has most of the guns
Questionable argument at best...
CEOs don't get fired for screwing up the budget even when they don't have a Union to blame...
However companys have threatonned to file for bankrupcy shortly after unionising...
To defend the unions for a moment.. thats generally due to a mix of issues.. the busness has more problems than just bad employee relations.. but the Union is entirely unsimpetheic and in protecting jobs ends up distorying the whole company.
There are times when other solutions need to be considered. Unions are a good blut force for employeers who aren't doing right. It's not allways the right solution.. but in some cases it's the only solution.. and in some cases it's the worst posable solution...
In the case of info-workers.. jobs do not need to be protected...
I don't actually exist.
My point is, you're not a 'victim'. People arrive here every day with scarcely the clothing on their backs and thrive. Are you saying that with all you've got going for you it's not within your capabilities to find another job?
"If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine
Most intelegent programmers laugh at the thought of a "tech union"... demand is so high that for most of us we could easily walk and get another job. I recently did just that, much more frendly co-workers and much higher pay. Tho I noticed that there are a great many out there in the tech world that couldn't quite make it into the "elite" status. In fact I see so many freeloaders in my workplace, it makes me sick. The last thing we need is a union to protect these people. There are so many tech jobs out there right now that if you need a union to protect you from management, it means you just arn't smart enough to be in that line of work.
Although I am clearly biased on this point, I just dont see any other need for a tech-union, perhaps someone else can enlighten me on this issue.
-nite
I'm a good cook. I'm a fantastic eater. - Steven Brust
We need unions. That is why its the united states of america.
I'm sorry, but I have to comment on that piece of patriotism... it's just that there are also unions outside of the united states. And AFAIK, US didn't invent it (UK, I think), nor is it the country with the most unions.
Opus: the Swiss army knife of audio codec
This might sound fine in principle, but given then history of unions harrassing scabs and management I don't think this will happen. Courts in this country have more or less made it possible for unions to do almost anything but kill to defend their position. Quite frankly, I don't want somebody from union hassling me every day b/c I want to get paid more than him for knowing more and working harder. Unions are monopolies on labor and *should* be considered a trust. I have yet to see much or any proof (and maybe I haven't looked hard enough) where those that work hard get the recognition they deserve. With unions the pay will always be lowest common denominator and the idea of bargaining for your own skills will go right down the tubes.
It's just not worth it for tech workers - the field is too competitive to lose the money b/c some old guy who's still looking for the Any Key has been in the job longer.
Monopsony? Is that why I can't get a PlayStation 2?
1) If all programmers, as a union demanded that, tehre would be less programing jobs.
2) Tech companies screw employees usually only because the employees are young (or rather, if they were a little wiser, it wouldn't have happened).
3) Of course. Companies can always screw their employees. But I want to see big companies first. If MS Employees unionize, I can understand that. But I don't want to be labelled badly as 'non-union labor' just because I don't want to play in your club.
You know.. all too often, all the pro-union stuff sounds great at first. I mean, it does. Fairness across the board, benefits, etc.
I watched a supermarket go union. The promoters came in, and over a year and a bit, took a place where everyoen *liked* the boss, adn everyone was treated fairly, pretty much all would agree... and different people had different non-official benefits.. like the lady with her crazy sister who had to go take care of her all the time.. bos cut her LOTS of slack, gladly.. she was part of his community. Boss kept some peopel in who could only work a couple hours a week, because they tried, and needed the money. Boss did LOTS of things, like giving people extra days off, rewarding good work....
Once the union came in.. sure.. everyone got a little raise... the boss no longer had say in seniority, could no longer decide who or what should be in charge of what (not to the same degree anyway)... and.. no longe rhad the freedom to be generous with certain employees. Sorry... lady, yuo can't work enough hours. No job for you anymore...
Sorry billy.. you can't spend extra hours after work stocknig shelves.. you're a service clerk.. your contract says you can't do that unless I promote you adn give you a raise.. they say if I need shelves stocked, I should bring in a higher paid shelf stocker. I know you really simply want to work a few extra hours so you can save up to go to college.. but I'm sorry. The Union says no.
And now, everyone just bitches abou ttheir 'contract' instead of liking going to work every day, knowing that the owner of the shop, who is *responsible for the fact that everyone has a job there*, is their friend and respected community member. Now he is just 'management'.
Tech union? no thanks.
Let me get this straight.. so if the need (demand) for a type of skill decreases, then employers should still pay the higher wages? NOT EVEN CLOSE!! .. the GREAT thing about America and Capitalism is that anyone can be wealthy if they work hard, expand their education and have a little luck on their side. - of course if Society (and unions) Teach them TO MILK EVERYONE ELSE and live with the attitude.. it's not fair! not fair!!, it causes employees to become victims. Less productive/Less motivated victims. After all, we all should get the same wages right? (no, not right! the harder working, more skilled employees deserve more $ than the lazy ones that have earned seniority by sitting on their ass in a union for many years)
-Celtic
=-=-=-=-=-=-=-= - The Celtic - =-=-=-=-=-=-=-=
I will not join a union unless I am starving to death and that is the only option. Right now, the Unions are the ones that are acting as if they're starving to death. If only that was true. Union == Mobster, Lazy, Useless. Let a union take some of my wages?? For what?? For whining to my employer and making him lose money (the thing that allows him/her to hire me?) No Thanks! At one time they had a place.. now they aren't needed and it appears the union leaders are realizing such. -Celtic
=-=-=-=-=-=-=-= - The Celtic - =-=-=-=-=-=-=-=
Labor history is the history of new technologies coming up, corporations racing to take advantage of them, and claiming that they want to have a direct relationship with their employees.
Railroad trusts operated camps of Chinese workers who came to the United States to do the jobs that there were not nearly enough Americans in that region to do.
Why deny dot-com employees the right to organize? Management organizes its institution as it sees fit, often ignoring the technical knowledge of their employees, to the detriment of the employees and the company.
Customer service employees-tech support staff, sales staff, and even web designers and sysadmins get overworked and underpaid.
Furthermore, the fact that real wages have been declining for decades has finally borne fruit in a growing group of disgruntled, disaffected people in many industries.
I feel that this peremptory statement dot-coms make about unions, which presumes to know the attitude of employees, misses the point: Dot-coms have good reason to be afraid of their employees!
IT employees realize that their skills are crucial to the operation of these businesses. What was once a tiny, specialized field has become the marketplace for more and more people. Unlike the drivers of a fleet of trucks, if IT workers go on strike, all they have to do is make a few keystrokes to disable a system. Only a lack of coordinated effort among these employees prevents them from having this kind of bargaining power.
Goat sex free since 2001
Ok, try not to see this as flaimbait, since it isn't intened as such, but..
What about the future? yes, NOW we can command large salaries from companies, and wander into someplace else with ease if they balk, but what about 5 years from now? 10? 15? The tech market has crashed before, as all markets do from time to time, its just the cycle of things. Sooner or later, the demand will taper off, and maybe decrease substantially. I'd bet you and most of us would love to have unions around then, to keep greedy corps from screwing us too liberally when the leaner times show up. If we fail to organize now, when we have the power to do so with little real opposition, we will face a war to do so when we really really need to.
I for one support unions, and would join one given the chance. I have a future to consider, and unless you're retiring soon, so do you.
-={(Astynax)}=-
-={(Astynax)}=-
"Darkness beyond Twilight"
Collective bargaining helps the workers at low and average skill level at the expense of the exceptional. Labor unions base pay on minimums and seniority. Many studies (see DeMarco and Lister) have shown that an exceptional developer can be as much as 20 times more productive than an average developer. Unless the pay scales negotiated by the union reflected that (and good luck getting the majority to go for it) exceptional developers would find themselves having a difficult time negotiating the double to triple average salaries they can find now.
--
...and i've seen firsthand how the union can stop individuals from having their chance to stand out, because let's face it - unions are socialism - and socialism protects those that cannot, or will not, protect themselves, sometimes at the expense of those who have the drive to do great things.
Once my dad had to deal with a situation in which a younger guy working in a warehouse doing forklift work, etc. wanted to improve himself by taking a position of greater responsibility, and was willing to do it for the same wages he was currently getting. The union wouldn't allow it, of course, because it undermined the union to have someone working for less than they had negotiated for that position.
Are you going to let unions take away your right to work harder for your company to get ahead,and stand out from your less able/less willing colleagues?
If nobody ever re-invented the wheel, we'd all be pushing around flintstones cars, wouldn't we?
The windshield in your car out in the parking lot would be broken out.
It's clearly documented. It happens all the time. It's the Union way.
Hay thar.
Many of them talk about staying with the same company for many years, most techs I know say you should not stay with the same compay for more then four
Maybe you don't now. but think 10 years down the road. eventually you, and a decent percentage of these techs you know, will want to settle down, get married, have a new generation of geeks, whatever. and when that day comes, you/they won't want to think about headhunters anymore. you wont be thinking that the best response to a bad boss is to move away from him, because relocation once you've started a family isn't easy and it isn't kind to them. at that point you're going to want somebody backing you up when you want better for yourself, because if you get yourself screwed then, there's a lot more riding on your paycheck than whether or not you can get the Sony PlayStation 5, or whatever they're up to by then.
the union gets them good pay and benefits, no shortage of those that I know of.
you really think that's going to last forever? the economy, Old and New, is heading probably heading into a recession, and I don't trust the current administration to get us out of it too well. I'm not predicting doom and gloom for all of us here, we just can't rely on Kung Foo skills to get us out of everything.
The last thing we need here in the land of the free and home of the brave is union activity.
Anyone who feels the need for a union should move to a country with a government style that is more in line with union thinking. Socialist governments.
And where I live we've got plenty of National Socialists that I would love to send along with you.
Union members and NAZI's, I've got no use for either one except maybe as bad examples.
. Quit playing Monopoly with Bill. Switch to one of many non-Microsoft products today.
One year you can be bleeding edge, but if you sit on your butt, you'll very quickly become a useless freeloader.
Security must be the most wicked example of this. Six months out of date means you're useless until you catch up.
If tech workers were unionized, a prized worker five years ago, given a guaranteed senior position through "seniority", allowed to remain stagnant would be a bafoon. Imagine taking direction from somebody who thinks of Java as some new experimental thing, UML does not exist, and fat clients are the norm.
Pilots, teachers and the like don't have these problems. They have different problems.
As for the "idiot construction worker" comment... Most tech people I've known fully respect trade workers. Who in their right mind would call a gainfully employed individual in a job with plenty of free time an idiot?!
That combined with the "you deserve more" comment has me wondering why you're trying to manipulate your audience.
I have all of those things and neither am I young. I saw my father nearly wiped out by a bad business decision and a sudden shift in the economy. He buckled down and got back on his feet. For a while, we went to one car, my mother cut my hair, we got our clothing from thrift stores, and my dad worked two jobs. It was tough, but he prevailed and later prospered. It's tough to let go of what we've achieved and have to start over, but it's possible. And it's an available choice. I'd rather do that than count on a union to rescue me.
"If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine
That goes absolutely both ways my friend...
Unions cross the line too.. you better believe it.
It's possible that unions serve as a vital part of the economy, in the manner of a governor, holding back periods of economic overexcitement and limiting the inevitable corrections after the excitement runs out of steam. Naturally you don't want the union holding _all_ power, that'd be like shutting off the engine entirely and there are plenty of cases of unions that ended up this powerful and totally out of balance. But throwing away the 'governor' is a good recipe for revving until you blow up your engine, and that's no better.
I'm anti-union, or at least, that's my stance. I've seen the crap they pull... but of course, I don't know everything.
Folks, Unionization in some trades is different than in others. In some trades, it can have a huge effect on the economy, in others, it doesn't.
For instance.... I would hate to be viewed as 'non-union' labour, just for offering my services. I don't want some union to turn into a monster that dictates (for the good of it's members) how and when and what those people are permitted to do for a living. I'm sorry.. that's not what it's supposed to be about.
Now.. if I look more at something like the union that, say, supermarket employees for a chain of supermarkets belong to, it makes more sense. The employees organize so they can have some muscle with the equally-organized company employing them.
If you work for a megacorp.. maybe this is what you want.
If you work for a dot-com startup with only a hundred or so employees, get real. You can organize your own revolt if you really want to.
This sounds racist to me. If other people are willing to do your job for less, and they're just as capable as you, why shouldn't they get the job? Because their skin is a different colour?
You obviously know jack shit about H1 visas. Because of the fact that the ONLY reason someone on an H1 visa is here is because of their employer, they are AT THE MERCY of the employer. Everyone here is talking about how they can just change jobs if the work conditions suck- not so with an H1B. They are with that company for the long haul, no matter how shitty the wages are or how terrible the hours are. Ever heard of those stories of people who pay their life savings to be smuggled to freedom, only to be put in to indentured servitude when they get here? Guess what, H1B's are government-sponsored indentured servitude. Who loses? Guys like you and me, who don't get jobs because some poor schmuck from india is getting paid a pittance to work 80 hours a week.
Call me racist or whatever, but I don't give a rat's ass whether someone here on an H1 visa is fluroescent green, they're being exploited by the companies they work for, at the expense of people who live here. That's not racist, that's pragmatic.
Hi everybody!
;)
Yes, I'm going to sound like an arrogant bastard (and mayhap I am), but I personally don't want a union.
I can see right here, in Germany, what they do: mainly suck money out of your pocket. See, they are paid wether you have a job or not.
They also try to force you not to work during a strike, which is simply ridiculous.
I'm a programmer. Have been since '81. Always will be. Nobody tells me not to work, thank you.
Only people with poor skills are treated badly. The others walk into (even) higher-paying jobs. Recession or no, this will never change: real good programming requires intelligence, always a rare resource. Therefore, an upper-echelon programmer will always find well-paid work.
And hey, what better job in the whole wide world than being paid well for your hobby
Ciao,
Klaus
---
"What, I need a *reason* for everything?" -- Calvin
Free PC version of ChipWits at http://www.breueronline.de/klaus/chipwits/
:-)
Okay, seriously now...
I think I'm probably anti-union. I understand how important they are in a market where employers literally decide whether workers starve to death, but in the 21st Century tech sector, such a thing is uncessesary. I'm an individualist, and I would hate to be denied a job because don't want to be part of a union. This happens because unions make companies sign agreements not to hire non-union employees, and if the company breaks this agreement, the union members leave and the company is "blacklisted" in the same fashion that companies blacklisted union members a hundred years ago.
And this is largely a matter of perspective, but I also think that unions encourage laziness and a lack of personal development. That may be fine for some beer-swillin', gun-totin', wife-beatin' blue-collar white-trash steelworker (not to encourage stereotypes, heh heh) in rural Kentucky, but I'm a tea-drinkin', C++/Java-codin', pasty-white East-coast boy who puts his personal interests and the interests of his employer (after all, I am part of the company too!) ahead of the interests of some amorphous coagulation of power-hungery socialists whose only common thread is their current occupation. (Yes, unions and Socialism have a long, torrid history of pleasing each other orally. Just look at how much union supported Al "I went to China and all I got was this lousy failed political model" Gore.)
I mean, come on! In an era where any technology worker can turn a great idea into millions in stock options and become a bourgeois CEO overnight, why would anyone in this industry want to encourage such Mafiaesque organizations of groupthink drones who squeeze their employers' balls so they can do poor work and get paid [relatively] big bucks? (Heh, If you need proof of what this, look at the American automobile industry. Unions are the reason American cars have such a [rightfully] poor reputation)
I'm not discouraging all groups of workers. I am an admirer, for instance, of certain German labor groups who have strict requirements in terms of knowledge and training for their members. When you hire a member of one of these guilds, you are assured a certain level of expertise and quality of work. These workers feel a sense of duty to both their guild and their employer to do good work.
