Slashdot Mirror


Dot-Coms Say 'Unions Not Welcome!'

subbiecho writes: "Automotive related e-biz software company, The Cobalt Group, has spoken out against unions forming within their ranks, in this article. Cobalt Group CEO, John Holt sent an un-prompted e-mail to workers, alluding to Amazon.Com and other companies undergoing organizing drives, saying he preferred a "direct dialogue" with employees. This adds more fuel to the fire of pro-union supporters in their attempt to build a cohesive technology workers union."

405 of 405 comments (clear)

  1. Union YES! by jeff13 · · Score: 1

    I like unions better than yer boss!

    Example:

    Your sitting at your desk on the tech support late shift. Your manager comes to your desk and states:
    "Get your stuff.
    Get out.
    Your fired".
    Why you ask?
    "Because our a hacker".

    No police, no explaination, no job.
    Bullocks? F**k you, it happened to me. I had to leave the city I lived in and it took years to pay my debts.

    I've read the posts here and you are all pretty much anti-union. Are you lot completely ignorant of labour law?
    You'd better learn how to beg.

  2. Re:Unions = No Motivation To Perform by jeff13 · · Score: 1

    You're quite correct. Unions are FAR from a perfect solution to the problem of Employer relations.
    But I'd still rather be in a union than letting some jerk manager decide who and who isn't the best worker.

    See, your Grampa seems to forget that the important thing here is that the families of ALL those people got fed. You're here aren't ya?

  3. Re:I support Unions for the tech industry by Neumann · · Score: 1

    Interesting reply. All through the article you tell us how you are spending money then at the end you complain that the original poster was just focusing on money?

    The simple truth is this: If you wanted to save a lot of money you could. You dont NEED to live in an apartment on your own, you could have roommates. You dont NEED to eat out several times a week, you could pack a lunch. You dont NEED a quality car, you can get a cheap $500 disposable one.

    If you are using your kids and house as an excuse to keep from getting a better job, that is YOUR problem. Life is change. The sooner you realize that and your kids realize that, they better off you will all be.

  4. Ah, ignorant quotation of history. by Ubergeek26 · · Score: 1

    Labor movements were started as a result of unsafe working conditions, or because of unfair child labor laws. In those days Unions served a very good purpose. No how many tech workers do you have to worry about falling into large vats of molten metal, or having their fingers caught in machinery (daisy wheel printers don't count;D). Very few.

    You use the term laissez-faire. One that is almost always linked to Socialism. So what did we really learn from history about Unions and Socialism. Both start out as good and well intentioned concepts, but both suffer greatly from greed. While the needs of leaders of both are oft times met, the needs of those that the leaders serve go unanswered.

    Want a good example of why unions are obsolete look at the News Printers Guild that went on strike in Seattle. Boy that sure put a stop to the Seattle Times and Seattle PI. In fact for a while both papers were given away.

    History as you can see has proven time and again that "laissez-faire" or cynical ideologues are usually right because they rely on reality and not a fatasy that will never happen so long as greed exhists

    If the next big recession hits there will still be a massive need for people to maintain exhisting computer systems, even if the companies that hire those people may be hurting financially.

  5. One good thing about being me... by MxTxL · · Score: 1
    I'm sure a lot of you feel the same way... one good thing about being me is that i am damn good at what i do.

    I am not worried about the influx of foreign labor. I'm not worried about the trend for our universities to put out too many CS majors that will very soon flood the workplace and invariably push down salaries. I'm not worried about huge mega-corporations and their monopolies.

    Why?

    Because i'm damn good at what i do. I can program a computer as well as anyone i know. If someone can do it better than me, I am glad to learn from that person and assimilate the new material. I can hold my own in any discussion on tech, and add something meaningful to the discussion. I can do things that would blow some people's minds.

    In our new computer-centric world people who can make computers do their bidding will always be in demand. Computer technology is not going away, there will ALWAYS be a need for programmers.

    I am damn good at what i do, this being the case, if i'm better than 99% of the unwashed masses of other programmers, i will always have a job and i will command the salary i want. This is true no matter what happens.

    Anyone who would want to join a union just isn't confident in his or her own skills. If you are confident in yourself and you are absolutely the best you can be, always striving to be better you really have nothing to worry about.

    Why on earth would you subject yourself to a set salary and seniority benefits that a union would impose? If you feel that it's good to be you, you shouldn't need that crap.

  6. Re:Unions are needed. by No+One · · Score: 1

    What do you mean the ONLY way? Nothing is preventing workers from getting together on their own and approaching their employer.

    Uh, what exactly do you think a union *is*? I't a group of employees getting together and presenting problems to their employer.

    --

    --

    There is no sin except stupidity -- Oscar Wilde
  7. Re:Amazing... - Pilot Pay by hfcs · · Score: 1
    Look at pilots - they're less bright than coders by a lot, (I speak from USAF experience), but they're highly skilled and unionized - most airline pilots bring in $100,000+ for doing a job that's substantially less challenging than writing complex code.

    Actually, no, very few professional pilots bring in $100,000. The seasoned vetrans with 25+ years of senority might, but the vast majority make at or less than public school teachers. (Coming from someone who has friends who are pilots). It takes 5-10 years for most of them to break $30,000. And it's kinda apples to oranges to compare coding creativity to the potential for stress and the responsibility that comes with being an airline pilot.

  8. Re:We need to unionize, why? by IronChef · · Score: 3


    I have a friend who works at a California university. There is some kind of union present on campus. He has a tech job, and is not a union member, yet is forced to pay several hundred clams per month in union dues. The reason is that it "isn't fair for him to receive the benefits of union representation without paying."

    He has constant disputes with the pointy-haired management, has a hostile workplace and a pack of other problems. Naturally the union does nothing for him, but he can't say, "don't represent me, I want nothing from you, and I don't want to give you any money."

    It should be illegal to extort money from non-union members in this way.

  9. Re:Unions suck. I'll quit if forced to be in one. by Anonymous Coward · · Score: 3

    It's unfortunate that so many of the people who are responding to this issue are completely ignorant of any history prior to the times of their own lives. The mere fact that we have weekends, vacations, child labor laws, minimum wages, basic safety standards in the workplace etc, etc all stem from the labor movement over the last century.

    The notion that a skilled person can always go out and get a different job or create one not usually true. Before the "Great Depression" most skilled craftmen, which is what software engineers are today, were treated very poorly. So were academics.

    It's stange to read postings by mostly technically trained people who are so attached simple minded notions like free markets and corporatism! I wonder how many such folks are born again Christians or how many could distinguish between the Vietnam War and the Peloponnesian War.

    The pleasant conditions the most software engineers enjoy today are not necessarily going to last forever. The quality of software is generally poor even though we are well paid and engineers have little control over either the quality or purpose of the software they create. I suggest something like a Union of Concerned Programmers, at least for a start.

  10. Many good point's mentioned... by onepoint · · Score: 3

    Many good points mentioned above. But my history with unions is awful.. case in point.

    I got a job at a medical manufacturing plant from a buddy of my dad. They put me on a machine that was producing 720 units per shift and i was told that's all it could do from the foreman. So what did I do, I spent that night reading the instruction book for that machine. The next day I had the sucker producing 2700 units in half of my shift time. The foreman patted me on the back and my car window was smashed. My dad's friend told me to slow it down. So what did I do, I got the sucker down to 900 units per shift, got yeld at by the foreman, got my locker broken into ( lost one hell of great book), and had a wiper blade broken. All in 3 days.

    So the end of that week I deciede to take my revenge on the entire union. I got the manuels for most of the plants presses and machinery ( plant was closed on sundays ) and wrote a 27 page memo to the president of the company. Come tuesday, I hit my machine and have it running at full speed, the next machine at full speed and 3 other machines running at almost there top speed. Total production I was told was about 13 days worth of output. I was smart enough to leave 1 hour before the shift change. All the while the president, and plant manager watched me behide a glass window.

    I was told that most of the employees of the union were required to retrain and they would have to hit my production within 1 month. There were some layoffs from that plant within 2 weeks.

    My fathers buddy never spoke to me again and we moved out of the area.

    I think unions are good if the union understands that they have to produce at the maximum levels of skills they have and that they also have a good employer that will offer consistant training to improve the knowledge of the union. Better educated workers bring better productions with less stress and long term benifits to the firm.


    above email is spam bait so look at my bio.

    --
    if you see me, smile and say hello.
  11. Re:I'll join by jamesneal · · Score: 1
    Bah.. If you want to attack my argument, go ahead, but don't attack my skills. Every job I've interviewed for I've gotten an offer letter for. Of course, that could be more of a reflection of the job market.

    My point is that at least every job I've taken has had pretty much the same working conditions and my friends in other parts of the state pretty much agree with me. Maybe things are different in the golden cube-seas of California; Maybe it's time I started looking for a change of scenery.

    I really enjoy the work I do, otherwise I'd go do something else. What I don't enjoy is the pervasive corporate culture that seems to think our time is not a resource. I don't believe the companies I've been at are isolated examples of this.

    As for your claim of union corruption, yeah it exists. But I think for the most part, unions do more good than harm.

  12. Re:ah, slashdot by BBB · · Score: 1
    Nobody forces companies to accept unions, it's sometimes just the best business decision to make.

    Nobody, that is, except the National Labor Relations Board, the Department of Labor, or any number of state-level similar organizations that pass laws saying e.g. that firms are not allowed to pay less than the union-dictated wage, that firms must hire a certain number of union workers, that firms may not make refusal to join a union a condition of employment, etc etc etc etc.

    It looks to me like you are the one who has not read much about the reality of unions and how, like large corporations, they rarely settle for operating in a free market.

    -BBB

  13. BREAKING NEWS by AoT · · Score: 1

    Giant corporation says "unions not needed"

  14. Re:I support Unions for the tech industry by ReTay · · Score: 1

    "The Real Meat of the matter: "* Tech companies expect un-sustainable levels of "work from their employees. "* Tech companies will lay-off people without a "second thought if it helps the bottom line. "* Tech companies will require unfair, new "contracts to be signed by all employees, without "any form of negotiation at all! (This is taken "from real life experience - where a consulting "firm completely revamped all employees stock "option contract, without protection for wrongful "termination / layoffs, and gave us no option but "to sign or resign!) Your first issue with hours puzzels me didn't you find out how many hours you would be expected to work before you accepted the job? Next you complain that a company is going to lay you off for their bottom line. Big deal there is plenty of jobs out there and every year there is more jobs opening up. If you want to roll the dice with start-ups that is your choice. Next Breaking contracts... If anybody breaches a contract with me the end up with a very costly court settelment to pay. Or didn't you set up anything like that for yourself? Wrongful termination himm that is actionable under law. Mabey you need the support when dealing with a company however I do not. And I will keep my pay checks. The government takes enough for entitlement programs thank you very much.

  15. Unions Suck... by Anonymous Coward · · Score: 1

    My company is preparing to go to LWE, and we had to ship 5 computers and about 40 boxes of tshirts, as well as some other swag, across country (LA-NYC).
    It cost us some $1100 to ship it all.
    That's about 3000 miles...the union at the Javits center is charging us almost $1500 to move the SAME boxes less than 1000 feet.
    That's nothing but extortion, pure and simple.
    We are NOT ALLOWED TO carry in our own stuff...dollies aren't allowed on the show floor unless a union guys pushing it. It's fucking ridiculous.
    And the bad thing is that companies and convention centers condone this behaviour.
    Another example; we have a popcorn machine at our booths...they won't allow us to dispense it ourselves, we have to pay a union worker over $20 per hour. $20 PER HOUR TO HAND OUT POPCORN!!!
    It disgusts me...honest to God.

  16. Re:Amazing... by llywrch · · Score: 5

    > Although I am clearly biased on this point, I just dont see any other need for a tech-union, perhaps someone else can enlighten me on
    > this issue.

    Simple. Consider for a moment that having ``elite" status means that you are one of the top 5% or 10% in your work bracket. Employers fall all over themselves to give you want you want.

    But what if you just don't make that bracket. You're in the 10% bracket right below yours. Or you look funny. Or you decide you want to only work 40 hours a week.

    Or say you lose out on a raise because your PHB decides to give it instead to one of those slackers who just happens to offer something on the side that the PHB likes. (And it's not always nookie.)

    Sure, if that happened to you right now, you could walk off the job & get a better-paying one tomorrow. But recessions happen, & all of the clued bosses who would hire you in a heartbeat have hiring freezes. Or you get into a car accident, sure it's the other guy's fault but he's a deadbeat & your insurance doesn't cover it, AND you are out for six months. Can't code, can't work, can't do anything but count the holes in the ceiling thru a medication haze. And you find your employer laid you off while you were out, & no one wants to hire you.

    Don't say this couldn't happen to you. For generations people have been giving loyalty & their strong backs to employers, then something happens & you discover how your boss repays all that loyalty. All it takes is one PHB, one bad break, & your career can get toasted.

    And that's why unions get started. Because you can't always trust your boss.

    And be glad that there's an interest in unionizing high tech. You'll never see a union at a place like McDonald's or 7-11 (which need unions worse than the high tech industry) because you need some kind of stable workforce that'll be around for at least a couple months at the job. You need jobs that are worth fighting for, that are worth having.

    Geoff

    --
    I think I see a trend here. Maybe for them it really would be easier to muzzle the entire internet than to produce p
  17. unions.. by Restil · · Score: 3

    What I've noticed about the union where I work, and I'd imagine its similar elsewhere, is that the aim of the union is to "protect" the "average" employee. This is good for the mediocre employee as they are pretty safe from getting fired for doing mediocre work as long as they meet the minimum acceptable standards. Even if they're below those standards, the union will cry a river for them in their defense and they'll be able to hold onto their job for that much longer.

    The bad news is, in their bargaining for better money for the lowest common denominator, they eliminated the possibility for anyone to get a raise based on any factor other than senority. It doesn't matter that one employee works twice as hard as another. He will get paid the exact same amount as the other employee. The raises are also fixed. Its gonna be 50 cents per year. Thats it. No more until the contract is renewed, and even then its not likely to get any better.

    Of course, the employees aren't hopeless, but its ironic that the only way they can be truely appreciated for their performance is to move up into management, and therefore OUT of the "protection" of the union.

    -Restil

    --
    Play with my webcams and lights here
  18. Re:My biggest impression of unions. by Caspuh · · Score: 1

    If they turned on that feature, they would be robbing a union worker of his job. A major lawsuit would follow.

  19. Re:We need to unionize, why? by Fervent · · Score: 2
    Dude, the only thing my union did for me when I part-timed at A&P supermarket in high school was collect my dues -- and they were huge! It was something ridiculous like $5-15 a month.

    Considering my wages were below the lowest tax bracket, this was a ton.

    --

    - I don't care if they globalize against free speech. All my best free thoughts are done in my head.

  20. Re:Unions are needed. by hugg · · Score: 2

    because unions do prevent those people
    from squeezing the most of their workforce...


    You're right, why should a company expect to get the most out of their employees? Naw, the more lazy and surly, the better.

  21. A New Union for the New Economy by partingshot · · Score: 1

    Programmers need a voice!

    The tech corporations have a big
    voice in government. Congress,
    President, Senate. All of these
    branches are tripping over themselves
    to do what these corporations want.

    Do you think that they are always acting
    in our best interest?

    Go to business school fool! Bottom-line.
    Maximize profits.

    Why does the union have to be of the 27-inch
    neck variety? Why can't we have a union
    that lobbies? Like the CPA's, or the Teachers,
    or the Lawyers?

    We need a voice! On the capitol! Who
    denies this?! Who is representing your
    interests? Laws are being passed people!

    Can WashTech step in?

    --
    Anonymous posts are filtered.
  22. Re:I support Unions for the tech industry by AugstWest · · Score: 2

    What you are saying is that because you have voluntarily made certain life choices, everyone must change to accomodate you.

    That is pretty far from what I'm saying.

    What I'm saying is that a 40-hour work week isn't too much to ask of an employer. I'd be happy with a 50-hour week, but that's out of the question as well.

    Here's a wacky concept: maybe you shouldn't buy a house or cars if you can't afford them, and maybe you shouldn't have kids if you can't afford to raise them.

    I can afford them quite well, actually, but I don't see the need to work 12 hour days 7 days a week to pay for them. I don't drive an expensive car, I don't live in a mansion, and I spend very little money, putting over 40% of my income in the bank. I don't live paycheck to paycheck, and I haven't since I was in college, which I will also be paying for for the next 30 years.

    But buying a house is expensive, ongoing bills are expensive, and really, none of this has anything to do with what is reasonable to expect from your employees.

  23. Re:I support Unions for the tech industry by AugstWest · · Score: 2

    Write back to us when you have kids.

  24. Re:I support Unions for the tech industry by AugstWest · · Score: 2

    It amazes me that all anyone got out of my post was the economic aspect. In all honesty, it's the least important, and has the most bearing on your married\single status.

    I haven't had a chance to sit down to a meal with my wife for weeks now. My cats look at me like I'm the most evil person on the planet. I haven't spoken to my brother, my mother, my sister, or anyone outside of the office and my wife when I wake up in the morning in weeks.

    Time is far more important than money. Money is fluid, it can always be found. Time isn't, and it goes by WAY too fast.

    I think that employers should have reasonable expectations toward how much of their employees' time they can require. I don't think that this is too much to ask.

    I am single, and too work in the tech industry, but understand a very simple principle that most don't ever think of. Look for a new job, get offer, accept offer, and then quit. Not so complicated now is it?

    Let's see... I don't have time to spend at home, or to call my family, or to talk to my wife, but somehow I have time to job hunt, interview, second interview, etc.

  25. Re:another by Zico · · Score: 1

    It was a supermarket, actually — I noticed when I re-read my post that I should've said that instead of "grocery store," but didn't think I'd bother correcting myself with another post. FWIW, it was a "Kroger's," if you're familiar with 'em.


    Cheers,

  26. Re:Amazing... - by Schnedt+Microne · · Score: 1

    Naw.

    Asses are yoked into teams to pull a load together. Like the 'group' mentioned above.

    --
    Hay thar.
  27. Re:Unions = No Motivation To Perform by Tungz10 · · Score: 1

    How much did the screenwriter for Rules of Engagement make? Must have been one of those guys who made the minimum...

  28. Re:Let free traders trade without cashing in by paw_dawg · · Score: 1

    seems to me the internet and unions and the democrates all in in the same bed....and maybe thats a good thing....maybe its not...i know we all have to get along or we will get more of this bush crud thats about to hit us. besides whos cars you want a german union made bmw or a kia?...unions have thier good and bad points....just like non union does.....i guess it all depends on who joins what cus the companys will have to follow the skilled employees

  29. Unions are necessary for IT. by Eneff · · Score: 1

    The problem is that we see how it's been done in other places. We have to negotiate for us, as opposed to the auto industry... rules like:

    No consecutive work weeks with more than 55 hours.

    -- One week of 70 hours is fine when there really is a crunch, but when a week drags out to a month to a way of life, code productivity suffers... and often the coder doesn't notice it.

    Rest is necessary for creativity. (Yes, you can have that creative spark at 30 hours straight, but you would notice that creativity comes more often with proper sleep.)

    OT pay for over 65 hours in a week.

    If they don't schedule properly, then it's them who have to pay, not us.

    Rights to code written outside of worktime.

    (and just think how much open source would flourish if people had time to code out of work!) -- there are still those contracts where an employer can hijack code.

    Formalized termination procedures.

    Make it possible for them to be fired, but those rules should be posted. It is a nasty restriction that will cause red tape, but it will curb problems such as being fired just before options, etc.

    Protection for foreign workers...

    --- but that's what a tech union should look like.

    Further, there should be separate barganing for call center employees. They do resemble the auto industry in a way. Anyone can work them, but not everyone can work them for long periods of time. -- whereas bad conditions destroyed the physical body, call centers often destroy the mind.

  30. I am union and not impressed.. by nolife · · Score: 1

    I work in an IT department that is unionized (and my contract is currently under heated negotiation ;). IMHO the union is not a good thing for a fast moving always changing field like the IT field. I see it every day at work. Things have changed from the old dumb terminal days and the workers have not. There is no reason to change. I think you would have to shoot at least three people to get fired. Even then it would still probably be questionable. You could screw things up every day and nothing will happen. When it comes time to let someone go its not the most qualified or hardest working that stay, It is 100% based on seniority and NOTHING ELSE. You could be a complete screwup and not even know what an IP address is for, but you will still have your job when the layoffs come.

    I see it every day and it is very frustrating..
    This helps NO ONE.

    IT/Internet/networking etc is not my company's primary focus (only about 500 IT people for 100k total work force). If it was we would not have a single customer and would have folded when the last dumb terminal was gone years ago.

    Any IT/technology company that turns union will loose the ability to adapt to swift changes like a non-union company. When times are not so good and you are forced to downsizing you CAN NOT just keep the hot runners and drop of the not so hot, it does not work that way. If and when the times require you to hire again, more then likely you will be obligated to offering the previous lay-offs back again, even if they transformed from Java programer to brick layer for the 12 months they were laid off.

    --
    Bad boys rape our young girls but Violet gives willingly.
  31. Re:Of course, only in the US by gengee · · Score: 1

    Umm. No. Your analogy does not apply. If a seller offers you a price of 10$, and the buyer says "I won't buy your product." the buyer can drop his price, or decide not to sell the product. He is not forced to sell at a lower price. What would be a proper analogy, would be every potential consumer in the world joining together, paying 50$ a month to a group of thugs, who then use their 50 billion$ war chest to make SURE you sell your product for a buck fifty. Unions are evil. They had there place in the 20's and 30's, before numerous civil reforms. Now they are nothing more than organized crime.
    signature smigmature

    --
    - James
  32. Excersises in the obvious by jayhawk88 · · Score: 2

    Gee, management of a company doesn't think they need a union? Gosh, that's suprising!

    *End Sarcasm Mode*

    It seems a lot of the posts have been critical of unions, but please remember that they have been absolutely critical in the development of many nations. There may yet come a day when the number of programmers/admins/technicians in the job market outweighs the number of available jobs. If that day ever comes, unions are going to start looking a lot more attractive to a lot of us.

    What's that? Your highly trained, and have a unique skill set? That's what IronWorker Dan thought at the beginning of the Industrial Revolution. Then one day he looked around, and all his friends were trained as iron workers as well. Now, maybe Dan's company recognizes his true skill and value, or maybe they just see 100 other guys who will do Dan's job for half the price.

    The phrase, "Those who ignore history are doomed to repeat it" seems relevant right about now...

    1. Re:Excersises in the obvious by jayhawk88 · · Score: 1

      Please don't take this as a personal assualt, but I don't think your giving enough credit to the skill many forms of manual labor take. Sure, you could quickly learn to weld, work a metal lathe, assemble sheet metal on an aircraft: but that doesn't mean your doing the job as good as those who have been working the job for years.

      If any one skill set becomes less in demand, an IT worker can quickly jump to another

      Really? So if you spent the first 10 years of your professional life as a programmer of various languages, you could jump right into a network admin job should the situation require it? Or perhaps a chip designer position?

      I'll grant you that IT professionals are on a whole more adaptable than most other professions, but that's no guarentee of employment down the road. The IT job pool is only going to get more diluted in future years, as more and more children start migrating to the field. Chances are they'll be trained and educated very similar to you and I, and will have many of the same marketable and adaptable skills.

    2. Re:Excersises in the obvious by Chris+Johnson · · Score: 2
      And there is _always_ someone who will do your job for half the price.

      No, let me rephrase that:

      There is always someone who will convince your PHB that he can do your job for half the price.

      All you merry little libertarians- you're awfully confident in how smart your _boss_ is *g* it's one thing if _you_ are genuinely so smart and brilliant and productive that you can outwork any six cheap MCSEs, but how much confidence do you really have that you won't be replaced by someone who sucks because your boss is having a bad brain day?

      Sorry: you're replaceable. (Maybe that will lead to the death of the company and you know it: one word- 'oops') The more you fight and sweat and bleed to do six times the work at half the price, the more people will be out there bullshitting that they can do what you do at a _quarter_ the price. This is not logical, it's a load of rubbish. Now convince the pointy-haired one of that...

    3. Re:Excersises in the obvious by Anonymous+Squonk · · Score: 1
      What's that? Your highly trained, and have a unique skill set? That's what IronWorker Dan thought at the beginning of the Industrial Revolution. Then one day he looked around, and all his friends were trained as iron workers as well. Now, maybe Dan's company recognizes his true skill and value, or maybe they just see 100 other guys who will do Dan's job for half the price.

      That's cause Iron Worker Dan can only Work with Iron. I'm sure I could do Iron Worker Dan's work with a month of training, maybe less.

      IT workers, on the other hand, have a diverse range of skills that get more diverse every year. Not just any Joe can do that. IT workers are hired not only for what they can do, but for what else they can learn to do.

      If any one skill set becomes less in demand, an IT worker can quickly jump to another. I think it is highly unlikely that everything related to IT will become more supplied than demanded in my lifetime, as the world becomes more and more inaccessable to those without basic computer skills.

  33. Re: Pro Teachnology Unions by Felinoid · · Score: 1

    The problem info-workers have is not the same as labor workers...
    In labor the worker depends on that job but the employeer can get rid of him at any time.
    In high skill labor the worker can leave and the employeer is stranded...

    As such you have NDAs and other such agreements.

    Experence is a commodity... if you have an employee who stays with you for 10 years your lucky... and you'll work to keep him...

    Unions in high skill labor have been known to trash ideal work conditions...
    They can only shoot for just above reasonable. When you allready have that a Union is a sereous problem.

    --
    I don't actually exist.
  34. Re:Another thing about Unions & computers. by itachi · · Score: 1

    Ironically enough, the pricey BMW/Benz cars are assembled by non-union workers who are paid far better than the union workers employed by the Big Three. Unions are also responsible for the 8 hour day and the weekend off. Sure, they aren't perfect, but who is? I think the place where the computer industry needs unions is tech support. More of a guild system, really, than unions - better wages and so forth, but also better training.

    itachi

  35. Unions, fine. Closed shops, no. by bperkins · · Score: 1

    Labor unions are not usually considered a trust ( in the anti-trust sense), so if they are legal, I don't see why they shouldn't exist. However, the "closed shop," where only union workers are allowed at a particular company is something I object to, at least in my line of work. I want to be able to negotiate my terms of work, without anyone else having anything to say about it.

  36. Let free traders trade without cashing in by Gothmolly · · Score: 1

    In a free market, where international talent, and non-local talent can be as valuable as local brick-and-mortar style talent, it makes no sense to stick to the old fashioned "my gang is bigger than your gang" style of unions. In a world where communication is quick and valid, the market can move at a fast enough pace that companies with poor management practices will quickly wither on the vine. Laissez faire!

    --
    I want to delete my account but Slashdot doesn't allow it.
    1. Re:Let free traders trade without cashing in by Miguelito · · Score: 1

      It's not Bullshit... Have you even worked in a union job? The very first job I had was one where I _had_ to join the union (and it was the Teamsters). It did exactly as he said: I would bust my ass, and other lazy workers got promoted simply for being there a few months longer. Unions love to go by seniority, as if time at the company has anything to do with your worth as an employee.

      The few guarantees that the union contract got us were little more then enough to make sure that we could pay our monthly dues (we're talking seasonal workers here). Then after quitting, the union hounded me (and a friend who quit the same day) for about 4 months trying to get us to pay dues even though when we left the job, we were automatically out of the union. The numbers on the mail we got from them about questions were never answered, and we called all times of the day.