I am an adherant to what I understand is a typical Japanese business philosophy, where the workers feel they are representatives of their organizations, and work hard to bring the company, and therefore themselves, honor and fortune. In contrast, union members see themselves as their employers' enemies, and work for themselves and their power-hungry union leaders. Much like typical communist systems, the leaders end up becoming militant despots, and the workers, their unknowing robot slaves who think they're benfitting.
I enjoy my job. I know that I am a part of the same group as my boss, his boss, and the CEO. I know that by doing good work I bring acclaim to the entire company, and therefore, myself. I am not my own enemy.
Unions can suck my capitalist cock!
(This as really some wonderfully craffed flamebait, don't you think?)
All generalizations are false.
--
I like to watch.
How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?
Man, cry me a fucking river. Coal, steel, oil workers. *Those* guys need unions. Those guys give up lungs, give up seeing daylight, for long hours, low pay, and an early death. Technology workers have tremendous leverage (that is, if you are really worth anything, as opposed to some wanker who just impressess non-techies with big words). As somebody said, perhaps we need a technical worker's lobby, to fix up all the fucked up laws created by ignorant politicians. But a union? That is just pushing pansy-assed-ness a bit too far.
It's 10 PM. Do you know if you're un-American?
Properous for who? You must mean the capitalists and people of upper income. When things go well in the US, not all prosper equally or proportionally for their work.
"Canada, by contrast, is a much easier place to organize. You'll note also that Canada is generally considered to be an (ugh!) socialist country."
Canada is a capitalist economy, I do know that for sure. I'm not sure how much your capitalists rely on the government though. You probably have a more represntive government, which allows such things as nationalized medical care.
Here in the US we have "state capitalism", where tax payer dollars fund the research of the capitalists. It is not entirely this way, but the most of the major developments have occured in public institutions and national agencies. Our government is far less representitive than yours, even though we so often champion democracy.
"Look at the automotive industry. It's full of people who do menial tasks like machining brake pistons. And yet, their unions are so strong that they get paid $35/hr+ - for minimum wage work!"
How about the automotive CEO's that make 60-70+ million a year? Now that is wage inflation, at least the guy making pistons is producing something.
"Faced with competitive pressure from non-union workplaces (ie. Asian companies especially), with the $35/hr trailertrash brake piston machinist, Detroit can't afford to throw out the marginal parts. It's only because of sheer tenacity and Big Three ingenuity that Detroit has survived. United Auto Workers have become a liability to themselves and Big Three shareholders."
Ingenuity? You mean convincing the US government to ingnore mass transit, therefore making a car a neccesary purchase for anyone with a job. The rest is just marketing and fancy electronics. The automobile has its purpose, commuting isn't it.
World Socialist Web Site
What it takes is for some of that top 10% to decided that they value power over their employement (beyond do-this-or-I'll-quit), some degree of safety in their employement, due process in their fate, and benefits beyond simply money. Heck, they might get more money too.
In an informal way, this has already kind of happened. A large portion of the highly talented programmers et. al. have shown that they don't value money over everything. They aren't executive, they aren't "professional" in the anything-to-benefit-the-company fashion. They actually have moral conviction and will act on it. So things aren't that bad. At the same time, it's not a big step to unionize from here.
I have never been in a union, but the memebers that I know do not think like people in the tech. world. Many of them talk about staying with the same company for many years, most techs I know say you should not stay with the same compay for more then four. They talk how the union gets them good pay and benefits, no shortage of those that I know of. I just don't think that teches think union.
Great people don't need people to complete them, great people complete other people. -- Matthew Pawlikowski.
It would be nice to see something like this for technology.
I fully agree that unions had their place. There is a lot owed to the people who stood and took beatings from strikebreakers and all the other awful things that corporations did to their employees. But given a choice between me deciding what perks, benefits and wages are best for me and a union deciding which of those things is best for me, I will trust my decision first and foremost.
My biggest impression on the evilness of unions, came while I was unpacking for a trade convention in Philedelphia. I had to be sure not to be seen carrying my own boxes into the building, they had union workers whose "job" it was to do that. Unions, what a load of shit.
What you are interested in this case is passage of immigration laws which would punish companies abusing H1B employees.
... Nope, that's pretty much it.
And who will lobby Congress to pass such laws?
Well, there's Unions. And
Problem is the Unions currently have no stake in the technology sector so aren't really all that interested in using their considerable clout to clear up the H1B situation. If parts of tech work (lets say operations type stuff) would start getting union representation, the H1B abuse that we've seen wouldn't last long.
--
Business. Numbers. Money. People. Computer World.
The problem is that right now we're settling for less than what we should expect. There are some fabulously profitable companies out there. But all of that money was made by coders, who got a generous amount of money, but in all honesty deserve more.
This sounds suspiciously like communism and the labour theory of value. Just because somebody didn't type a line of code doesn't mean they didn't contribute. As much as I hate sales and marketing, I know that they are also essential to most companies. Companies live and die by their management--just compare a well-managed company to a poorly-managed one, and you'll realize how valuable management really is.
Maybe you don't think CEOs deserve their multi-million dollar salaries. The truth is that the good ones easily earn their paychecks and more. For instance, Apple would be dead and buried without Steve Jobs. In that light, no matter how much they're paying him, he's clearly been a net contributor to the company.
2. Tech companies haven't been above screwing employees. People get let go a couple weeks before their options come due, often for fabricated reasons. H1-B visas get rammed through Congress to drive down IT salaries. Imagine if the Big Three automakers tried to import tens of thousands of foreign workers and then pay them substandard wages!! It can only happen in IT.
This sounds racist to me. If other people are willing to do your job for less, and they're just as capable as you, why shouldn't they get the job? Because their skin is a different colour?
Marketing practices of today may become labor practices of tommorrow. If a company is willing to screw consumers with "content protection" do you really trust it not to screw its own employees?
If they screw you, you leave. With sites like F*ckedcompany.com around, it's not too hard to find out which companies suck before you apply. If it's true that marketing behaviour is indicative of employee treatment, then it should be really easy to avoid loser companies. You have nobody to blame but yourself if you don't do your research.
A lot of anti-union people scream "I'm too good for a union - unions are for idiot construction workers." But many industry that depend on highly skilled labor are highly - pilots, aviation mechanics, teachers, athletes, actors. It obviously works for other "knowledge industries".
Three of the five groups you mentioned have recently pulled or are pulling strikes about bullshit issues and making ridiculous demands. I'll focus on teachers' unions:the teachers' union in BC used parent volunteers as an issue in a recent strike. They told teachers, "Remember, parent volunteers are here to take your jobs." The union actually wanted to keep parents out of schools. This had absolutely nothing to do with helping kids, and would have destroyed many sports teams and other extracirricular activities. These unions force job advancement to be dependent on seniority instead of performance. That harms kids, and removes any incentive for teachers to do a good job. The good teachers ultimately become bitter and frustrated with the system as they watch bad teachers climb up the ranks because of their seniority. The result is the mess that the public school systems have become today.
Technology unions probably would be different than old-school unions...
Oh, sure, at first they would be. They'd be all dressed up as something new and shiny, and they'd try to make us think they'd reformed. Gradually, they would reveal themselves, taking larger and larger bites out of our paychecks so they could donate money to political candidates we didn't support. They'd misinform employees to make them hate management, so they would have a stronger hold over us (I've seen this very trick happen before). Unions are corrupt--don't kid yourself. Unlike corporations, they have nothing to gain from good employer-employee relations.
I know of *no* industry where unionization has decreased wages or really adversely affected employees.
It's a basic truth of economics that increased prices will result in decreased demand. In other words, if unions artificially jack up wages, the result will be lost jobs and an inefficient economy. It's not a coincidence that the computer industry is ununionized and has experienced so much growth.
Money is power. Employers have it, you don't. Unless you're an employer.
Power doesn't like to compromise. Of course employers don't want Unions, it compromises their authority. "You don't need a union, we have a direct dialogue that we value". Fucking whatever. Let me translate for the dense:
You don't need a union. Unions increase your negotiating power which makes wages rise and firing people more difficult. We like to pay what we feel like paying and fire who we feel like firing.
Employers who respect their employers would encourage their employees to form Unions. Employees who work for employers who share their interests have no motivation to join a Union.
If money is power and businesses are not democracies, where does the power in our society lie? Wake the fuck up!
Bryguy
microsoftword.mp3 - it doesn't care that they're not words...
Engineering unions do exist, but only at large companies. These are not the kind of companies geeks generally enjoy working for anyway -- they tend to be bureaucratic and defensive.
An anecdote on unions generally: when I used to work for the industrial-defense complex, I worked at a fairly small group within a very, very large company (Hughes Aircraft, if you must know) with about 200 people, of whom the programming staff was about 40 or so. (Yes, you saw that correctly -- 80% overhead. And I think we were one of the leaner organizations!) Somehow, we had inherited a lone union guy, perhaps a Teamster, perhaps a UAW man -- I don't recall. His job, apparently, was to show up for work every day perfectly soused. He was redfaced all the time and reeked of scotch. Most of the time he spent in the warehouse in back. Nobody could say what he did, but we all made damn sure that we didn't try to move computers during the day when he might stumble out from his warren. No matter how incompetent he may have been, he could still issue a grievance against us geeks for taking his (or a co-unionist's) job by moving a Wyse terminal. Ugh.
That's because you're not looking hard enough. Airline traffic controllers. Eastern Airlines, where the unions badly miscalculated and drove a foundering airline into the ground, leaving all their members without jobs. The auto industry, where they drove down quality, pushing American car buyers into the waiting arms of the Japanese. Unions make stupid decisions all the time that result in a net loss of unionized jobs.In the end, unions are about solidarity, not intelligence. If history is any guide, and I think it absolutely is, a programmers' union would rapidly dissolve into pissing matches about who gets to write "if" statements, and who gets to write "where" clauses. Nothing would get done, and the fun (and there is a lot of it) in our field would rapidly drain out of it, to the exact extent that the business is unionized. As one of my friends who works as an animator for a major studio observed once he got his union card, the union heirarchy is dominated by people who can't draw worth a damn.
Dog is my co-pilot.
If you're part of a union and it's NOT backing you on issues as important to a tech as IP is, then YOU ARE USING IT WRONG. What, you figure the idea is to import some grizzled old Teamsters or UAW guys who will make everybody be little slaves to two bosses instead of just one? You've got some funny ideas about who is running the hypothetical tech union show. YOU ARE. Unless you're going to make it work like you describe, in which case who needs you?
Tech workers don't need a union. We need a Guild. With the breakoff of SAGE from USENIX, I'm hoping (and trying to scream enough) that SAGE will actively become what we need.
Both Unions and Guilds can provide very important benefits for their industry (not just their membership):
The big things most of us don't like about unions are things I think we can avoid by having a guild:
I want a Guild. I want someone to back me up as a professional, to help me get my job done better and more efficiently (both for myself and my employer), and help insure that I'm not being abused. What I don't want is someone telling me how I have to work, for how much, and what I can't do.
Guilds, NOT Unions.
-Erik
There are always four sides to every story: your side, their side, the truth, and what really happened.
that's because you are management, silly. your employer is just not allowing you to admit it.
'Looking back to a better day, feeling old and in the way.' -David Grisma
Unions have their problems, but alternately it's inevitable that without them, employers will start crossing the line. Problems with Unions can be addressed, but how do you oppose an abusive company without some similar sort of organization? "Everybody's organized but the people."
Those types of workers are generally paid hourly and do not need a degree. I know some of you say a degree is not neccessary for any IT job and perhaps you are right but most companies whether it is right or wrong will promote/hire someone with a degree over someone without.
Most tech support workers also work in shifts and have lots of other similarities to other unionized positions.
Just my $0.02
"it could just be the midgets. You've got to be careful with midgets in Spandex." --Jamie Richardson
I'm a DBA at at an institution of higher education in the midwest, which has a professional/technical union, and not being a "right to work" state -- I'm screwed.
/.) bitch about this for much too long, but the simple facts remain:
More to the point, we're all screwed.
What has the union done for me? Capped my pay raise at 3% three out of the last four years, and removed my will to work.
I could (and have outside
1) Union protection removes the consequences of failure -- so nothing gets done.
2) Union barganing for too wide a group removes the incentive to excel.
3) Tech jobs require the ability to learn and apply -- job specs based on "years of experience" don't cut it.
4)A union shop forces groups of people working _very_ different jobs to group together and bargin under the same contract.
For example, my contract is bargined by some paper pushers in another department for about 300 people including the mail carriers of the university.
5) Unions are like herpes -- they're the gift that keeps on giving. Once you form one, good luck getting rid of it.
It's that last item I'm working on as my gift to my alma mater before I sell out. See, you have to fight city hall to create a union, but you've got to fight the UAW's lawyers and a bunch of guys named "Guido" to disband it.
It's a giant mess. STAY AWAY FROM UNION SHOPS. (I'm leaving as soon as I get my degree and Oracle Cert...)
Unions are horrible things. They only make sense for people to stupid and unimaginative to know they can walk away from a job and join a competing company or start their own company if they don't like where they are. I remember my father working years going to night school after work so that he could progress in the world. Finally after a decade or more of special school and training he got a promotion to a job that was much better and paid better. The union sued him and the company and won. He was forced to train someone (without extra pay for doing so) else at the job when they had no prior experience in that field and honestly really couldn't do the job. That person got to take the job while my father was forced to go back to being a grunt worker. The company still arranged so he ended up doing most the work for that position but he couldn't get the promotion or the raise because the union always complained whenever he tried. To top it off the union often strikes forcing him and others who just want to make a living from being able to so that some idiots can fight over if they get 7 or 8 vacation days a year. Luckily now that his kids are moved out and he doesn't have so many responsibilities he is looking for a better job but it was enough to teach me my lesson. I've quit jobs before for organizing and I'd do it again. If I don't like where I'm at I can easily find a new job.
At what price learning? At what cost wisdom? The price is a man's peace of mind, and the cost is his life.
yea unions usely drive out the small guy to keep the area theres...Large companys might go union but small biz could never follow...i work for a union now and its totaly f-cked up..If i had a choice i would never have gone union..but hey I had no choice...it was union or you dont work Boy...Yippie isnt it grand
Leaving aside your pop economics, the "Scabs will replace you" argument is only true of unskilled labor. In tech, getting up to speed on coding projects takes time and effort, and usually is accomplished best by the sort of informal training that happens when you interact with experienced coworkers. Scabs will have a hard time adjusting. Hence, employers will find it cheaper to negotiate than to fight, not to mention better PR. Go preach your management propoganda elsewhere.
microsoftword.mp3 - it doesn't care that they're not words...
I'd recomment A People's History of the United States by Howard Zinn. It isn't exclusively about unions, but it talks about them quite a bit, and places them in context as well. I found it quite enjoyable to read as well, and I'm not that much of a history buff.
In some cases Unions are required due to employers taking advantage of uneducated people. But in most cases the unions hinder the progress/salarie of the dedicated individual. All employees are grouped into classes/departments and perfomance is no longer considered. ie. NOT IN MY JOB DESCRIPTION. Imagine a software house where we have debuggers and programes. If a programer finds a bug he will no longer be allowed to follow it through and fix it. It will have to be transfered to the debugging department to document it and research it. Example: I have seen a hotel maid pass by a news paper in the hallway and call a houseman in order for the paper to be picked up two hours latter the houseman finally has time to pick it up. If a manager would have picked up this paper a greivance would be filled. So a 2 second job took more than two hours.
As for:
* Tech companies will lay-off people without a second thought if it helps the bottom line.
No collective agreement will prevent this. Lay-off's are a part of business, they allow a company to recover when they are unable to make ends meet. If lay-off's are not permitted then you are headed into bankruptcy.
DRM? No thanks, I'll just get it somewhere else...
For one, you don't actually need to work or live where the business actually is for lots of things.
For another, the job market is so good, if your job sucks, LEAVE. Do you have any idea how many unskilled computer workers there are out there? If you can do your job with even half a brain, companies love you. Lots of paper MCSE's out there...
If unions get too crazy, businesses will just start hiring foreign workers.
One of the things I love about my job is that I don't have union politics. None of this "you can't try that, you can't do that, it's not your job, I'll file a grievance with the union rep" bullshit.
And, just try to get some slacking idiot out of a position. Wait and wait for the union to agree he's a dirtbag.
I don't think you know what you're asking for here.
"We apologize for the inconvenience."
Now, Kirk, you need to show me how this is possible. If my co-workers and I work together to create a product, and we ask for more than the product generates in income after expenses, then the company will go under.
Fact is, workers always take home only a small portion of the value they create. The capitalist keeps the rest for himself. Why?
Because he owns the company. But where did the get the capital from?
Look at the social nature of capital, that is, that it's a socially (or human-created) structure, and realize that even high-wage workers are being stiffed. Workers can have the whole pie, dammit...
Direct action gets the goods! http://iww.org/
- Paul in Seattle
And of course people never get unfairly promoted in IT now do they?
Here's a link to a CNN story that I found particularly apt.
Enjoy!
--
The gift of death metal does not smile on the good looking.
He asked for a *balanced* viewpoint in a book, not that of a card carrying socialist.
Union Rep: Just give us 20% of your wages and we'll provide you with monthly brochures filled with an in depth analysis of where your money is going after we masquerade the illegal activities we will actually use your contributions for.
Dot-Com-Guy: Well according to Slashdot these contributions will not help the Linux movement to overthrow the evil Gates empire
Union Rep: You see by contributing you assist other dot com'ers who are ending up on FuckedCompany.com
dot-com-guy: How much will this affect my stock options?
Union Rep: Well we currently have Sammy the Bull Gravano who has made great strides in the Ecstasy game to invest your money in the hot new pharmaceutical sectors in Amsterdam
dot-com-guy: Is he a Slashdot moderator?
Real news you can use
360 degrees of Karma
Yeah... try working for a union. Then try working a raise into a union contract. Sounds like a pretty easy thing. Not so. If you have a huge shop of programmers, DBA's, Lan guys, and the like it takes forever (we've been waiting for well over a year).
That's what they used to say to rape victims.
microsoftword.mp3 - it doesn't care that they're not words...
Unions are the only way for workers to organize and to have any power whatsoever in influencing what their conditions, pay, etc, will be. I don't understand the people here who talk about unions being useless and 'bad for the economy' and so on. I understand them if they're like venture capitalists, or big CEOs or whatever, because unions do prevent those people from squeezing the most of their workforce, but someone SHOULD prevent that.
A technology workers' union would be good for technology workers. That much is certain.
The idea that unions give you power in an environment like this is nuts. My wife belongs to a union at a mental health hospital. The union got them a 2% raise spread over five years in exchange for dropping holidays down to 8 a year.
If you are a good performer, you don't want to be in a union.
Unions take away your power and give it to the people you wish could get fired. (Of course they can't since they're in a union!)
> This is the same sort of argument that drives me nuts when police and firefighters bitch about how dangerous their work is. If you don't like the job or the pay or the hours, quit.
OK, so when there are no cops, firefighters or EMTs in your community, an arsonist burns your house down, with you in it, and you need medical attention, you'll be fine, don't worry!
Yes, that's sarcastic, but police & firefighting work (especially in some areas of some cities in the US) IS DANGEROUS. Someone has to do that work. Hopefully motivated people who want to do that kind of work. Is it too much to ask that they be rewarded for literally putting their life on the line every day?
BTW: I also support pay increases for teachers. They're the ones educating our next generation of leaders (and followers, and others), I'd much prefer they could concentrate on that, rather than on how they're going to feed their family, or can they buy a new car because the old one died.
Sort of off topic, but this is a bogus statistic. Especially in OO languages, lines of code mean nothing in terms of productivity. Some of my most productive days at have been spent refactoring a bunch of nasty code into more clear and maintainable pieces, often in the process reducing the number of lines substantially. If two programs do the same thing, but one has 30000 lines of code and the other 10000, which do you think will have fewer bugs?
How to solve most of our problems: 1.Lots of nuclear plants. 2.Cure aging.
Really. What happens if the new place is just as crappy as the old place? Change jobs every three months and see how willing another employer will be to take you on. What happens if you have a family? Do you move them around all the time? Not everyone is 24 and unmarried in the tech industry. I've worked at just as many bad companies as good ones and it is difficult to tell whether the management is any good, not to mention the fact that it could change for the worse in 9 months time. Unions are a way for workers to have a say in how a corporation is run. Why shouldn't tech workers have that right? It certainly would have curbed the excessive behaviour of some of the companies I've worked for.
I can confirm this. I worked as a network admin at a (unionized) post-secondary educational institution. I got my 2% per year raise annually, just for showing up every day. I worked hard, put in crazy hours, just to get the job done. I got 2% per year. I found and implemented new technologies to improve our network. I got 2% per year. In my department there were two guys who basically screwed around all day. They got 2% per year.
A union removes any and all flexibililty that a manager needs to promote and reward good staff and correct bad ones. A unionized shop is horribly inefficient because employees are rewarded according to how long they have stagnated, not according to the benefits they bring to the organization.
Unions are a nice safe place for people with enough gumption to stay off welfare, but not enough to really take care of themselves.
Our secratary worked 16 horus -- (8am - 12am) and was asked to be back at 8:00am the next morning!
All this because my boss decided to start working on TWO 50 page proposals just 3 days before they were due ... -- Its his business to start them whenever he'd like, but I think it underlines a critical problem in the workplace -- complete lack of respect for the employees.
Free Techno/Jazz/DNB/MI Music by guys obsessed with monkeys!
It's not FUD, it's true. I was in a very similar situation when I worked as a bagboy at a grocery store. I made barely above minimum wage, and was forced to pay union dues. It was ridiculous and annoying. If the union had struck, I would've crossed the picket line in an instant, and I suspect most people working there would've too.
Also, $42/mo is astronomical, IMHO. And I care a lot more about a healthy relationship with management than pay or vacation time anyway.
I actually kind of favor a tech union because I think management tends to treat their employees very badly (in terms of forced overtime without pay (for salaried) and job stress) and don't listen to them. I don't know if a union could change this, but I don't know of anything that would have a better chance. But if it ever became like any of the major labor unions I'd want to see it wither away and die.
The worst unions protect mediocre or poor workers, are corrupt, and force you to be a member. They really do. I've heard too many detailed first-hand stories of actual incidents from too many different unconnected people for it to be a made up hoax.
Need a Python, C++, Unix, Linux develop
Hear Here!
I'm very suspicious of unions. About as suspicious as I am of large corporations. But, they have their uses. I'm all for mandatory open shops. If workers at a company don't see the need to join a union, maybe it doesn't need one. If the company changes its tune, people will learn, and join the union.
Need a Python, C++, Unix, Linux develop
Comment removed based on user account deletion
All the talk seems to be about either a union or non at all. We're smarter than the average button pusher/machine watcher over at the steel mill. Why can't we find a better solution to our problems using the technology we love so much?
The biggest problems I've heard expressed here as a reason why tech needs unions are:
1) unrealistic hours
2) pay that is not as high as it should be
The main reason not to unionize is that a tech worker can walk next door to get a job at any time. This argument is quickly countered with the idea that individuals don't make enough of a difference to force a change.
The problem boils down to that the individuals do not work in concert to sway management. Unions fix this, but impose their own overbearing 'management' in the process. I pose this question: Would tech workers work in concert if the had the same expectations of their workplace?
For instance, many here report being 'expected' to work 12/7 for weeks on end. I find this appalling, as do many others, but yet this poor slob is told, "that's tech work." But what if there is a way for the poor slob to show his manager that 12/7 is not normal in any way, and that professional workers do not find those requirements 'professional' in any way?
There has been some moves to form a programmer's guild. If one of these guilds posted sample contracts that listed what are reasonable pay and expectations for workers, would it produce change? Specifically, could the poor slob show that to his manager, say," Hell, no!" to his manager when asked to work ridiculous hours, and resonably expect that no other poor slob would step in to take his position after being fired? Could the existance of such a standard of conduct and expectations reasonably be expected to convince the manager that he won't be able to find anyone to fill a position with unreasonable requirements?
My take on the situation is that tech workers are being taken advantage of because they are young, inexperienced and just don't know any better. I think the situation could easily be rectified if we informally banded together to agree on broad expectations of pay and working conditions. Then the college grad could look at the "What to expect from work" website before the job hunt, and not settle for third world sweatshop working conditions.
Aah, change is good. -- Rafiki
Yeah, but it ain't easy. -- Simba
Please read this before flaming ;)
I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.
Now, the above two lines were only an example.
The Real Meat of the matter:
* Tech companies expect un-sustainable levels of work from their employees.
* Tech companies will lay-off people without a second thought if it helps the bottom line.
* Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all! (This is taken from real life experience - where a consulting firm completely revamped all employees stock option contract, without protection for wrongful termination / layoffs, and gave us no option but to sign or resign!)
For too long, people have been of the opinion that: Techies are overpaid, and thus should be mistreated.
I believe that Technical people are highly paid, for doing very challenging work, that most of the people (even educated well...) would not be able to or want to do.
Here's my support for Tech Unions and organizing. What does the industry have to fear, if everything is really A-OK already?
Might we actually get more than a week of severance when the filthy-rich board of our dot-com decides to lay-off half of the company?
Might people working here, away from their families abroad, actually be able to take reasonable time-off to visit their relatives, and return to work?
Please be reasonable folks... add the influence of the slashdot readers to the Unions organizing. Listen to their goals if you personally meet those organizing, and if you agree with them, support them.
The anti-union sentiment on slashdot always manages to surprise me. Here's a couple of ideas for all you laissez-faire ideologues. Why don't you:
a) read a history book on the labor movement, rather than accept what's force-fed you by corporate media outlets and stand-up comics.
b) think a while about what's going to happen when the next big recession hits. Just because your skills are in demand now doesn't mean they always will be; or do you think PHP scripting and network programming are skills so integral to western civilization that you'll always have a job?
c) accept that collective bargaining can fit very neatly within a free market. If a company can't deal with workers organizing, then it's the company's fault. Nobody forces companies to accept unions, it's sometimes just the best business decision to make.
--
Where does this idea of all automotive or factory jobs being unskilled mindless monkey work come from? It seems that some of you have been watching too much Charlie Chaplin!
Being from Detroit (the home of the auto industry) and having a good number of family and friends in the industry, I can tell you that this is simply not true. Tomorrow when you get in your car and it doesn't explode three times on your way to the office, be thankful that your vehicle was assembled by people who are skilled and take pride in their work. Yes, it's repetitive, but so is designing and building apps that all look like nothing more than modified spreadsheets. And yes, there are those who do fulfill the stereotype, but there are slackers in every working venue in every industry -- look around you, for cryin' out loud!
But there's one point that everyone seems to be missing here: part of the reason unions were formed was to ensure the safety of the workers. Losing life and limb in factories used to be a pretty common thing (and it still happens occasionaly). Imagine if getting distracted even just for a few seconds while at your keyboard meant that you'd lose a few fingers, all the while your foreman is yelling at you to work faster, harder, longer over the already deafening thunder and clanks of the other machines.
Now, I don't actually believe that we in the tech industry have to worry about serious and life-threating injuries, but I do believe that we would need the combined strength of a union if we ever want to be allowed to grow up. What I mean by growing up is being able to work hours that permit a rewarding family life -- you know, like having stress-free pager-free time for a wife and kids and dogs and friends and trips to the Grand Canyon or London and...
Software developers should not look to unions to solve their problems. A better, and more appropriate solution is for a professional organization, similar to doctors and lawyers.
This organization, in addition to providing collective bargaining and lobbying on behalf of its members would also impose strict standards and guarantee the quality of its members.
I am 28 years old. For 32 years my father has been employed in the same job at the same factory (a paper mill), and has been president of the union for the majority of that time.
In my memory, they have been on strike once, and that didn't last very long. I remember going with my father to the picket line and sitting and talking to the employees sitting out in their lawn chairs (I was really young at that time).
The reason my dad got involved in the union in the first place is because he is a very smart guy, and factory labor didn't give him the mental stimulation he desired. He ran for president of the union local, and got it.
For any of you to say that unions don't care about their members, you've obviously never dealt with a man like my dad. He busted his ass for years during his free time (which there wasn't much of to begin with) working for members of the union.
He ended up getting out of the role of "Union president" because he decided he wanted to run for public office. He ran for 3 offices over time, none of which he won. (New guy, democrat in highly republican part of MI, and about 1/10 the money his opponents threw at their campaigns.)
After the financial, physical, and mental drain of the campaigns he went back to work (actually he worked all thru each campaign, but I think you know what I mean) content to let the other guy in charge of the union stay there. He needed a break and went back to doing "just his job" for 8-12 hours a day, often going weeks with no days off. Thing is, he didn't MIND busting his ass that much because the union made it worth his while... and he made it worth the company's.
Now, (and this leads to the part you may want to think about) 5 years ago his company was bought out by another. Guys at work came to my dad and begged him to run for union prez once again - contract negotiations were coming up with the new company, and these people know after having worked with my father for so many years that he is fair, tenacious, and works his fingers to the bone to accomplish things. He became president again, and it was business as usual.
Here's the important part... On January 11th of this year management of the plant my father works for let the company know that they are closing on March 31st. Do not pass Go, do not collect 200 dollars - they are totally screwed. And management is trying to screw these guys that have devoted their lives to their jobs into getting less than they deserve. They've offered no severence package, and are trying to go around the contract.
My dad is 52 years old, he has worked at the same place for 32 years. He has worked HARD and been a great employee during those years. There is nowhere he can go and make the money he makes now, and those 6 weeks of vaction he EARNED after so many years? He may as well forget about vacation time for awhile now.
These sorts of things are happening more and more - do you honestly feel the tech industry is immune? Now? 5 years from now? 10? 20?
I hope nothing like this every happens to you, or anyone close to you. If it does, you would be better off with a guy like my dad working round the clock busting his ass protecting YOU, with the Union behind him. Not all Unions are bad, not all leaders are corrupt. Not all companies are going to be around forever - and if they go, they certainy are not thinking about what's fair to YOU, the worker. Hopefully, someone with some pull is.