      Like a lot of things in life, the idea of unions is noble... but when reality kicks in, they suck. There's far too much corruption in them and they tend to either not benefit the workers enough, or they do more harm then good by making demands that companies can't pay for.

      --
      - My favorite error message: xscreensaver, running on an old Sparc 5 w/ 8bit color: bsod: Couldn't allocate color Blue
    2. Re:Let free traders trade without cashing in by cthugha · · Score: 3
      In a world where communication is quick and valid, the market can move at a fast enough pace that companies with poor management practices will quickly wither on the vine.

      Yes, and that would explain why bad management practices and lousy working conditions are so prevalent in the tech industry today, wouldn't it. There have been numerous stories on /. about bad treatment of tech workers, particularly in shit-kicker positions like tech support, simply because no workforce has ever united against bad management. Sure, an individual can take a stand or walk out of a job he/she doesn't like, but what are isolated individuals going to achieve in the greater scheme of things?

      It's time that tech workers united, be it as a union or at workplace level, not only for our own sakes, but for the sake of the clients/customers who put up with bad products as the result of bad management.

    3. Re:Let free traders trade without cashing in by nnod · · Score: 1

      screw that, i'm a tech worker. the last thing i want is unions. i hate unions. they disgust me.

      thats all i'm gonna say. i don't feel like getting into it.

    4. Re:Let free traders trade without cashing in by jeffry_smith · · Score: 1

      I've also worked in a Union. There are good and bad about unions, apparently you've seen the bad. The good is when you get fired because the boss doesn't like the way you dress, or decides to outsource the entire operation to India because it's cheaper for them, or that you're going to have to work 80 hours a week for no more pay.

      Those in the tech world have gotten used to being a scarce commodity, and being able to demand what they want. But don't think businesses treat you wonderfully because of enlightened self interest. They treat you that way because it helps them make a buck. If they could cut costs by treating you lousy, and get away with it, they would.

    5. Re:Let free traders trade without cashing in by Neumann · · Score: 1

      Unions do nothing but promote mediocrity. They dont reward for being a better worker and they DO reward for being "just good enough" (Which in a union shop, is usually pretty bad).

    6. Re:Let free traders trade without cashing in by Myxx · · Score: 1

      Sorry, but I have to disagree with you too. The whole point in joining a Union is to keep you from having to worry about your job. That is good, but as others have said, it also prevents the firing of otherwise worthless employees. It is as bad a tenure for teachers. And before anyone gets their panties ina wad, I was a teacher and I hated tenure. Veteran teachers who had given up long ago on teaching got to keep their jobs. You want to know why some kids can't learn? Sometimes it is as much the teacher's fault as the parents and students.

      But, having been management everywhere I go I have had to deal with it beinghard enough to fire a worker who would not work. If it wasn't thefear of it being termed racial, or gender, or sexual preference, or ethinic preference, then it would be because I just didn't like them. Heaven forbid it be that they didn't work!

      Now I am the kind of person that doesn't care if I like you or not. If you do a good job I can live with not liking you. But I do insist that you have the same work ethic as I do. Unions allow people with no work ethic to continue working, remaining a parasite on those that carry the group along.

      But what about the union worker? If I had been inthe Union when I started in this field I would never have been able to leap from a lowly tech support phone guy to Supervisor and beyond had I been in the Union. Tell that to my wife and my upcoming child that I couldn't make better money because the Union didn't allow me to leap frog based on my abilities.

      I am done.

      ----------

      --

      ----------
      Twisted Little Gnome - The Podcasting Network http://www.twistedlittlegnome.com
    7. Re:Let free traders trade without cashing in by zkiwi · · Score: 3

      If this is the case then the union won't last very long. This is because the company that employs it's members will probably wither and die.

      My experience with unions has been from the point of view of a relatively new industry (electronics)and an incompetent and hostile management. This is where unions excell IMO.
      However for people of a programmers or similar ilk I think that a guild or society (eg Lawyer)
      would probably be more applicable. This would
      probably fix the mediocrity tendencies of unions
      (which are sometimes needed in non-skilled shops!)
      but provide a protection mechanism for members by ensuring that only the Guild( or Society) supporting companies will get the best people.

      Well it works for lawyers and engineers.

    8. Re:Let free traders trade without cashing in by DaBunny · · Score: 1

      How do you get Union == Cartel? The only reason I can see is that union members are represented by a single group. Of course, management is by definition a single group. So following your reasoning, all management is also a cartel.

    9. Re:Let free traders trade without cashing in by jejones · · Score: 1

      Gee...here on /. what's the main thing ranted about? The MS monopoly. Among the general public, OPEC is another target of people's wrath. What is it about labor that makes a monopoly or cartel in it, which is exactly what a union is, noble and virtuous, unlike monopolies and cartels in other goods?

    10. Re:Let free traders trade without cashing in by redtux · · Score: 1
      BULSHIT

      Now why did know ths subject was guarenteed to get some moronic (probably but not neccessarily aerican) pro-freearket prat stating that unions are evil, stifle initiative etc

      Lets just make one very clear point - for employees to be able to show initiative they have to feel that they are not going to be sacked for speaking out of line

      Sorry to dissillusion you but this the normal situation in non-union shops

      Wow - I was even polite

      --
      Microsoft(tm) - a particular virulent virus that has infected most Pc's.
    11. Re:Let free traders trade without cashing in by AdminMan · · Score: 1

      If you don't feel like getting into it, then why the fuck did you post?

    12. Re:Let free traders trade without cashing in by Tackhead · · Score: 2
      > [ Tech shops need unions ] for the sake of the clients/customers who put up with bad products as the result of bad management.

      You obviously haven't seen the quality of service from your local (unionized) DMV lately, have you?

      Or attended a trade show and waited four hours for people who walk at a snail's pace and take routes around booth spaces reminiscent of a Family Circus cartoon in order to get your packing materials back for your booth.

      Unions exist to protect union members, not customers.

    13. Re:Let free traders trade without cashing in by enochian · · Score: 1
      "lousy working conditions are so prevalent"? Are you serious? I've never seen better work conditions. Flexhours, options, full benefits, great salaries... etc

      I agree that tech support can be a "sh!t-kicker" of a job, but overall, high-tech workers have it easy!

      I honestly believe that no workforce has ever united against high-tech management because there is no need. Gone are the days that managers work their employees to sickness (and yes I realise it still happens, but i'm speaking in general terms here).

      Unions served a very necessary service many moons ago, but today in general, companies have realized that if they make their workers happy, they will have better work.

      eno.

    14. Re:Let free traders trade without cashing in by mcwop · · Score: 2
      Maybe workers that desire a union should unite and start their own company that incorporates the values they hold so dear. Then compete with the companies managed by "evil" people.

      --

      "I don't think it's selfish, to eat defenseless shellfish." -NOFX

  37. heh by z84976 · · Score: 1

    I for one would not ever join a union. Sure they had their place in the developing years of labor... now they're just money-makers for their leaders. Why should I waste MY salary paying THEM? No thanks, you backwards morons, I'll not be joining you even if I have to give up my job and revert to being a welder somewhere (I did that once, ya know).

  38. Re:ah, slashdot by jault · · Score: 1

    "Nobody forces companies to accept unions"??? Labor laws do exactly that. Once the majority of workers at a company agree to organize, there isn't anything the company (or even the workers who don't want to be represented) can do to stop it; they have to accept the union & begin negotiating. And as for a recession, what's a union going to do about it? Force the company to keep you on the payroll when there's nothing for you to do anymore? Yeah, I'll bet companies just LOVE that.

  39. Re:Unions not necessary by AoT · · Score: 1
    Nowadays, unions serve to enable employees to exploit employers

    when the first ceo gets fired because the workers of a company unionized and asked for so much that the company could no longer afford his 3mil + salary, you tell me.

  40. another by Lord+Omlette · · Score: 1

    for software companies to move to India? Who need Silicon India when you can BE in India itself?

    Oh wait, the union website says Amazon.com was looking at India around September '00, wonder if they acted on that...

    Many unions are^H^H^Happear to be run by thugs who don't mind bullying union and non-union members alike... What will prevent a tech alliance from becoming corrupt? Too many egos will be clashing hardcore...
    --
    Peace,
    Lord Omlette
    ICQ# 77863057

    --
    [o]_O
    1. Re:another by dragonfly_blue · · Score: 1
      Whoa, weird. Zico and I agree on something.

      Guess I'd better go find my hat and eat it...

      --
      Free music from Jack Merlot.
    2. Re:another by Schnedt+Microne · · Score: 2

      Actually, my skill in the workplace is what lets me ask for a raise and not get fired.

      I don't need somebody else to ask for me. Thanks anyway.

      --
      Hay thar.
    3. Re:another by JHDrexler · · Score: 1

      Actually, as I understand it, being a member of a union takes away your ability to ask for a raise period. When you elect a union, in the US, the union becomes your sole represenative when bargaining with management. We are currently undergoing an organization effort for our non-technical positions.

    4. Re:another by cthugha · · Score: 2
      A more democratic structure, perhaps? I don't know what the situation is in the US, but in Oz, unions are typically organized around a somewhat authoritarian model, on the pretext that worker solidarity is needed to achieve their goals.

      As with virtually anything in politics, it's up to the people to make sure that unions don't become corrupt. We should be skeptical of our union leaders just as we should be skeptical of our government.

    5. Re:another by fintler · · Score: 2

      What gives you the idea that they are run by "thugs"? Unions give you a chance to be able to ask for a raise and not just get fired for the sole reason that you asked for one. They allow you to have a say in what your contract will be, if a majority of the workers don't like it, it's out. What does ego have to do with this? An elected board representing the union will allow the union to stay (for the most part) without corruption. The members of the union can just vote out the people they think are ripping them off.

    6. Re:another by jotaeleemeese · · Score: 3

      That is hsortsightness: you and many here think that their talents are very special and will remain like that for ever. There was a time when differential calculus was mastered only by Newton, or when only Chopin or Lizst could play their own music. Now any high school or first year-college guy *has* to understand calculus, and in any music school you can find a dozen people that can play the piano as well as it could be expected in Chopin's time.

      Lets say that the IT wrokers are better off *now* without unions, but that will not last forever because those skills we thing are so precious now will be common currency sooner than we expect.

      God bless M$ that keeps moving the posts without reason. I loathe Linux that makes the skills I acuired 5 years ago be equaly relevant today ;-)

      --
      IANAL but write like a drunk one.
    7. Re:another by Zico · · Score: 1

      And, don't forget, unions give you the chance to sit at home without pay when you'd rather be working. And then, if you decide that you want to work anyway, so that you can make money to support your family, the unions then give you a chance to get beaten up, get your car trashed, and get pelted by batteries or food when you cross the picket lines. Now why on Earth would anyone think that they're thugs?

      Oh yeah, and I speak from experience, since I was forced to join a union when I worked part-time at a grocery store in high school. There was a lot of strike talk during part of the time when I was there, and it was just pathetic to see the lazy slob old-timers (length of time in the company, not their ages) badgering part-timers my age to support the union, so that they could continue to work even less hard than us kids and collect an even bigger undeserved paycheck for it.


      Cheers,

    8. Re:another by DaBunny · · Score: 1

      So you experienced getting beaten up, getting your car trashed, etc? All that simply because there was strike talk? Amazing! Or maybe you're exaggerating your experience just a bit, and conflating it with what you've seen in movies or on TV?

    9. Re:another by jejones · · Score: 1
      What gives you the idea that they are run by "thugs"?

      Oh, I don't know...probably the Teamsters, or things like hearing about the kindly actions of union members towards so-called "scabs." Whatever else one can say about Microsoft, I've never heard anyone say that it sends out people to physically beat up potential competitors--that's SOP for unions.

    10. Re:another by Zico · · Score: 1

      No, I speak from the experience of knowing that today's unions suck. The beating up, trashing at cars, etc. doesn't need my testimony, since anyone whose turned on the local news during a strike already knows that stuff happens. The badgering part was the only thing that's happened personally to me.


      Cheers,

    11. Re:another by No+One · · Score: 1

      Was that a family-owned grocery store then? Because the union at the big chain store I worked at was set up and managed by the stores itself, and I understand that's the norm. Furthermore, the charters of those unions forbid things like strikes, work slowdowns, etc. In other words, they're just a way for the employer to siphon some money from the employee's paychecks and provide a sinecure for the CEO's nephew. Their real purpose, of course, is to prevent a REAL union from receiving legal recognition, since membership in the store's union is, of course, mandatory. Those unions do jack shit for the employee, and every employee in the store knows it.

      --

      --

      There is no sin except stupidity -- Oscar Wilde
  41. Unions for tech workers... by quark2universe · · Score: 1

    is like trying to herd cats. At least with the bright ones. For the intelligently challenged, maybe not.

    --

    Believe in things of which no person has ever learned
  42. Screw the Unions by Phoenix1 · · Score: 1

    We should take all the lazy union memebers, stick em in a bag and ship em to Cuba

    --
    poop.
    1. Re:Screw the Unions by Anonymous Coward · · Score: 1

      My dad told me a story about workin in a union environment.... one day he was told to shred plastic sheets, and by the end of the day had done the entire stack. on his way out the door for the day, a particularly large burly man came up and started shoving him, and saying to leave more work for the next shift and work SLOWER, my dad stated he was doing his job honestly and doing what he was getting paid for, he was then threatened with bodily harm. he left there.

    2. Re:Screw the Unions by Travoltus · · Score: 2

      My mother lead a union at a hospital and she never endorsed this crap.

      I for one would agree to all five conditions. Plus let me add:
      6) My union would not stand for people habitually coming in late or not at all.
      7) My union would not get involved in issues like abortion or military action in Bosnia, etc.

      However, what my union would do, is follow in the tradition of union forefathers/mothers who made the workplace a safer place, outlawed child labor, and established the 8 hour work day/40 hour work week.
      My union will be the one that saves your tail from being fired and blacklisted for not putting in 80 hours constantly, against your will.

      And if you think you can just LEAVE for another job, think again. The dotcoms have fallen. The party is over.

      Oh and I also predicted unions would get a big boost in the IT industry if the dotcoms happened to fall and an employer's market situation came about. Well, that time is coming. We'll soon see.
      ========================
      63,000 bugs in the code, 63,000 bugs,
      ya get 1 whacked with a service pack,

      --
      --- Grow a pair, liberals... stop letting the Republicans bully you!
    3. Re:Screw the Unions by Vanders · · Score: 2

      Those conditions all sounds perfectly normal. But then i'm (currently) a Union worker in the UK.

      I don't know what sort of weird idea the US Unions seem to have, but they sound like a bunch of idiots with no idea where they are going, or what they're supposed to be doing. If the Unions in the US really are as bad as people are making out, then I a can understand the hostility the Americans show towards them.

      In the UK, if you want to join a Union, you can. If you don't want to join, thats fine too. No one will force you, or bully you, or think any less of you. If the Union workers go out on strike, non Union workers are (usually) able to cross any picket lines without hassle. I know for a fact that during the industrial action that was taken by my Union last year (One day strikes), that non Unions members, and even essential Union members, were able to cross the picket lines and go to work. Hell, they even came out and had a chat on their break times with the Union reps. I guess we know how to be civilised about it.

      Unions are there to support you in your job. They are there to handle pay negotiations, secure fair deals for workers, and to handle grevencies for employees who are unable to talk to managment for whatever reason (Bullying or uninterested managers for example). They are not there to think for you, or to tell you what to do.

      I pity all these people in the US who don't know what a proper Union is all about. They really do make life a lot easier, and the monthly sub for (my Union) is less than i'd spend on beer on a single night out. Good value for money, i'd say.

    4. Re:Screw the Unions by ReTay · · Score: 1

      Enough You want me to agree to a union? Fine if you accept the following conditions... 1. If a worker does not want to join the union they don't have to. 2. If a worker dosen't want to join they don't have to pay union dues. 3. Workers are allowed to leave the union at any time they wish and bargin with management alone. 4. No worker who does not join the union can not have his car destroyed by some coward who can't face that worker. Also no other forms of shunning trying to set up people or harassment will be used. 5. If I object to the way the union is handeling money nobody will show up in the parking lot and try to break my legs. If every one of thoes terms are acceptable bring it on. If not froget it. Peroid.

    5. Re:Screw the Unions by fintler · · Score: 2

      Let me guess, you're the same type of person that judges the US's poverty level at anyone getting (approx) $17,000 usd/year. If you think you can comfortably support a family on that kind of income in the US, you've got to be insane. This is what the unions fight against, they let people come together to make their lives better. Read your history a bit, understand what it was like in the industrial era without unions. Workman's Compensation was a joke, if you got sick, you could loose your, job and in some cases, your home, due to the fact that a lot of factory workers' homes were owned by the company's they worked for.

    6. Re:Screw the Unions by Master+Bait · · Score: 1
      Americans are too lazy to unionize anymore. They're completely happy to work 60 hours a week on 'management salary'. No overtime pay, just some wishy-washy grey concept of ladder-climbing self flagellation. A promise of future riches as everytone somehow thinks THEY are going to become multimillionaires and will do so because they work very, very hard and beat themselves with lots of long hours.

      Work for reward is stuck in the belief systems of many Americans. The reality is some actually get to be wealthy, but only a few. And mostly because of lady luck. And most who become wealthy are NOT HAPPY at all.

      Kind of sad, really.

      Happiness never happens because of external circumstances. Never.

      Join the union and take some time off!


      blessings,

      --
      "Only in their dreams can men truly be free 'twas always thus, and always thus will be."
      --Tom Schulman
    7. Re:Screw the Unions by fR0993R-on-Atari-520 · · Score: 1

      You said:
      Let me guess, you're the same type of person that judges the US's poverty level at anyone getting (approx) $17,000 usd/year. If you think you can comfortably support a family on that kind of income in the US, you've got to be insane.

      Indeed he definitely would be insane, as anybody knows that "living in poverty" and "comfortably supporting a family" are very far apart on the economic spectrum.

      I would say that someone who is living in poverty has absolutely no chance of supporting a family nor "living comfortably" by any modern sense.

      --
      There are 11 types of people in the world: those who understand unary, and those who don't.
  43. For the record... by rc.loco · · Score: 1

    I work for the Cobalt Group. I am a technical staff member. I am relatively satisfied with my work, and think the best part about the place are the people. That includes John, the CEO. The environment is very open and people communicate across many levels without getting their undies in a knot b/c one may not be following "the chain of command." As long as that is the case, I don't really see a reason for a union at our shop - however, I'm not willing to say that unions are unnecessary for the industry as a whole. I have met people who have it much worse, some at other dot-coms and some at prestigious brick-and-mortars. I am extremely grateful for my workplace dynamics when I hear their stories.

    --
    --rc
  44. so? by chuqui · · Score: 2

    so dot-com companies don't like unions.

    Name me the five companies in "traditional" companies that said "unions? gee, we love unions. you don't even have to vote! Just come in and have a chair, we'll talk".

    Why is it news that these companies don't want unions around? Basically, NO company wants unions around. this is news?

    --
    Chuq Von Rospach, Internet Gnome = When his IQ reaches 50, he should sell
    1. Re:so? by chuqui · · Score: 1

      > You've obviously got no idea how unions work. I work in the office of a Local of the United Brotherhood of Carpenters

      Um not quite. I used to be in the teamsters in my youth, and my sister is a honcho in a big local office in southern california. I'm quite familiar with how unions work, good (my sisters) and bad (my former one)

      But nice try. Unfortunately, just because someone says something you don't like doesn't mean they're clueless. Although it's easier to claim so than refute the actual argument....

      --
      Chuq Von Rospach, Internet Gnome = When his IQ reaches 50, he should sell
    2. Re:so? by ichimunki · · Score: 2

      It's important to recognize that some unions are doubleplusungood and some are doubleplusgood. Unions related to highly technical skills like plumbing, carpentry, etc etc tend to emphasize skills for all members, and most cities encourage this sort of guild structure by requiring licensed (which often more easily achieved by being a union member) workers for critical works projects.

      Unions related to things like housekeeping are there to feed off lower-class workers who are no good at defending themselves against either the management or the union.

      --
      I do not have a signature
    3. Re:so? by Anonymous Coward · · Score: 1

      Name me the five companies in "traditional" companies that said "unions? gee, we love unions. you don't even have to vote! Just come in and have a chair, we'll talk".

      You've obviously got no idea how unions work. I work in the office of a Local of the United Brotherhood of Carpenters and we have dozens of companies who have come to us out of their own free will and signed voluntary agreements. Why? Maybe because they want a skilled, trained workforce and feel they can advertise on that basis. This is common practice in all unions I know of, and certainly all I have been in contact with.

      I suspect that most of the anti-union rhetoric here is based on the right-wing rhetoric we've been fed by employers for so long.

    4. Re:so? by chuqui · · Score: 1

      not to beat a dead horse, but...

      My first posting said to "name five". You keep saying it's demonstrably wrong, but you've never named any names to prove it.

      Ohwell.

      --
      Chuq Von Rospach, Internet Gnome = When his IQ reaches 50, he should sell
  45. It could work (hint: open source ethic!) by Junior+J.+Junior+III · · Score: 1

    As more IT workers enter the labor market, an individual's skills and specialites will mean less and less. The people with the most skills will always be in demand and always have it pretty good, but there will always be an underclass of midlevel and entry-level employees. These are the people who stand to gain from unionization.

    Even for those who are currently making out pretty well, there are still issues unique to the IT labor market. Maybe labor shortages are so severe that you really do need to work 60-80 hrs. a week, but maybe also you'll finally be able to actually get paid for it.

    If you think your salary is really all that great, first compute your real hourly wage by factoring in all the overtime you don't get paid for. Then think about all the things you'll do with all that money when you finally get some time off... oh, wait you don't get any time off until you retire, which will happen when you either burn out or when they fire you for not being in your early 20's. What are you going to do with all that money if you've got no time to enjoy spending it?

    Even if everything else is good, there's still the issue of abuses of labor. You're a lot stronger if you've got union backing and have a complaint, assuming that the complaint is valid and you have a strong, non-corrupt union helping you to look after your interests.

    Bottom line is, management is already organized. It's only fair for labor to organize itself.

    In order for unionization to work, here's what I think will need to happen:

    • Membership must be voluntary. Management cannot coerce workers not to join, and the Union cannot coerce workers to join.

      Individuals who feel they can negotiate better contracts for themselves without the union should be free to do so, but they should enjoy none of the benefits that unions have secured for their members (unless they can somehow successfully negotiate them for themselves).

    • There must exist some means to stamp out corruption in unions. I think one good way to achieve this would be to have a means for sharing information among union members that bypasses the old-school model of the straight dope being handed down from on high.

      Traditionally there have been union newsletters which brainwashed the membership with propaganda and told them what a great job the union was doing, while the corrupt bosses went around and did whatever. Instead of the traditional newsletter, why not have an open-contribution website (much like /. naturally) where union members could speak out? Important issues could be discussed with relative anonymnity and safety, and the highest-modded contributions to the discussion could be used as the basis for the choices the union would have to vote on. Done properly, this would take a bit of effort to implement, but once in place, there would be little need for union bosses, and thus there would be no one at the top to corrupt. The whole decision-making process could be transparent, and any attempts at corruption would be weeded out like bugs in open-source software.

    • If this isn't effective, several unions could compete with each other. Think one union is corrupt? Dump them and sign on with another! This would at least give you another option besides quitting your job and finding another one.

    I don't suppose that there's an easy answer to EVERY problem that unionization brings up, but at least if there's a body in existence that addresses labor issues, new workers who enter the labor market won't have to continually invent the wheel for themselves. I certainly don't have all the answers for all my problems, but maybe a few of my friends do. It wouldn't hurt to ask them, but I might not even think to. The collective power of a union is like having thousands of friends, and you get to benefit from the wisdom of each of their experiences in dealing with management. Unionizing IT jobs could make a real difference.

    I rang, you rang, we all rang for orangutang!

    --
    You see? You see? Your stupid minds! Stupid! Stupid!
  46. Re:I support Unions for the tech industry by Vassily+Overveight · · Score: 1
    So. If people do bad things to you it is basically your fault, because you didn't shoot them when they started doing those bad things?

    If you're being attacked, the first thing you're supposed to try is to get away. Only when that's not possible does the law permit you to use force. In this case, if your employer is treating you badly, you don't get your AK-47, you get another job.

    I'm still wondering why the guy who started this sub-thread can't simply tell his employer that he's not going to work 12-hour days, 7 days a week. The worst that can happen is that he's fired from a job he considers crap anyway.

    --

    "If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine

  47. Re:Unions are a SAD JOKE! by jjjack · · Score: 1

    Ah, the wonderful tried and true Social Darwinist ideal. The cream rises to the top, right? And once there, we all know they are extremely moral and take good care of everyone. Of course they don't lobby to the government claiming they don't have enough native IT workers, and get them to pass bills allowing 80,000 IT jobs to be imported each year, driving down wages, right? No, they're far too moral. Of course strict laissez faire capitalism doesn't breed a cycle of poverty, causing even the most talented to have to struggle 10x as much as some dumb kid of a rich CEO, because we all know that the invisible hand guides things to the moral side. Hell, even Adam Smith never claimed it was moral. You're far too idealistic if you believe what i think you're trying to say. The fact of the matter is, once you're at the top, it's not hard to forget what it was like when you weren't. Most people don't give a shit, and will do anything to lower overhead and increase shareholder profits. Our society's far too complex for the libertarian ideals you exude. Communism may only work in a dream world, but the same goes for laissez faire capitalism and strict libertarianism. Social Darwinists are just presumptuous pompous asses who are looking for a reason not to feel guilty about those they exploit. Andrew Carnegie may have been a great philanthropist (founded many libraries, a university...etc) but he sure didn't do too much for his workers. The only reason the average factory worker isn't working 12 hour days and being told the business isn't responsible for their finger being cut off is because of unions, and that alone is good enough reason for me, because I doubt that corporate boards are any more moral than they were 100 years ago, especially when they still use Chinese slave labor and pay Indonesians $1.25 a day (which allows them to buy 2 plates of rice with a small amount of steamed vegetables and live in an 8x15' hut with a tin roof). I wonder what's lacking in those countries...hmm.....unions?

  48. Re:Unions not necessary by palinkas · · Score: 1
    Wrong! If there is competition, prices will be kept down... This means that the workers will get a bigger piece of the pie.

    (especially if they help other workers in their industry organize)

  49. Re:Weak unions are America's main problem... by palinkas · · Score: 1
    This truly is brainwashing, and could not have happened if strong (and smart, which apparently was the problem in the US) unions had been there.

    It's not dumb unions, it's corrupt unions. I'm not neccessarily talking about Teamsters/mob stuff, either. I mean union bosses acting as another layer between capital and labor.

    The AFL-CIO is a labor bureaucracy designed to serve the few, the piecards (paid union officals) by making deals between management and the workers. The structure of the mainstream unions in the US guarantees a structural corruption in unions.

    Think about it, what a union is supposed to be: a union should be the workers themselves, united, in solidarity to achieve a common goal.

    The working class and the employing class have nothing in common. - IWW Constitution

    - Paul in Seattle

  50. Comment removed by account_deleted · · Score: 1

    Comment removed based on user account deletion

  51. Have the Balls to Stand on Your Own Two Feet by The+Grip+Reamer · · Score: 1

    I have been freelancing for over 11 years. I complete the project and leave. Every time. I come back if they have another. And they usually call.

    You don't need a job. You merely need to present interested parties with your attractive skills. If you don't have them, get them. Jeez, in the early, lean days I was even a secretary! The most iimportant skill is being able to make their job easier. Tell me that doesn't inspire the business equivalent of love!