**disclaimer**
If this 'essay' is as disjointed and inconcise as I think it is...my apologies! Still haven't had any coffee :)
A job is not a right... it's a privilege. A job is not owed to you by anyone. You earn what you're worth--that is, how much the results of your work are worth to your employer or customer(s). In dollars. Running a business is not easy, else you'd be running one. The founders of your business started out with a great idea and struggled make money with it. Maybe you're struggling with them right now. Chances are, you solicited your services to that employer, they liked what they saw, and asked you to help them, laying their terms on the table. And guess what--YOU AGREED TO THEM. My employer buys my skill as a programmer--based on terms we agreed to--and in return I do whatever they want while I'm sitting in the office they provided for me. If at any point, I feel the terms of the agreement aren't to my liking, I will alter the terms or leave. And I would never extort my terms or pay someone to extort them for me. Most of us in this industry are smart, talented people. I don't live and die by my computer skills. You can be anything you want--you and I chose this field, at least for now. Stop whining about being "put upon by the cruel world." Compared to other industries, those of us that do our jobs are taken care of very well. So get to work, or go work for GM.
- When asked to give estimates for something you hadn't had time to check, say you MUST have time to analyse it.
- Check the task and try to divide it into component parts.
- For each part that you feel you had enough experience doing it before, come up with a duration value and add 10% for problems (they always happen). If that part depends on something else (ex: having certain data from the costumer) the state it very clearly (and put it down on a note, you might need it if the other part doesn't deliver on time)
- For each part that you do not feel you had enough experience doing it before, say so and refuse to give estimates. Never forget the argument that it's the manager's responsibility to come up with project times not yours (they get the money, they get the laurels so they should also get the blame).
- If pressed from management with irrealistic estimates say they ABSOLUTLY WILL NOT BE ACHIEVED. Don't forget to tell your manager that you will reafirm the IMPOSSIBILITY OF DELIVERING ON TIME AND THAT YOU SAID SO TO YOUR MANAGER to anyone that asks you (or not), including the costumer and your manager's manager
- If the management still decides to go ahead with impossible schedules no matter what then flattly refuse to work extra ours. If you usually work 10 hours/day immediatly reduce it to 8 hours/day so that they get the message. You might also consider VISIBLY looking for a new job (at the start of a new project that will make them go crazy).
- Beware of working extra hour for any shitty-shit problems - if you are SEEN as willing to got the extra mile for small things you will be COUNTED UPPPON to always go that extra mile to finish irrealisticly scheduled projects on time. It WILL NOT STOP - for every project you manage to pull out against incredible odds you will be "rewarded" with at least one other project like that
- Never forget that THEY need YOU more than YOU need THEM. When you leave the company might not go bankrupt but the project you just left might very well go belly-up (or have an incredible delay), and that will surely have a negative impact on the preson(s) responsible by that project
The beter you are at what you do the beter it works!!!Umm, what is the iron law of political science?
Need a Python, C++, Unix, Linux develop
Depends on the union contract & state law. If it's a closed shop, you either join the union or you leave the company. In an open shop, you don't have to join. If you're not a member, you don't have to strike. Of course, don't expect the union members (who are negotiating for all workers, not just the union members, in a right to work state) to be too sympathetic.
Me, personally, I wish I had a union or some larger group to represent me at my last company. Management at the company felt it would be SPLENDID to work us 6 days a week, 10 hours a day. Under a union? I doubt that would have ever happened. Ditto for the time I was sick, and management disclosed the VERY SURPRISING revelation to me that "you don't get any paid sick time". Nice. My current company thankfully HAS paid sick time, unlimited in fact (beyond a month or so though, your disability kicks in). They also have flexible hours-- come and go as I please, as long as I a) finish my work on deadline and b) average 40 hours a week (pushing that theory, I could work 20 hours this week, and 60 hours next, and nobody would care). A union would have atleast been someplace to turn to, instead of having to deal with the BS from the last job. (And yep, it was a dot-com start-up...) To the folk who say unions have no place since we can all quit and have jobs in a few days/weeks-- I'm sorry pal, but those days are numbered. Eventually work like ours isn't going to be the specialty, it's going to be as common-place as auto-work related jobs. All those 'kids' in college majoring in Computer Science and other fields related to IT? Eventually they'll be out in the work force, and suddenly jobs like ours will need some sort of defense. Are unions the answer? I honestly don't know.. I've heard good and bad about them, but IMHO, SOME form of representation is better than NO representation. My 25 cents.
All I know about Bush is I had a good job when Clinton was president.
The president's party always loses seats in both houses of Congress in midterm elections. Poli Sci types call it the "Iron Law" because it has only 2 exceptions since the Civil War - 1934 and 1998.
Wow... did I just write that?
"A microprocessor... is a terrible thing to waste." --
"A microprocessor... is a terrible thing to waste." --
GeneralEmergency
So please explain again to me.
Why is it alright for businessmen to band together to form a union so that they can reap the benefits of co-operation (we call it a "company", but it is an association of investors), but not alright for workers to band together to do the same?
If employers want the right to deal with each employee individually, why can't we have the right to deal with each shareholder individually?
And why do the people who invest financial capital get to elect the directors of an enterprise, but the people who contribute the human capital get no say at all?
Unions exist as an external force on companies, because workers are excluded virtually everywhere from participating in corporate government in the same way that "shareholders" are ('shareholders' is understood in the narrow sense of those who invest financial capital, not those who invest their human capital in a firm.) Corporate government is still back in the ages when only property-owners could vote, the mere worker was entitled to no vote. This is still the case in most corporations.
I am anarch of all I survey.
Unions are a natural and important part of any free economy. It is only through unions that workers are able to collectivly bargain with their employers, creating a natural balance of power. Also, it is foolish for any company to try and stop unions because people will become very defensive of their civil rights, especially in free societies like the US. Throughout history there are numerous examples of powerful companies and/or governments trying to exert too much control over their members, invariably leading to disaster.
"Unions do nothing but promote mediocrity. They dont reward for being a better worker and they DO reward for being "just good enough" (Which in a union shop, is usually pretty bad)."
You have a great point about this. Unions also are allowed to dip into your paycheck practically at will and they use this money soley to promote ONE political party that over 40% of union members do not support.
Which is a stupid way to buy influence, the reason why the corpers contribute to BOTH parties is so that they have influence no matter WHO wins...
Also, unions have had a lot to do with the de-industrialization of the USA. Back in the 70's and early 80's, virtually EVERY factory where I'm from (Ashland, Ky) ended up shutting down, mostly after the unions comitted job suicide by strike after strike during bad economic times.
Now don't get me wrong, unions DO have their place, and at one time, in the early 20th Century did a LOT of good in getting reforms in workplace safety, the 40 hour work week, etc. But I think they have long outlived their usefulness in the places where they are still prevalent (heavy industry and government). Workers apparently realize this as well, as union workers are now a small minority of the total workforce.
Will unions come to the tech professions? Sadly, YES. Why? Because of operators like the place I used to work for. The management treated the tech department like dogs, paid us nothing (and refused to give me a raise at mu annual review despite the review being near perfect). They took full advantage of West Virginia's "Chineese overtime" system (as it is called) and paid us far less than our hourly rate for overtime that at times we were FORCED to work.
It should come as no surprise to anyone that the tech staff turned over 100% from the time I was hired until the time I left.
So yes, I DO think unions will come to technicians, and other service workers. But it will be the beginning of the end of the tech industry as we know it.
I just hope we are a lot smarter about it and keep control with ourselves, and not create a political self-serving bureaucratic machine like the AFL-CIO or the Teamsters (who had a president, Ron Carey who stole an election, called the UPS strike solely to try to save his own ass, and ended up settling for pay increases that would take the average UPS worker 5 YEARS to recoup the pay they missed during the strike.).
We as a profession do NOT want to go down that road.
=== The price of freedom is eternal vigilance
You would only get to keep 23 of those.
"A microprocessor... is a terrible thing to waste." --
"A microprocessor... is a terrible thing to waste." --
GeneralEmergency
Unions normally exist in a market with one employer or a few employers acting as one. The goal of a union is to stop monopsony power.
The reason for this? The "menial" tasks that the anti-union people talk about in the auto-industry are actually considered skilled labor. They have valuable skills. However, if the "Big Three" decided that they would only pay $12/hr, these people would have nowhere to sell their skills, because there is only one employer. A union (monopoly of labor) and employer (monopsony of labor) negotiate, and you can something similar to a competitive market, but less efficient. However, it is more efficient than union/competitive industry or monopsony/exploited people.
If you have a competetive marketplace like in tech, (there are 10s of thousands of employers, and even in areas with sparse tech, there are probably 15-25) with lots of potential employees.
Unions will fail in tech, because "scabs" will laugh and cross pickup lines, and we're as a rule not imposing enough to scare them. Unlike the teamsters, I can't see tech unions working with the mob to kill scabs, but that's just me.
Alex
Having worked in both unionized and non-unionized employments in the tech field, let me address some of this.
;-) Market downturn for your position? Oh well, lesser pay for you this time around. Unions tend to protect against that. It's rare to see cuts in salary, except in extreme circumstances.
Both have their pros and cons.
Pros for being unionized:
- Job Security. Getting fired because your boss feels like it is tough to come by. One myth about unions is that you can't get fired for nothing. You can, but it's much tougher for your boss to do.
- Wage Security. Chances are, with a union you won't have your wages dramatically drop. It does happen, however that's in extreme cases where the union can see the company will not survive. But your union will negotiate a long-term contract saying what raises you will get and when.
- Working Conditions. Under most unions, if not all, these tend to go up. You, most likely, will not be required to work 12 or 16 hour days if you don't want to. If you do, you will be compensated for it. Same for pagers and after hours. Your work area will be up to par.
- Standards. You will probably have standards that will rule what you do, when you do it, how you do it. It won't be a free-for-all, today you are sys-admining, tomorrow you are installing software on a clients machine, next day you are debugging software from the guy that just up and quit.
Cons for being unionized:
- Lumped Grouping. You may end up in a situation where you, say a sys-admin, are lumped into a union with programmers. The prog's make $60k/year, but your job commands $75k/year. The company says to the union, hey, we'll give you prog's the $60k, but the sys-admin's get that too. 25 prog's, 2 sys-admins voting in the union on the contract. Who do you think is going to win? Not the sys-admin.
- Seniority Rules. Seniority tends to be the thing in a union. The longer you are with a company, the better your chances of picking up jobs within the company. And the job doesn't necessairly have to be related. I've seen secretaries go from secretarial pool to 2nd tier help-desk support, double their salary, all because the union contract called for internal first, based on seniority, then external. 20 years in the pool, vs 1 year 1st tier help desk. Who wins? Who's more qualified?
- Based Rate Salary. You get what everyone else gets, starting from a base. Perhaps you are in a group of programmers, and now high-level programming is called for. Because the programmers all get $60k, you get it too, even though your specific knowledge would command more on the open market. However, the salary is protected through market downturns.
Pros of being non-unionized:
- Negotiated Salary. You get what you negotiate. Don't like their 3 weeks holiday rule, and negotiate 4? It's yours. Same for salary. Market rules.
Cons of being non-unionized:
- Indiscriminate Firing. They can let you go, when they want, how they want, etc. Yes, there are laws, but ask any labour lawyer how tough it is to win based on those laws. Layoff time? Your turn, so sorry.
- Negotiated Salary.
These are some notes that just popped into my head. There are many more reasons on either side of the issue, but it's really up to the individual. I've met many people who love unions, and wouldn't try to work without them, and I've seen others who hate them vehemently. I've seen people switch sides so often, I got whiplash watching.
I doubt there's any truly "right" answer, it does tend to be up to what the individual is looking for. If you don't want a union, you find a job in non-unionized shops. If you want one, you find a job in a unionized shop.
Vip
You can also see a model in some more activist unions of the union opposing things that aren't directly related to employment, but represent the beliefs of their employees. The National Education Association is probably the most notable such union -- much of their lobbying in education isn't related one way or the other to employment, but simply reflects what teachers believe are the best ways for schools to operate -- as opposed to what pundits, principles, school boards, and sound-bit-searching politicians think is best.
As someone who will be entering the teaching profession in the near future, I can speak with some authority on this. The NEA is NOT a labor union. Consult their website, read their literature. In none of those materials will you find the NEA refer to itself as a union, or be affilicated with other unions.
The AFT, American Federation of Teachers, is a union however. They are affilicated with the AFL-CIO, advocate strikes if conditions deteroriate to the point where they become necessary. The NEA does not advocate strikes on any level.
Yes, the NEA lobbies all levels of government on a variety of issues not overtly releated to teaching, but in the view of the NEA, all issues relate to teaching. The NEA has an official position on gun control (less guns in schools=good) and nuclear weapons (they kill people) for example.
The only national teachers' union, AFT, does not lobby for any issue not overtly releated to teaching. They have an official position on national testing, but leave gun control to others.
The NEA is a teacher ONLY organization. If you are not a teacher, you cannot join. The AFT, on the other hand, says that any school employee from the counselors to the bus drivers can join. The philosophy being that everyone who works for a school has a vested interest in it being the best possible. However, management of the school (administrators and principals) are not allowed to join. The NEA leaves that decision up to the local level. If local branches of the NEA wish to permit administrators to join, then that's kosher. Most local chapters will allow administrators to join, so long as they were members of NEA as teachers, before moving into the management position.
Calling the NEA a union is simply incorrect, despite them having a number of features which most unions have.
No sig is worth reading.
It's so very sad. The United States is the undisputed IT industry leader of the world. We have more jobs paying higher wages creating more engineer millionaires than anywhere on the planet.
Even the crappiest just-out-of college student can find an extraordinarily well-paying job in the IT field here.
So what do the socialists want to do? They want to fuck it all up buy unionizing. I just don't understand how anyone with half a brain working in the IT field in the United States would want to invite the evils of unions into our industry.
Sure, if you're incompetent or a freeloader, you want to be in a union, but if you have even a minimum of self-respect for your ability to go out there and secure a job why on earth would you say, "Unions, Yes!"?
Why on earth are you people so intent upon killing the goose that lays the golden eggs?
Why are you letting these clowns ruin our country?
The pay's not as good, the benefits are stable, and you usually get a union of some kind for State or Federal employees anyhow. And it's REALLY hard to lose a government job when you're on full-time, thanks to the anti-PHB protections that the government has put in place.
My own pointless vanity vintage computing page
I guess the companies don't want the unions. If the unions get in, companies will have to treat people better.
OTOH
Q: How many teamsters does it take to change a light bulb?
A: 15. You gotta problem wid dat?
Wansu, th' chinese sailor
As has been commented, your unskilled labor includes:
Electricians
Plumbers
Pilots
Teachers
Nurses
EMTs
Airplane Mechanics
etc, etc.
Really unskilled there, anyone can just be a nurse, just walk into a hospital and sign up!
The traditional industries in which unions are strong all have the same achilles heel. It is near impossible to move those jobs completely out of the country. Unions derive their power from the fact that industries can't survive without their workers and can't easily move production to another locale without breaking the bank.
Information-based industry, though, has no trouble simply packing up code and shipping it off to Timbuktu. The cost of moving is trivial and developers are a dime a dozen. A modicum of training and voila! We've got XYZware.com now cranking out software from Swaziland.
Unions are bound to fail in this industry because developers are in a very different position than, say, an auto worker. Whereas any single auto worker is completely disposable, good software engineers are individually important to the well-being of a company. The auto worker can derive strength by turning his interests over to a union who will bargain with management using the threat of large-scale walkouts. The software engineer, OTOH, gains essentially nothing through collective bargaining. He, in fact, would lose out in the case where the company decides that it is in its best interest to fire all union members and hire new engineers or change company locale altogether.
Businesses are not interested in seeing unions form because they fear the strike. However, information industries have an ace up their sleeve, which is the relative (to other industries) simplicity of moving to another country whose laws may not favor unions as much as they do here.