    Now try conceiving of the sheer justice of a union, while simultaneously holding (at least for a moment) the notion that there is no such thing as a "right" to a job. You can't do it.

    A job is created when some industrious soul (who has likely already worked himself silly) conceives of a valuable task that is simply too much for him to do alone. He makes an agreement with someone to exchange value for value, possibly you.

    How will a union protect you when the company goes under? Or when the project ends? How will it protect you when the most skilled workers take their ball(s) home? Or when the guy at the top realizes he's stuck with a bunch of losers and closes up shop?

    Unions are like the Spanish Armada. They cannot compete with guys like me, who whip around in our tiny boats.

    This isn't about insulting those who love unions. It's about indicting a really bad idea. You die-hard socialists go ahead and join the union. I wish you the best of luck. I really do. But get ready to say good-bye to the best and brightest, those benevolent and willing mentors who until now have gladly shown you the ropes. They'll be on to greener pastures, because you've just tried to chain their wallet to the dumbest guy on the staff. The company (or project) that they go to may just eat yours for lunch.

    Quit whining about how you're treated: leave!
    Quit whining about cube hell: leave!
    Quit whining about your wages: learn!

    You can do it yourself. Anything. Although you may need to hire someone. Imagine if they wouldn't let you stop paying them when you wanted to end the project. Imagine that they got some thug (say, a fed?) to promise bad things would happen to you if you refused. Imagine that they demanded you pay their useless pal, Wayne, to "help". Oh, it goes on....

    -B...

  52. All the "good" things by grantdh · · Score: 2

    The mere fact that we have weekends, vacations, child labor laws, minimum wages, basic safety standards in the workplace etc, etc all stem from the labor movement over the last century.

    Damn - now I go an do this contracting/consulting thing and find that weekends are for working, vacations are a figment of my deranged imagination, my pre-school child is helping me code (and doing a better job of it - little bugger!) not to mention the fact that my desk doesn't sit right and I'm sure the lighting is out of whack.

    Still, the $500k per year I'm pulling in more than pays my medical, loss of income protection and other such things.

    I figure that when I retire in a couple of years, I might just buy me one of them union things...

    *cough cough*

    Most of the above is a joke - I'll leave it to you guys to figure which bits are jokes and for what reason(s) :)

    --

    I left my body to science, but I'm afraid they've turned it down...
  53. The Good, The Bad, The Mediocre by grantdh · · Score: 2

    OK, so back in the past, unions did a lot of good stuff and fought for the right of the worker to not be stomped by nasty employers. Given the situation 100 years ago, I can agree that was a good thing.

    However, times change and I'm not going to rely on the situation of 100 years ago to justify what I see around me in unions today. Afterall, I'm driving a shit-hot car with great features and flying ace aircraft now - 100 years ago, we didn't have all that. Should I accept shoddy driving/flying environments because a group fought to get them 100 years ago? :)

    Here are some notes from my experience many years ago:

    1. Working as a casual hours shop assistant in a KMart (working for pocketmoney while at school) - I was *forced* to take a 15 minute break in the middle of my four hour shift because the union demanded it. They never asked me if I liked having to sit for 15 minutes in the smokey staff area wondering how long it would take to get back into the swing of my work when I returned to the floor.

    2. Despite Australia's "voluntary union" status, I was forced to pay union dues (deal between unions & mega-store chain to reduce disruptions).

    3. The union supported government parties/delegates that I did not.

    4. Votes were conducted as a "show of hands," not a secret ballot. Guess what kind of experience you would have if you voted against the desires of the union/delegate....

    Now some current experience from a union that is a client of mine (I do IT/management consulting for them)

    1. Fewer people joining the union has resulted in less income which is placing a strain on their out-dated management concepts (little empires, massive duplication of effort, obsolete equipment, etc).

    2. Senior union management are realising that they may have to downsize and undergo process review/re-engineering to survive (all the things they complained about when fighting employers :)

    3. One union here is in the middle of a strike with its own admin staff - they are part of a different union and are striking over work conditions at the union's offices. Poetic justice? :)

    Unions once were great, have gone through a period where they got "too big for their boots" and are now being dragged back to reality. Where I see a union excelling is:

    1. Where people cannot job-hop to other employers for better conditions, etc (hotshot tech/management staff can get away with it - call centre staff often cannot :( The classic example mentioned here was the car manufacturers "colluding" on payrates and preventing skilled staff job-hopping.

    2. Where "free" legal advice/service is not available - either contract reviews or fighting for rights - such as the firebrigade staff who were terminated for speaking out. Unions can offer a centralised service to members for free/cheap due to economies of scale.

    Reviewing the above two points, isn't this what groups like the IEEE and Australian Computer Society attempt to offer?

    One person has noted previously in this discussion that they wouldn't join the IEEE due to their political machinations. Perhaps if sufficient people were to note their disagreement with this direction, the IEEE could:

    a) stop their machinations

    b) have an "opt-in" political contribution as part of membership - those who agree pay, those who don't do not (nifty way of checking if they really do represent the desires of their members :)

    Organisations such as unions have their benefits, provided they create and maintain a system which is agreed to by their members. One problem here is in the method by which member agreement is obtained. Another problem is getting a large group of people to agree on anything :)

    There is a need for some sort of representation for those in IT who do not have cutting edge skills (eg: those who haven't reinvented themselves every couple of years). Whether a union is the answer or not will be decided by the industry itself over the coming years.

    --

    I left my body to science, but I'm afraid they've turned it down...
  54. Re: Not all high-tech jobs are elite by wumingzi · · Score: 1

    Before I start on this, I would like to note that I am not currently in a union noe have I ever been in a union. However, I have worked in a "union shop" More on this later.

    Most intelegent programmers laugh at the thought of a "tech union"... demand is so high that for most of us we could easily walk and get another job.

    Quite right. This is not so much an issue for programmers, project managers, sysadmins and other members of the technical elite. Remember however that amazon.com (for instance) employs a number of less-than-technical people in warehouse jobs, editing positions, tech support, etc. These jobs are not well compensated, and especially when you're down at the bottom of the food chain, the mobility level between companies as not as high as it is for techies.

    Now, something which you may not know about unions. When a union comes into an organization, it does not (in most cases) force every single non-management person in the company to join the union. I worked as a design engineer in a marine electrical company at one time. The workplace floor was what we call a "closed shop". If you don't have your union card, you don't pull wire.

    The front office had no such restrictions. None of the engineers were unionized, nor were the accountants, sales people, etc. (some of them used to be shop guys, but I don't think they kept their cards up to date. Could be wrong about this).

    Having said all of this, working in a unionized shop was not one of the more fun jobs I've had. A nine-to-five attitude permeated the place, and the managers figured that the workers were all out to hump the company. On the other hand, having friends who work at Amazon, some shops really deserve to have a union forced on them. If Jeff Bezos doesn't figure out how to reward employees with something other than 50 hour-weeks, forced overtime near Christmas, and now not-so-valuable stock options, that may be the situation he will face.

  55. Re:Moderators? by BigBlockMopar · · Score: 2

    Okay. Whoever moderated this down is an idiot. You don't moderate a posting up or down based on whether or not you agree with the point made: you moderate based on the quality of the facts and method in which they're presented.

    Yes, read your moderator guidelines.

    Regardless, I still have more karma than you do.

    --
    Fire and Meat. Yummy.
  56. Skilled technical craft union is the answer by Anonymous Coward · · Score: 1

    Like a good trade organization hear in Hollywood in the Biz. A trade organization where the bar to enter the union is your solid skills in your craft. Where an employer will hire union, because for twice the pay they get 3x the work done and done properly. Where the union provides a buffer for those of us who switch jobs frequently - the retirement, medical benefits that we techincal nomads often don't get. It works for film editors, it can work for programers. Not all unions are like the Teamsters. Some try to leverage the skills and professionalism of their members.

  57. Re:I support Unions for the tech industry by Dancin_Santa · · Score: 1

    It is true that technology companies expect un-sustainable levels of work, but in the vast majority of cases, these companies are fairly compensating their employees.

    This is SUCH bullshit.

    How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?

    How do you compensate someone for the entire months lost due to crunch time, forced by the people who a) have the money to invest in realistic scheduling and b) aren't there with you the whole time?


    You are right, there are companies and managers who are reprehensibly bad at scheduling and who feel that a hands-off approach (read golfing) is a proper way to lead a team. However, how long do you expect to work at this place? Are you seriously going to put up with this managerial bullshit for the rest of your life? What keeps you at this particular job? Are you at the only software company in your city?

    I'm asking earnestly. I really can't understand why someone would stay at a crappy job when they clearly should be able to get another job at the drop of a hat. I understand that you have bills to pay, I understand that you have mouths to feed, but I don't understand why you would put your own sanity on the line in such a terrible work environment.

    Do you think that a union would be able to help you in this bad company? If 'yes', how so? Would they force the company to limit your work hours to 40? Would they make it mandatory for all managers to read Rapid Development or Code Complete?

    I don't see

    1) Why you would put up with working at a crappy company. and

    2) What you expect a union to do for you.

    Dancin Santa Searching for answers...

  58. Re:Amazing... - by RandomPeon · · Score: 3

    Wow, a comment worth reply. :)

    I guess if you take my argument to its logical extreme it is Functionalism (which is distinct from Marxism, but now I'm using that philosophy minor to split hairs). But it's really more of a free-market Functionalism - techies are the critical irreplaceable segment of an IT company. They're skills are unique and a finite number of people can do their job at all, therefore, like executives, they should be generously compensated (obviously less so than senior managment - but the point is that both groups are critical). Support departments tend to be a different story. However, techies, like blue-collar folk, tend to be isolated from management and most likely to be subjected to unfair treatment (I don't know any Marketdroids who worked 70 hrs/wk for two weeks to meet a deadline only to get laid off the next morning when the project got done on time). This is where some form of representation comes in.

    This sounds racist to me.

    There's plenty of documented cases of employers abusing the H1-B system. It has no checks and balances - these people often get fucked. You can read other comments here or the original stories for examples. (I wish to plead laziness for not supplying links.) There was absolutely no attempt by tech workers to lobby Congress on these issues, so suprise, we got shitty, one-sided legistlation. Until we live in a world with absolute free trade with a truly global market (never) restrictions on outsourcing employment are justified.

    If they screw you, you leave.

    That gets hard if everyone is colluding to screw you. It's true that some software isn't made by a couple oligopolies like cars are - yet. Despite this fact, anti-consumer initiatives like SDMI, CSS, etc. have managed to get universal support. It may only be a matter of time before everybody's management gets their act together to suppress developer wages. I'm not saying they would be wrong in trying to do so - that's their job, minimize expenses. The purpose of a union is to provide a counterbalancing institution - at least in theory. Someone needs to be looking out for your interests.

    I'm not gonna play long-term predictor, but the dotcom shakeout indicates we might be seeing a world with relatively few software/networking/whatever companies. Most industries tend to consolidate as they mature, and there's no reason software would be an exception. If and when all software is made by Apple-Microsoft-Intel-NBC or IBM-Redhat-Sun-AOL-TimeWarner and three other companies, leverage would shift substantially away from the workforce to the employers. If you think this is absurd, bear in mind we once had dozens of automakers in America, we now have exactly two (Chrysler doesn't count). Troll-preempt: This an exagerrated example, please don't tell me Apple belongs in the second megacorp or something like that. (Somewhat OT, while I'm not a Marxist, he did predict consolidation decades before it happened. Rest assured, I hate communism as much as you, just should give credit where it's due.)

    Three of the five groups you mentioned have recently pulled or are pulling strikes about bullshit issues and making ridiculous demands.
    It cuts both ways. Counterexample: Pepsi workers where I live had shitty wages, pension plans, disability pay, etc. The union came up with a proposal that would have compensated Pepsi workers slightly less than local Coke workers with equivalent jobs. The company made a ridiculously low offer and then refused to negotiate "on principle." Who's the idiot here? All a strike indicates is an inability to reach an agreement - it isn't automatically the union's fault.

    I may be going out on a limb by suggesting that we trust a system with a rather shady history. But we may have the solution to the problem of advocates who don't advocate well - the Internet. Rank and file union members have set up websites criticizing bad union leadership and company management alike. The NWA flight attendant contract (big issue when you have one airline like we do in Minneapolis) was scuttled by an independent website which claimed it didn't really benefit members.

    In the olden days, all organizations had to be hierarchial - you had to have literal "bosses" even in unions. Today, you can set up a discussion site where anyone with a stake in the issues can voice their opinion. If flight attendants can use the net to prevent abuses of the union system tech workers should have no difficulty. It's awfully difficul to bullshit a large group of people who have the ability to communicate on a discussion system. I just can't see a traditional crooked union popping up when all the members can post comments.

    It's a basic truth of economics that increased prices will result in decreased demand.

    It is also a basic truth of physics that bodies move in accordance with Newton's laws and relations derived from these laws. Any so-called "basic truth" or "law" is valid only under a finite set of circumstances. Just as the laws of classical mechanics only accurately describes the world at relatively low speeds, the law of supply and demand only accurately describes the world in markets where all information is available to all actors, the number of actors is large, all actors meet the formal defition of efficiency, and the barriers to entry and exit approach zero.

    Just as Newton's laws stop working well as we approach .1 * c, the law of supply and demand stops working well when we move away from ideal free market conditions. Good and bad results that the free market system couldn't predict happen. Somehow, unionized industries are able to have real wage increases without massive layoffs. Somehow, Microsoft has been able to retain control of entire markets with substandard products in the face of substantial competition. Examples of results opposite what supply and demand would predict abound.

    These so-called "laws" become become less useful in describing behavior as we move away from the hard sciences to the soft ones, like economics and political science - even the Iron Law of Political Science has two exceptions (1930 and 1998) and social scientists still call it the "Iron Law" because relative to their other laws it's done an awfully good job.

  59. Yep - UAW v. Johnson Controls, 1991 by supton · · Score: 1

    UAW v. JOhnson Controls, US Sup. Ct, 1991 - The majority decision struck down fetal protection policies in the workplace which kept all women of child-bearing age from working in blue-collar jobs...

    Johnson controls left a really bad loophole (seems like the court fucked up) which would allow discrimination against an employye if a company can prove that there would be a substantial risk of tort liability --oops. BUt it is proof that the union has the clout to FILE A TITLE 87 SUIT AND FOLLOW THROUGH.

  60. Re:Amazing... - Point #4 is flawed by RandomPeon · · Score: 2

    I was at my local library recently and I browsed the computer section for entertainment. It had a 1990 book entitled "The Decline and Fall of the American Programmer" and it claimed that by 2000 all the programmers in America would be unemployed, having been replaced by harder-working Indians. American programmers were supposedly 1)lazy, 2)overpaid, 3)inefficient, 4)overeducated, 5)stupid.

    Strangely, US programmers are doing quite well, even though their salaries have been jacked through the roof (albeit not by unions). It appears #4 turned out to be a real benefit - US folk have shown a better ability to adapt to new technology. It looks like the sky has been falling for a while.

  61. Re:I support Unions for the tech industry by Derring · · Score: 1

    I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.

    Are there any unions that are pro-immigrant? Anywhere?

  62. Unions as agents for their clients by seichert · · Score: 1
    I think it is important to look at what services unions provided to their clients. Unions often provide many services including contract negotiation, retirement planning, skills development, etc. For these services their members pay dues and agree to allow the union to make many decisions regarding their employment situation.

    Is this so different from a consulting firm that sends workers out for contract assignments? Well, maybe a little. But the idea is still there.

    A union is almost like its own contracting firm. Basically you join the union and then the union hires you out to the employer. The union is responsible for getting you a good wage, retirement plan, benefits, etc. If the union fails to provide you with what you want you quit the union and go it on your own.

    The problems traditionally associated with union usually stem from violence and government meddling. Most union members are not violent and would never bring violence upon a scab or management they did not like. A small number of union members have attacked scabs or management as a means of negotiating. Historically the problem has been that the local police have looked the other way(much the way they used to look the other way when management would club strikers, seems things don't change I guess) for political or whatever reason.

    The government has gotten involved by creating the NLRB(National Labor Relations Board) and various other agencies to deal with unionized labor. Whether you think the government is on the side of unions or management, it doesn't matter they are involved. They do not level the playing field. They get in there and try to interfere with negotiations between two business organizations (unions and management). The only role for government is to make sure that a) no one gets away with using violence as a tool for negotiation, b) no one commits fraud during the negotiation process, and c) contracts are enforced in the courts.

    If you want to join a union go for it. But consider your other options like negotiating for yourself, quiting your job, joining a consulting shop, starting your own firm. Also consider that you don't have to join a formal union with government recognition and all the hoopla. You could organize with your co-workers, get legal counsel, and start working on a negotiating plan.

    Above all, never lower yourself to use violence to get what you want. If US tech workers become known for violence then all of the IT jobs will head for foreign countries.
    Stuart Eichert

    --

    Stuart Eichert

  63. IT Unions not needed at this point? by Eil · · Score: 2


    First off, my knowledge and expertise on labor unions themselves is very much limited and I do not claim to be an expert or even to know what I'm talking about. But since this is an open forum, I'd like to add my perspective.

    I think it can be agreed that unions exist for the protection of the workers against their employers. I do believe (but am not certain) that unions as we know them today started with the auto industry. Henry Ford, while being the innovator he was, pretty gave not a flying shit about his employees. Working conditions were pretty bad and so the workers fought back and went on strike. A union was created somewhere along the lines and workplace quality went up.

    But the coin can be flipped. A union can become strong enough that suddenly the employer is the one in the stranglehold. This is when people starts saying that unions are evil, etc.

    Right now, I'd say that the IT industry needs no unions. AFAIK, the good programmers are practically babied and so are some of the bad ones. In general, I would guess that IT workers have it made. Until we start approaching a world something like that in Neal Stephenson's _Snow Crash_, an IT union is a bad idea. We don't want our employers to hate us this early in the game. :P

  64. Busting a Union by jazman_777 · · Score: 1

    I worked at a war company (euphemism: "defense contractor") as a mechanical engineer; once upon a time, the machinist's union went on strike. All the engineers not essential to the production line (including me) were put on the production line. It was common for 2 engineers to do the work of 5 collectivist stooges, taking a 2-month backlog of work and putting the line 2 months ahead. In the end, production didn't miss a beat and the union accepted the last, best offer that the company made. Some of the union literature I saw lying around was downright vitriolic: "Management is the Devil", basically.

    --
    Slashdot: Failed Car Analogies. Amateur Lawyering. Anecdote Battles.
  65. Re:ah, slashdot by hugg · · Score: 2

    Hear hear. Tech workers are not like skilled workers doing manual work ... you can only weld so fast, or lay so many bricks/hour, or fix an engine so fast etc.

    OTOH, a tech worker with the right skills can sometimes do a job 1000%-10000% faster/better than someone lacking those skills. And you can't expect training and a bumper sticker to magically teach someone to be the kind of creative problem solver that is valuable in the tech biz.

    Maybe the majority of /.ers are heartless technocrats, but we just don't want our highly specialized and arcane jobs lumped in with someone who inserts Windows-2K CD's in a drive all day and clicks Ok. (no offense to the humble MSCE :) )

  66. Re:Amazing... by nrftwicked · · Score: 1

    You'll never see a union at a place like McDonald's or 7-11

    Actually, we had one McDonald's here in Vancouver (BC, Canada) organize, or at least they came very close - anyhow, it is possible.

    --


    If nobody ever re-invented the wheel, we'd all be pushing around flintstones cars, wouldn't we?
  67. I'm working my 12th straight day... by AugstWest · · Score: 3

    ...and I have 6 more to go.

    There's only been one day that was less than 12 hours, and I fought like mad to get that one day.

    Everywhere you go, you hear "that's how tech is."

    Tech burnout, IT madness, whatever you want to call it, it's pervasive and for some unknown reason we're expected to be available 24/7 7 days a week. Beepers, cell phones, etc. totally invade our privacy.

    It's got to stop before the tech industry eats itself. The business owners aren't going to do it, as we've seen lately with Amazon and Cobalt, they're going to do whatever they can to keep things as they are.

  68. Re:Of course, only in the US by itachi · · Score: 1

    In any market interaction, there is room for negotiation. Unions are nothing more than workers getting together so that they have as much bargaining power as management. This is a Good Thing. Unions mean weekends, 8 hour days, health care, living wages, and other things that make life possible for approximately 10-15% of the workforce in the U.S. alone, and many more worldwide.

    itachi

  69. Re:Unions are a SAD JOKE! by jjjack · · Score: 1

    Yes...exactly...we all know that corporate moguls with huge shares in a corporation truly care about the workers' welfare and wouldn't do anything to hurt them solely for the purpose of raising his stocks a couple points. No that's never happened, because we live in "the greatest country in the world"!!!! Wake up, mon ami, working conditions are only tolerable in this country becuase unions make sure they stay that way. What evidence do you have to show otherwise? That IT jobs have good conditions? That's because at the moment most tech companies need more employees. But when the "revolution" (as the media would call it) is over, and they've got enough people to meet the demand, we'll see who claims they need organization. It wouldnt be the first white collar union....secretaries are often unionized. It's for their own benefit, don't assume it means you're going to spend half your life striking. jjjack

  70. Re:I support Unions for the tech industry by Tonttoro · · Score: 1
    If you work at a company that's abusing you, it isn't their fault for doing it, it's your fault for letting them.

    So. If people do bad things to you it is basically your fault, because you didn't shoot them when they started doing those bad things?

    I sense wrong values here. Even though I agree to some extent that at least some people can choose where they work at. Sometimes there isn't as much choise just because of families, or some other reasons.
    --
    when everyone gives everything,

    --
    when everyone gives everything, then everyone everything will get
  71. Re:Amazing... by grimiore · · Score: 1

    i whole heartedly agree... having a union is kinda like having a communists regiem. The elite are held back because everybody has gone union and no one will hire them. So they have to jump through the hoops and hurdles to get ahead as they should, or they quite the union and risk being blacklisted. Then the "slackers", those sub par techies, are raised par level with the eletists..... hey, if i can't get that 79K/year job, then it's for a few reasons: they offered me something other than money (a pleasent atmosphere, weekends off, no cubicles and no formal wear) or i'm just not that good enough.. i don't need a union to make up for my own failings.

  72. Re:Convincing by RandomPeon · · Score: 1

    I think someone from overseas pointed us to a better model here . Maybe we could get European style unions for techies in America.

  73. Re:Amazing... - by jazman_777 · · Score: 1

    >1. Any group has more power acting cohesively.

    Actually, the group cedes power collectively to a few. That has led to union bosses, who are notoriously corrupt. So you end up being a union flunky.

    --
    Slashdot: Failed Car Analogies. Amateur Lawyering. Anecdote Battles.
  74. Re:You have no clue. by pkaminsk · · Score: 1

    Not everybody wants an extra safety net. Why should it be right for a union to force this safety net on everybody who wants to do a particular kind of job?

  75. Re:We need to unionize, why? by Malcontent · · Score: 1

    Presuming everything you say is true. Does that mean that every union is corrupt? Every union member works for minimum wage and squalor.

    The fact is companies hate unions because it empowers the employees. Pretty soon then start asking for more money or better hours and if they stand united the company has to fight them or give in. In the old days the companies broke knees these days they sue you.

    The fact remains if you don't like the way a company is behaving the absolute worst action you can take against them is to try to recruit their employees in a union. IF they attempt to stop you you can sic the govt on them and if you succeed they will curse your name every night before they go to sleep.

    form a union = Bitchslap a corporation

    --

    War is necrophilia.

  76. Re:Amazing... by itachi · · Score: 1

    Tech Support.

    Tech Support.

    Tech Support.

    itachi

  77. Re:Unions not necessary by Felinoid · · Score: 1

    Unions are a good thing even in todays econnomy.
    Basicly labor workers can not speak for themselfs indivudually. They have to pay rent and the employeer can pay them as little as they like knowing the employee will have to take what ever they give.

    Unions enable a workforce to leave when the employeer isn't being reasonable or changes are needed.

    I'm an advocate for smaller unions.. not lagger ones.. in the big ones the heads really don't know when the feet are cold. The larg unions invent problems and end up nuking perks.

    However info-workers are not in this same fix. They aren't trapped...

    I mean when are they gona form a CEOs Union or a Union for elected officals.. hmmm?
    There are some jobs that don't need protection... and some that do..
    And Unions really really really do themselfs a discredit when they attempt to push themselfs into areas where Unions aren't needed.

    --
    I don't actually exist.
  78. Re:We need to unionize, why? by jhigham · · Score: 1

    In the Post Office, you do not have to be a member of the Union, and so do not have to pay dues, but -are_ provided full access to the union.

    I would think that letting anyone have the benefit of the contract is reasonable (I don't really like it, but it isn't that terrible), but they can even register complaints with the union, etc just as a paying member can.

  79. Re:I support Unions for the tech industry by bvankuik · · Score: 1
    Everyone forgets here that it's not you versus them. The company is made up of people.

    I don't want to work at justa tech company where the boss thinks that I am not an equal part of the company. I work at a small tech company where I personally know the owners. And I like it that way; I want to hear their stories about how it all got started, how the meeting with customer X was, etc. I want to know their side of the story.

    But I am not just a friend. I am a highly skilled worker and I'll quit when I'm not happy. Just as they would get rid of me when they're not happy with me.

    A union would just be in the way. I want a good relationship with my company. I don't have a union in my marriage either, right?

  80. Silly. by Stu+Charlton · · Score: 1

    (Moderate up +1, Funny.)

    "Have a look at the auto-industry.. seen any real innovation, anything 'market shattering' there in the last 30 years? No."

    Actually, yes. Tremendous innovation. I don't think you're a car buff. But, even anyone who's not a car buff would recognize that there are more reliable, affordable, and gas-efficient cars out there than ever before. This started because of innovation at Toyota and eventually carried over to other manufacturers.

    "Havnt we all heard of the WTO? of the WIPO? FTAA? etc etc? What is happening is the Capatalist System is hitting a peak. It takes money to make money, and TransNationals are realizing it is easier to share in profit than really compete. "

    Hmm. Last I checked, the WTO promotes global competition and the unions want it stopped because of that.

    Nice troll.

    --
    -Stu
  81. Re:Unions suck. I'll quit if forced to be in one. by floop · · Score: 1

    Why didn't your father quit and find another better job or just start his own company? Sounds like you dad is some kind of looser, you John Gault wannabe.

  82. Unions in many places & skill level Q.s by jeffsenter · · Score: 2

    I see many postings citing the differiation in skill level in the tech industry as a reason not to unionize. The assumption is that either pay will be based on seniority or all workers will be paid the same. I do not see why this must be the case. My parents are both professors with Ph.D's (also high skill level) and belong to the university's faculty union. My Dad however makes a lot more than my Mom because he publishes more and gets promoted more. By the university's standards he is a better professor so he is paid more. Also the pay in different fields for professors history vs. chemistry varies a great deal.

    I imagine a union of programmers would negotiate to get standards for minimum pay-level (no HB-1 visa underpaying) and working hours (no 7 days of 14 hours in a row). Beyond this different programmers could be paid different amounts. Why couldn't individuals negotiate their own salaries and still be in the union? I have known some professors at my parents' university that have negotiated special raises.

  83. Re:We need to unionize, why? by Bruce+Perens · · Score: 5
    What I really don't like about unions is that if you happen to have a job in a unionized industry in most U.S. states, you are forced to either be a member of the union, or if you don't want to be a member you have to pay their dues anyway. And if you don't want to be a member, the union will be working 100% of the time to have you "bumped" from your job, which the law allows them to do and they usually succeed.

    I it just doesn't seem fair.

    About 25 years ago I worked in retail, selling home electronics. I was given the choice of joining the retail clerks union or quitting. I told my boss that I'd rather quit. He didn't want to lose me, so he promoted me to store manager. All the time I worked there, the union employees were making very close to minimum wage and were working in horrible conditions, and the union manager was driving a very expensive car and wearing suits more expensive than any worker could afford. There were no strikes. I'm sure there was lots of corruption.

    Thanks

    Bruce

  84. Re:Unions, fine. Closed shops, no. by ljavelin · · Score: 1

    Typically, unions and management form a contract.

    Sometimes that mutually agreed upon contract spells out a "closed shop", a not ideal but sometimes necessary mechanism to prevent management from circumventing the intent of the contract agreement.

    Of course, neither management nor the union is required to agree to add "closed shop" clauses in their agreement. And in most "closed shops" any eligable potential employee can join the union.

    Personally, I'm in management and not in a union. But I once worked in management in a poorly operated company, and I completely understand why unions need to exist.

  85. That's what they have done in Finland by Anonymous Coward · · Score: 1

    I don't know about other countries, but the labor unions are so powerful in Finland that the employers have formed their own union: The Confederation of Finnish Industry and Employers. Their opponent is a union of labor unions, The Central Organization of Finnish Trade Unions. Every couple of years those two adversaries try to come up with a comprehensive long-term contract. Usually they hold the government hostage by threatening not to agree unless the government chips in with concessions. All in all, I think all parties are pretty happy about the arrangement.

    Marko

  86. Re:Unionize--or think about it first, then unioniz by Electric+Jesus · · Score: 1
    There are a lot of reasons why workers form unions.

    Is one of them an effort to teach employees how to split impossibly long paragraphs into more manageable pieces?

    Just wondering...

  87. Re:Unions by forrestt · · Score: 1

    they fought the good fight back in the 1800s for everyone to which I'm grateful.
    III.IIVIVIXIIVIVIIIVVIIIIXVIIIXIIIIIIIIVIIIIVVIIIV IIVIIIIIIVIII...

    I'm grateful for everything Bill Gates has done to let corporate America know what is POSSIBLE in the computer industry, but I'm not about to use NT. Sounds like your full of pi

  88. Re:Amazing... - by tbo · · Score: 2

    They're skills are unique and a finite number of people can do their job at all, therefore, like executives, they should be generously compensated (obviously less so than senior managment - but the point is that both groups are critical).[snip] However, techies, like blue-collar folk, tend to be isolated from management and most likely to be subjected to unfair treatment (I don't know any Marketdroids who worked 70 hrs/wk for two weeks to meet a deadline only to get laid off the next morning when the project got done on time). This is where some form of representation comes in.

    This is sorting itself out on its own, without union help. All the dot-coms that try to get by through slave-driving without a plan are going under. The companies that don't reward their workers are begging on the streets for more VC, and they're not getting it. The companies that do get it will weather this downswing, and come out doing just fine.

    There's plenty of documented cases of employers abusing the H1-B system.

    I agree with you that the H1-B system is screwed up. The problem lies in its implementation, not the fundamental concept of encouraging immigrant tech workers, though (which is what you had originally seemed to be saying). Once again, I'll make a blatant plug for Canada and point out that our immigration system is generally less screwed up than yours. We don't ship people back after 5 years or any of that crap.

    If and when all software is made by Apple-Microsoft-Intel-NBC or IBM-Redhat-Sun-AOL-TimeWarner and three other companies, leverage would shift substantially away from the workforce to the employers.

    If that came to pass, yes, it would be time for unions. I don't see it happening any time soon, though. Until it does, I think unions would be more a burden than a benefit.

    That gets hard if everyone is colluding to screw you. It's true that some software isn't made by a couple oligopolies like cars are - yet. Despite this fact, anti-consumer initiatives like SDMI, CSS, etc. have managed to get universal support.

    These examples are quite different from employee treatment. Employees are generally a lot more informed about their companies than consumers are, for one...

    Counterexample: Pepsi workers where I live had shitty wages, pension plans, disability pay, etc. The union came up with a proposal that would have compensated Pepsi workers slightly less than local Coke workers with equivalent jobs. The company made a ridiculously low offer and then refused to negotiate "on principle."

    If it was the tech industry, all the Pepsi people could have just left for the nearest Coke plant. Then Pepsi would have been up shit creek without a paddle when they discovered nobody had been commenting their code...

    Rank and file union members have set up websites criticizing bad union leadership and company management alike

    For now, I think that level of organization is all that's needed--no formal unions necessary. The company I was working at this summer did some nasty bullshit to employees, mainly because of two idiot executives. If we had wanted to, we could have simply told the general manager that X had to change or all his developers would walk. That would have destroyed the company completely, since it would take 6 months for anyone else to figure out our flagship products. I nearly organized such a coup, but, as a lowly co-op student, I didn't quite have the pull needed. All that was really needed was a desire to change things on the part of employees--a union was simply unnecessary.

    Just as Newton's laws stop working well as we approach .1 * c, the law of supply and demand stops working well when we move away from ideal free market conditions.

    Yes, but, at least right now, the computer industry is very close to an ideal free market. There are many "sellers" (employees) and many "buyers" (employers), and no one entity or small group has excessive market power. If that were to change, there might be a need for unions... Until then, they're just dead weight.

  89. Unions and Slashdot by Weezul · · Score: 3

    First, do you think that a union would really fix the H1 Visa problem? I'd assume that a union would just try to decrease the number of H1 Visas. I suppose it might force companies to pay H1 Visa recipiants more since this would make them less attractive, but this just means that only the companies without unionized labor would have lots of H1 Visa holders. I think federal legislation to force fair treatment of H1 Visa holders wopuld be much more effective.

    Second, do you think that unions would really do anything to fix the problems with unfair co compeat contracts and NDAs? These issues are much to subtile for your average union and they only effect a minority of emploies (the more intelegent ones). Now, I suppose that a tech union might be a bit smarter then other unions, but I still think that it would ignore it's smarter most importent members in favor of the mass of dues paing html typing idiots.

    I think the tech industry would be much better served by having a "tech workers loby" which did not deal with companies, but dealt with congress and the courts instead, i.e. it would try to help show that bad contracts and H1 Visa abuse should be illegal.

    Alternativly, one could make an argument that unions would be ineffective since there are many many tech companies, i.e. unions are designed to deal with companies which have "monopolies on work." Now, the solution to this problem would be a more "distributed union" where the workers just discussed the problems they were having at work. It would be possible to look up people's opinions on companies to get a realistic view before joining a company and it would be possible to get help organizing "one time strikes." Actually, maybe we are closer to having such a place then we realize.. maybe a weblog like slashdot or kuro5hin could do this job.

    --
    The Christian religion has been and still is the principal enemy of moral progress in the world. -- Bertrand Russell
    1. Re:Unions and Slashdot by Ian+Bicking · · Score: 2
      I'd assume that a union would just try to decrease the number of H1 Visas. I suppose it might force companies to pay H1 Visa recipiants more since this would make them less attractive, but this just means that only the companies without unionized labor would have lots of H1 Visa holders. I think federal legislation to force fair treatment of H1 Visa holders wopuld be much more effective.
      I think H1B visas should eliminated as common practice in any field -- for very skilled people in very specific situations, it kind of makes sense. But that's not the way it's being used.

      I'm really entirely in support of immigration, I'd just like the immigrants to get Green Cards. It hurts all workers when some workers are disempowered. The entire concept of the H1B Visa is that it ties an employee to their employer -- it's indentured labor. It has no place in the work place.

      I'm really not even worried about the competition -- this isn't a zero-sum game, and people deserve an opportunity regardless of what country they come from.

      Second, do you think that unions would really do anything to fix the problems with unfair co compeat contracts and NDAs?
      First, Unions are groups of workers -- they will be at least as knowledgable as the individual workers. And unions deal with contracts in all fields of work. That's what they do. They most certainly would understand the subtleties of the contracts.
      I think the tech industry would be much better served by having a "tech workers loby" which did not deal with companies, but dealt with congress and the courts instead
      That's just a union that doesn't actually have any base of real strength. Unions are lobbies. And more than that.
      Alternativly, one could make an argument that unions would be ineffective since there are many many tech companies, i.e. unions are designed to deal with companies which have "monopolies on work."
      The technology industry isn't that much harder than many other areas. Admittedly, it would be harder to get techies in non-technology companies unionized, but it is certainly possible. It is important that unions have the ability to collectively bargain, and to have contracts that ensure that all applicable employees at a union company are union. These are endangered rights.

      However, the field of technology is actually very much suited to unionizing in other ways. Replacing workers is quite difficult -- even if the worker market wasn't tight. It's a skilled profession. There are also very significant benefits that a union can bring to employers. It's in the union's interest to be representing people of quality and value. Both by being somewhat exclusive (as many professional unions are), and by helping to provide training (as is common for unions), a union can increase the standard of skill.

  90. Re:Amazing... - by Schnedt+Microne · · Score: 1

    1. Any group has more power acting cohesively.

    I'm not a 'group', dude.

    Frankly, I steer clear of people like you who want to harness me onto a team.

    I have more power that way.

    --
    Hay thar.
  91. Re:I support Unions for the tech industry by AugstWest · · Score: 3

    It is true that technology companies expect un-sustainable levels of work, but in the vast majority of cases, these companies are fairly compensating their employees.

    This is SUCH bullshit.

    How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?

    How do you compensate someone for the entire months lost due to crunch time, forced by the people who a) have the money to invest in realistic scheduling and b) aren't there with you the whole time?

  92. Re:Of course, only in the US by tbo · · Score: 3

    I think it's interesting that your description of extortion, "either you give me this, or we [sic] wont work," is in fact a description of a market economy, which can be summarized as "either you give me a better price or I won't buy your gizmo."

    You wouldn't know a market economy if it bit you in the ass. Markets work best when you have many sellers and many buyers, all operating independently. The tech industry has tens of thousands of competing companies and millions of employees, which is just the way things should be. The tech industry is damn close to an ideal free market.

    Adam Smith, the idol of capitalists, would in fact have approved of unions, in my opinion

    Do you know anything about Adam Smith? He would have viewed labour unions as market collusion, an evil that distorts prices and creates market inefficiencies. Your statement is about as ridiculous as claiming that Karl Marx would have favoured the AOL-Time Warner merger. Please, take an economics course.

    With reasonable labour laws (such as those in Canada), there's really no need for unions in the tech industry. If you don't like your job, get another. When you leave a tech job, the company loses huge amounts of accumulated knowledge, and, whether the company knows it or not (the good ones do), it costs them big-time. This is more true in the tech industry than any other industry I can think of.

    Nobody wants to pay you $75,000 for 8 hours a day with 6 weeks vacation? Maybe it's because you're not worth it. Ideal markets do a very good job of paying people what they're worth. Sometimes the truth hurts. If nobody wants to pay you $X, upgrade your skills, look around, and you'll probably get what you want.

    Don't try to tell me it's hard to find a new job--it's easy if you don't suck. I'm only a co-op student, and I have no trouble. First co-op term, I had to turn down interviews because I was getting so many, and I got exactly the job I wanted. This time, I only applied to one place, and got the job without even an interview.

    Yes, companies pull occasional bullshit like firing people without telling them, but that just means your labour laws need a bit of tweaking. If that happened here in Canada, you could sue their asses for wrongful dismissal.

    Sure, unions increase wages in the short-run, but they ultimately harm workers by decreasing the supply of jobs or putting employers out of business or by taking huge chunks of your paycheck. It's simple economics--if you increase the price of something (higher wages), demand will fall (==less jobs). There's a few details (price elasticity of demand increases with time, etc.) that tell you that the reaction won't be immediate, but it will happen.

    Historically, unions have been corrupt, anti-democratic organizations. I know this because, during the Cold War, my grandfather was an active member of the Communist Party in the US. He was ordered to infiltrate the UAW, which he successfully did. Maybe it's no longer the Communist party that has their fingers in the union pie--it could be the Mob--but they're not really about protecting workers. Corporations don't have a monopoly on evil...

    I know what you're going to say "Aha! Those labour laws are there because of unions! So there!". Yes, very true. Unions did have a useful place in society. They're not needed in today's highly-educated, highly-skilled labour market, though.

    Maybe you're thinking "but I deserve to be paid $XXX,000, and I should get 72 weeks of paid vacation a year". Why do you think you are somehow entitled to any of this? You're entitled to what you can negotiate in good faith with your employer, and you're entitled to have your employer honour your employment contract. Nowhere in the Consitution is flex-time, sick leave, or overtime pay guaranteed.

    I'm not saying people don't have the right to organize unions--they do (and should) have that right. I'm just saying it would be stupid to do so in the tech industry.

  93. Re:Amazing... - Point #4 is flawed by RandomPeon · · Score: 1

    You *can*, however, FTP your source code to another country and have programmers there work on it. India has benefitted greatly from this practice and companies under pressure from stockholders to cut costs/raise profits will certainly be looking at the cost and control differences between an arrogant, demanding US union and cheap foreign labor. It'll all just move offshore.

    I read somewhere that a lot of Indian software workers were ridiculously underskilled - people who had learned multimedia animation in one week from less-than-reputable institutes.

    Simply put, there's no where to go. In order to even learn to write software, you need the following skills:
    1)Literacy
    2)Algebra (int a = b)
    3)A really good grasp of the elusive concept of a 'function'
    4)Logic skills
    5)Pre-calc ideas (needed to understand anything about efficiency)
    6)Discrete math
    7)Calculus
    8)etc.

    1-4 are absolutely essential for even the most trivial coding. If you want to do anything remotely sophisticated you need more.

    You're assuming that there are a sizable number of people in some country with these skills who don't currently have any use for them. Assuming this place exists, a software company has to teach these people how to code and then deal with a crew of novice programmers. Only then it can pay them peanuts to turn out code. Even if you could find large chunks of people inclined to learn to code, the return on investment is just terrible in the short-to-mid-term in teaching someone how to code from scratch who has never seen a computer. Sure, companies will pay to send their coders to a week-long course on JavaWidgets3001.6, but what company could jusify teaching someone C from square zero?

    The only thing you can do remotely without these skills is simple HTML. Based on my university experience, I don't think India is up to the task of writing millions of pages of English-language web pages. And less-challenging code is generally more language-based - someone in Elbonia can code a new algorithm up and Americans will use it, but I don't think Elbonians will be writing JavaScript pages or VB GUIs unless they happen to speak English too.

    Where do you find a massive number of literate, mathematically trained folks? First-world countries, where governments have invested in compulsory education. There's nowhere you can find people with the requisite background who will work for nothing. Western Europe's out, Japan's out, Canada's out. They all have heavily organized workforces, min wage laws, etc. Eastern Europe and Russia, maybe, but what sane business would want to move its primary production there right now?

  94. All you communists out there... by tbo · · Score: 3

    Money is power. Employers have it, you don't. Unless you're an employer.

    Maybe at McDonalds, that's true, but things are very different in the tech industry. What developers are selling (knowledge and skills) is extremely valuable, and good companies know this.

    At the place I was working this summer, if the two most senior developers had walked, the company would have folded. Management could come and go, the market could change, but these developers were the company. The knowledge in their heads was irreplaceable, and management knew it.

    That's power.

    An intelligent employer will pay employees what they're worth and do everything possible to keep the good ones around. Unions make that harder, because now Joe Slacker has to be paid as much as Jane Ubercoder, just because he's been around as long. When you fuck with the free market, things almost always get worse.

  95. Re:ah, slashdot by rabidbat · · Score: 2

    c) accept that collective bargaining can fit very neatly within a free market. If a company can't deal with workers organizing, then it's the company's fault. Nobody forces companies to accept unions, it's sometimes just the best business decision to make.

    This is clearly wrong. Companies are forced to accept unions all the times. That is what the NRLB is all about. They force elections for the union and then require that the employer accept the union as the representative of all the workers. Even workers that vote against the union are coerced into accepting union representation.

    The current labor laws are incompatible with a free market.

  96. Unions.. by teatime · · Score: 1

    Thanks to unions like the IWW, (an anarcho syndicalist union that people are free to join and leave at anytime) at the turn of the century we all have 2 days off in a week, have 40 hour work weeks and we are not expected to work before the age of 15. If the "free market" capitalists have their way thes and other labor attrocities will increase. Unions are social constructs which can exprees the desires of their constituents very well.As with all social constructs they have negative and positive attributes. I believe that the positives far outweigh the negatives.

  97. Re:Labor history by The+Red+One · · Score: 1

    Unfortunatly or fortunatly as the case may be unions just DO NOT have a place in todays modern working world. ... Use your own free will, you do not like your working conditions. QUIT. You do not like your payscale? BETTER YOURSELF and get a better job.

    This may be fine from your youthful perspective with your whole life ahead of you, but I will share a story from my own perspective.

    In the small city where I live, the main industry was a large steelworks (a series of smelters that produce steel). Unfortunately, the steelworks decided to shut down its local operations, because they were no longer viable - with local coal deposits being exhaused, and environmentalists taking a stand against the gross pollution of their outdated smelters.

    The workers at the steelworks - about 15% of the city's population - were out of work. Most of them were in their 40s and 50s, and had no choice but to retrain, there were no jobs for them - as their skills with outdated smelter technologies were useless in today's high-tech world. Many motivated individuals decided to retrain in Information Technology, after hearing about the desperate need for workers in the industry. Unfortunately, they found that no companies wanted to hire 50 year old workers with no experience in the IT industry. They wanted young graduates, or workers with years of experience.

    Luckily, the steelworks was largely unionized. The Union stepped in, and staged a large campaign to find jobs for the thousands of retrenched workers. Individually, these aged workers stood no chance of finding work in a new career, but together, they were a large force, determined to find work for every last one of the workers. The Union organized university courses and retraining for the younger workers, and tirelessly campaigned to find jobs for the others.

    During this difficult time, the Union rallied support from the larger community to support these workers. Those workers that ran into financial difficulty were supported by others, and fundraisers supported their efforts. The 'Union spirit' carried these workers through this turbulent time, and now, four years later, nearly all of them have found work, or formed their own companies - with financial backing organized by the Union. What could have been a massive tragedy for thousands of workers has been averted, and turned into a testament to human compassion and co-operation.

    This is why I do not think unions have outlived their purpose. The concept of a large group of workers co-operating for the good of the whole is as relevant today as ever. Many unions have collapsed into autocracy, and the original spirit of unionism has been forgotten by them, but despite these failures, events such as those I descibed above renew my passion for the concept of a group of workers uniting for the good of all.

    In the youthful IT industry, the young professional workers take it for granted that changing careers is easy, but this is not so for older workers, with experience in outdated fields of work. Today's young IT workers will discover this as they get older. Information technology unions need not have collective bargaining as their primary goal, but the concept of a union that provides training and employment services for their members is one that could work well. As people relocate from job to job, one thing can stay constant - the Union, and the training, social interaction, and worker advocacy it provides. It would provide a stable lifeline in the tumult of the IT industry

  98. Re:Amazing... - by ReTay · · Score: 1

    You make several good points. However I am forced to disagre with your basic logic. Unions were formed to protect less skilled labor until they became more skilled. At least that is the idea. Most tech workers have no need for unions. Look at how hard the recruters are chaseing people now. If your not getting paid enough talk to just about any company find the pay your looking for and go there. What possibile need would I have for someone else to be dipping into my paycheck?

  99. Re:Until All Communications Are Free by Schnedt+Microne · · Score: 1

    Yeah, but the 'Industial Workers of the World' (IWW) are socialist nut-cases. I'm not talking 'creeping socialism' here. I'm talking about the dirty hippies at the protest wearing a 'wobblies' t-shirt.

    --
    Hay thar.
  100. There is no need in this industry by bradlaw · · Score: 1

    What in the world do IT workers, especially in the U.S. need with a union? We are some of the most highly paid, employable group around and possibly ever. When in history has a group wielded so much leverage in negotions with employers?

    The only downside is the outfits that expect (err demand) lots of unpaid overtime. Occassionly it is necessary, but if you team morale is good, are given realistic goals and they take pride in their work, you will not have to ask for the overtime when needed.

    Imho, I feel the unions see an industry with a TON-OF-MONEY that could go towards paying dues. Unfortunately, they cater to the worst side of people by basically saying: "you will work less, guaranteed bonuses, guaranteed raises and be more difficult to fire if you screw up... just vote yes in the ballot and give us 2% from your paycheck.".

    Unions had/have their place and time in several industries, but by large they are doing more harm than good in this country now. If anywhere unions are needed ARE IN THRID world countries where those sweatshops for making clothes, shoes, whatever are....

    --
    "If you have the urge to say 'No Offence' before or after... Its best to be quiet" --- Brad Lawrence
  101. You're the clueless one here. by testy · · Score: 1

    People don't realize that a union is a safety net, so that the worse case scenario doesn't happen.

    People also don't realize that a union is a ceiling, preventing the best- (or even moderately good-) case scenarios from happening. I can barely keep track of the number of times that qualified people have been turned down for promotions in favor of the union's "strict seniority" policy. One of those senior union members showed up at the beginning of his shift, slept in the breakroom for eight hours, and left at the end of the day. Every day. Did I mention that this was a United Auto Workers shop?

  102. Re:Unions are harmful in the IT industry by kurokaze · · Score: 1

    then I'll come running to a union :)

  103. I'll take a burger flipping job... by Micah · · Score: 1

    before I take a tech job that requires union membership.

    (the following might sound like flamebait but it's not intended to be, so at least count to ten before moderating it as such. :-) )

    I'll start by saying that I fully support the right of people to organize for reasonable pay and better conditions. That was especially necessary about a century ago and still holds plenty of merit.

    But today, most unions in America serve one purpose: to siphon money from workers to Democratic campaign coffers.

    Sure, you can generally opt out of having your money used for political purposes, but most don't bother. Including conservative Republicans.

    I'm sorry, but that is just WRONG and I get steaming mad every time i think of unions. If it isn't blatently illegal, it should be.

    Here in Oregon we've had a several year fight between the Oregon Taxpayers United, led by Bill Sizemore, versus the big unions, mainly education and government workers unions.

    Sizemore has been trying to get ballot initiatives passed that would make it illegal to withhold money from paychecks to use for political purposes, among other things. The unions counter that that is "silencing the voices of our teachers and public workers."

    That is a LOAD OF TRIPE!!!! If anyone wants to give to any campaign, they should be able to do it -- but they should write the check themselves, not have it automatically deducted.

    The irony is that the unions take money from workers, and they have a LOT of it, and uses it to advertise big government, high tax liberal candidates and to oppose Sizemore's initiatives. But if it weren't for them, the workers they claim to support would have a lot more money in their pockets, partly because they wouldn't automatically have political funds withheld, and partly because more politicians who support tax cuts would be elected.

    They have the gall to say that anyone who supports stoping this practise is unfair. What's unfair is that they have the political advantage because the illegally (or should be illegally) stealing money from unsuspecting workers to support their causes.

  104. Re:All you libertarians out there... by BrianH · · Score: 1

    God I hate socialists....

    >>Of course employers don't want Unions, it compromises their authority.
    So, I have a dream. I take my money and create a company to fufill that dream. Now you're going to tell me I shouldn't have authority over how its run?

    >>Let me translate for the dense
    The term "blind leading the blind" comes to mind.

    >>Unions increase your negotiating power which makes wages rise and firing people more difficult.
    In other words, basing wages on skill and firing people who slack off goes out the window, replaced by your socialist "screw the skilled to benefit the mediocre" mentality.

    >>We like to pay what we feel like paying and fire who we feel like firing.
    As a former small business owner, this one just made me laugh. Companies are in business to make money...period. They pay what they can to retain employees and still maintain profitability. Do you have any idea how many companies have closed their doors after employee unionization? Look it up.

    >>Employers who respect their employers would encourage their employees to form Unions
    No, I preferred to go out and chat to my employees face to face. I enjoyed running a company, and had fun with my employees. If they'd gone union and forced us into an adversarial relationship, I'd have shut the whole thing down.

    >>If money is power and businesses are not democracies, where does the power in our society lie?
    You know, that's why you leftists will never get anywhere in the tech industry. You try that "poor employee versus the rich boss" mentality that has worked in so many industrial situations, but you overlook the fact that tech workers are QUITE wealthy themselves. I got a good laugh one time watching a union organizer try to sway a bunch of programmers and CS operators to organize and join (he was apparently brought in after a bunch of crummy employees complained after being laid off). It was funny watching the guy rant on and on about the power of "united" workers to finally earn the pay they deserve, and how unions were the only way to show the "rich bastards" who actually controls a company...nobody had the heart to tell him that the company had made them ALL "rich bastards". The presentation ended, the organizer was escorted from the building, and it was never brought up again.

    --

    There is nothing so pathetic as seeing a beautiful young theory roughed up by a tough gang of facts.
  105. Of course, only in the US by bucky0 · · Score: 1

    Yeah, due to unions, if you work at an auto plant, you can: not goto work for 2 weeks, protest in front of your office, and expect to get your job back. How is that good for the economy? I've always thought that unions had a place, but that they were outdated now. Now, it's just extortion (either you give me this, or we wont work). Of course, that's just how I see it
    -Bucky
    The few, the proud, the conservative.

    --

    -Bucky
    1. Re:Of course, only in the US by AdminMan · · Score: 1

      What happens when your "skills" are commonplace and the job market is no longer tight?

    2. Re:Of course, only in the US by AdminMan · · Score: 1

      Canadians have to pay for lawyers as well, but some things are just slam-dunks. In Ontario, an employer must have a face-to-face meeting to fire an employee. Anything else constitutes wrongful dismissal, regardless of the employees work record.

    3. Re:Of course, only in the US by tzanger · · Score: 1

      What happens when your "skills" are commonplace and the job market is no longer tight?

      The shame on you for not keeping yourself marketable. I really is as simple as that.

      Anybody can be a code monkey, just as anyone can flip burgers. You think that being able to code PHP or Perl gives you some kind of right to a good wage?

      Personally, I'm a pretty good programmer and okay hardware designer. But it's my passion for these things (especially hardware) which drives me to better myself and my broad range of interests give me many different ways to attack a problem. This sets me apart from many other people or even EEs who went to school, got their papers and sat on their laurels. If I ever become complacent then yes I will fall by the wayside. Is that someone else's fault? Should I have some kind of prop? Of course not.

      (And yes, I do have a young family, four other mouths to feed, car loans, a mortgage and credit cards. Telling me to grow up and "wait till I have a life" aren't valid.)

    4. Re:Of course, only in the US by dbrutus · · Score: 1

      Tell that tripe to the people who get harrassed, beaten, or killed breaking strikes. If unions are more than violent extortion rackets, why have they lobbied for and gotten special legal protections so that they cannot ever be blamed for union violence? If a company were to be as violent as unions are, the board would go directly to jail for the violence and probably also get nailed under criminal RICO.

      DB

    5. Re:Of course, only in the US by fintler · · Score: 1

      Union companys' work on a contract that is agreed on at a specfied time interval. Management will not allow someone to do something like this an still be able to keep their job. That is not what unions are for. Thay are to ensure that you cannot be given an unfair salary for work that obviously deserves more credit.

    6. Re:Of course, only in the US by Fobi · · Score: 1

      Now, it's just extortion (either you give me this, or we wont work).

      Extortion? No, that is the free market. You are allowed to claim what you want for your labour. If you get what you want; now that is for the market to decide.

      Of course if you see that the company can not afford to give you what you want then there is now reason to ask for it. Be happy with what you get or find a new job. But, this is for you to decide.