It's a really difficult and touchy subject, but I think it's an issue that will come to a head some time in the next couple of years. In the end, I predict that we will see the entire information industry unionization drive cracked by the unwillingness of many (if not most) engineers to join. Without enough numbers, unions would be effectively powerless, and with management's very real threat of moving jobs, it is likely they wouldn't have much power to begin with.
Dancin Santa
One virtually ignored aspect is technical support. Dell computer burned through every qualified tech in Austin, then they burned through everyone who could operate a computer with halfway decent proficency. Then they burned through all the people temp agencies could drum up. Having a union might cost Dell a little more, but it would actually improve Dell's bottom line by helping to retain qualified employees, instead of having to move their tech support department, because they're under-paying their employees. This is not unique to Dell. Considering that most tech support departments are turning to auto-mechanics for their troubleshooting skills, I don't expect it will be long before they are unionized. And it will be good for those who need tech-support. The larger corporations might even think about training their employees on new products.
It's very gratifying to see my post get so much intelligent discussion!
;)
Unions may not always work, and may not always be a boon to every industry, but the truth of the matter is this: WE... the workers and citizens of the United States, deserve the right to form a union within the workplace if we see fit.
It is corporations that profit from a lack of worker organization, not those of us putting in the long hours, and spending thousands of dollars on educating ourselves just so we can GET these time-consuming, energy-draining but albiet satisfying jobs.
You've all heard of the Teamsters? Well.. they began as a Lawyers Union, in California. Bet ya thought they were all truck-drivers, right? Who would've thought lawyers needed a union? Who would've ever thought geeks did? Well, if there is this much hoopla.. apparently some geeks need it.
How can anyone NOT support the right of workers to have a voice? Any workers! That's what I'd really like to know.
yes, i realize this is buried waaaaaay at the bottom of the list and no one will ever see it. think that stops me?
"We don't stop playing because we grow old. We grow old because we stop playing."
Whoa...Piloting a Jet is less challenging than coding?! Coding x86 assembler maybe. Airline pilots work long hours and if they screw up they can kill hundreds of people along with themselves. Of course they deserve a six figure salary! Joe Blow VB/Java/Perl coder hardly has more responsibility than that, and I'd say $50,000 (especially US$) is fair and generous compensation.
I'm sure there are more senior technical people who work on critical safety systems that warrant a six figure salary, but that's only a fraction of the techies out there.
As for pilots being unionised--their jobs are deemed quite important, so if the nation's economy is disrupted too much they'll just get canned anyways. Think back to the Reagan days...
I believe Unions as they exist today in North America are obsolete. Labour relations should be more co-operative than confrontational, and from my observations "professional" unions (teachers, nurses and so on) have hindered those professions. They are not regarded as professional occupations in the same way managers and engineers are (although they definitely should be), and that has to do with the sometimes unprofessional, teamsters-style strategies employed by sometimes self-interested union leaders.
I think you proved the point made. It is your fault you don't have money in an account to cover your ass when you decide to say to the hell with it. It's your fault that you have your commitments.
Once you have a family and a mortgage, cars and educations to pay for, the whole "you can get another job" thing isn't quite as simple.
Having a mortgage, cars, student loans, kids, family makes everything more complex, however, it does not make it impossiable to get another job. If you just have planned your life a little better, it wouldn't be that hard.
MarNuke
I happen to like my job, I happen to like my employer. I want to work for a company, be part of it, work with it for our combined success, I want to be judged, promoted and rewarded for my work and efforts, not the amount of time I've worked there and not on the collective effort of my co-workers.
I don't want to work for a union, I don't want to work with unionized people, I do not want to work in an environment where it is "us the employees" vs "them in managment".
Unions are for people that work in comodity positions where anyone can do the same job and exist to protect dead wood.
The difference between Canada and the USA is that in Canada healthcare is a right and gun ownership is a privilege.
Folks, higher skilled workers earn more than lower skilled workers in this industry. Even when the lower skilled workers have more seniority. The reason is that we don't have collective barganing and each worker is free to negotiate their own wage.
Moreover, we don't have a couple of hundred dollars a month sucked out of our paychecks to fund the organizer's pockets.
The net result of all this is that those of us who are in the top percentiles skills wise get to make a shitload more money than if we where in a "union" shop.
In the world of unions, every worker gets the same wage, regardless of differences in talent. They get the same raises based on years of experience. They have no power to bargain on their own behalf - no matter how much better they might be than their coworkers.
And folks, there's a hell of a lot of difference between a top-end coder or data analyst and a mediocre one.
Unionization will be a loose-loose proposition. Top talent will loose wages if they stay in union shops and union shops will loose top talent since they won't pay them what they deserve.
Bad idea, folks. Really.
Of course. I've built several of them. There's most of a 1974 Plymouth Valiant in thousands of individual Zip-Lock baggies in my living room at the moment. The clerk at Wal-Mart asked me if I was dealing drugs because I buy so many baggies.
Building a car isn't easy, and anyone with sufficient knowledge of all the parts of a car that they can relatively successfully assemble one, will be paid more than minimum wage as a simple law of supply and demand.
As for machining brake pistons, as an example, it's very easy. With ten minutes of training, anyone could do it. It makes mopping floors look like ir would need a PhD. I would suggest that $35/hr for such a job is rather excessive.
I should ask, what does it take to have a good life in Toronto? What is the cost of living? How many hours would it take to earn at mininum wage to pay for an house? Apartment? Food? Bills?A lot. But you obviously don't know anything about supply and demand.
Let's say that affordable housing for minimum wage brainiacs is a two hour commute away.
If Taco Bell can't get people to mop the floors in downtown Toronto because all their minimum wage employee base is, by virtue of real estate costs, too far away from work, then Taco Bell is going to have to pay more money. Either to entice people who can live in the more expensive parts of the city to work there, or to offset the high costs of the commute.
I think unions have a way to go to improve their image and their fuctions in a high-tech world, but they fought the good fight back in the 1800s for everyone to which I'm grateful.Great! Yeah, the 1800s were a time with no labor laws. The industrial revolution was in its infancy, and as society shifted from an agrigarian existance to an industrial workforce, yeah, unions had their place.
But today? Nah. If you don't like your job, get another one. Can't find a better job? Read a book, then try again.
Fire and Meat. Yummy.
I disagree. The reason your car doesn't explode is because it's engineered that way. I am honstly awestruck when my auto mechanic friend pulls parts out of a vehicle to repair and they are in such a state of disrepair that you have to shake your head... I mean if your CV joints go, they usually cripple the vehicle instead of locking up and causing an accident. If your tie rods go... well then you're fucked but usually these things are built such that when a piece dies, it dies gracefully. I would hate to think what vehicles designed by web programmers would do.
For sure! It's all about quality of design. Quality of construction is important, but the design should have sufficient tolerance for errors in the construction that nothing really bad happens.
As an example of construction errors, a long held legend among Toyota dealership mechanics is that approximately 40,000 Camrys left the plants in 1987, missing a right front speaker.
A speaker is a little harder to miss than a tiny little C-clip that retains the active ingredients in your brake master cylinder! And Toyota has, unquestionably, some of the best assembly quality in the industry. (Note that they're not unionized, either, and yet Toyota employees are better paid than many union factories.)
Actually, the fun thing about Toyota is that they pay their staff a small minimum. And then the assembly line workers get generous bonuses based on the quality of their work. The net effect is that everyone is paid what they're worth, because your pay is inversely proportional to your defect rate.
Sadly, UAW is very much against this sort of practise. I think that's telling.
If a job requires a level of skill then pay for it. Don't pay the twitt stamping out metal pieces $28/hr to watch a machine work and take the product and put it on a shelf for post-processing. That is promoting mediocrity.For sure! And remember, most of the people in these manufacturing jobs *are* mediocre. They're there because they were too lazy or unmotivated to go to school, or to learn about something like computers on their own. And therefore, when you give them a union, they become mediocre with an attitude.
Fire and Meat. Yummy.
If you were, you would be more likely to know that most unions are run by the mob.
(Posting anonymously because I don't want to be buried under Giants Stadium)
No, they don't do that anymore. Too messy.
Now, they take you to a Jersey wrecking yard, toss you into the trunk of a toasted Caprice Classic, and then you get to ride through a Newell shredder.Ouch.
That's the leading Hoffa disappearance theory, too, BTW. If you've never seen a car shredder, lemme tell you, there'd be nothing left. These things can shred forged nodular iron crankshafts.
Fire and Meat. Yummy.
How about the automotive CEO's that make 60-70+ million a year? Now that is wage inflation, at least the guy making pistons is producing something.
I think $60-$70 million is a little more than what the CEOs get paid.
Now, as for what the CEO does. He organizes the company, provides a vision and an outlook, and helps to ensure that the shareholders get a good return on their investment.
The guy who machines brake pistons does something that can be taught with ten minutes training.
If you lose your CEO, you'll have to use $$ to lure one away from another company.
If you lose your brake piston machinist, you can train any McDonalds counter-schlep to do it in under ten minutes.
I fail to understand how you can equate the CEO with such unskilled labor and suggest that any wage parity is warranted. That's sheer idiocy.
The automobile has its purpose, commuting isn't it.When the alternative is riding on public transit with unionized hotel chambermaids and other smelly dregs of society, yeah, the car's purpose very much is commuting. And if my government won't allow me to drive to work, then my quality of life is impaired. I will then take my talents and skills and move somewhere that allows me some standard of living for my hard work.
Canada is a capitalist economy, I do know that for sure.To the same extent that France is capitalist. Sure. Any further to the left, and the national passtime of hockey will be replaced by shredding copies of Pravda for toilet paper.
I'm not sure how much your capitalists rely on the government though.Northern Telecom gets over $100 million in government subsidies every year. Canada has a population of approximately 1/10th of the US tax base from which to draw those subsidies.
You probably have a more represntive government, which allows such things as nationalized medical care.I'd rather have the option of paying money and geting health care where I don't have to sit three hours in a waiting room with a chatty homeless heroin addict as I wait for a strepped throat prescription.
Here in the US...Wanna do something illegal?
Here's a suggestion. You seem disenfranchised with the US. I'm disenfranchised with Canada. You want something more left, I want something more right. I'm 6'4", 185 lbs, brown hair and eyes, 26 years old, no criminal record. If you've got similar stats, we can pull an ID swap. How's that?
You'd be able to vote for the Socialist Workers Party next Canadian election, and I'd be able to vote Libertarian next American election.
The scary part is, I'm only halfway kidding.
Fire and Meat. Yummy.
Labour law falls under provincial jurisdiction. The difficulties in organising vary greatly from province to province.
True.
And while there are many things I don't like about Mike Harris, his stance on unions is one of the reasons I helped to re-elect him.
Fire and Meat. Yummy.
I'm not quite sure what the linkage is, but does anyone smell a rat where pro-H1Bs and anti-union sentiment can be found in the same place?
But it doesn't stop there. Some creative jobs are organized. Hollywood is very unionized; actors belong to the Screen Actor's Guild (SAG) or the American Federation of Television and Radio Artists (AFTRA), musicians belong to the American Federation of Musicians (AFM) directors belong to the Director's Guild of America (DGA), drivers belong to the Teamsters, and most of the support people belong to the International Association of Theatrical and Stage Workers (IATSE). Lucasfilm's animators and CGI techs in Northern California belong to IATSE, which is trying to organize online entertainment shops. If you're doing web design or involved in running a web site, it might be worth talking to an IATSE organizer. They send people to ACM SIGGRAPH meetings in SF, so they're not hard to find.
A union shop is a great advantage in an industry with heavy time pressures. It gives the employees an effective way to push back. Anybody in those unions who works a 12-hour day gets paid major overtime. Get called in for a weekend emergency, and big bonuses apply. This discourages employeers from understaffing and overworking their employees. If a job needs to be done 24/7, it takes four full-time employees.
Organizing in the US is very tough. Over 90% of employees who try to organize a union are fired, even though this is illegal. Canada, for example, has stronger labor laws, and it's much easier to organize there. This is the main reason for declining union membership in the US.
Despite the obstacles, temps at Microsoft have successfully organized a union, and won a lawsuit against Microsoft.
... such as collective pricing on insurance, registry of good/bad employers (our own black/white lists), legal counsel, etc. without a traditional labor union?
;)
There are features there that I'm interested in, particularly since it would help reduce the risk in going independent.
Someone mentioned the idea of a 'guild', which is really very interesting, and probably the best fit. SAGE is AFAICS a mostly skills/interest group, what I'd be interested in is something like that but with the addition of services at group prices. I can get 25% off ORA books with a Usenix/SAGE membership, howsabout 25% off Sun or Cisco hardware?
Your Working Boy,
Although the easy answer here is to be multi-skilled. e.g. I can do Java, Delphi, architecture design, OO design, test design, technical writing, IT strategy design - and implementation, business analysis, requirements gathering, and a few other software engineering tasks.
I can also run a business team of 10 people - but if you tell my boss this I will slap you, I'm trying to keep it quiet so that I don't have to. But I do get involved with business process design, with reviewing business practices and with creating corporate strategy.
I'm not saying I'm any good at any of these things. But my company thinks that I have enough skill in each of them that it employed me (and has since promoted me) ahead of people with more specialised skillsets.
(Just to confirm, I do have extremely well developed skills in some of the above areas. And I really suck at some of them. I wont say which
~Cederic
Well, that's certainly true. I'd much rather have a nice, short program that did the same thing.
The point is, whether new or just updated, the lines of code edited per year has been dropping steadily. I think that this is because of the large number of newbie programmers flooding the marketplace, not only bringing the average down with their output but also by taking time away from the experts for trivialities.
When it comes down to it, the average productivity has dropped, no matter what scale you use. Propping up mediocrity, as all unions do, is more inappropriate for the tech industry because of the wide variance in productivity. Take the best UAW worker versus the worst, how much more productive is the shining star? ALmost not at all, they are on an assembly line, it goes a certain speed. Take an Alan Cox or some other genius versus the most clueless newbie, the productivity ratio is enormous.
Let's get rid of the unproductive programmers who will never amount to crap and get back to work.
I have my own Union. My company can fire me at any time, and I can come in, pick up my coffee cup, and say "I'm GONE" at any time. They'll be the one whose screwed, I can find another IT job anywhere, it'll take my replacement at least a few months to get up to speed on what I've been working on. I'm happy working here, if I'm not I'll quit and get another job. Employee/Employer loyalty is a fabrication of the unions, if a company is screwing you DON'T WORK FOR THEM.
My Other Computer Is A Data General Nova III.
All a union would accomplish is allow some 2-bit,
half-ass programmer to claim similar pay and
status as their more experienced and talented
peers.
I bet that you're not going to find any highly
skilled and paid individuals rushing to join
a union because they not they don't need it!
Their skills speak for themselves, not some
200lb gorilla which claims to be a voice for
the workers when really they're just bullys.
In the IT industry, competition is King. If you can't take the heat then you have no place here.
I worked at UPS during the Teamsters strike a few years ago. I can tell you how much the union was looking out for their people: They gave their members $55 per week in strike pay. Then they took out the union dues. Some people went home with $13 paychecks with which they were supposed to feed their families. Yeah, I can see how much the union cared about its "brothers and sisters"..... What a f***ing crock, they cared NOTHING about their members.
load "windows7"
While you won't move your primary production to one facility in E. Europe in one shot, you might want to take a look at Rational Software's methodology. By breaking down projects into small pieces that cycle quickly, each cycle leaving useable artifacts, you have the basis for distributing your code to many shops in many countries all of which use this methodology (30 day free trial available at www.rational.com) to get requirements and manage changes. Great tools (expensive as hell though).