      If you think that your superiors could have given you a larger share than you are getting you are free to go and ask for more. But, if they don't feel like giving you more, then you can just forget if you are making your claim alone.

    7. Re:Of course, only in the US by dbrutus · · Score: 1

      Third world countries are third world countries because the government steals too much and is too capricious to invest in without bribing left and right.

      In that atmosphere workers are screwed already. The only hope is to get skills and emigrate into a high paid H1b job. If you're successful in the US, come back and build a business back home and treat people decently.

      DB

    8. Re:Of course, only in the US by Kyobu · · Score: 2

      How is it good for the economy? Because it's good for workers. The economy is not purely measured in the size of the GNP, the Dow and the NASDAQ. It's also measured in quality of life.
      I think it's interesting that your description of extortion, "either you give me this, or we [sic] wont work," is in fact a description of a market economy, which can be summarized as "either you give me a better price or I won't buy your gizmo." Unions are not extortionist. What's extortionist is when an employer says, "We're employing you for $2 a day with no health benefits and no recourse if you get injured. You'd better keep working here because if you don't, we'll fire you and be deprived even that $2. And if you try to unionize, we'll fire you, also."
      Adam Smith, the idol of capitalists, would in fact have approved of unions, in my opinion. He believed in unfettered bargaining for goods and services, in a free marketplace. It's disingenuous at best to assert that a nonunionized job is equivalent to a marketplace. The employer has control over everything, and the worker only has control over whether he works there or not. If he decides to go somewhere else, he is unlikely to find anything better if employers are left to their own devices. Only with collective bargaining can labor be put on an equal footing with management. I could cite lots of cases of employee exploitation, but I'm sure you're aware of them, too.
      The tech world is no different from other industries. Simply because there arent's any knives or swinging cattle carcasses doesn't mean that there aren't hazards, or that employers don't exploit their (often easily-replaced) employees.

      --
      Switch the . and the @ to email me.
    9. Re:Of course, only in the US by DaBunny · · Score: 1

      How does keeping yourself marketable protect you against a poor job market.

      I know we're talking ancient history here, but take a look at what happened about 20 years ago. There was a huge demand for engineers. Mechanical, chemical, etc, etc. Pay for engineers was through the roof. Companies tried everything they could to hire them, and lobbied to allow more engineers to immigrate. It was a great time to be an engineer.

      Then the economy slowed some, and changed some. Suddenly people who were able to write their own tickets had to scramble for jobs, or even take low-paying jobs in different fields.

      Of course nothing like that could ever happen to tech workers...

      Of course you should work hard to keep yourself marketable. But don't think that's a guarantee. And don't be so sure you'll never need help.

    10. Re:Of course, only in the US by cyber-vandal · · Score: 2

      Yes, companies pull occasional bullshit like firing people without telling them, but that just means your labour laws need a bit of tweaking. If that happened here in Canada, you could sue their asses for wrongful dismissal.

      In the UK, we have to pay for our lawyers, so unless you've got a lot of money, your only hope would be to get union support. I'm tired of hearing that unions are evil. With secret ballots being mandatory, what's to stop the members voting out a corrupt leader? Why shouldn't employees want to protect themselves from poor management?
      This argument is all because the media lies are believed about union excesses and the excesses of corporations are smoothed over. Could this be because the owners of the media don't like unions rather than unions being bad?

    11. Re:Of course, only in the US by tzanger · · Score: 1

      Then the economy slowed some, and changed some. Suddenly people who were able to write their own tickets had to scramble for jobs, or even take low-paying jobs in different fields.

      Okay I thought you talking about letting yourself slip and not being able to find a good paying job in your field. But tell me this: How do unions protect against your job going tits-up? They can't keep ALL their tech workers in jobs with great pay if the economy just won't support it...

      With regard to the economy taking a shit and the tech market shrinking: That's why you try to keep diverse. I do electronics design and write code, but I am good enough to be a decent network admin and with a bit of help could design networks (LAN *and* WAN) because I have the basics down, I've done some (small) setups and know about a lot of the mistakes which are made. I subscribe to trade mags outside my immediate knowledge so if need be, I could get into another market with a little bit of bullshit and kick into high gear and learn what needs to be done. Hell, I can do household rennovations and fix cars, too. Diversity is the only way to keep yourself from getting trapped in a market which may not be there tomorrow. I really would like to hear how a union would help you here.

    12. Re:Of course, only in the US by dbrutus · · Score: 1

      When you get out of the early 20th Century, let me know. You are clearly living in the past.

      It took all of 5 minutes to look up the Enmons decision, a 1973 ruling that exempts unions from extortion law if the extortion is undertaken to further legitimate union objectives. That includes cases of assault, even murder. You might want to check out the Cato institute. Here's an URL: http://www.cato.org/pubs/pas/pa-316es.html

      12 state codes also follow the federal rules.

      DB

    13. Re:Of course, only in the US by dbrutus · · Score: 1

      No arguments that companies hired their own thugs but that's pretty much taken care of in the legal code. The past abuses by Pinkerton in no way justify present legal preference for union violence.

      DB

    14. Re:Of course, only in the US by Tackhead · · Score: 2
      >What happens when your "skills" are commonplace and the job market is no longer tight?

      You were either smart enough to acquire new skills for which the job market is tight while your old skills were current, or you lose your job.

      Or you pay a bunch of thugs a few percent of your paycheck every month to preserve your job, even though you're obsolete, and your job can be more efficiently performed by someone (or something!) else.

      I prefer to live in the former reality, not the latter. Therefore, I will oppoze unionization in my industry and my company, and I will not work in a union shop.

      My company is run by managers smart enough to realize that the way to succeed is to make the employees sufficiently happy that they'll never want to unionize.

      If your company's so bad that you want to unionize, it's a symptom of a problem with management. A union is a brute-force solution - beat the crap out of management until they grudgingly give you a few pennies back; with luck, it'll be more than the union thugs take. The better solution is to enclue management until they take the right steps to fix the underlying problem of employee dissatisfaction.

      Any manager who refuses such encluement can easily be dealt with by leaving such a company.

      Isn't it ironic - the Marxist fantasy of how the "workers shall own the means of production" is the reality in the tech world, by definition.

      If you're a leftist tech worker, re-read your Marx. You don't need the class warfare, (of which a Union is part) because you're already living in utopia.

      If you're a rightist tech worker, just laugh ;-)

    15. Re:Of course, only in the US by RandomPeon · · Score: 1

      And in third world countries can the cops beat up working-class people who complain, companies can collude to pay zero-level wages, and the working class gets fucked into the ground. Real intelligent post here.

    16. Re:Of course, only in the US by Kyobu · · Score: 1

      Uh, companies are as violent. You clearly haven't read much early-20th century American history. The employers beat the living shit out of union members every chance they got. And you wanna find a citation for your assertion of "special legal protections"?

      --
      Switch the . and the @ to email me.
  106. Perspecives on unionization by einhverfr · · Score: 1
    I know of *no* industry where unionization has decreased wages or really adversely affected employees.

    I am not so sure. It is my experience that where workers are well treated and appreciated by the management, that unions destroy the dialogue that can potentially create a unified and powerful company and community. THe fundamental purpose of a union is to advance the members' causes, and the exclusion of management from this process is not always a good thing.

    Don't get me wrong, I think that unionization can also be a good thing where the process has already broken down. But it is neither a panacea nor a road to Utopia. Rather unionization is a reply to bad management decision that create a conflict that never should occur. It is therefore a call to arms in a conflict that never should have happened and for which the management holds entire responisbility.

    --

    LedgerSMB: Open source Accounting/ERP
  107. let them form, already! by SupahVee · · Score: 1
    I would have to say that I stand on both sides of the issue.

    On one side, you have the pro, which says that yes, employers do nothing less than rape the talent of highly skilled workers, all for higher profits, better stock prices, and longer vacations for themselves. All the while, people like you and me are working 80 hour weeks with a vacation a year consisting of a friday-monday weekend vacation. It sucks, plain and simple. I didn't strive to be good at what I do only to have the sales and marketing people who run companies to determine that I am not living up to their f**ked up standards. I say form up, get some tech power organized and watch these sales and marketing mgrs crap themselves when their whole MIS/IT/IS group goes on strike from being given 2 week deadlines for 4 month long projects.

    OTOH, I married into a phone family, my in-laws, their parents, and a most of their friends worked for the Bell, when it was just Bell. They were all in the union, and they had their cars trashed, lives threatened and were damn near physically assaulted when they HAD to cross the picket lines just to be able to buy food and pay their utilities in the middle of winter in Minnesota. Where was their strike pay that was in their union contracts? It was gone, nobody knew where, but the only consolation that they received from the union was a picnic with chips and soda.

    Unions can be just as corrupt, if not more, than the companies they represent, and there isnt a whole lot to stop them.

    I guess there really isnt a way to say whether or not a tech union would turn out alright, but it certainly stands a bigger chance of succeeding with people like us (read /. readers, Linux geeks, and even the occasional Windows user, provided they are really likable) than with that corrupt bunch of criminals called the CWA.

    --
    "See, we plan ahead! That way, we never have to do anything now."
  108. So you want a union... by msobkow · · Score: 1
    There are tech related jobs like help desk, system support (tape monkey), wiring infrastructure (cable monkey), and the like which might benefit from a union.

    There is a tremendous need for the "Steady Eddie" programmer as well -- the people who prefer a 9-to-5 job monitoring and maintaining existing systems; people who don't love their job, but do it for the paycheck and stability. I could understand them finding some appeal to a union, as they are typically not as well paid as other programmers in the industry.

    The developers who get "used" by fly-by-night dot-coms and soon-to-go-public companies allow themselves to be used. They're naively chasing a dream that they're going to win some magic IPO lottery, because a few hundred other people in the industry have.

    Take a look at the serious professional, and you're far more likely to find someone who has the experience and confidence to say "no" to the unreasonable demands. They're also the people who will present a reasoned, thoughtful explanation of why a schedule is unreasonable, and provide proposals that are reasonable.

    Companies and organizations that want to compete in the IT field want the professionals to lead the teams, and a bunch of regular programmers to implement those visions. They want people who are self motivated, self-training, and realistic.

    What the industry doesn't need is a skirt for the incompetant to hide behind, nor a mass of average replacable workers who think they "deserve" an unreasonable wage because they've "got experience."

    I deal with far too many people already who think that experience relates to their years in the workforce. You can spend ten years working with the same tech and the same tools, and still be inexperienced. All those years won't help you worth squat when that market dries up and you need to shift gears.

    I'm far more interested in working with people who are willing to learn on their own, try different tools and technology, and who can see how those alternate viewpoints relate to their job. I like working with the creative code artists who see the commonality and similarity of diverse systems, who do perverse things like use compiler techniques for parsing data files.

    Those are not the goals of a union. The union wants everyone to fit in cookie-cutter categories and salary bands. They want pay for years of service, not for breadth and depth of useful experience. And most of all, the union wants their cut of your paycheck.

    Unionize IT? Ttthhhpppttt!!! The very idea comes from the same lawyer-driven camps as software patents.

    --
    I do not fail; I succeed at finding out what does not work.
    1. Re:So you want a union... by DoofusRufus · · Score: 1

      I thought if you were incompetent you were promoted in to management.

      --

      'Looking back to a better day, feeling old and in the way.' -David Grisma

  109. Re:Unions can be useful by Peter+H.S. · · Score: 3

    Yes. This is something that a lot of people miss about unions; the legal protectection against abuse.
    Here i Denmark, the IT-workers has a rather good union called PROSA. When you have to sign a new contract, NDA or noncompete, you just take it to the unions lawyers first, so they can look it over. Since these lawyers are experts on their field, they can give you good advice,like; "this is standard stuff, you can sign it." or "take the contract back, and make them change this line, because..." or "This is a lousy contract, but you can sign it anyway, because if they try to enforce it, we will take it to court, and win."
    Especially noncompetes, can be really, really bad for your career. Why learn that the hard way?

    I know, smart US IT workers take their contracts to a lawyer too. But if push comes to shove, it is really nice to have a union behind you. It seems that a lot of US citizens, often prefer to drop to take any action against really unfair work treatment, even though they have a really good winning case, simply because, the thought of a long, legal struggle, would grind people down, or that the slight chance of losing the case, would mean personal ruin. So people swallow their defeat, and humiliation.

    But if the union is behind you, the picture might change; The corperation can't play the "we grind you down in a long lasting legal struggle" card, since they now deal with an organization.
    The employer can't intimidate the worker, with a bunch of lawyers, telling him lies, since the union got lawyers who knows the law.
    And the union cover the legal cost too.

    Most cases are standard stuff, but if a case is really unjust, the union can throw all its weight behind it. Something you can't get, when it is just you and your lawyer, against a perhaps large company.

  110. Unions Have Served a Purpose by Kenneth · · Score: 1

    I've read a bunch of comments about how unions are only for the lazy, and unskilled, and I had to comment.

    Unions were organized to protect individuals. Let me tell you a story:

    In the days before unions, a mining company set up a coal(?) mine, quite some distance from any town. Since they needed a lot of workers, they also set up a town, but (of course) the company already owned all of the land, then rented it to the employees. The only stores around were owned by the company, and the only transportation available provided by the company. Also note this was either pre automobile, or at least before they were so common.

    Workers were paid exactly enough money to pay for what they needed (nothing more), if it was found that they had been saving money, they either had their pay cut without explanation (there was no legal requirment to say why), if they tried to leave, they had to pay some large amount of money to 'repair' the property.

    Eventually the workers tried to organize. The company called out the national guard, and told the national guard that they were heavily armed and very dangerous. They were all killed, and not just the workers, but their wives and children who had taken cover with them.

    The company saw nothing wrong with mass murder in order to put down a forming union that was organizing only to demand an end to what amounted to slavery.

    Tell me, would a union have protected only the lazy in this circumstance? The company prevented you from leaving, they made sure that you couldn't leave, or if you did that you couldn't reach any other destination alive (remember the transportation problem). Until unions came along, slavery in the United States was still essentially legal. You may have had the legal freedom to leave, but it was plainly made impossible to do so. They might not easily be able to beat you, but hey mining is a high risk occupation.

    Moreover, do you think that there would be much in the way of worker safety concern were it not for unions? There wasn't before unions.

    It is true that unions have done some stupid things, but they also fought for the rights of workers. Minimum wage is a result of union forces (note that unions also have a big lobby), laws that give you worker compensation if you injure yourself on the job are a result of unions. Laws that give you the right that right to leave a job and get a new one are also the result of unions.

    Companies will try to extract the absolute MOST from their workers, often at the expense of the human rights of those workers.

    Such things have been done all over the world, and will resume again almost immeadately if unions are done away with.

    Now for the subject of unionizing the tech industry:

    It probably won't have the desired effect. It is true that many of the more skilled employees can walk away from a job, and go to another one. A strict union would not increase competition for skilled workers.

    Besides a universal IT union would be as bad an idea as a universal IT corporation. That is not to say that unions are bad, only that only one union would be a very bad thing indeed.

    It is however necessary to have something to keep employeers from using various methods to control people who COULD walk out the door at any time. One example I read about was someone who was told that he would have to agree to certian unplesant conditions, or another worker would be fired. That worker was not int the IT field, and had nothing to do with the task this sysadmin had been given, she was however his friend, and trying to put her life back together after a bitter divorce, and several other problems. He stayed there for quite a while, because the person who would have been fired was a good person, and his conscience wouldn't let him allow the boss to destroy her life, and since he had no proof of the threat, there was nothing that could really be done about it from a legal standpoint.

    A better solution would be something a little more like a guild. Guilds are more for specialized individuals, and could operate to ensure the quality of employees. If an employee was a member of a particular guild, the employer could be assured of a certian level of competence.

    In return the guild could negociate on behalf of the employee. If an employer breaks the contract, or will not provide what the guild wants, that employer can't get guild members, and has to take his chances elsewhere. If a guild is too inflexible, or demands too much, employers will ignore them, and competeing guilds will be formed.

    Since a someone working outside a guild would not be stigmatized as a scab, the danger of crossing picket lines as such is gone. It will be in the employer's best interest to work with the guilds, because they will have quality workers, if one doesn't assure qualiy, it won't be a guild any more.

    If any person or group of people is given enough power, they will misuse it. That is the reason the framers of U.S. Constitution were so careful not to give too much power to any one individual. If a company becomes too powerful, the company leadership will use it. If a union becomes too powerful, the union leadership will misuse it.

    Unions have done good, they have also done some seriously bad things. I prefer to live in a world where unions exist, I have been told too many stories about what happened before unions, and it wasn't pretty. Many of the laws you cannot concieve of living without were encacted because of the union lobby.

    --
    There is a civil war coming in the United States. Remember which side has most of the guns
  111. Re:Unions not necessary by Felinoid · · Score: 1

    Questionable argument at best...
    CEOs don't get fired for screwing up the budget even when they don't have a Union to blame...

    However companys have threatonned to file for bankrupcy shortly after unionising...

    To defend the unions for a moment.. thats generally due to a mix of issues.. the busness has more problems than just bad employee relations.. but the Union is entirely unsimpetheic and in protecting jobs ends up distorying the whole company.
    There are times when other solutions need to be considered. Unions are a good blut force for employeers who aren't doing right. It's not allways the right solution.. but in some cases it's the only solution.. and in some cases it's the worst posable solution...

    In the case of info-workers.. jobs do not need to be protected...

    --
    I don't actually exist.
  112. Re:I support Unions for the tech industry by Vassily+Overveight · · Score: 1
    That's what they used to say to rape victims.

    My point is, you're not a 'victim'. People arrive here every day with scarcely the clothing on their backs and thrive. Are you saying that with all you've got going for you it's not within your capabilities to find another job?

    --

    "If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine

  113. Amazing... by nitehawk214 · · Score: 4

    Most intelegent programmers laugh at the thought of a "tech union"... demand is so high that for most of us we could easily walk and get another job. I recently did just that, much more frendly co-workers and much higher pay. Tho I noticed that there are a great many out there in the tech world that couldn't quite make it into the "elite" status. In fact I see so many freeloaders in my workplace, it makes me sick. The last thing we need is a union to protect these people. There are so many tech jobs out there right now that if you need a union to protect you from management, it means you just arn't smart enough to be in that line of work.

    Although I am clearly biased on this point, I just dont see any other need for a tech-union, perhaps someone else can enlighten me on this issue.

    -nite

    --
    I'm a good cook. I'm a fantastic eater. - Steven Brust
    1. Re:Amazing... by UniqueUserID · · Score: 1

      I'm going to agree with this post. The Tech Workers of America (can we use TWA now that the airline is nearly defunct?) won't ever get off the ground.

      I was able to get a $150,000+ job by myself on my own merits. A Union would only dilute my ability into a general pool of dumb, protect the stupid (God knows there's a million of them out playing techies in the workplace), and take dues out of my paycheck, rather than concentrate it in my pocketbook.

    2. Re:Amazing... by osgeek · · Score: 1

      Complete Agreement.

      In my experience working for a Silicon Valley startup, working at Apple, and starting my own company - a quarter to a third of tech employees are marginally useful at best, and wasteful malicious freeloaders at worst.

      In a downturn, these people should be let go to protect those at the company who are doing the best work and to protect the shareholders.

    3. Re:Amazing... by johnlcallaway · · Score: 1

      Thank you for pointing out which groups Unions hurt. They hurt those that can take care of themselves, either because they don't have the personality traits or skill sets.

      There are companies that have unions which are structured such in a way that it brings productivity to its knees. A previous position I held was at Bath Iron Works, where I couldn't even move my PC from one desk to another. Where it takes two people to install memory (an electrician and a PC technician). Where a network admin couldn't even use a screwdriver to tighten a loose network patch panel, but had to wait for an hour (of outage) for an electrician to show up. Where salaried employees were constantly threatened with grievances if they did something a certain way. Tell me again why I can trust my fellow workers? I couldn't wait to get out of there. (Although walking around on Aegis destroyers being built was way cool!!)

      In my career, I have been an operator, DBA (Informix, Sybase, and Oracle), programmer, UNIX admin, and network admin. Tell me one union shop where I can maintain all of those skill sets. Instead, I can only exercise one of those skills, which will lower my value. I get paid what I get paid at my current job because I can move around and provide support in all of the above areas, sometimes even on the same day.

      So, tell me again how a union would help me? Or is this one of those 'sacrifice the one for the good of the many'.

      All unions do is replace one possibly corrupt bureaucracy that takes advantage of people with another. In the case of a union, it's the workers taking advantage of other workers.

      No thank you, I'll take care of myself.

      --
      I rarely read replies, it's my opinion and if you thought about your opinion a little more, I'm OK with that.
    4. Re:Amazing... by f5426 · · Score: 2

      > Although I am clearly biased on this point, I just dont see any other need for a tech-union, perhaps someone else can enlighten me on this issue.

      Just answer those simple/not-so-simple questions:

      1/ How old are you ?
      2/ How many hours a week do you work ?
      3/ How much holidays a year do you have ?
      4/ Do you have children or a familly ?
      5/ What do you want to do with your life ?

      Cheers,

      --fred

      --

      1 reply beneath your current threshold.

    5. Re:Amazing... by susano_otter · · Score: 1

      Why do we need a Union? Computer Techs, along with Academics, are virtually the only people on earth using the Internet properly.

      We have the ability, the skills, and the inclination to freely exchange information: thoughts, ideas, opinions. The information age makes Unions unnecessary - obsolete - for us! Why do we need a Union?

      To collectivley bargain with our employers? We're already a collection of individuals sharing opinions, organizing protests, formalizing policies - all without paying dues to some organization!

      To lobby the government for legislation to improve our work environment and reward system? We already do that, too - but not as much as we could, or should be.

      The fact is, we have here the opportunity to transcend unions altogether. We have all the tools we need to organize; the solution isn't to bring in new tools (or , in the case of unions, old, cumbersome, and often corrupt and counter-productive tools) - the solution is to use the tools we have.

      Collective bargaining? Yes
      Unions? Hell no.

      --

      Any sufficiently well-organized community is indistinguishable from Government.

    6. Re:Amazing... by No+One · · Score: 1

      Hmmmm.... Let's take that a little farther

      Using a house to shield you from the forces of nature is spineless and wrong.

      See how bloody stupid that statement was?

      Fact is, the vast majority of our institutions are *designed* to shield us from those forces. Government. Police. Fire department, anyone? Insurance companies.

      Maybe the best way of dealing with it is to find a way to protect yourself from negative consequences?

      --

      --

      There is no sin except stupidity -- Oscar Wilde
  114. Re:Unions by jmv · · Score: 2

    We need unions. That is why its the united states of america.

    I'm sorry, but I have to comment on that piece of patriotism... it's just that there are also unions outside of the united states. And AFAIK, US didn't invent it (UK, I think), nor is it the country with the most unions.

  115. Re:Unions, fine. Closed shops, no. by mssymrvn · · Score: 1

    This might sound fine in principle, but given then history of unions harrassing scabs and management I don't think this will happen. Courts in this country have more or less made it possible for unions to do almost anything but kill to defend their position. Quite frankly, I don't want somebody from union hassling me every day b/c I want to get paid more than him for knowing more and working harder. Unions are monopolies on labor and *should* be considered a trust. I have yet to see much or any proof (and maybe I haven't looked hard enough) where those that work hard get the recognition they deserve. With unions the pay will always be lowest common denominator and the idea of bargaining for your own skills will go right down the tubes.

    It's just not worth it for tech workers - the field is too competitive to lose the money b/c some old guy who's still looking for the Any Key has been in the job longer.

  116. Re:We need to unionize, why? by alcohollins · · Score: 1

    Monopsony? Is that why I can't get a PlayStation 2?

  117. These companies need to get together by Paradise_Pete · · Score: 4
    All these companies suffering from this problem ought to organize. Their collective bargaining power would be able squash any of this pesky "union" noise.

  118. Re:Amazing... - by mindstrm · · Score: 3

    1) If all programmers, as a union demanded that, tehre would be less programing jobs.

    2) Tech companies screw employees usually only because the employees are young (or rather, if they were a little wiser, it wouldn't have happened).

    3) Of course. Companies can always screw their employees. But I want to see big companies first. If MS Employees unionize, I can understand that. But I don't want to be labelled badly as 'non-union labor' just because I don't want to play in your club.

    You know.. all too often, all the pro-union stuff sounds great at first. I mean, it does. Fairness across the board, benefits, etc.

    I watched a supermarket go union. The promoters came in, and over a year and a bit, took a place where everyoen *liked* the boss, adn everyone was treated fairly, pretty much all would agree... and different people had different non-official benefits.. like the lady with her crazy sister who had to go take care of her all the time.. bos cut her LOTS of slack, gladly.. she was part of his community. Boss kept some peopel in who could only work a couple hours a week, because they tried, and needed the money. Boss did LOTS of things, like giving people extra days off, rewarding good work....
    Once the union came in.. sure.. everyone got a little raise... the boss no longer had say in seniority, could no longer decide who or what should be in charge of what (not to the same degree anyway)... and.. no longe rhad the freedom to be generous with certain employees. Sorry... lady, yuo can't work enough hours. No job for you anymore...
    Sorry billy.. you can't spend extra hours after work stocknig shelves.. you're a service clerk.. your contract says you can't do that unless I promote you adn give you a raise.. they say if I need shelves stocked, I should bring in a higher paid shelf stocker. I know you really simply want to work a few extra hours so you can save up to go to college.. but I'm sorry. The Union says no.

    And now, everyone just bitches abou ttheir 'contract' instead of liking going to work every day, knowing that the owner of the shop, who is *responsible for the fact that everyone has a job there*, is their friend and respected community member. Now he is just 'management'.

    Tech union? no thanks.

  119. Re:Unions are a SAD JOKE! by TheCeltic · · Score: 1

    Let me get this straight.. so if the need (demand) for a type of skill decreases, then employers should still pay the higher wages? NOT EVEN CLOSE!! .. the GREAT thing about America and Capitalism is that anyone can be wealthy if they work hard, expand their education and have a little luck on their side. - of course if Society (and unions) Teach them TO MILK EVERYONE ELSE and live with the attitude.. it's not fair! not fair!!, it causes employees to become victims. Less productive/Less motivated victims. After all, we all should get the same wages right? (no, not right! the harder working, more skilled employees deserve more $ than the lazy ones that have earned seniority by sitting on their ass in a union for many years) -Celtic

    --
    =-=-=-=-=-=-=-= - The Celtic - =-=-=-=-=-=-=-=
  120. Unions are a SAD JOKE! by TheCeltic · · Score: 1

    I will not join a union unless I am starving to death and that is the only option. Right now, the Unions are the ones that are acting as if they're starving to death. If only that was true. Union == Mobster, Lazy, Useless. Let a union take some of my wages?? For what?? For whining to my employer and making him lose money (the thing that allows him/her to hire me?) No Thanks! At one time they had a place.. now they aren't needed and it appears the union leaders are realizing such. -Celtic

    --
    =-=-=-=-=-=-=-= - The Celtic - =-=-=-=-=-=-=-=
  121. Labor history by perdida · · Score: 3

    Labor history is the history of new technologies coming up, corporations racing to take advantage of them, and claiming that they want to have a direct relationship with their employees.

    Railroad trusts operated camps of Chinese workers who came to the United States to do the jobs that there were not nearly enough Americans in that region to do.

    Why deny dot-com employees the right to organize? Management organizes its institution as it sees fit, often ignoring the technical knowledge of their employees, to the detriment of the employees and the company.

    Customer service employees-tech support staff, sales staff, and even web designers and sysadmins get overworked and underpaid.

    Furthermore, the fact that real wages have been declining for decades has finally borne fruit in a growing group of disgruntled, disaffected people in many industries.

    I feel that this peremptory statement dot-coms make about unions, which presumes to know the attitude of employees, misses the point: Dot-coms have good reason to be afraid of their employees!

    IT employees realize that their skills are crucial to the operation of these businesses. What was once a tiny, specialized field has become the marketplace for more and more people. Unlike the drivers of a fleet of trucks, if IT workers go on strike, all they have to do is make a few keystrokes to disable a system. Only a lack of coordinated effort among these employees prevents them from having this kind of bargaining power.

    1. Re:Labor history by greggle · · Score: 1

      Startups don't work that way. And when my company is off the ground, I guarantee you I'll fire anyone who forms a union in my company. I'll do all their jobs myself before I'll bow to any union thugs

      And if you are in the U.S., hopefully that employee would have the balls to take your anonymous coward butt to court and sue you, the prefered way it seems people these days solve problems.

      Last time I checked, it was still illegal to fire someone for unionizing. Perhaps that why you are posting as an anonymous coward - cover your tracks.

      P.S. Before you start your startup you might want to check out basic employee management relations and the laws that apply to them.

      gregg

      --
      Work Hard, Rock Hard, Eat Hard, Sleep Hard, Grow Big, Wear Glasses if You Need 'Em.
    2. Re:Labor history by Ryano · · Score: 3

      "If you have a vested interest in the well being of your dot-com, are you going to organize an antagonistic force within it?"

      It is a mistake to see unions of employees as necessarily antagonistic to the well-being of the company. Sensible unions look out for the well-being of their members, which means they have a vested interest in keeping the businesses which employ them healthy, and indeed the industry sector generally.

      The well-being of a company is not synonymous with the well-being of its management. What unions in the tech industry could do is essentially ensure a fairer distribution of the company's success between management and staff.

      It's worth noting that in the case of the Cobalt Group the antagonistic note is being struck by management: I read this as a fairly thinly veiled threat.

    3. Re:Labor history by m0zone · · Score: 1

      Gregg he can just do what unions do to ppl when they step out of line lay them off for 1 yr and they go away to another job...unions are thugs and if i owned a biz i would just shut the doors before i went union =)

    4. Re:Labor history by fornix · · Score: 3

      When it comes time to strike, what's that going to do to your stock & options?

      If you have a vested interest in the well being of your dot-com, are you going to organize an antagonistic force within it?

    5. Re:Labor history by pkaminsk · · Score: 1
      Hear, hear! Unions are nothing but organized mobs, and rule by fear (and now by law, it seems). Once a union takes over an organization, even if it is with the majority support of the current set of employees, all new hires are forced to join the union as well. I was sure this somehow violated my (Canadian) rights, but apparently not.

      Unions exist by dint of the right to assemble. What happened to my right to not assemble?

      And yes, I know, I can always find another job... But employers who fire any and all unionized employees, or simply shut down the place when a union forms, have my full support.

    6. Re:Labor history by Anonymous Coward · · Score: 1

      The simple argument against unions in the tech industry is that we simply do not need them. You mention several old-line industries that were unionized with good cause but can not draw parallels between them and the tech industry. These were mostly unskilled labor in areas and eras when available jobs were a premium. The simple fact was that there were not enough jobs to go around and corporations took advantage of it

      You mention sysadmins and web designers as two fields in which employees are often underpaid and/or abused. My stance (since I am both) is that either of these that can't get a decent wage in this market doesn't deserve one. The truth is that this is an attack by under skilled technicians on those of us that are good enough to name our own price. As a one time government employee I've found unions to be burdensome, slow, and expensive.

      Disabling a system with "a few keystrokes" is not a strike. It's sabotage and it's against the law. For every unskilled unionite that attempts this there will be a very skilled (and well paid) technician to undo the damage. The reason unions won't survive in the tech industry are several but chief among them are a lack of willingness by skilled technicians to support underskilled workers and the fact that there are just too many jobs out there for anyone to be unhappy long enough to make the dues worth it.

      TomlinXS
      --
      .sigs are for wimps

    7. Re:Labor history by disneyfan1313 · · Score: 1

      Unfortunatly or fortunatly as the case may be unions just DO NOT have a place in todays modern working world. We are not tied down in one place anymore, there are not areas with just one industry. Use your own free will, you do not like your working conditions. QUIT. You do not like your payscale? BETTER YOURSELF and get a better job, or learn how to sell yourself better. Quit crying and expect someone to take care of you, who do you think you are... Ricky Martin?

      --
      -=SiGH=-
    8. Re:Labor history by RandomPeon · · Score: 2

      Stock options are going down the tubes. If you're betting on stock options to make it anymore you're awfully gutsy. Raw salaries are the way for any company that wants to attract good people to go anymore - even Microsoft has figured this out.

      Unions that can't strike exist - one of the largest unions of all, the AFSCME, is a union of govt employees who are legally prohibited from striking. Transportation unions can have their strikes cancelled by presidential action. But both of these groups manage to leverage pretty sweet benefits by being organized even though their ability to strike is limited or nonexistent. I assume a union could coexist with stock options - a smart one would agree to a no-strike clause in return for options that aren't ridiculously overpriced. It could be a win-win situation for employees.

  122. nearsighted... by AstynaxX · · Score: 1

    Ok, try not to see this as flaimbait, since it isn't intened as such, but..

    What about the future? yes, NOW we can command large salaries from companies, and wander into someplace else with ease if they balk, but what about 5 years from now? 10? 15? The tech market has crashed before, as all markets do from time to time, its just the cycle of things. Sooner or later, the demand will taper off, and maybe decrease substantially. I'd bet you and most of us would love to have unions around then, to keep greedy corps from screwing us too liberally when the leaner times show up. If we fail to organize now, when we have the power to do so with little real opposition, we will face a war to do so when we really really need to.

    I for one support unions, and would join one given the chance. I have a future to consider, and unless you're retiring soon, so do you.

    -={(Astynax)}=-

    --
    -={(Astynax)}=-
    "Darkness beyond Twilight"
  123. Unions help the average at the expense of the good by ry4an · · Score: 2

    Collective bargaining helps the workers at low and average skill level at the expense of the exceptional. Labor unions base pay on minimums and seniority. Many studies (see DeMarco and Lister) have shown that an exceptional developer can be as much as 20 times more productive than an average developer. Unless the pay scales negotiated by the union reflected that (and good luck getting the majority to go for it) exceptional developers would find themselves having a difficult time negotiating the double to triple average salaries they can find now.
    --

  124. My father is a union business rep... by nrftwicked · · Score: 1

    ...and i've seen firsthand how the union can stop individuals from having their chance to stand out, because let's face it - unions are socialism - and socialism protects those that cannot, or will not, protect themselves, sometimes at the expense of those who have the drive to do great things.

    Once my dad had to deal with a situation in which a younger guy working in a warehouse doing forklift work, etc. wanted to improve himself by taking a position of greater responsibility, and was willing to do it for the same wages he was currently getting. The union wouldn't allow it, of course, because it undermined the union to have someone working for less than they had negotiated for that position.

    Are you going to let unions take away your right to work harder for your company to get ahead,and stand out from your less able/less willing colleagues?

    --


    If nobody ever re-invented the wheel, we'd all be pushing around flintstones cars, wouldn't we?
  125. Re:ah, slashdot by Schnedt+Microne · · Score: 1

    The windshield in your car out in the parking lot would be broken out.

    It's clearly documented. It happens all the time. It's the Union way.

    --
    Hay thar.
  126. people in the tech. world: think future by duckpinned · · Score: 1

    Many of them talk about staying with the same company for many years, most techs I know say you should not stay with the same compay for more then four

    Maybe you don't now. but think 10 years down the road. eventually you, and a decent percentage of these techs you know, will want to settle down, get married, have a new generation of geeks, whatever. and when that day comes, you/they won't want to think about headhunters anymore. you wont be thinking that the best response to a bad boss is to move away from him, because relocation once you've started a family isn't easy and it isn't kind to them. at that point you're going to want somebody backing you up when you want better for yourself, because if you get yourself screwed then, there's a lot more riding on your paycheck than whether or not you can get the Sony PlayStation 5, or whatever they're up to by then.

    the union gets them good pay and benefits, no shortage of those that I know of.

    you really think that's going to last forever? the economy, Old and New, is heading probably heading into a recession, and I don't trust the current administration to get us out of it too well. I'm not predicting doom and gloom for all of us here, we just can't rely on Kung Foo skills to get us out of everything.

    1. Re:people in the tech. world: think future by ReTay · · Score: 1

      There are two consulting compainies with in 30mi of me and I live on a farm. Bump that to 60 or less then 1hr drive and it is over 50. Why do I have to move if I switch jobs. I can change companies once a year untill I retire and still not have to move. And everytime sombody tells me I can't git along without them the first thing I do is put my hand on my wallet. It is where they all want to be. Yes I think tech jobs will continue to increase. And yes I will rely on my network skills to keep me employed. I don't need or want a union. And gloom and doom talk will not help your case and only helps you look like a demigog.... The only thing I have to fear is that the company I work for will figure out that my grumbleing around raise time is an act so I don't have to pay them to play with all their wonderful toys. ;)

  127. Soacialists by ONOIML8 · · Score: 1

    The last thing we need here in the land of the free and home of the brave is union activity.

    Anyone who feels the need for a union should move to a country with a government style that is more in line with union thinking. Socialist governments.

    And where I live we've got plenty of National Socialists that I would love to send along with you.

    Union members and NAZI's, I've got no use for either one except maybe as bad examples.

    --
    . Quit playing Monopoly with Bill. Switch to one of many non-Microsoft products today.
  128. Point 4, skills degrade FAST by Dr.+Evil · · Score: 2

    One year you can be bleeding edge, but if you sit on your butt, you'll very quickly become a useless freeloader.

    Security must be the most wicked example of this. Six months out of date means you're useless until you catch up.

    If tech workers were unionized, a prized worker five years ago, given a guaranteed senior position through "seniority", allowed to remain stagnant would be a bafoon. Imagine taking direction from somebody who thinks of Java as some new experimental thing, UML does not exist, and fat clients are the norm.

    Pilots, teachers and the like don't have these problems. They have different problems.

    As for the "idiot construction worker" comment... Most tech people I've known fully respect trade workers. Who in their right mind would call a gainfully employed individual in a job with plenty of free time an idiot?!

    That combined with the "you deserve more" comment has me wondering why you're trying to manipulate your audience.

  129. Re:I support Unions for the tech industry by Vassily+Overveight · · Score: 1
    Once you have a family and a mortgage, cars and educations to pay for, the whole "you can get another job" thing isn't quite as simple.

    I have all of those things and neither am I young. I saw my father nearly wiped out by a bad business decision and a sudden shift in the economy. He buckled down and got back on his feet. For a while, we went to one car, my mother cut my hair, we got our clothing from thrift stores, and my dad worked two jobs. It was tough, but he prevailed and later prospered. It's tough to let go of what we've achieved and have to start over, but it's possible. And it's an available choice. I'd rather do that than count on a union to rescue me.

    --

    "If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine

  130. Re:Bleh by mindstrm · · Score: 2

    That goes absolutely both ways my friend...
    Unions cross the line too.. you better believe it.

  131. Re:Weak unions are America's main problem... by Chris+Johnson · · Score: 2
    Also note there's a parallel- Japan's 'economic miracle', which was very much driven off the same sort of energy. Unfortunately Japan's economic miracle fizzled and they ended up having to suck down serious economic 'readjustment' and settle for having an economy like a normal country- we're next.

    It's possible that unions serve as a vital part of the economy, in the manner of a governor, holding back periods of economic overexcitement and limiting the inevitable corrections after the excitement runs out of steam. Naturally you don't want the union holding _all_ power, that'd be like shutting off the engine entirely and there are plenty of cases of unions that ended up this powerful and totally out of balance. But throwing away the 'governor' is a good recipe for revving until you blow up your engine, and that's no better.

  132. My rant. by mindstrm · · Score: 2

    I'm anti-union, or at least, that's my stance. I've seen the crap they pull... but of course, I don't know everything.

    Folks, Unionization in some trades is different than in others. In some trades, it can have a huge effect on the economy, in others, it doesn't.

    For instance.... I would hate to be viewed as 'non-union' labour, just for offering my services. I don't want some union to turn into a monster that dictates (for the good of it's members) how and when and what those people are permitted to do for a living. I'm sorry.. that's not what it's supposed to be about.

    Now.. if I look more at something like the union that, say, supermarket employees for a chain of supermarkets belong to, it makes more sense. The employees organize so they can have some muscle with the equally-organized company employing them.

    If you work for a megacorp.. maybe this is what you want.

    If you work for a dot-com startup with only a hundred or so employees, get real. You can organize your own revolt if you really want to.

  133. Re:Amazing... - by jCaT · · Score: 3

    This sounds racist to me. If other people are willing to do your job for less, and they're just as capable as you, why shouldn't they get the job? Because their skin is a different colour?

    You obviously know jack shit about H1 visas. Because of the fact that the ONLY reason someone on an H1 visa is here is because of their employer, they are AT THE MERCY of the employer. Everyone here is talking about how they can just change jobs if the work conditions suck- not so with an H1B. They are with that company for the long haul, no matter how shitty the wages are or how terrible the hours are. Ever heard of those stories of people who pay their life savings to be smuggled to freedom, only to be put in to indentured servitude when they get here? Guess what, H1B's are government-sponsored indentured servitude. Who loses? Guys like you and me, who don't get jobs because some poor schmuck from india is getting paid a pittance to work 80 hours a week.

    Call me racist or whatever, but I don't give a rat's ass whether someone here on an H1 visa is fluroescent green, they're being exploited by the companies they work for, at the expense of people who live here. That's not racist, that's pragmatic.

  134. High IQ is always in demand by KlausBreuer · · Score: 1

    Hi everybody!

    Yes, I'm going to sound like an arrogant bastard (and mayhap I am), but I personally don't want a union.

    I can see right here, in Germany, what they do: mainly suck money out of your pocket. See, they are paid wether you have a job or not.

    They also try to force you not to work during a strike, which is simply ridiculous.
    I'm a programmer. Have been since '81. Always will be. Nobody tells me not to work, thank you.

    Only people with poor skills are treated badly. The others walk into (even) higher-paying jobs. Recession or no, this will never change: real good programming requires intelligence, always a rare resource. Therefore, an upper-echelon programmer will always find well-paid work.

    And hey, what better job in the whole wide world than being paid well for your hobby ;)

    Ciao,
    Klaus
    ---
    "What, I need a *reason* for everything?" -- Calvin

    --
    Free PC version of ChipWits at http://www.breueronline.de/klaus/chipwits/
  135. What would you suggest instead? Structs? by The_Messenger · · Score: 4
    Unions are a basic part of ANSI C. If dot-coms outlaw unions, are they going to review millions of lines of code, changing unions into structs, arrays, or macros?

    :-)

    Okay, seriously now...

    I think I'm probably anti-union. I understand how important they are in a market where employers literally decide whether workers starve to death, but in the 21st Century tech sector, such a thing is uncessesary. I'm an individualist, and I would hate to be denied a job because don't want to be part of a union. This happens because unions make companies sign agreements not to hire non-union employees, and if the company breaks this agreement, the union members leave and the company is "blacklisted" in the same fashion that companies blacklisted union members a hundred years ago.

    And this is largely a matter of perspective, but I also think that unions encourage laziness and a lack of personal development. That may be fine for some beer-swillin', gun-totin', wife-beatin' blue-collar white-trash steelworker (not to encourage stereotypes, heh heh) in rural Kentucky, but I'm a tea-drinkin', C++/Java-codin', pasty-white East-coast boy who puts his personal interests and the interests of his employer (after all, I am part of the company too!) ahead of the interests of some amorphous coagulation of power-hungery socialists whose only common thread is their current occupation. (Yes, unions and Socialism have a long, torrid history of pleasing each other orally. Just look at how much union supported Al "I went to China and all I got was this lousy failed political model" Gore.)

    I mean, come on! In an era where any technology worker can turn a great idea into millions in stock options and become a bourgeois CEO overnight, why would anyone in this industry want to encourage such Mafiaesque organizations of groupthink drones who squeeze their employers' balls so they can do poor work and get paid [relatively] big bucks? (Heh, If you need proof of what this, look at the American automobile industry. Unions are the reason American cars have such a [rightfully] poor reputation)

    I'm not discouraging all groups of workers. I am an admirer, for instance, of certain German labor groups who have strict requirements in terms of knowledge and training for their members. When you hire a member of one of these guilds, you are assured a certain level of expertise and quality of work. These workers feel a sense of duty to both their guild and their employer to do good work.

    I am an adherant to what I understand is a typical Japanese business philosophy, where the workers feel they are representatives of their organizations, and work hard to bring the company, and therefore themselves, honor and fortune. In contrast, union members see themselves as their employers' enemies, and work for themselves and their power-hungry union leaders. Much like typical communist systems, the leaders end up becoming militant despots, and the workers, their unknowing robot slaves who think they're benfitting.

    I enjoy my job. I know that I am a part of the same group as my boss, his boss, and the CEO. I know that by doing good work I bring acclaim to the entire company, and therefore, myself. I am not my own enemy.

    Unions can suck my capitalist cock!

    (This as really some wonderfully craffed flamebait, don't you think?)

    All generalizations are false.

    --

    --
    I like to watch.

  136. Re:I support Unions for the tech industry by Hard_Code · · Score: 1

    How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?

    Man, cry me a fucking river. Coal, steel, oil workers. *Those* guys need unions. Those guys give up lungs, give up seeing daylight, for long hours, low pay, and an early death. Technology workers have tremendous leverage (that is, if you are really worth anything, as opposed to some wanker who just impressess non-techies with big words). As somebody said, perhaps we need a technical worker's lobby, to fix up all the fucked up laws created by ignorant politicians. But a union? That is just pushing pansy-assed-ness a bit too far.

    --

    It's 10 PM. Do you know if you're un-American?
  137. Re:Unions by marxist · · Score: 1
    No way. Unions are evil. They dilute capitalism, the system which makes America as properous as it is.

    Properous for who? You must mean the capitalists and people of upper income. When things go well in the US, not all prosper equally or proportionally for their work.

    "Canada, by contrast, is a much easier place to organize. You'll note also that Canada is generally considered to be an (ugh!) socialist country."

    Canada is a capitalist economy, I do know that for sure. I'm not sure how much your capitalists rely on the government though. You probably have a more represntive government, which allows such things as nationalized medical care.

    Here in the US we have "state capitalism", where tax payer dollars fund the research of the capitalists. It is not entirely this way, but the most of the major developments have occured in public institutions and national agencies. Our government is far less representitive than yours, even though we so often champion democracy.

    "Look at the automotive industry. It's full of people who do menial tasks like machining brake pistons. And yet, their unions are so strong that they get paid $35/hr+ - for minimum wage work!"

    How about the automotive CEO's that make 60-70+ million a year? Now that is wage inflation, at least the guy making pistons is producing something.

    "Faced with competitive pressure from non-union workplaces (ie. Asian companies especially), with the $35/hr trailertrash brake piston machinist, Detroit can't afford to throw out the marginal parts. It's only because of sheer tenacity and Big Three ingenuity that Detroit has survived. United Auto Workers have become a liability to themselves and Big Three shareholders."

    Ingenuity? You mean convincing the US government to ingnore mass transit, therefore making a car a neccesary purchase for anyone with a job. The rest is just marketing and fancy electronics. The automobile has its purpose, commuting isn't it.

  138. Re:We need to unionize, why? by Ian+Bicking · · Score: 2
    Unions will fail in tech, because "scabs" will laugh and cross pickup lines, and we're as a rule not imposing enough to scare them.
    Like most highly-skilled professions, employees potentially have a lot of power. You can't replace a good employee easily. And unlike other professions, the top 10% of the workers are 10 times as productive as the rest. (well, okay, maybe not quite that much... but it's still pretty extreme)

    What it takes is for some of that top 10% to decided that they value power over their employement (beyond do-this-or-I'll-quit), some degree of safety in their employement, due process in their fate, and benefits beyond simply money. Heck, they might get more money too.

    In an informal way, this has already kind of happened. A large portion of the highly talented programmers et. al. have shown that they don't value money over everything. They aren't executive, they aren't "professional" in the anything-to-benefit-the-company fashion. They actually have moral conviction and will act on it. So things aren't that bad. At the same time, it's not a big step to unionize from here.

  139. Do people in the tech. world think union? by Guysdrinkingbeer · · Score: 1

    I have never been in a union, but the memebers that I know do not think like people in the tech. world. Many of them talk about staying with the same company for many years, most techs I know say you should not stay with the same compay for more then four. They talk how the union gets them good pay and benefits, no shortage of those that I know of. I just don't think that teches think union.

    --
    Great people don't need people to complete them, great people complete other people. -- Matthew Pawlikowski.
  140. Re:Amazing... - by Ian+Bicking · · Score: 3
    If a company is willing to screw consumers with "content protection" do you really trust it not to screw its own employees?
    You can also see a model in some more activist unions of the union opposing things that aren't directly related to employment, but represent the beliefs of their employees. The National Education Association is probably the most notable such union -- much of their lobbying in education isn't related one way or the other to employment, but simply reflects what teachers believe are the best ways for schools to operate -- as opposed to what pundits, principles, school boards, and sound-bit-searching politicians think is best.

    It would be nice to see something like this for technology.

  141. Re:Unions suck. I'll quit if forced to be in one. by Neumann · · Score: 1

    I fully agree that unions had their place. There is a lot owed to the people who stood and took beatings from strikebreakers and all the other awful things that corporations did to their employees. But given a choice between me deciding what perks, benefits and wages are best for me and a union deciding which of those things is best for me, I will trust my decision first and foremost.

  142. My biggest impression of unions. by JWW · · Score: 1

    My biggest impression on the evilness of unions, came while I was unpacking for a trade convention in Philedelphia. I had to be sure not to be seen carrying my own boxes into the building, they had union workers whose "job" it was to do that. Unions, what a load of shit.

    1. Re:My biggest impression of unions. by Caspuh · · Score: 1

      The subway system in LA is equiped to operate itself without operators in each train. Unfortunately the transit authority has to hire a certain number of union workers. This means that these people get paid $20 an hour to operate a throttle and call out the stops. What a waste. Of course, it was really fun when they went on strike for a few months last year.

  143. Re:I support Unions for the tech industry by IntlHarvester · · Score: 2

    What you are interested in this case is passage of immigration laws which would punish companies abusing H1B employees.

    And who will lobby Congress to pass such laws?

    Well, there's Unions. And ... Nope, that's pretty much it.

    Problem is the Unions currently have no stake in the technology sector so aren't really all that interested in using their considerable clout to clear up the H1B situation. If parts of tech work (lets say operations type stuff) would start getting union representation, the H1B abuse that we've seen wouldn't last long.
    --

    --
    Business. Numbers. Money. People. Computer World.
  144. Re:Amazing... - by tbo · · Score: 4

    The problem is that right now we're settling for less than what we should expect. There are some fabulously profitable companies out there. But all of that money was made by coders, who got a generous amount of money, but in all honesty deserve more.

    This sounds suspiciously like communism and the labour theory of value. Just because somebody didn't type a line of code doesn't mean they didn't contribute. As much as I hate sales and marketing, I know that they are also essential to most companies. Companies live and die by their management--just compare a well-managed company to a poorly-managed one, and you'll realize how valuable management really is.

    Maybe you don't think CEOs deserve their multi-million dollar salaries. The truth is that the good ones easily earn their paychecks and more. For instance, Apple would be dead and buried without Steve Jobs. In that light, no matter how much they're paying him, he's clearly been a net contributor to the company.

    2. Tech companies haven't been above screwing employees. People get let go a couple weeks before their options come due, often for fabricated reasons. H1-B visas get rammed through Congress to drive down IT salaries. Imagine if the Big Three automakers tried to import tens of thousands of foreign workers and then pay them substandard wages!! It can only happen in IT.


    This sounds racist to me. If other people are willing to do your job for less, and they're just as capable as you, why shouldn't they get the job? Because their skin is a different colour?

    Marketing practices of today may become labor practices of tommorrow. If a company is willing to screw consumers with "content protection" do you really trust it not to screw its own employees?

    If they screw you, you leave. With sites like F*ckedcompany.com around, it's not too hard to find out which companies suck before you apply. If it's true that marketing behaviour is indicative of employee treatment, then it should be really easy to avoid loser companies. You have nobody to blame but yourself if you don't do your research.

    A lot of anti-union people scream "I'm too good for a union - unions are for idiot construction workers." But many industry that depend on highly skilled labor are highly - pilots, aviation mechanics, teachers, athletes, actors. It obviously works for other "knowledge industries".

    Three of the five groups you mentioned have recently pulled or are pulling strikes about bullshit issues and making ridiculous demands. I'll focus on teachers' unions:the teachers' union in BC used parent volunteers as an issue in a recent strike. They told teachers, "Remember, parent volunteers are here to take your jobs." The union actually wanted to keep parents out of schools. This had absolutely nothing to do with helping kids, and would have destroyed many sports teams and other extracirricular activities. These unions force job advancement to be dependent on seniority instead of performance. That harms kids, and removes any incentive for teachers to do a good job. The good teachers ultimately become bitter and frustrated with the system as they watch bad teachers climb up the ranks because of their seniority. The result is the mess that the public school systems have become today.

    Technology unions probably would be different than old-school unions...


    Oh, sure, at first they would be. They'd be all dressed up as something new and shiny, and they'd try to make us think they'd reformed. Gradually, they would reveal themselves, taking larger and larger bites out of our paychecks so they could donate money to political candidates we didn't support. They'd misinform employees to make them hate management, so they would have a stronger hold over us (I've seen this very trick happen before). Unions are corrupt--don't kid yourself. Unlike corporations, they have nothing to gain from good employer-employee relations.

    I know of *no* industry where unionization has decreased wages or really adversely affected employees.

    It's a basic truth of economics that increased prices will result in decreased demand. In other words, if unions artificially jack up wages, the result will be lost jobs and an inefficient economy. It's not a coincidence that the computer industry is ununionized and has experienced so much growth.

  145. All you libertarians out there... by abe+ferlman · · Score: 2
    Ok, I've just gotta let loose on this one.

    Money is power. Employers have it, you don't. Unless you're an employer.

    Power doesn't like to compromise. Of course employers don't want Unions, it compromises their authority. "You don't need a union, we have a direct dialogue that we value". Fucking whatever. Let me translate for the dense:

    You don't need a union. Unions increase your negotiating power which makes wages rise and firing people more difficult. We like to pay what we feel like paying and fire who we feel like firing.

    Employers who respect their employers would encourage their employees to form Unions. Employees who work for employers who share their interests have no motivation to join a Union.

    If money is power and businesses are not democracies, where does the power in our society lie? Wake the fuck up!

    Bryguy

    --
    microsoftword.mp3 - it doesn't care that they're not words...
  146. You're not looking hard enough by Scareduck · · Score: 2
    This is nuts.
    Look at pilots - they're less bright than coders by a lot, (I speak from USAF experience), but they're highly skilled and unionized - most airline pilots bring in $100,000+ for doing a job that's substantially less challenging than writing complex code. Did I mention they have unions?
    Yes, and only experienced pilots with the majors get that kind of money. You think Maj. Greenears fresh out of his three-years-and-out stint in the Air Force is gonna make that kind of money flying cargo for TNT or DHL? Uh, no. That is to say, unions are a great deal for those guys in them, but a lousy deal for those not involved. You think they're gonna let some hotshot 18-year-old in the treehouse once they've established a union? You gotta be kidding me. He's gonna have to go through all kinds of hazing before he's allowed in the club.