You end up having your high level folk in the US, gathering the requirements and managing the process while the bulk of the work goes on in 2nd world nations saving costs.
DB
I suspect that genuinely good programmers are underpaid relative to their less productive counterparts. I suspect that a union doesn't help them.
-Dave
There is a startling difference between the traditional laborer and the tech industry: The very best tech workers can be up to 100 times more productive than the average. There is no way in hell that a manual laborer could be even 2 times more productive than average, they are slowed down by physics and the other workers around them. Not true of tech workers, someone else's slowness is independent of your own speed.
Good programmers know that they can crank out thousands of lines of code in a day if the requirements are well defined. The industry average for lines of code per year dropped to 6500 from 9000 per programmer. Is this because the requirements aren't there? Probably in large measure, but in any case, the average productivity stinks. You elite programmers out there: doesn't the average year of output sound like a slow month?
I'm using this to conclude that we do not need a union for the tech industries. There is no need to try to protect the other half of the bell curve. They can get a job that they can handle, and stop trying to pretend that they are techies. If they want unions so bad, let them go make cars.
- Convinced that anything slightly anti-business is "communism", and that "communism", regardless of what it's describing today, is "evil"
- Americans, and therefore subscribers to the notion that Unions are just a way of channelling money to the Mafia
- Convinced that all programmers are single, young, and in a job market where they can pick up any type of job they wish, and therefore able to choose the Linux based open source employer of their dreams with no dreaded clueless salespeople to screw up the objectives and with benefits that'd make those poor sods in "socialist" countries like, er, every single country other than the US, weep.
Is there any way that this topic could end up being anything other than a flamefest?It's just one of those topics I'm surprised you'd want the Slashdot crowd to contribute to. Next stop: "Should Government Trustbusters Nationalise Microsoft?"?
--
You are not alone. This is not normal. None of this is normal.
"I don't think it's selfish, to eat defenseless shellfish." -NOFX
I do notice a lot of anti-union sentiment here, and I don't think is really well thought out. Many people seem to object to the entire idea of unions based on one bad experience. This isn't really a good way to judge an entire issue, the first time I tried to install Linux it crashed and ate three hours of my time, should I decide that Linux sucks based on this alone?
While, admittedly, unions can sometimes do bad things, look at the way it was before we had unions. Go back and read about the working conditions under Rockerfeller or any of the other tycoons, it sucked much worse than any of the problems you've had with unions. Also, unions have a positive affect even in industries that aren't unionized, the fear of unionization sometimes keeps a corporation from doing anything really nasty.
I think some of the rest of the problem is that mostly people only hear about unions when they go on strike, the times when the union negotiates with a company and they come to an agreement are usually left out of the news. Any union worker has better pay, better benefits, and more job security than a non-union worker. In our era of increasing corporate power I can't help but think that any check on that power can't be bad.
"Mission Accomplished" -- George W. Bush May 1, 2003
The point of the union is to help people get a good, stable income and benefits so you can raise a family, or whatever, with peice of mind.
.COM, a union is definitely a viable option here. Working together is a good thing.
People don't realize that a union is a safety net, so that the worse case scenario doesn't happen.
The UAW (United Auto Workers) has directly affected the quality of my life while growing up. There were a lot of tough times in the 80's and the UAW helped my family through it. There were stikes and shutdowns, etc. It all worked out in the end, and my family and the company are both doing well.
In fact, I would be willing to say that if the UAW did not exist, I would not be where I am today, with a good tech job and having the free time and interest to write this post on Slashdot.
Just because you have not benefitted from a union does not mean that MILLIONS of other middle-class people have not. Many people's quality of life would not be as high, plain and simple.br>
Also, considering the fact that I would not feel very comfortable raising a family while working for a
While few of you highly skilled techies are likely to spontaneously become Asian or Native American overnight, you are certain to grow older. (Or die, of course.) Look around and count the number of employees over 50 (or even 40) you work with. Now count the number of years you have left until you are old enough to be considered outdated. (Oh, I know... you are going to always keep your skills up to date... yeah, right.) Unions aren't perfect, but they stick up for all the workers not just the super-talented ones. They negotiate for the older workers who bring with them a history of why things are done the way they are as well as the worker who was injured in an accident and is disabled.
I can hear you say, "but discrimination on the basis of age or disability is illegal." Only if you can prove it. If you are in a union, you know you at least have someone who will be on your side when your company decides 35 is too old to be a good programmer.
No one ever had to evacuate a city because the solar panels broke!
Shrug, I'd rather have someone to represent my interests. I think I gave a prime example of why as well-- your only comeback is that I'd lose some money to union dues. Big deal; atleast I wouldn't work 50-80 hours a week and then be told it wasn't enough on Sunday.
Granted, I'm still not in a union and my current job is amazing. Excellent team, nice hours, good pay and very flexible management.
But, as I said, wait another 5 or 10 years. IT will change, eventually people will want a lot of things from employers like--
a) paid training to keep current on new technologies.
b) better pay to keep up atleast somewhat with the rising costs our society always has.
c) better positions, or new positions dealing with newer technology-- not legacy technology that's "on the way out" (along with your job entirely).
The problem as I stated earlier, is that it seems a vast majority of posters here (so far, this topic just started so I'll hope for more pro-Union or atleast pro-organized labor) aren't for Unions because they view their jobs as safe, and the demand for their work as endless. It never crosses their mind that the same colleges they were through is bulging with fresher IT workers that are willing to take cheaper wages to pay off those expensive college loans.
Unions might not be the answer, but there must be some way of keeping our rights respected and our pay reasonable-- because honestly, I see this job and I'm happy with the pay, but I don't see myself in this job four or five years from now. And why? Because technology moves ahead at speeds that would require someone to go back to college every 4-5 years for new training and/or hit up seminars and/or read a library of books to keep up.
And the interval between new languages, technologies, hardware and software is only shortening.
I'd gladly give a union a portion of my pay, if it meant represntation and fair pay for new and old workers alike, and retraining where needed.
All I know about Bush is I had a good job when Clinton was president.
Labour law falls under provincial jurisdiction. The difficulties in organising vary greatly from province to province.
Look at the automotive industry. It's full of people who do menial tasks like machining brake pistons. And yet, their unions are so strong that they get paid $35/hr+ - for minimum wage work!
I don't know. Can you build a car?
I should ask, what does it take to have a good life in Toronto? What is the cost of living? How many hours would it take to earn at mininum wage to pay for an house? Apartment? Food? Bills?
I think unions have a way to go to improve their image and their fuctions in a high-tech world, but they fought the good fight back in the 1800s for everyone to which I'm grateful.
III.IIVIVIXIIVIVIIIVVIIIIXVIIIXIIIIIIIIVIIIIVVIII
Unions often force employers to promote based on stagnation as opposed to merit...
Cheers,
Rick Kirkland
You mentioned foreign workers here in the US.
Consider this, if unions were forced upon tech companies, you'd see a lot of farming out to countries (take your pick out of India or any of a half dozen countries in that area) where they don't have the kinds of standards that we in the US have. They are doing that enough as it is, and forcing unions upon the industry would cause this to happen anymore.
The end result would be less jobs here, and companies farming out to countries whose standards, etc., are far below the US.
Fabulous idea.
Let's introduce a bunch of corrupt union ring leaders into our ranks. Let's not get better pay, or better jobs but instead have to pay union rates as well. THE HELL WITH THAT.
Get your head out of your ass. If you were a good admin you could get a good job that doesn't involve your sitting in some tiny cube overworked and underpaid. I work 9-5, make 6 figures, and I love the power that leaving at any time gives me. I am incharge of my group and we work well together. We work with each other not for each other.
My suggestion, get a better job and do not ruin things for the rest of us. If you were any good you would be able to get a job that you would actually enjoy.
(And you could do it on your own if you tried.)
-sirket
(Sorry for the inflamatory post but I will be damned if I will let a bunch lazy people freeload off the hard work that the rest of us put in. Good jobs are out there and are not hard to find. Or better yet, found your own company and make things better.)
How many of the non-unionized employees lost their jobs because the company was forced to pay non-productive employees for 3 months and provide them with massive benefits? How many jobs could have been saved?
Companies are not bottomless moneybags. If they are forced to pay for something in one sector, expect that another sector is going to be screwed out of their share. All you have shown is that pro-worker laws at the non-US location sucked valuable monetary resources from the US location, forcing a larger number of layoffs in the US.
Dancin Santa
It actually lowers our value, by encouraging company loyalty. Given that we are in demand, having people move around more results in a more active market, resulting in higher average saleries.
Cheers,
Rick Kirkland
Any economy gets run by supply and demand. The only way you can bid up the price of labor so that these countries get out of their hole (and I'm thinking more about 2nd world countries, not 3rd world) is to send more work their way. Code outsource is a relatively clean and easy way to give them relatively high paying jobs (in their local wage scale) while saving the job exporters enough money to increase total employment.
As for your anticipated glee at the insertion of back doors by outside the US programmers, that's why you compile from source after checking it. Besides, anything that malicious that it bankrupts a company is going to have some competent forensics people going over the mess. They'll trace it back to the outsourcing company and the hacker goes to jail. Most of the adults know this and thus don't hack from work no matter what country.
DB
I am not amazed by the incredible range of emotions this topic has spurred. I am totally saddened and angered at the elitism, racism, generalities, banalities and for the most part a reliance on anecedotal evidence for the arguments. Where is this alleged intelligent IT professional?
I would venture to guess that a large part of this audience is young and too specialized to see a large world of which they are a part, and how much of the opportunity and easy pickings they have are because people died at the hands of company/government supported efforts to keep workers as thralls and chattel. And you have the gall to think that it does not continue to happen and will not continue to happen?
A sense of community should go way beyond the buds you play Evercrack with and include all the 'sheeple' out there who have bought into the silicone snake oil scheme. That demand for product, whipped up by the media and marketing is the only reason you have the job opps that are there now.
Booms don't last forever. Talk to the folks who make the physical existence around you possible. Think about how recent the reliance on computing is. Think about how only half of the U.S population owns a computer, or uses one in the workplace (and sales suck). Think about how hard the push is among Big Corp America and the lackey government that paves its' way to turn every kid into a tech wizard. Soon you will be the old farts trying to get a job maintaining some 6GL code you've never seen.
As more of us who are currently old farts start to realize that all we have learned in those worker dog jobs translate into tech skills, and small corps realize that two stable adults that need a little training are worth more than one unstable whiz kid, you may just wish you had some protection.
I just had to add some flame bait didn't I?
'Looking back to a better day, feeling old and in the way.' -David Grisma
>>>2. Tech companies haven't been above screwing employees. People get let go a couple weeks before their options come due, often for fabricated reasons. H1-B visas get rammed through Congress to drive down IT salaries. Imagine if the Big Three automakers tried to import tens of thousands of foreign workers and then pay them substandard wages!! It can only happen in IT.
>>>This sounds racist to me. If other people are willing to do your job for less, and they're just as capable as you, why shouldn't they get the job? Because their skin is a different colour?
No. That's wrong. I used to work for SeraNova. We built web sites. The company was run by a guy from India. The parent company is called Intelligroup. The CEO and his friends would bring in a bunch of developers from India. Sure they worked cheaper. But if one of them did ASP dev, he sure didn't do C++, or PERL, or even Visual C++. After they laid off of most of the IT and programming departments (me included), because the company was losing money, our little part of the company started losing money and clients as fast as the rest. Why? Because all these kids they brought in from India were paper Unix, or paper MCSE, or paper whatever you java people are, had no experience with anything, are completely unwilling to work on or learn about anything not directly related to their specialty, and don't seem to have much imagination at all.
Please, shut up. I'm not being racist. I'm telling you about the people that came to Provo Utah, from India, and couldn't cut the mustard.
The few guys that are left over from the old company have to work harder. The kids who used to just do HTML had to learn java, unix, etc, to get everything done themselves. I'm sure Cliff and Nick exaggerate, but not by too much. The "Unix Specialist" they hired knows telnet, knows IRC, knows how to chat, and that's it. They had to outsource their actual hosting and management of Solaris machines to a guy that used to work there (he made a little hosting company just for them).
So. Not racist. Just PISSED. We had a fun, profitable, working little company going, and Intelligroup/SeraNova fscked everything up. With cheap imported labor. Happily, that includes themselves.
Failure is not an option.
Failure is not an option.
It comes bundled with Windows.
Whoever moderated the parent offtopic better get their shit together...
[an error occurred while processing this directive]
Based on the comment, "I'm only a co-op student," I'm guessing you've never experienced a slow economy. Sure right now it's extremely easy for a programmer to find a job. Maybe it will always be easy for the best programmers (and don't be that sure that you're one of them) to find a job. However, as the economy slows, it will become harder for good programmers to find jobs. Enjoy the good times while they're here, but make some plans for bad times. If you live under the assumption of, "Don't try to tell me it's hard to find a new job--it's easy if you don't suck," you might be in for an unpleasant surprise.
Unions bad/good? It all depends.. they can be both.
What bothers me, these days, is how often a perfectly happy workplace is interrupted by 'outsider' union organizers who come in to try to convince the staff that they should unionize, under their guidance, because it will benefit them.
We aren't talking about several employees getting together and saying 'we need solidarity, so we can change things, because we don't like what's going on here', we're talking about outsiders coming in and brainwashing (or propagandizing) the staff into thinking that it's GOOD for them to unionize.
THAT is my problem with it...
If I ever own a shop, and people try to unionize, I *WILL* shut it down.
(just a reference, I work for one of the computer biggies down in Austin)
:-)
I am well compensated for the work I do.
I am quite happy with my environment.
I know that if I am not happy with my conditions, whether it's pay or environment or management, I can go elsewhere and do just as well if not better.
I find the idea of having to pay a part of my salary to somebody to represent me, in a word repugnant. I can go in and talk to management anytime I want to and they will listen to me.
I find it scary that if I were in a union and they decided go on strike/work stoppage, even if I didn't agree with the rest of the union, it would affect me directly. This is the flip-side of the coin, if their interests did not represent mine, my voice would be silenced.
Unions cannot stop me from getting laid off, so what's the point of wasting money on dues?
Maybe it's the Texan in me, but I just don't cotton to other people "representing" me. I like to do my own negotiations
Folks
Unions don't help in the long term. They are for profit organizaitons that use harsh tactics to intimidate both employers and union members. I've seen this done for over 10 years. In other trades that my family members belong to.
As a developer, I strongly feel we need representation that will not cost us a dime! We need a guild that will represent our needs. A non profit organization that will be our voice.
Unions don't work. Only the tatics employeed by unions work. Unions encourage their memebers to perform illegal acts against a company when certain working/contractual conditions are not met. This is not good for our economy nor is it good for the future. Large IT companies will go offshore and hire unskilled laborers, programmers etc.. to do the work that can be done here in the states.
Don't be against some kind of organization, make sure you think about a guild, that doesn't profit from our hard work. We need some kind of a foundation. Something like the Free Developers Guild (FDG), Free Network Engineer's Guild (FNEG)
etc...
The Guild's can force companies to make working conditions better etc.. by notifying the media, political representatives etc..
The Guild's will never engage in illegal activities, like sabotage(sp), violence against employers and employees.
This what we need to work for.