    2. Tech companies haven't been above screwing employees. People get let go a couple weeks before their options come due, often for fabricated reasons. H1-B visas get rammed through Congress to drive down IT salaries. Imagine if the Big Three automakers tried to import tens of thousands of foreign workers and then pay them substandard wages!! It can only happen in IT.
    I have yet to hear a shred of evidence that foreign IT workers have actually driven down the wages. If anything, they tend to come up to industry norms once they can no longer be legally exploited because of their H-1B status.
    If a company is willing to screw consumers with "content protection" do you really trust it not to screw its own employees?
    Here you are talking about Hollywood. This is a heavily unionized business, and one that is about to have a 32 oz. can of whoopass delivered unto them. There, unions are on the verge of shooting themselves in the foot again as the Screenwriter's Guild has created a setup that may bust that union altogether: by announcing with near certainty that a strike will occur this summer, studios are stockpiling scripts, ensuring no work will get done -- and nobody will get paid. But simultaneously, their heavily counted-upon co-unionists, the Actors' Guild, are still licking their wounds from last year's strike, so there's no guarantee that the actors will honor the WGA's "picket line". This on top of stupid laws, rising real estate prices, stupid union demands (Internet rights? Don't they know there's no money to be made on the Internet?), and idiots in charge of production have seen the heavy attrition of union jobs from showbiz.
    4. A lot of anti-union people scream "I'm too good for a union - unions are for idiot construction workers." But many industry that depend on highly skilled labor are highly [unionized] - pilots, aviation mechanics, teachers, athletes, actors. It obviously works for other "knowledge industries".
    Pilots are expensive albeit hypercompetent bus drivers. Teachers are to education what the jackhammer operator is to the construction industry, that is to say, teachers are in the business of indoctrination rather than education. Athletes and actors are idiots. Aviation mechanics are probably the only group you mentioned that has a semblance of being a "knowledge worker".
    5. Technology unions probably would be different than old-school unions - it would have to be easier to get rid of people, since it's easier to freeload than it is in manufacturing. Contracts would probably be shorter term, grievance procedures would be streamlined/scaled back, working condition issues would be much less important, etc.
    Mmm, no. See, back in the 60's, my dad used to work for what was then called North American Aviation, which was subsequently swallowed by Rockwell. He was a frontline manager at the metrology lab, which meant that he managed the guys who maintained and calibrated all the ohmmeters, oscilloscopes, waveform generators, etc. It being that North American was a "closed shop" (i.e., the union could extract dues from all employees, regardless of whether they wanted union representation or not), my dad ended up getting exactly zero benefits from this arrangement. The union, for all its bluster, got the front line employees exactly zilch as far as increased wages (at that time in the late 60's, raises were impossible to come by), but they sure weren't gonna let go of those weekly dues!

    Engineering unions do exist, but only at large companies. These are not the kind of companies geeks generally enjoy working for anyway -- they tend to be bureaucratic and defensive.

    An anecdote on unions generally: when I used to work for the industrial-defense complex, I worked at a fairly small group within a very, very large company (Hughes Aircraft, if you must know) with about 200 people, of whom the programming staff was about 40 or so. (Yes, you saw that correctly -- 80% overhead. And I think we were one of the leaner organizations!) Somehow, we had inherited a lone union guy, perhaps a Teamster, perhaps a UAW man -- I don't recall. His job, apparently, was to show up for work every day perfectly soused. He was redfaced all the time and reeked of scotch. Most of the time he spent in the warehouse in back. Nobody could say what he did, but we all made damn sure that we didn't try to move computers during the day when he might stumble out from his warren. No matter how incompetent he may have been, he could still issue a grievance against us geeks for taking his (or a co-unionist's) job by moving a Wyse terminal. Ugh.

    I know of *no* industry where unionization has decreased wages or really adversely affected employees.
    That's because you're not looking hard enough. Airline traffic controllers. Eastern Airlines, where the unions badly miscalculated and drove a foundering airline into the ground, leaving all their members without jobs. The auto industry, where they drove down quality, pushing American car buyers into the waiting arms of the Japanese. Unions make stupid decisions all the time that result in a net loss of unionized jobs.

    In the end, unions are about solidarity, not intelligence. If history is any guide, and I think it absolutely is, a programmers' union would rapidly dissolve into pissing matches about who gets to write "if" statements, and who gets to write "where" clauses. Nothing would get done, and the fun (and there is a lot of it) in our field would rapidly drain out of it, to the exact extent that the business is unionized. As one of my friends who works as an animator for a major studio observed once he got his union card, the union heirarchy is dominated by people who can't draw worth a damn.

    --

    Dog is my co-pilot.

  147. What? by Chris+Johnson · · Score: 2
    How can you say this? Every industry is different. Is it me or are IP rights the MOST likely area for collective bargaining to force some improvements in conditions? Do you really, really think the primary concerns of tech IT workers are pizzas and getting to sit around and not code and still get paid? I really don't think the collective concerns of _IT_ _workers_ would add up to that. IP rights are consistently part of IT worker concerns, along with privacy and the ability to pick a technically superior solution rather than *coughMSFTahem* the PHB-oriented concern that is a nightmare but for political reasons you have to use it...

    If you're part of a union and it's NOT backing you on issues as important to a tech as IP is, then YOU ARE USING IT WRONG. What, you figure the idea is to import some grizzled old Teamsters or UAW guys who will make everybody be little slaves to two bosses instead of just one? You've got some funny ideas about who is running the hypothetical tech union show. YOU ARE. Unless you're going to make it work like you describe, in which case who needs you?

  148. Not a Union, but a Guild.... by trims · · Score: 2

    Tech workers don't need a union. We need a Guild. With the breakoff of SAGE from USENIX, I'm hoping (and trying to scream enough) that SAGE will actively become what we need.

    Both Unions and Guilds can provide very important benefits for their industry (not just their membership):

    1. Standard grievance procedures. Got a serious problem with your employer (or another employee) that's not being handled properly? Don't try for the new-fangled arbitration deal - that's a real easy way to come up with the short end of the stick. Talk to a lawyer? yeah, well, maybe you get it settled, maybe you just lose a couple of thou in fees. But if your Union/Guild has a standard grievance resolution setup, well, you're far better off.
    2. Minimum Work Conditions. Yeah, OK, we don't have forced labor. But wouldn't it be nice if you got compensated for carrying that beeper? Being on call? Have a known overtime rate for hours above 50? Get comp time for those 12-hour days?
    3. Professional Standards that Mean Something. If I say I'm a Programmer IV in Java, or a UNIX Admin III, wouldn't your employer love to trust that you really were? Having a reasonable standard rocks. It helps everyone, and gets rid of alot of the slackers.
    4. Professional Responsibility. If we can get collective power, we get power in the organization. No more hanging the poor tech guy out to dry when the impossible-to-do-but-mandated project crashes and burns. In fact, we might even get to nix silly ideas in the bud. Look at professional Engineers. They have to sign off on projects - if they don't, the project doesn't go. Period.

    The big things most of us don't like about unions are things I think we can avoid by having a guild:

    1. Inability to hire/fire and quit/start at will. Businesses need to be able to get rid of people; conversely, I want to be able to quit when I have (or want) to. As long as we can get a good grievance proceedure to stop retaliatory and personal firings, I think we make out here.
    2. Stratified and Standardized wages. This is the big one. While we desperately need a experience standard (see above), the industry is far to varied to try to force a wage schedule on it. We want to be able to negotiate what we can get on a case-by-case basis. Guilds are more focused on maintaining/promoting the standards of the profession, which I think is what we really want.
    3. Massive Beauracracy. I think we're better off with a reasonable national Guild (which probably would have, what, maybe 50 or 100 total people administratively), rather than hundreds of little unions, each with a couple of beauracrats. Take a look at the major unions nowdays (Auto, Airline, etc.). Do we want to run things that way? Keeping ourselves to a minimal central organization lets us (the membership) keep an eye on things, and avoid many of the power abuse problems.

    I want a Guild. I want someone to back me up as a professional, to help me get my job done better and more efficiently (both for myself and my employer), and help insure that I'm not being abused. What I don't want is someone telling me how I have to work, for how much, and what I can't do.

    Guilds, NOT Unions.

    -Erik

    --
    There are always four sides to every story: your side, their side, the truth, and what really happened.
  149. Re:Free Agency Good, Union Bad by DoofusRufus · · Score: 1

    that's because you are management, silly. your employer is just not allowing you to admit it.

    --

    'Looking back to a better day, feeling old and in the way.' -David Grisma

  150. Bleh by Sarcasmooo! · · Score: 1

    Unions have their problems, but alternately it's inevitable that without them, employers will start crossing the line. Problems with Unions can be addressed, but how do you oppose an abusive company without some similar sort of organization? "Everybody's organized but the people."

    1. Re:Bleh by The+NT+Christ · · Score: 1

      You don't need a union to organize. If there's a problem with management, you can bet people have noticed. Emailing everyone in the company except the boss is trivial these days. I've organized plenty of uprisings in my time, albeit at fairly small companies.

      --

      I didn't pay for my operating system either

  151. Re:Amazing... - Point #4 is flawed by Ian+Bicking · · Score: 2
    Strangely, US programmers are doing quite well, even though their salaries have been jacked through the roof (albeit not by unions).
    I'm afraid I don't have a quote, but I have seen note that people with CS degrees today are earning less than they were in the 80s. Certainly not the end-all and be-all of statistics, but I wouldn't simply assume that salaries have gone up.
  152. Only a tech support union?? by tupawk · · Score: 1
    Instead of forcing a union on the whole industry why not only unionize the so called "entry level" positions like tech-support workers??

    Those types of workers are generally paid hourly and do not need a degree. I know some of you say a degree is not neccessary for any IT job and perhaps you are right but most companies whether it is right or wrong will promote/hire someone with a degree over someone without.

    Most tech support workers also work in shifts and have lots of other similarities to other unionized positions.

    Just my $0.02

    --
    "it could just be the midgets. You've got to be careful with midgets in Spandex." --Jamie Richardson
  153. Why I hate 'my' union. by Anonymous Coward · · Score: 1

    I'm a DBA at at an institution of higher education in the midwest, which has a professional/technical union, and not being a "right to work" state -- I'm screwed.

    More to the point, we're all screwed.

    What has the union done for me? Capped my pay raise at 3% three out of the last four years, and removed my will to work.

    I could (and have outside /.) bitch about this for much too long, but the simple facts remain:
    1) Union protection removes the consequences of failure -- so nothing gets done.
    2) Union barganing for too wide a group removes the incentive to excel.
    3) Tech jobs require the ability to learn and apply -- job specs based on "years of experience" don't cut it.
    4)A union shop forces groups of people working _very_ different jobs to group together and bargin under the same contract.
    For example, my contract is bargined by some paper pushers in another department for about 300 people including the mail carriers of the university.
    5) Unions are like herpes -- they're the gift that keeps on giving. Once you form one, good luck getting rid of it.

    It's that last item I'm working on as my gift to my alma mater before I sell out. See, you have to fight city hall to create a union, but you've got to fight the UAW's lawyers and a bunch of guys named "Guido" to disband it.

    It's a giant mess. STAY AWAY FROM UNION SHOPS. (I'm leaving as soon as I get my degree and Oracle Cert...)

  154. Unions suck. I'll quit if forced to be in one. by MikeFM · · Score: 3

    Unions are horrible things. They only make sense for people to stupid and unimaginative to know they can walk away from a job and join a competing company or start their own company if they don't like where they are. I remember my father working years going to night school after work so that he could progress in the world. Finally after a decade or more of special school and training he got a promotion to a job that was much better and paid better. The union sued him and the company and won. He was forced to train someone (without extra pay for doing so) else at the job when they had no prior experience in that field and honestly really couldn't do the job. That person got to take the job while my father was forced to go back to being a grunt worker. The company still arranged so he ended up doing most the work for that position but he couldn't get the promotion or the raise because the union always complained whenever he tried. To top it off the union often strikes forcing him and others who just want to make a living from being able to so that some idiots can fight over if they get 7 or 8 vacation days a year. Luckily now that his kids are moved out and he doesn't have so many responsibilities he is looking for a better job but it was enough to teach me my lesson. I've quit jobs before for organizing and I'd do it again. If I don't like where I'm at I can easily find a new job.

    --
    At what price learning? At what cost wisdom? The price is a man's peace of mind, and the cost is his life.
    1. Re:Unions suck. I'll quit if forced to be in one. by hrieke · · Score: 2

      WTF? I have never heard of a union forcing someone from not being promoted out of the union ranks.
      details please.

      --
      III.IIVIVIXIIVIVIIIVVIIIIXVIIIXIIIIIIIIVIIIIVVIIIV IIVIIIIIIVIII...
    2. Re:Unions suck. I'll quit if forced to be in one. by Omnifarious · · Score: 1

      In all likelihood, all the companies in that industry were unionized under the same union. His dad would've had the same problem everywhere.

  155. Re:Labor history isnt it grand? by m0zone · · Score: 1

    yea unions usely drive out the small guy to keep the area theres...Large companys might go union but small biz could never follow...i work for a union now and its totaly f-cked up..If i had a choice i would never have gone union..but hey I had no choice...it was union or you dont work Boy...Yippie isnt it grand

  156. Answer to: Scabs will replace you union fools by abe+ferlman · · Score: 2
    Dude,

    Leaving aside your pop economics, the "Scabs will replace you" argument is only true of unskilled labor. In tech, getting up to speed on coding projects takes time and effort, and usually is accomplished best by the sort of informal training that happens when you interact with experienced coworkers. Scabs will have a hard time adjusting. Hence, employers will find it cheaper to negotiate than to fight, not to mention better PR. Go preach your management propoganda elsewhere.

    --
    microsoftword.mp3 - it doesn't care that they're not words...
    1. Re:Answer to: Scabs will replace you union fools by alexhmit01 · · Score: 2

      You need to worry about your experienced engineers, not your low level programmers (assuming that you have enough programmers that a union would touch you). If your technical team strikes, you'll replace them damned fast. In technology, you don't have weeks to deal with union whining (most strikes that get covered are usually over minute details, although some are caused by genuine issues).

      Besides, in tech, the union wouldn't really be able to strike. If they went on strike, the company would likely go under, so there is nothing to negotiate.

      Besides, given stock options, most employees are owners, so striking seems counter productive for all but the lowliest employee.

      Alex

  157. Re:ah, slashdot by Ian+Bicking · · Score: 2

    I'd recomment A People's History of the United States by Howard Zinn. It isn't exclusively about unions, but it talks about them quite a bit, and places them in context as well. I found it quite enjoyable to read as well, and I'm not that much of a history buff.

  158. Re:I support Unions for the tech industry by MeNeXT · · Score: 2
    I have worked in the travel industry and have been on both sides, so here is my 2cents.

    In some cases Unions are required due to employers taking advantage of uneducated people. But in most cases the unions hinder the progress/salarie of the dedicated individual. All employees are grouped into classes/departments and perfomance is no longer considered. ie. NOT IN MY JOB DESCRIPTION. Imagine a software house where we have debuggers and programes. If a programer finds a bug he will no longer be allowed to follow it through and fix it. It will have to be transfered to the debugging department to document it and research it. Example: I have seen a hotel maid pass by a news paper in the hallway and call a houseman in order for the paper to be picked up two hours latter the houseman finally has time to pick it up. If a manager would have picked up this paper a greivance would be filled. So a 2 second job took more than two hours.

    As for:

    * Tech companies will lay-off people without a second thought if it helps the bottom line.

    No collective agreement will prevent this. Lay-off's are a part of business, they allow a company to recover when they are unable to make ends meet. If lay-off's are not permitted then you are headed into bankruptcy.

    --
    DRM? No thanks, I'll just get it somewhere else...
  159. HA! by borzwazie · · Score: 1
    Unions aren't going to work so well in the Internet community.

    For one, you don't actually need to work or live where the business actually is for lots of things.

    For another, the job market is so good, if your job sucks, LEAVE. Do you have any idea how many unskilled computer workers there are out there? If you can do your job with even half a brain, companies love you. Lots of paper MCSE's out there...

    If unions get too crazy, businesses will just start hiring foreign workers.

    One of the things I love about my job is that I don't have union politics. None of this "you can't try that, you can't do that, it's not your job, I'll file a grievance with the union rep" bullshit.

    And, just try to get some slacking idiot out of a position. Wait and wait for the union to agree he's a dirtbag.

    I don't think you know what you're asking for here.

    --

    "We apologize for the inconvenience."

  160. Re:Unions not necessary by palinkas · · Score: 1
    Nowadays, unions serve to enable employees to exploit employers.

    Now, Kirk, you need to show me how this is possible. If my co-workers and I work together to create a product, and we ask for more than the product generates in income after expenses, then the company will go under.

    Fact is, workers always take home only a small portion of the value they create. The capitalist keeps the rest for himself. Why?

    Because he owns the company. But where did the get the capital from?

    Look at the social nature of capital, that is, that it's a socially (or human-created) structure, and realize that even high-wage workers are being stiffed. Workers can have the whole pie, dammit...

    Direct action gets the goods! http://iww.org/

    - Paul in Seattle

  161. Re:ah, slashdot by Ian+Bicking · · Score: 2
    The current labor laws are incompatible with a free market.
    The fact that people have to eat isn't compatible with a free market. But they do. The worker/employer relationship is not an exchange of goods among peers. It is fraught with manipulation and coersion, usually to the detrement of the worker.
  162. Re:Probably seniority issues by cyber-vandal · · Score: 2

    And of course people never get unfairly promoted in IT now do they?

  163. Just as an aside... by Mindwarp · · Score: 2

    Here's a link to a CNN story that I found particularly apt.

    Enjoy!

    --

    --
    The gift of death metal does not smile on the good looking.
    1. Re:Just as an aside... by gowen · · Score: 1

      Ahh, so one union boss is corrupt therefore all unions are corrupt. Tell me, do you design code with that "brain"?

      --
      Athletic Scholarships to universities make as much sense as academic scholarships to sports teams.
    2. Re:Just as an aside... by gowen · · Score: 1
      This from a person whos web page is utterly un-navigable without JavaScript turned on.

      You, sir, are a cretin.

      --
      Athletic Scholarships to universities make as much sense as academic scholarships to sports teams.
  164. Re:ah, slashdot by ostiguy · · Score: 2

    He asked for a *balanced* viewpoint in a book, not that of a card carrying socialist.

  165. unionize by deran9ed · · Score: 2


    Union Rep: Just give us 20% of your wages and we'll provide you with monthly brochures filled with an in depth analysis of where your money is going after we masquerade the illegal activities we will actually use your contributions for.

    Dot-Com-Guy: Well according to Slashdot these contributions will not help the Linux movement to overthrow the evil Gates empire

    Union Rep: You see by contributing you assist other dot com'ers who are ending up on FuckedCompany.com

    dot-com-guy: How much will this affect my stock options?

    Union Rep: Well we currently have Sammy the Bull Gravano who has made great strides in the Ecstasy game to invest your money in the hot new pharmaceutical sectors in Amsterdam

    dot-com-guy: Is he a Slashdot moderator?

    Real news you can use

  166. Re:Amazing... - by tidge · · Score: 1

    Yeah... try working for a union. Then try working a raise into a union contract. Sounds like a pretty easy thing. Not so. If you have a huge shop of programmers, DBA's, Lan guys, and the like it takes forever (we've been waiting for well over a year).

  167. Re:I support Unions for the tech industry by abe+ferlman · · Score: 2
    If you work at a company that's abusing you, it isn't their fault for doing it, it's your fault for letting them.

    That's what they used to say to rape victims.

    --
    microsoftword.mp3 - it doesn't care that they're not words...
  168. Unions are needed. by ff · · Score: 1

    Unions are the only way for workers to organize and to have any power whatsoever in influencing what their conditions, pay, etc, will be. I don't understand the people here who talk about unions being useless and 'bad for the economy' and so on. I understand them if they're like venture capitalists, or big CEOs or whatever, because unions do prevent those people from squeezing the most of their workforce, but someone SHOULD prevent that.

    A technology workers' union would be good for technology workers. That much is certain.

  169. unions take away your power by daemous · · Score: 1

    The idea that unions give you power in an environment like this is nuts. My wife belongs to a union at a mental health hospital. The union got them a 2% raise spread over five years in exchange for dropping holidays down to 8 a year.
    If you are a good performer, you don't want to be in a union.

    Unions take away your power and give it to the people you wish could get fired. (Of course they can't since they're in a union!)

  170. Re:I support Unions for the tech industry by jeffry_smith · · Score: 1

    > This is the same sort of argument that drives me nuts when police and firefighters bitch about how dangerous their work is. If you don't like the job or the pay or the hours, quit.

    OK, so when there are no cops, firefighters or EMTs in your community, an arsonist burns your house down, with you in it, and you need medical attention, you'll be fine, don't worry!

    Yes, that's sarcastic, but police & firefighting work (especially in some areas of some cities in the US) IS DANGEROUS. Someone has to do that work. Hopefully motivated people who want to do that kind of work. Is it too much to ask that they be rewarded for literally putting their life on the line every day?

    BTW: I also support pay increases for teachers. They're the ones educating our next generation of leaders (and followers, and others), I'd much prefer they could concentrate on that, rather than on how they're going to feed their family, or can they buy a new car because the old one died.

  171. Re:Now I get it... by bnenning · · Score: 2
    Good programmers know that they can crank out thousands of lines of code in a day if the requirements are well defined. The industry average for lines of code per year dropped to 6500 from 9000 per programmer. Is this because the requirements aren't there? Probably in large measure, but in any case, the average productivity stinks. You elite programmers out there: doesn't the average year of output sound like a slow month?

    Sort of off topic, but this is a bogus statistic. Especially in OO languages, lines of code mean nothing in terms of productivity. Some of my most productive days at have been spent refactoring a bunch of nasty code into more clear and maintainable pieces, often in the process reducing the number of lines substantially. If two programs do the same thing, but one has 30000 lines of code and the other 10000, which do you think will have fewer bugs?

    --
    How to solve most of our problems: 1.Lots of nuclear plants. 2.Cure aging.
  172. Re:I support Unions for the tech industry by cyber-vandal · · Score: 2

    Really. What happens if the new place is just as crappy as the old place? Change jobs every three months and see how willing another employer will be to take you on. What happens if you have a family? Do you move them around all the time? Not everyone is 24 and unmarried in the tech industry. I've worked at just as many bad companies as good ones and it is difficult to tell whether the management is any good, not to mention the fact that it could change for the worse in 9 months time. Unions are a way for workers to have a say in how a corporation is run. Why shouldn't tech workers have that right? It certainly would have curbed the excessive behaviour of some of the companies I've worked for.

  173. Re:Unions = No Motivation To Perform by JonKatzIsAnIdiot · · Score: 1

    I can confirm this. I worked as a network admin at a (unionized) post-secondary educational institution. I got my 2% per year raise annually, just for showing up every day. I worked hard, put in crazy hours, just to get the job done. I got 2% per year. I found and implemented new technologies to improve our network. I got 2% per year. In my department there were two guys who basically screwed around all day. They got 2% per year.

    A union removes any and all flexibililty that a manager needs to promote and reward good staff and correct bad ones. A unionized shop is horribly inefficient because employees are rewarded according to how long they have stagnated, not according to the benefits they bring to the organization.

    Unions are a nice safe place for people with enough gumption to stay off welfare, but not enough to really take care of themselves.

  174. Re:I support Unions for the tech industry by OmegaDan · · Score: 1
    Unsustainable levels of work is absoutley right! (I'm a sysadmin) I worked 15 hours on tuesday (the 23rd), 11am - 2 am and was asked (at 2:00am) to be back in the office by 10am ...

    Our secratary worked 16 horus -- (8am - 12am) and was asked to be back at 8:00am the next morning!

    All this because my boss decided to start working on TWO 50 page proposals just 3 days before they were due ... -- Its his business to start them whenever he'd like, but I think it underlines a critical problem in the workplace -- complete lack of respect for the employees.

  175. Re:We need to unionize, why? by Omnifarious · · Score: 2

    It's not FUD, it's true. I was in a very similar situation when I worked as a bagboy at a grocery store. I made barely above minimum wage, and was forced to pay union dues. It was ridiculous and annoying. If the union had struck, I would've crossed the picket line in an instant, and I suspect most people working there would've too.

    Also, $42/mo is astronomical, IMHO. And I care a lot more about a healthy relationship with management than pay or vacation time anyway.

    I actually kind of favor a tech union because I think management tends to treat their employees very badly (in terms of forced overtime without pay (for salaried) and job stress) and don't listen to them. I don't know if a union could change this, but I don't know of anything that would have a better chance. But if it ever became like any of the major labor unions I'd want to see it wither away and die.

    The worst unions protect mediocre or poor workers, are corrupt, and force you to be a member. They really do. I've heard too many detailed first-hand stories of actual incidents from too many different unconnected people for it to be a made up hoax.

  176. Re:Unions can be useful by Omnifarious · · Score: 2

    Hear Here!

    I'm very suspicious of unions. About as suspicious as I am of large corporations. But, they have their uses. I'm all for mandatory open shops. If workers at a company don't see the need to join a union, maybe it doesn't need one. If the company changes its tune, people will learn, and join the union.

  177. Comment removed by account_deleted · · Score: 1

    Comment removed based on user account deletion

  178. Half Union by Shotgun · · Score: 2

    All the talk seems to be about either a union or non at all. We're smarter than the average button pusher/machine watcher over at the steel mill. Why can't we find a better solution to our problems using the technology we love so much?

    The biggest problems I've heard expressed here as a reason why tech needs unions are:

    1) unrealistic hours
    2) pay that is not as high as it should be

    The main reason not to unionize is that a tech worker can walk next door to get a job at any time. This argument is quickly countered with the idea that individuals don't make enough of a difference to force a change.

    The problem boils down to that the individuals do not work in concert to sway management. Unions fix this, but impose their own overbearing 'management' in the process. I pose this question: Would tech workers work in concert if the had the same expectations of their workplace?

    For instance, many here report being 'expected' to work 12/7 for weeks on end. I find this appalling, as do many others, but yet this poor slob is told, "that's tech work." But what if there is a way for the poor slob to show his manager that 12/7 is not normal in any way, and that professional workers do not find those requirements 'professional' in any way?

    There has been some moves to form a programmer's guild. If one of these guilds posted sample contracts that listed what are reasonable pay and expectations for workers, would it produce change? Specifically, could the poor slob show that to his manager, say," Hell, no!" to his manager when asked to work ridiculous hours, and resonably expect that no other poor slob would step in to take his position after being fired? Could the existance of such a standard of conduct and expectations reasonably be expected to convince the manager that he won't be able to find anyone to fill a position with unreasonable requirements?

    My take on the situation is that tech workers are being taken advantage of because they are young, inexperienced and just don't know any better. I think the situation could easily be rectified if we informally banded together to agree on broad expectations of pay and working conditions. Then the college grad could look at the "What to expect from work" website before the job hunt, and not settle for third world sweatshop working conditions.

    --
    Aah, change is good. -- Rafiki
    Yeah, but it ain't easy. -- Simba
  179. I support Unions for the tech industry by noahbagels · · Score: 5

    Please read this before flaming ;)

    I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.

    Now, the above two lines were only an example.