Peace
James T. Romano
Don't look for a needle in a haystack. Look for a needle with other needles
As you'll find in the SEC filings of almost any public company, the primary goal of a public corporation is to improve the value of the company's stock for the shareholders.
My primary goal is to give myself and my family a good life.
These goals aren't always compatible. My job (sysadmining) requires that I work long (10-15 hour) days in uncomfortable working conditions. Pay isn't an issue. A senior UNIX sysadmin doesn't want for money.
As far as the hours are concerned, the only thing that can change the situation is if there are more qualified sysadmins in the market, or of my company stops growing.
As far as the uncomfortable working conditions are concerned (sitting on my butt in an over-crowded cubicle since we have no storage space), the only thing that could make my life better are improved ergonomics. Since my company isn't required by OHSA to do anything about the ergonomics of my workspace until after I'm already in pain, they're not going to do anything.
Right now, the only weapon is leaving or the threat of leaving. What kind of weapon is that? For the first three months at my next job I have to pay COBRA rates for heath insurance, I have to completely adapt a new environment to my suitings, and at the end of it all, I'm just working for another company for 10-15 hours a day, in cramped and uncomfortable work spaces, in a sea of cubicles so noisy that I can barely concentrate on my work.
I want better working conditions. I want better hours.
For as much as Americans believe that their's is the land of the free, you live in one of the only places (if not the only place) in the western world where you do not have this right by law.
No American law prohibits the formation of a union.
Dancin Santa
If not, then my response to the suspension would have been a hearty "bite me...fight your own fires."
"Rub her feet." -- L.L.
Manager Says Union Not Needed
This just in. In an important new development in labor relations, managers at leading firms have determined that unions are not needed. Despite widespead speculation by management that this was the case, positive proof was lacking until recently. An executive at a leading technology firm, Cobalt, was quoated as saying:
"Because clarity on issues like this is important, we have updated the Employee Handbook expressly stating Cobalt's position that a union is not needed here,"
When asked about safety regulations, taxes, reports to stockholders, and equal rights; management had no specific comment other than that they were "cautiously optimistic".
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
Unions are the reason we pay so much for cars out of detroit.
If the computer industry unionized, the price of computers, parts, software, etc., would skyrocket.
As somebody said, people get paid $35 an hour to perform menial tasks. What do you think the biggest expense is in building a car??
Could the computer industry survive a rise in prices due to unionship? Would we want that?
I don't know about you guys, but I like paying $130 for 40G Hard drives. I can remember paying $300 for a 100M Hard drive. I have no desire to go back to those kinds of prices.
My skills are in demand currently as a developer. I can spit and find a great paying job. I am not worried about someone else taking my job. If my job is eliminated, I get a week or two off while I go get another one. Even the lower paying salaries in my field are damn better than most. In my field, with one major project, I can GET NOTICED by the CEO or upper management and given more responsibility and thus, a raise. I have the freedom to move from job to job if i want, always increasing my yearly income until I retire. I work for a major southern Telco and the people that started out here 30 years ago are amazed that people move up so fast. They remember when it was normal to stay in one department for five years before moving up. Now, the rate of advancement keeps climbing, especially now with the incredible demand for skill developers.
With a union, all of that changes. You know when your next advancement is, because its in your contract. You don't have the freedom to jump around, especially if your entire career sector is unionized. You certainly can't volunteer to accept a new responsibility because somebody else may file a grievance with a union if they feel you are encroaching on their job. Even if the jobs are disimilar, its like a protracted court case. Do you have the time, energy and money to fight that? And what if your union strikes when you feel in your heart it is wrong? You must strike or quit. Because crossing that picket line can get you blacklisted in other jobs that fall under the same union. Scabs are not to be suffered. So therefore, you change careers or starve until the strike ends. Remember the UPS strike. Not everyone in the union wanted to strike, but they had to because to cross that picket line was to risk threat of injury to yourself or family, or to your career.
At the major Telco I work for, the customer service and technical support people were complaining about their jobs. They wanted to unionize. Nobody could understand why, it seemed they just wanted to complain about working at the low rung of the IT ladder. Its a crappy job sometimes dealing with the public. These people started out at least 30k-40k, got two weeks of vacation, free medical, personal and sick days, bonuses, discount stock purchasing plan, free tuition toward training, a FREE MBA in business, a free cell phone and a whole slew of other benefits. This job rocks as an entry level! And all they did was answer the phone and provide technical and customer support or answered email. Not a glorious job in IT, but hey, we all have to start somewhere. I did, and 3 years later I make over double in salary with a cushy office job developing web pages. I can go where ever i want now. But these people wanted to Unionize over some perceived threat by management. What they didn't realize was, that once they start union proceedings with the company, all bonuses and benefits freeze, for the entire company until a contract is agreed upon. Do you think the rest of the company is going to be happy with them? I doubt it.
The point is, the thought of a union in my field is scary and disconcerting. Those who want protection for their jobs in the IT field are usually those who don't have the skills to find other work if they suddenly are the victim of downsizing. I'm sure I'm painting with a broad brush, but I have the power to bargain my own contract, not rely on some organization who is going to tell me when I will advance and what I can't do as part of my job. The fact is, if you have the skills, you don't want for a job. The job wants you.
At the same time we all know politics is dirty and yet we all love to point out how dirty it is.
There's always sufficient, but not always at the right place nor for the right folks.
In my juristiction (and pretty much everywhere, AFAIK) there's absolutely nothing an employer can do about a union. They either accept the contract, or they don't do business.
And since the union pretty much decides who gets hired/fired, you'd better not talk to loudly about disolving it.
Cheers,
Rick Kirkland
Anyone interested in unionization or revolt against their capitalist masters should read George Orwell's "Animal Farm".
Workers of the world, unite. You have nothing to lose but your chains.
What the union organizers won't tell you is that you're only trading your chains for their chains.
Unions cause poor quality and regimented, unhappy workforces by promoting conflicts between managers and employees, and by pushing for stupid work rules that cause overstaffing. As a consumer, I want nothing to do with unions but am forced to deal with them (airlines, telcos, public sector). As an employee, I don't want any part of such activity. If my company treats me badly, I'll quit and go somewhere else - I'm confident in my skills.
sulli
RTFJ.
So most of you are coming off the greatest economic boom seen since the invention of cross border sea trade in the Mediterranean with the Minoans. And so most of think that either bad things can never happen to you or bad things can't happen.
tsk tsk tsk you poor innocent children. Let me educate you.
You work a bunch of hours now and say it's ok because you feel you're being compensated for it. Look out into the future. You're now older, have more responsibilities are expected to work the same or more hours and since the Great Downturn of 01 you haven't had a raise or much of one for 6 years, your job is less stable than ever and your CEO just cashed out to the tune of $100 million dollars because he/she train-wrecked the company the likes of which we haven't seen since Mike Armstrong managed to take ATT the most powerful monopoly in the country and screw it into the ground.
There's a new crop of freshly scrubbed help desk meat coming the door and they are grateful for the opportunity to get shit and shot for a few months at maybe 60% of what a geezer like you makes. But still you're confident. After all you're the greatest fucking programmer since the invention of hex and as long as the company keeps making the doorways big enough to fit your ego through you're good to go! But what's that sound - OH YEAH the phone's ringing and your manager wants you to sit down with a consulting company to give them skill sets and develop requirements for the new programmers that are going to be outsourced in Ireland and India. Yeah I know - tough break, you tried to get all those H1B's in the door at start your own internal group but you couldn't get the numbers and REAL AMERICAN programmers cost too much. You want to fork back your equity to pay for them?
So you passed on the management track to 'Stay Technical' and now you're not in a position to decide your own fate. You the alpha nerd are now the target of every cost reduction scheme. Dozens of other alpha nerds and nerdettes (AN/AN-F) are looking over their shoulders hoping its not them that gets the ax. All of a sudden project status meetings stop. You can't decide if its because the projects are dead or simply because managers are afraid to share any information with each other anymore. Sr. Team leads are 'encouraged' to look for savings in their own ranks. Remember 1 AN/AN-F = a multiple of baby nerds so you have to decide do you toss some qualified experienced bodies on pyre or do you commit the children to the flames. Either way, the only way out is up the chimney. 3QTR analysts hammer the stock and your options are officially so far under water you'd need the Glomar Challenger to get them back. Now you become aware that the work groups have been informally broken into 2 factions. The An/AN-F's and a junior group headed by new junior team leads who are going through the same exercise as you, looking for places to carve flesh. Flash forward. It's the next day and whole development group is scattered in a bloody heap. Scraps of bodies here, carnage, gore, goo over there. All killed off in a paranoid orgy of hate mistrust miscommunication and manipulation. The executives that are left are bought off to the tune of millions, the development assets are sold off to the offshore company and company ceases to exist. The workers did the knacking job themselves because they had no power position in the company and no stance from which to apply leverage to management.
If you think this story is scary just consider that it is true.
Being from Detroit (the home of the auto industry) and having a good number of family and friends in the industry, I can tell you that this is simply not true. Tomorrow when you get in your car and it doesn't explode three times on your way to the office, be thankful that your vehicle was assembled by people who are skilled and take pride in their work. Yes, it's repetitive, but so is designing and building apps that all look like nothing more than modified spreadsheets. And yes, there are those who do fulfill the stereotype, but there are slackers in every working venue in every industry -- look around you, for cryin' out loud!
I disagree. The reason your car doesn't explode is because it's engineered that way. I am honstly awestruck when my auto mechanic friend pulls parts out of a vehicle to repair and they are in such a state of disrepair that you have to shake your head... I mean if your CV joints go, they usually cripple the vehicle instead of locking up and causing an accident. If your tie rods go... well then you're fucked but usually these things are built such that when a piece dies, it dies gracefully. I would hate to think what vehicles designed by web programmers would do.
Back to the point: I am not disputing that your relatives are dedicated, hardworking people. The thing I'm disputing is that that has anything to do with the vechicle not working when it gets out. Auto plants are built with so many checks and balances that bad product just doesn't get out of the place: It's either reworked or scrapped. Take a moment and think about the ratio of QA-related tasks to actual assembly tasks and you'll see what I mean.
If a job requires a level of skill then pay for it. Don't pay the twitt stamping out metal pieces $28/hr to watch a machine work and take the product and put it on a shelf for post-processing. That is promoting mediocrity. Make him responsible for making the product good (maintaining the machine, etc.) or pay him minimum + seniority. That's my opinion, anyway.
A lot of folks are speaking out against this because they don't see a need in the high tech industry - they have technology skills that are giving them a good living.
However these unions are not aiming to organize the highly skilled professional - they are aiming at the thousands of lower skilled workers in the technology industry - the customer service reps working phone banks, the warehouse workers, etc.
These are people who are often forced into very poor working conditions, sometimes with little regard for such niceties as pay above minimum wage, sick leave, and so on. If you are such a worker a union can be a positive.
Management that comes out in a aggressive manner to fight a organization makes me wonder why they feel the need. If a company is treating it's workers well, they have no incentive to organize. It's the companies that are treating their workers shoddily that get organized.
Keep in mind that unions establish minimums, not everybody gets paid just the minimum. I'm a member of the Writers Guild (movie-television industry), I get paid considerably more than the negotiated minimum as do most of my friends. There are union members who get millions of dollars per screenplay -- but no member gets less than the minimum. I also get portable medical insurance, residuals (wouldn't tech workers like to get those?), a retirement plan -- this for %1.5 of my paycheck). I'm still totally freelance, going from employer to employer every few months. On the other hand, the entertainment business has very few employers.... so the tech industry may not be ready.
4. A lot of anti-union people scream "I'm too good for a union - unions are for idiot construction workers." But many industry that depend on highly skilled labor are highly - pilots, aviation mechanics, teachers, athletes, actors. It obviously works for other "knowledge industries".
You are kidding right?
They are very greedy. Let's look at teacher's unions. They are against standards for teaching and for performance based evaluation. As a result of their "union" power there are a vast majority of teachers that suck and don't give a piss about their students.
What really needs to happen is there needs to be more recruiting on the part of Colleges and Universities for their tech programs. What you see happening with a vast majority of tech companies is that they end up making their employees work overtime to compensate for the lack of qualified professionals. I know this is a major problem with Amazon, as my friend's fiance works for them and is constantly working overtime every single week, and not just a couple hours. As long as this continues in these types of companies the tech companies will continue to burn through us tech geeks.
I am against unions for one particular reason, and one alone. In the end once the "good work environment" becomes a standard it will the be about the Union's interest and not mine. Right now if I am not going to be treated well, as someone has so deftly stated I can go elsewhere for work, and usually an increase in salary.
Evry industry is nearing a effective monopoly or oligopoly - they collude and 'palm push' at the top, setting agendas for everyone.
Havnt we all heard of the WTO? of the WIPO? FTAA? etc etc? What is happening is the Capatalist System is hitting a peak. It takes money to make money, and TransNationals are realizing it is easier to share in profit than really compete. Have a look at the auto-industry.. seen any real innovation, anything 'market shattering' there in the last 30 years? No.
The barrier to entry for a worker is at the bottom - and their is no effective difference (in inherent rights or ablity) between one person and the next (outside skills which im sure we could argue werent that varying). Where as _any_ business is being 'sown' up these days - the barrier to entry is skyrocketing in almost every sector. What this leaves us is with one group that can set demands very effectively to the other (Business to Person).
My point? Well, when we realize that the 'free market' for employment is really not 'free' at all - that we are all forced to operate in a climate where their will always be someone willing to do your job (just as well) for just a little less (or another interview-ee willling to accept a little less) labour will realize its only opportunity is to try and work together. TransNationals are certainly doing it - people have nearly zero bargaining power in the employee marketplace.
Some people are going to pipe up saying "I make $120K a year - and could walk away into another $150K job in a week": I say good, but right now times are good for everyone, dont kid yourself - when 'times get bad' you'll wish you had any job at all. The TransNationals make money even when the economy is crap, and be certain: The transition to 'outsourcing' and 'contract employees' and its ilk will assure that when times appear they might get bad, all the really ruthless TransNationals will start chopping people left and right... it has to do with being nimble and having a more disposable workforce.
Workers of the World Unite!
One of the biggest problems the unions have had in breaking into the tech sector is most tech workers (rather correct) assumption that unions protect workers regardless of ability and productivity. They rely on seniority and other nonsense. These things don't fly in the tech industry. More ability and productivity = more pay. It should always work this way. Unions have never been structured to handle this.
This applies in tech and just about every other industry. The perfect example is my grandfather. He worked for Stanley (the US company that makes tools) way back before they were a union shop. He was a tool and die maker, dealing with 1/1000ths of an inch daily. He had good steady hands and a keen eye and could fix just about everything in the shop. He was a higher level tool and die maker because of his abilities. Then the shop unionized. He and the other high-level makers got pay-cuts, so that the lower-level (and lower-skilled) tool and die makers could get a raise and make the SAME money that he now did. Gone were raises, promotions and perks based on ability. Now things like seniority mattered. The work suffered, the tools suffered, and it was never the same through the rest of the time he worked there. But it was considered *OK* because now everyone made the same money and even the unskilled tool and die makers were now *protected* from the evil company that only wanted to make a buck.
You had to see his face while he told this story to fully comprehend it. He used to love his work, before he was in a union.
Portable versions of Firefox, GIMP, LibreOffice, etc
Nowadays, unions serve to enable employees to exploit employers.
Unions are a great way for a group of paint-sniffin' dropouts to use strongarm tactics to get more than their fair share out of life.
Considering that most tech folks (especially programmers) are wildly overpaid, I don't think they'll need to resort to union tactics anytime soon.
Slashdot: come for the pedantry, stay for the condescension.
After viewing the wide array of "Unions suck/Unions are for the lazy" posts here, I figured I should throw in my Cdn$0.02.
A couple years ago, my dad and another firefighter were suspended for speaking out at a town council meeting. The volunteer department found out through a 1-inch town newspaper item that their ladder truck was being farmed out to a nearby large city for a while, despite being told four weeks before the truck was staying in town. The firefighters had serious concerns about farming out the truck; the town has several tall buildings on the south end, and the ladder would have been moved to a department a good ten minutes away from where they normally were. The chief, who was involved in the decision to transfer the truck, said nothing about the decision to the crew.
At the next town council meeting, most of the department showed up. One firefighter, a lawyer, spoke for the group in front of the council about their concerns, both about the transfer of the truck and the secrecy in which the deal was shrouded. Despite being very civil and calm, the council ripped him, then called the chief up to back them up. After he was done speaking, he nearly ran out of the chamber. My dad followed and had a somewhat heated conversation with him. After the council meeting, my dad spoke with media that were on hand.
A couple days later, letters were delivered to my dad and the other firefighter. Indefinite suspensions! For speaking! My dad might have been suspendable for arguing with the chief, but the lawyer/firefighter was clean; there was no reason to suspend him. After a month, both firefighters were brought back on board. Soon after, some of the firefighters started looking into organizing. Despite several attempts to avert the organizing by the chief, the fire became a member of the Teamsters, and the first organized volunteer department in Canada.
The union wasn't brought in to increase wages, or let the firefighters be lazy; on the contrary, lazy people don't risk their lives around open flames on a regular basis for fun. They were brought in to preserve job security, to ensure fairness in disciplinary situations, and to ensure the firefighters have a group to defend them should the town try something stupid like that again.
So, yes, unions are still sometimes necessary in this age. If nothing else, tech workers might find them useful in making sure they aren't overworked by fly-by-night dot.coms that are likely to end up on FuckedCompany.com in the near future.
Much like big corporations, unions aren't all bad.
Someday, you're going to die. Get over it.
My father belonged to a union at one time. It is a pain to pay in the NOW, but in the future the union protects jobs. If not a new person can take you job making severely less then they pay you and they lay you off because it is cheaper to higher him then keep you. see my logic? If you work at a company for 10 or more years this is useful...because you depend on that job!!!!!!
"Before God we are all equally wise - and equally foolish." -Albert Einstein
Unions are a solution to a problem... However Unions have extended themselfs so far they try to insert themselfs when they are NOT nessisary. The inherent problem with Unions is they can wreck ideal working conditions.
Ask yourself... Can you leave at a moments notice and tell your boss "Go stuff it"?
Ask yourself is your boss working with you?
If you can answer no to both then you should consider a Union..
Look at the tech industy today. Attempts are made to lock employees in. Skilled workers are very valuable.
Unions will NOT prevent the insain work contracts that give away your work to the company. They will not protect your rights. And while they are at it they'll nuke your perks.
At the bargoning table everything can go. Unions are known for trading off better pay for other stuff and managment will just fork it over so they can own everything you code.. and add additional rules like you can't have a personal computer of your own.. You can't have your own website.. you can't go shopping on-line..
If you can quit at a moments notice you allready have more bargonning power than any Union can bring you.
The only power a Union has is for one guy (who really dosn't know what your problems are) to pull your entire work force.
It's a very blut tool and this isn't a blunt problem...
No I don't want to sign away my rights to my code or be locked out of work for a year. I'll work some place else if nessisary. But I won't sign.
Hell I don't even sign NDAs.. and they aren't that bad.. but I can chouse not to..
With a Union it's all or nothing... most of you will sign reasonable NDAs.. Would you like to lose your friday pizza so that "I".. the only idiot who wants this... dosn't have to sign an NDA? Do I want to be forced to accept an NDA becose NOBODY ELSE cares? See the problem?
It's for major issues... like my freaking life is in danger becouse I'm working next to a lithazic acid poison cannister that is breathing into the work space.. That level of stuff..
It may not be so blatent.. made to work when sick.. not given a proper amount of days off so working hard when not quite awake.. dangerous work conditions becouse fellow employee running fork lift was working 12 hours non-stop...
Unions are a good thing. Security guards, Supper market staff, oil refinerys...
Thies people are far to easy to replace.. Individually they can be thrown away.. as a group,... a union.. they get decent working conditions and decent pay...
But the tech industry is getting far better than decent working conditions with far better than decent pay..
This isn't an industry that needs a Union... It's an industry that needs less managment.. not more...
I don't actually exist.
Chances are that if you're being offered stock & options, you aren't at one of the many companies who are screwing their employees big-time, so why would you want to strike anyway? Striking is for those who are being screwed by their employers, i.e. those that aren't being offered stock, don't get compensated properly for their many hours overtime, etc. And it happens more than some people here care to realise, many seem to shrug it off with "I'm such a damn brilliant amazing programmer that everyone is just offering me really amazing jobs all the time etc etc." Come on .. who are these people fooling? A "great-sounding job offer" is not the same as a "great job" - job offers are supposed to attract you - they almost always sound a lot better than they really are. And sure, salaries are super high in silicon valley, but then so is the cost of living, so you blow a lot of it on rent etc anyway. And while there may be a lot of demand in Silicon Valley for skilled tech workers, the situation is NOT the same elsewhere in the states - there are places in the States where it is fairly difficult to get a tech job, and you *can't* just walk out of any job and walk into any other job you want to, anytime. The same everywhere in the world.
Sorry .. went into a bit of a rant there .. :)
"They only make sense for people to stupid and unimaginative to know they can walk away from a job and join a competing company or start their own company if they don't like where they are"
Firstly, not everybody WANTS to start a company (duh) - quite frankly, thats much harder work and longer hours than a 9-hour a day programming job. Secondly, not everybody is in a situation where it is at all possible to just walk out of their job and walk into a new super-amazing spiffo job tomorrow - if you don't happen to live in high-cost-of-living silicon valley, there are many areas in the States where the demand for skilled tech workers is very mediocre. And, believe it or not, not everybody wants to move across several states just to get a nicer job.
Speak for yourself. Consider, just for a brief moment, that maybe other people have different situations to yourself.
... But I am positive that this is what every union in existance has started with.
And if you think you can just LEAVE for another job, think again. The dotcoms have fallen. The party is over.
Only for the people who have no skills and aren't living up to what they said they could do. I'm a pretty damn good embedded systems designer (HW+SW) with "enough" skill in DB and IT to get a decent paying job no matter where I go. The party is still in full force for me, and will likely continue to do so until I decide I don't want to play anymore.
Folks, we're overlooking who we are. We are the people who make information happen. Information is power, if used correctly. A dot-com tech workers auction site (tech workers auctioning their services to employers) in close conjunction with a F*cked-companies type site is the thing. The real ly neccesary thing about the auction board is that it needs to be open bidding (all bids public) and all resumes public (except for personal info- name, address, etc.). This is how it works in a physical auction, from Sotheby's to a farm auction in Amish country. The potential bidders get to look at the item (the CV's are openly published) and the bids are repeated aloud by the auctioneer (openly published on the site). As long as workers post followup info to both sites ("Yeah, i took this offer here, and it is as advertised and the company is just great" or "I took this offer and got hosed this way and that way") and followup if the worker and company part ways, the system should work fairly well. Early adopters on the worker side are going to have a bit of a hard go, but so do all early adopters. Might work, yes?
It's almost irrelevant nowadays, if an employer here said "You have to work 12 hour days, 6 days a week". You can bet they'll have problems filling the position if they aren't putting up the money (and a lot of it) for something like that.
The problem with tech support, is every company does it differently, using different platforms, different applications, etc. It would be very hard to have some kind of "guild system" when you have such a large variance in that job. Tech support isn't something that you can train 5,000 people the same way and then send them off to 100 different companies and everybody's happy.
And different companies do it different ways. Some companies have large databases of tech info, and if a customer calls in, they ask a question, the operator (for lack of a better word) types it in the database, the database spits out an answer, and they give that to a customer. Others, smaller places usually, the tech support personal who answer the phones are expected to know a lot.
Every company does their own thing, and a guild system would not work in that situation.
As far as unions in tech industry as a whole, the biggest obstacle, is the fact that we, the workers, are the ones who control our lives, so to speak. If I don't like a company, I'm not going to go bitch at some union rep who makes more than me about it, and expect the union to strike, thereby causing a lot more tension, and in some cases, problems for both the company and myself.
If I don't like a company, I switch jobs. I have had half a dozen friends in the past year here in Austin do it, and they have all gotten much better jobs with little effort. Maybe most other places are not like that, and jobs might be scarce, but hey, you go where the work is.
I would never join a union. I would never work someone where many of my coworkers were in a union.
My explanation about why I hate unions is best given as an example. I worked at a large company where all the maintainance/construction people had a union. Anything that was their job, you would get in serious trouble for doing - for example changing a lightbulb or emptying a garbage can. I saw a lot of laziness from these people, but the example is the day I saw 10 guys digging a ditch. They each had shovels, but only one person was digging at a time. They would dig for a minute while everyone else watched, and then switch to someone else. Complete laziness.
It may only be a matter of time before everybody's management gets their act together to suppress developer wages. I'm not saying they would be wrong in trying to do so - that's their job, minimize expenses.
It's happened before -- back in the 70s there was deliberate industry plan to train all sorts of unqualified people as COBOL programmers (Don't laugh youngsters -- COBOL used to be the standard for internal development) This was very successful in depressing programmer wages. Of course most of these retrained secretaries were laid off when COBOL went out of fashion in the 80s, and then the real COBOL guys had to come in and clean up the mess for Y2K, but from what I've heard it really sucked to be looking for programming work in this period.
Another analogous event happend just in the last couple years with the MCSE debacle. Hard to believe, but in the mid-90s, NT admins were actually paid higher than Unix admins. But after the market was flooded with lots of imcompentant book trained people, NT system admin is probably the lowest paid ops job in the business.
So, it's easy to think that one's skills are sharp enough that they are immune to these sorts of tactics, but just remember It Could Happen To You. Even if you are 100x better than those other guys it does make picking up the phone and getting a better/higher-paying job harder if the market were to be flooded with people that look similar to you on paper and charge half as much.
--
Business. Numbers. Money. People. Computer World.
Do firefighters on a volunteer department get paid anything more than a token stipend?
About $20 per call. Since the department's coverage area increased a year ago, there have been a lot more calls.
Was this your father's primary job?
No, he's also an electrician at a Big Three auto plant (here's a hint; one of their concept cars, debuted at the Detroit Auto Show, runs Linux).
If not, then my response to the suspension would have been a hearty "bite me...fight your own fires."
And then it would have happened again to another couple firefighters. These guys see it as a duty; it's not exactly fun, but they do it anyway. My dad's been doing this for 25 years, and it's only in the past two or three that the town has started trying to pull crap like this. They felt it was better to organize before things got too bad, rather than let the morale of the entire department be tanked by a bunch of politicians. All, except for one vehemently anti-union guy, backed the union drive, because they all knew (from watching it happen live, in person) it could just as easily happen to them.
Someday, you're going to die. Get over it.
My brother is 5th generation sheet metal worker and so are my cousins, needless to say it is a family tradition. They are not teamsters or just general labor. To become a journeyman you have to go through the apprenticeship program that lasts four years. During the day you are assigned to a journeyman and 3 times a week you go to class to learn things from bending a flat piece of metal into anything you can think of to drafting and cad. I feel the IT industry could learn from this approach, the union could handle things like training, certification, and maintain professional competence. This approach could also eliminate the need for a bunch of certifications from different organizations and companies by bringing standardization. As it stands now either someone has a degree or they have a wallet filled with certs and everyone knows how qualified a MSCE is, or better yet, the ultimate ubergeek "The A+ Certified Tech." Who knows maybe I'm being an elitist.
On the benefits side, I like my company but I would rather have a decent matching 401K like the rest of my family. Stock options that are just an incentive to make me work harder because I am an owner of my company but not a big enough shareholder to change my work environment. And on the statistics side of things union workers make more money. I had a decent childhood we had vacations, nice clothes, safe neighborhood, and strangely enough my mom was a housewife in the 80's and 90's.
Travis
Although I am clearly biased on this point, I just dont see any other need for a tech-union, perhaps someone else can enlighten me on this issue.
1. Any group has more power acting cohesively. Imagine how much money we could pull in if we had real bargaining power with all the companies in the industry. Imagine if all the programmers in the US refused to work for less than, say $55,000. Free-loaders wouldn't be justifiable anymore, and anyone who was good enough/hard-working enough would be even better. Look at pilots - they're less bright than coders by a lot, (I speak from USAF experience), but they're highly skilled and unionized - most airline pilots bring in $100,000+ for doing a job that's substantially less challenging than writing complex code. Did I mention they have unions?
The problem is that right now we're settling for less than what we should expect. There are some fabulously profitable companies out there. But all of that money was made by coders, who got a generous amount of money, but in all honesty deserve more.
2. Tech companies haven't been above screwing employees. People get let go a couple weeks before their options come due, often for fabricated reasons. H1-B visas get rammed through Congress to drive down IT salaries. Imagine if the Big Three automakers tried to import tens of thousands of foreign workers and then pay them substandard wages!! It can only happen in IT.
3. Marketing practices of today may become labor practices of tommorrow. If a company is willing to screw consumers with "content protection" do you really trust it not to screw its own employees?
4. A lot of anti-union people scream "I'm too good for a union - unions are for idiot construction workers." But many industry that depend on highly skilled labor are highly - pilots, aviation mechanics, teachers, athletes, actors. It obviously works for other "knowledge industries".
5. Technology unions probably would be different than old-school unions - it would have to be easier to get rid of people, since it's easier to freeload than it is in manufacturing. Contracts would probably be shorter term, grievance procedures would be streamlined/scaled back, working condition issues would be much less important, etc.
I know of *no* industry where unionization has decreased wages or really adversely affected employees.
...and I for one know what C++ is. I agree with you position on unions, but come on, Biology majors != dumb. I would love to see you try and recite the stages of RNA transcription and all the fucking enzymes that are involved! Just because they didn't go into CS doesn't mean they are stupid. Liberal Arts majors however are a different story...
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
...and it's also a symptom of collective brainwashing.
There is obviously a problem with the fact that, in such a wealthy country, most workers do only have two or three weeks of holidays, a neanderthalian protection in case of disease, and very few days (sometines no days at all, they are considered as "sick days"!) for a woman who's having a baby.
I'm sharing my life between the US and my native country. In my native country (it shouldn't be difficult to guess where I come from), I have 9 weeks of holidays/year, I will get my full salary even if I'm sick for a very long period (that is, much longer than the number of "sick days" in America of than a short-term disablility period -during which you usually lose 25% of your salary in the US-), my wife will strop working three months if she has a kid and get a full salary (she'll even stop 6 months starting with the 3rd kids), etc... I'm not saying it's a panacea, nor that it's not going too far. I'm saying that America is scandalously backward on these issues, because everything has to be sacrificed in the name of competitive business.
In the name of economic competitivity, a preoccupation which really has become hysterical in America under the Reagan-Bush era, American workers have accepted the most extreme sacrifices on their working conditions, their free time, as well as their retirement and healthcare systems. This truly is brainwashing, and could not have happened if strong (and smart, which apparently was the problem in the US) unions had been there.