    The Real Meat of the matter:
    * Tech companies expect un-sustainable levels of work from their employees.
    * Tech companies will lay-off people without a second thought if it helps the bottom line.
    * Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all! (This is taken from real life experience - where a consulting firm completely revamped all employees stock option contract, without protection for wrongful termination / layoffs, and gave us no option but to sign or resign!)

    For too long, people have been of the opinion that: Techies are overpaid, and thus should be mistreated.

    I believe that Technical people are highly paid, for doing very challenging work, that most of the people (even educated well...) would not be able to or want to do.

    Here's my support for Tech Unions and organizing. What does the industry have to fear, if everything is really A-OK already?
    Might we actually get more than a week of severance when the filthy-rich board of our dot-com decides to lay-off half of the company?

    Might people working here, away from their families abroad, actually be able to take reasonable time-off to visit their relatives, and return to work?

    Please be reasonable folks... add the influence of the slashdot readers to the Unions organizing. Listen to their goals if you personally meet those organizing, and if you agree with them, support them.

    1. Re:I support Unions for the tech industry by jeffry_smith · · Score: 1

      > a bunch of us didn't sign it.

      > And they changed it.

      What do you call a group of people at a company who act in unison to have bargaining power with management? Oh yea, a union.

      You just demonstrated what unions are most useful for - they provide the organized way of ensuring workers requirements are recognized & met.

      (and yes, Unions can abuse the power, just like anything - there's good & bad. The key is to keep the good & fix the bad)

    2. Re:I support Unions for the tech industry by Shadow99_1 · · Score: 2

      Well I may not be the original poster you were replying to, but your reply really 'bothers me'...

      Now he's said he's nto all that young, so the first thing I'll mention is that he probably started in this industry before people made alot of money on it & probably didn't have the same chance to save money the way you will.

      Then you say that he in effect should have known better than to have a family & aka 'live a normal life' like anyone else because it may in effect interfere with your future employment options... Are you on crack or something? Do you really think we should all wait til we almost can't have kids anymore just because we need to save up all the money ever needed to take care of them? Should we skip marrying the woman we fall in love with (or guy for those women reading this comment) just because we aren't financially capable of saving money for some time after that happens? (ever seen how much a wedding costs, even the most simple types?)

      Oh one last thing... Not ever IT worker makes enough money they can save it up... Where I live I make almost nothing (I make ~30k/yr). I'm required to own a car ($200 a month used vehicle), required to have insurance (~$166 a month or $2000/yr), have an apartment (~$800/month), it would also be nice to have food (~$200/month), I'm required to eat out several times a week as I can't make the trip home on my lunch hour (btw which I'm not paid for) which adds another $100-200 a month... This is still leaving out alot but when you figure I make almost $2500/month I've now used $1600... & I don't really make $2500/month I make closer to $2100 after taxes (I have near $200 in taxes each check at 2 checks month)... That doesn't give me a whole lot for savings... In fact I used up my whole savings recently when I was in a car accident & got screwed over by the insurance company... They kept me waiting for ages on how much I was going to get for my car (it was totaled btw) & that whole time I had to have a rental vehicle, then they told me how much I'd get for my car & told me my car was worthless as it had been in lots of accidents & had previous frame damage (which was untrue btw, but I didn't have full-tort so I could not sue them to change the amount to a more accurate sum). I spent almost $1500 on a rental car, & another $2500 on a down payment for my new used car... Which was all my savings I'd built up... & was it my fault that I'm paid shit because of where I live (& I don't want to move due to family/friends/significant others who live here)? All the tech jobs around here make about as much or less without years of past experience (10+ & having worked with computers that long don't count, only real years on the job)...

      I pitty you. You seem completely focused only on having money & if you do have a wife & kids later I pitty them... Because you'll be a real bastard of a father & husband with the way your goals are.

      --
      we are all invisible unless we choose otherwise
    3. Re:I support Unions for the tech industry by Sloppy · · Score: 2

      I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.

      You don't need a union to fix that. This is a problem for the government to fix. The solution is to completely get rid of visas and instead, open the borders, so that anyone anywhere can work whereever the hell they want to. That way, your friends employers wouldn't have any special leverage or threats to hang over their heads.

      Tech companies will lay-off people without a second thought if it helps the bottom line.

      What's wrong with that?

      Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all! (This is taken from real life experience - where a consulting firm completely revamped all employees stock option contract, without protection for wrongful termination / layoffs, and gave us no option but to sign or resign!)

      But sign or resign is a perfectly valid option! If the employer doesn't offer a good deal, then don't take it. I don't get it, what's the problem here?


      ---
      --
      As copyright owner of this comment, I authorize everyone to defeat any technological measure which limits access to it.
    4. Re:I support Unions for the tech industry by The+G · · Score: 3

      Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all!

      Well, you know, after the company I was with was acquired and the new company gave us all new employment agreements to sign with all sorts of impossibly constraining terms... a bunch of us didn't sign it.

      And they changed it.

      If you try standing up to the corporate bullshit, you will frequently get what you want. They're throwing those contracts at you because they think you have valuable skills and information that they don't want others to have. But the other side of that coin is that you have valuable skills and information that they aren't going to want to lose over a dispute over five words in a contract. Get out of this "they can do whatever they want, workers just have to sit back and take it" attitude and you can make a difference.

      As for unions, well, maybe they could help with that. But more likely they will take your money, add a whole new "for your protection" bureaucracy, make it harder to communicate with management, spend your dues trying to keep smart folks out of the labor pool (The IEEE is a good model for what a tech union might look like politically, and its position of H1B visas is the reason I won't join. Those child labor laws taht were such a pain to get around when I was a kid? Those laws have a distinct union label on them too).

      The best bet is to have a frank, face-to-face dialogue with you managers. A union is a pretty sorry second to that. And if you can't have a frank, face-to-face dialogue with your managers, it's a safe bet that your company is already on the well-paved road to doom.

      Me, I'll applaud if techies unionize... because that means born scabs like me can write our own tickets.
      --G

    5. Re:I support Unions for the tech industry by Dancin_Santa · · Score: 1

      Believe it or not, I think many people can sympathize with you. It is not unknown in this country that a person's entire lifetime savings has been completely wiped out by one bad string of bad luck. However, all is not hopeless. A savings account can be built back up, and it is likely that you are making the minimum in your locale.

      Good luck!

      Dancin Santa

    6. Re:I support Unions for the tech industry by osgeek · · Score: 1

      I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.

      I guess it would all depend upon what you mean by "abused". I spent some time living in a decidedly third-world country, and knew some engineers who worked there and then ended up getting Visas over here. They were all profoundly happy to be able to have the opportunity to make so much money here. One of them had some problems with his employer who was holding his visa over his head and being a bit unfair, but he was able to get Netscape to sponsor him, so he switched jobs.

      I suppose you'd really have to personally experience the differences in the living conditions in his home country and here to fully appreciate the enormous opportunity that being in the US entailed for him. Those opportunities are a direct result of the success of our non-unionized capitalistic market. Why would we want to screw that up?

      * Tech companies expect un-sustainable levels of work from their employees.

      Non-issue. There are plenty of great-paying jobs in tech companies that aren't very demanding. If you're stuck in one that requires too much from you, go out and get another. Probably, if you at least get an idea of your opportunities, you can go to your employer and negotiate a better arrangement. If you're anywhere near a decent employee and your employer has any business sense, they'll work with you to make your job more palatable. The number one complaint that I hear from employers these days is, "We just can't seem to find people for our job openings!"

      * Tech companies will lay-off people without a second thought if it helps the bottom line.

      See above. Tech companies don't make lay-off decisions lightly. It costs them a lot of money to pay severances and to ramp back up as soon as their restructuring is done. Without lay-offs, though, many great companies would go under. Do you think that Apple could have made a comeback when Jobs returned if they hadn't restructured and had massive layoffs? Probably not. Thanks to those layoffs years ago, Apple is still feeding a lot of families, sending a lot of employees' kids to college, and producing computers that I happen to like using.

      * Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all! (This is taken from real life experience - where a consulting firm completely revamped all employees stock option contract, without protection for wrongful termination / layoffs, and gave us no option but to sign or resign!)

      This is when you talk to your coworkers and you gauge how others feel about it and how far they'd be willing protest the new contracts. You then go to management and let them know the general level of employee dissatisfaction, and try to negotiate changes. This kind of organization is far different from industry-wide unions with union bosses, seniority, and all that other union bullshit.

      If all else fails, quit and go find another job.

      One word of serious advice: Always buy your options. You may not have a great deal of confidence in the company after you leave, and you may not want to part with the money, but dollar for dollar, buying options in a startup company gives you much better odds than winning the lottery. A few years from now, you won't regret not having that option money. You will regret not having the stock if they go public or are sold. I could go on and on with stories of actual acquaintances who missed out on millions of dollars because they were pissed when they left a startup, so they didn't buy their options - but suffice it to say: Always buy your options.

    7. Re:I support Unions for the tech industry by Ubergeek26 · · Score: 1

      If your wife was worth her weight in gold, as I assume she is otherwise it wouldn't matter so much to you, didn't it ever occur to you that, if it meant in the end that you could spend more time with her and your kids, she would be willing to put up with your job hunting. Hell she could even be relieved.

      I may be single, but isn't really by choice. I make time. I have also made it know to my employeer that I won't work unneccessary overtime.

      If none of these things work, do you at least get lunch time? People that say they haven't got time haven't tried to make time. I may be 26, but I learned awhile ago that time isn't something that just appears. You have to make it.

    8. Re:I support Unions for the tech industry by bnenning · · Score: 2
      I'll mention is that he probably started in this industry before people made alot of money on it & probably didn't have the same chance to save money the way you will.

      Possibly true. Still, even most people who don't have large salaries can save 10% of their salary fairly easily, which will accumulate significantly over time.

      Then you say that he in effect should have known better than to have a family & aka 'live a normal life' like anyone else because it may in effect interfere with your future employment options... Are you on crack or something?

      Please read again what I said, which was that if you make certain life decisions you should understand that there will be tradeoffs involved.

      Do you really think we should all wait til we almost can't have kids anymore just because we need to save up all the money ever needed to take care of them? Should we skip marrying the woman we fall in love with (or guy for those women reading this comment) just because we aren't financially capable of saving money for some time after that happens?

      Of course not. What I am saying is that when you assume these responsibilities you must be aware of the sacrifices you may have to make, and make them when necessary rather than complaining about how life isn't fair because you can't have everything you want and trying to force others (e.g. your employer) to bail you out.

      was it my fault that I'm paid shit because of where I live (& I don't want to move due to family/friends/significant others who live here)?

      It's not your "fault" (it's not anybody's fault, because nothing is actually wrong), but it is your choice. You've in effect chosen to pay (via a lower salary) to be around your friends and family. A perfectly reasonable decision, and once again it comes down to tradeoffs. What I dispute is that your choices should be subsidized by others.

      Because you'll be a real bastard of a father & husband with the way your goals are.

      I was not aware that wanting to be self-reliant and assuming responsibility for my actions constituted being a bastard. Thank you for enlightening me.

      --
      How to solve most of our problems: 1.Lots of nuclear plants. 2.Cure aging.
    9. Re:I support Unions for the tech industry by dentin · · Score: 1

      > How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?

      You don't. That's not the companies job. And if this is your problem, you're clearly an idiot. Quit your job and work somewhere else. You should know better than to sacrifice your happiness.

      > How do you compensate someone for the entire months lost due to crunch time, forced by the people who a) have the money to invest in realistic scheduling and b) aren't there with you the whole time?

      Not your problem. You can only try to influence the schedules, but if it isn't your job, it isn't your job. If that's too much for you to handle, go work somewhere else.

      -dentin

      --
      Alter Aeon Multiclass MUD - http://www.alteraeon.com
    10. Re:I support Unions for the tech industry by Bob+Uhl · · Score: 2
      Why don't you just move to another job? This is the tech industry--there are a lot of companies competing for workers. You can look for another job while still working at your current one; that's how every one of the folks to leave us recently has managed it.

      Unions deal (poorly) with a monopoly on employment. There is no monopoly on employment in today's tech economy. He who thinks otherwise has his head in the sand. If you don't like where you are, go somewhere else. Every major city has multiple concerns going. Even little towns typically have more than one company going on. There might be sacrifices required--e.g. you may have to move, or accept a lower salary. It's all about what 40 hrs/wk. is worth to you. If it's worth losing your current seniority (although this can be managed) and a drop in pay, go for it.

      Other people might be happy to work 60 hrs/wk. for more pay. It's called perfect competition. Since you're not willing to work those hours, you will not pull the same amount of money in that they do. Which is fair.

    11. Re:I support Unions for the tech industry by Dancin_Santa · · Score: 1

      I think you're mistaken if you think a union would lobby Congress for laws that were more favorable *for* foreign workers. With the recent influx of H1B recipients, we have seen more xenophobia in the tech industry than we've seen in a long time. See this link from Washtech.

      Dancin Santa

    12. Re:I support Unions for the tech industry by Dancin_Santa · · Score: 2

      I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.

      What you are interested in this case is passage of immigration laws which would punish companies abusing H1B employees. This is definitely an area in which the law can be improved. No company should be allowed to have coolie labor, and no foreign employee should be forced to accept such actions by an employer because they can't leave the company without getting shipped back to their originating country. But you don't need a union to do this, you need politicians with a backbone and conscience. Unfortunately, you can have one or the other, but not both.

      * Tech companies expect un-sustainable levels of work from their employees.

      * Tech companies will lay-off people without a second thought if it helps the bottom line.

      * Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all! (This is taken from real life experience - where a consulting firm completely revamped all employees stock option contract, without protection for wrongful termination / layoffs, and gave us no option but to sign or resign!)

      It is true that technology companies expect un-sustainable levels of work, but in the vast majority of cases, these companies are fairly compensating their employees. If it is not palatable to work 80 hours a week for a significant chunk of coin, then you are free to quit and join another company that only asks 40 hours, but don't expect the same salary. Companies that require grueling hours will generally see a high turnover rate. Taken to the extreme (which is not so extreme, actually), these companies will eventually see that they are unable to attract new talent. The company will change or die.

      If you are looking for a union to validate minimum work habits, then expect management to hire outside the union.

      Layoffs are a fact of American business. But think of where a company would be if it was *forced* by a union to keep all of its workers in a downturn. The company would obviously have more expenses and, if the risk is high enough, eventually go out of business. Look at DSCM, they are doing everything they can to keep alive the company. A dead company hires zero workers. This is one aspect of capitalism that is bitter in the macroeconomic world and deadly in the microeconomic.

      As far as your contracts are concerned, it would behoove you to see a lawyer. A class action lawsuit might be in order.

      Might we actually get more than a week of severance when the filthy-rich board of our dot-com decides to lay-off half of the company?

      It can surely be said that some companies are simply pumped to IPO and then run into the ground, but in the vast majority of companies, the founders view their company as their baby and are willing to sacrifice many things to help it grow. It is a little harsh to accuse the management of being heartless in halving the company workforce. It sure stings, and it sure feels unfair, but drastic cuts in numbers is a last-ditch effort to save a drowning company. You are likely better off getting laid off than being kept around to feel the brunt of corporate bankruptcy.

      A union guarantees nothing that doesn't already exist, except that more companies are going to be leveraged underwater by the strong hand of the union. This is, of course, assuming that a union would be able to generate any power in the first place.

      Dancin Santa

    13. Re:I support Unions for the tech industry by Tackhead · · Score: 2
      >How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?

      You tell his wife and kids to make up her mind whether she wants him or the fancy goddamn appliances, because she can't have both.

      Or she tells him to make up his mind whether he wants her or the fancy goddamn stock options because he can't have both.

      Two jobs ago, I was in a Saturday morning meeting when my sysadmin got the latter call on his cellphone. He chose the wife. Regrettably, the company went titsup.com and he ended up losing both.

      If you can't take the heat, stay outa the kitchen.

      If you've got a family and mortgage, it's incumbent upon you to choose your employers and manage your finances more wisely.

    14. Re:I support Unions for the tech industry by bnenning · · Score: 2
      That's what they used to say to rape victims.

      Give me a fucking break. No woman chooses to be raped. Every tech worker chooses to get up and go to work. You always have the option of quitting anytime you want. Maybe it would cause you some financial hardship (although if you manage your finances with any degree of responsibility you should be able to survive at least a few months out of work), but nobody has a gun to your head. To compare having a lousy job with being a victim of sexual assualt is ludicrous.

      Sorry if this sounds rude, but rape is a particularly sensitive subject for me and it bothers me when relatively minor problems are compared to it.

      --
      How to solve most of our problems: 1.Lots of nuclear plants. 2.Cure aging.
    15. Re:I support Unions for the tech industry by sulli · · Score: 2

      Not quite. You don't need a union (with all of the relevant bureaucracy) to improve conditions with your employer. Direct bargaining works fine, as proven by his experience.

      --

      sulli
      RTFJ.
    16. Re:I support Unions for the tech industry by Stiletto · · Score: 1

      * Tech companies expect un-sustainable levels of work from their employees.

      Why not get another job?

      * Tech companies will lay-off people without a second thought if it helps the bottom line.

      Why not get another job?

      * Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all!

      Why not get another job?

      I don't see the point of unions--especially in the tech industry where there is SO much work. If you don't like your job, quit and find a new one. If you don't like your salary, re-negotiate or quit. If you don't like your working conditions, re-negotiate or quit.

      Make sure your contract is fair BEFORE you sign it. If the company is allowed to lay you off at will, make sure you can walk at will. If you are skilled, and the company still is set on firing you, then it's bad management--the company is clearly doomed from the start. Find another one!

    17. Re:I support Unions for the tech industry by Ubergeek26 · · Score: 1

      I am single, and too work in the tech industry, but understand a very simple principle that most don't ever think of. Look for a new job, get offer, accept offer, and then quit. Not so complicated now is it?

      I will grant you that it can wear on a family to jump from job to job every year, but hopefully you did enough homework to avoid the same mistake.

      I am noticing a very alarming thing, and, at risk of offending you all, that is a majority of tech related people are wusses. Nobody here has the guts to do what they know is right. Instead alot of you would much rather give up your money to someone so they can go and bitch about how poorly treated you are. WHY?! Don't you people care for yourselves more than that. Or has the Star Trek and Star Wars Episodes warped your thinking into a communal type of philosophy, where it is bad to voice your opinion. Why is it that we continue to stay in bad situations? Are we like abused spouses, and think things will change if we stay around.

      Pull your heads out. The very idea of unions in this day in age is a joke. They don't work anymore. Just like socialism doesn't work. They would work if we weren't human and greedy people. Instead we, and I mean all of us not just Americans, are forced to look out for numbero uno, ourselves.

    18. Re:I support Unions for the tech industry by bnenning · · Score: 2
      Once you have a family and a mortgage, cars and educations to pay for, the whole "you can get another job" thing isn't quite as simple.

      This attitude really bothers me. Your family and mortgage and cars didn't suddenly appear on your doorstep, you chose to assume those responsibilities. What you are saying is that because you have voluntarily made certain life choices, everyone must change to accomodate you. Here's a wacky concept: maybe you shouldn't buy a house or cars if you can't afford them, and maybe you shouldn't have kids if you can't afford to raise them. If you do put yourself into a situation where you are living paycheck to paycheck and have other people dependent on you, of course you are going to have less flexibility and that is your not your employer's fault. With salaries what they are in IT, almost all of us should be able to save a sufficient amount to survive being out of work for quite a while.

      I do not understand why people think that having a family should come without any tradeoffs. And yes, I'm single. That's why I'm saving a lot now so that if I do have a family in the future I will still have some degree of freedom.

      --
      How to solve most of our problems: 1.Lots of nuclear plants. 2.Cure aging.
    19. Re:I support Unions for the tech industry by Vassily+Overveight · · Score: 1
      How do you compensate someone who is totally lost to their family because they're stuck in the office 7 days a week?

      This is the same sort of argument that drives me nuts when police and firefighters bitch about how dangerous their work is. If you don't like the job or the pay or the hours, quit. If you have any talent whatsoever, you can have a new job by turning into a different driveway tomorrow morning. If you work at a company that's abusing you, it isn't their fault for doing it, it's your fault for letting them.

      --

      "If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine

    20. Re:I support Unions for the tech industry by Vassily+Overveight · · Score: 1
      Here's my support for Tech Unions and organizing. What does the industry have to fear, if everything is really A-OK already?

      Let's see, featherbedding, work rules, strikes, unreasonable demands, an adversarial relationship with its labor force, an inability to lay off the incompetent, corruption, shakedowns, worker dues used to lobby for legislation that goes against company interests.

      By the way, since you have nothing to hide, I'm sure, I'd like to come over and search your house.

      --

      "If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine

    21. Re:I support Unions for the tech industry by AugstWest · · Score: 5

      If you work at a company that's abusing you, it isn't their fault for doing it, it's your fault for letting them.

      My company isn't always like this, and hasn't been for the couple of years I've been here. The company has changed drastically over the last couple of months, and I'm in a position where even a couple of weeks out of work would be unacceptable.

      We're not all young and single and without commitments. We're not all in full control of our work situations.

      The company took on VC money and a new CTO. He's of the mind that we weren't hired, we were purchased. This isn't a unique situation, either, and I'm stuck with it for a couple more months.

      Once you have a family and a mortgage, cars and educations to pay for, the whole "you can get another job" thing isn't quite as simple.

      This is the same sort of argument that drives me nuts when police and firefighters bitch about how dangerous their work is. If you don't like the job or the pay or the hours, quit.

      That's genius. Sheer genius. Ever hear of a sense of duty? Ever had your house catch fire, or robbed?

    22. Re:I support Unions for the tech industry by Ded+Bob · · Score: 2

      I have seen several friends on H1 Visas abused in the workplace. I would happily join a union that would address this - and other issues.

      Good news. New rules are in place for H1 visas. If they can find any other company to take them, they can just switch jobs.

      Tech companies expect un-sustainable levels of work from their employees.

      Please define these "un-sustainable levels".

      Tech companies will lay-off people without a second thought if it helps the bottom line.

      For a .COM this is usually a good sign it is about to go under.

      Tech companies will require unfair, new contracts to be signed by all employees, without any form of negotiation at all!

      I have not run into that.

      Might we actually get more than a week of severance when the filthy-rich board of our dot-com decides to lay-off half of the company?

      What money could they give you? These companies barely have enough money to survive. If you sue them and win, you might see a few dimes.

      Might people working here, away from their families abroad, actually be able to take reasonable time-off to visit their relatives, and return to work?

      I have seen several people do just that where I work (non .COM). I have no idea if they had any problems doing so, but they were able to do it.

      I still have to disagree with unions as they are today. I remember a few unions threw a tantrum about a non-union company aiding in the construction of a building a Purdue University (a state school). The non-union company charged Purdue less and paid their workers more. That is probably why the unions were scared; their workers might have seen benefits at working for a non-union shop.

  180. ah, slashdot by nomadic · · Score: 5

    The anti-union sentiment on slashdot always manages to surprise me. Here's a couple of ideas for all you laissez-faire ideologues. Why don't you:

    a) read a history book on the labor movement, rather than accept what's force-fed you by corporate media outlets and stand-up comics.

    b) think a while about what's going to happen when the next big recession hits. Just because your skills are in demand now doesn't mean they always will be; or do you think PHP scripting and network programming are skills so integral to western civilization that you'll always have a job?

    c) accept that collective bargaining can fit very neatly within a free market. If a company can't deal with workers organizing, then it's the company's fault. Nobody forces companies to accept unions, it's sometimes just the best business decision to make.
    --

    1. Re:ah, slashdot by v2 · · Score: 1
      Ok, so lets form a union so that our obsolete jobs don't disapear.

      We have jobs now because we can do something. In the end coding is not about knowing C or Java syntax. It's about a way of thinking. Maybe what we're doing now is PHP or something similar. It's not a big task to learn something new. But what if the company you're working for doesn't have the patience to let you learn? They can always hire a young kid how knows what you would have to learn.

      Tech companies are notorious for not wanting old employees. If someone get's old, they're dumped. We have no job protection when we get old if there are no unions. The problem is that tech companies don't realize that they are hiring people, not skills. If they would want to hire skills they should outsource everything.

      There have been cases where union were good for a while, but let me tell you, in an industry where if you don't like your job that you can spend just a litle time improving yourself and end up with a better job....no, unions aren't the answer.

      Unions aren't here to give us better jobs. If someone wants a better job then go for it. Unions are here to protect us from abuse from the company. How many of you feel that you have too much work? I have felt that, for a long time. What do you do? Do you tell your employer that you have too much work? No. You work more. With contracts between employers and unions people get protected from this kind of abuse.

      Sure, HellDesk sucks....BUT it IS the bottom of the food chain. What do you want, there is no such industry where the bottom job doesn't suck. But this ins't some industry where it takes 10 years to lean a new skill(by the way, in a union you would not be allowed to learn/practice a new skill if it threatend one of your "brothers" job), it takes months or a year to be proficient enough to get a job.

      There are industries where workers aren't in a 'food chain', those industries are mostly the ones with unions protecting workers. And on not letting you learn... That's a riot. Here in Finland our central organization of trade unions (SAK) educate their members. Every year 50000 people attend on their courses (that's almost 1% of our population).

      Unions do have some side-effects, I agree. But the side-effects are very small compared with the benefits.

    2. Re:ah, slashdot by jeffry_smith · · Score: 1

      > by the way, in a union you would not be allowed to learn/practice a new skill if it threatend one of your "brothers" job

      Not in any union I know. Most have very extensive training programs. In fact, most use an apprenticeship method to train new workers, and I know that many of them require continued training while working to keep current.

    3. Re:ah, slashdot by Sloppy · · Score: 2

      think a while about what's going to happen when the next big recession hits. Just because your skills are in demand now doesn't mean they always will be; or do you think PHP scripting and network programming are skills so integral to western civilization that you'll always have a job?

      What does this have to do with unions? If my skills start to become less useful, do I somehow deserve to keep my useless job that isn't generating profit for my employer? It's my responsibility to keep myself employable, not anyone else's.


      ---
      --
      As copyright owner of this comment, I authorize everyone to defeat any technological measure which limits access to it.
    4. Re:ah, slashdot by rlc69 · · Score: 1

      Final example: In 95-96, at the end of the Bush Sr. recession,

      Huh? You mean the one that ended (forgetting which quarter exactly the recession ended) ~Q1 of 1992? By summer of 1992 we had positive growth.

    5. Re:ah, slashdot by Anonymous Coward · · Score: 1

      I have read many history books on the history of labour unions, and these have been from many viewpoints, not just the UAW standpoint. The history of organized labour is about large organizations taking advantage of workers, first the companies, then the unions. Unions take away the freedom of indivdual choice, and force employees to follow the line, or risk their jobs.

      The history of unions is also violent. Most people are aware of the idea of union breaking, but few people really realize the violence that takes place on a picket line. I worked at a company, in which several groups went on strike. Any worker trying work was spit on, with several charges of assult being put forward. Even though the charges went through, the employees who were assulted were not able to work again. Both mine and my bosses German cars were damaged.

      Not even unions try and create jobs where there are none. If there is a recession, the most a union can do to keep salaries and job rates artifically high is to drive the companies to close down.

      Only workers without real skill who will be taken advantage of require unions. Needleworker, construction workers and other easy to replace jobs should ever require a union. And these unions should not have to power of current unions such as UAW. Why is it that unions can collaberate against companies, but companies cannot touch unions?

      If unions are to powerful, the reduce technological advancement, and hurt workers who prefer to compete on their own merits.

    6. Re:ah, slashdot by IntlHarvester · · Score: 1

      By "Tech Worker", it includes those doing AOL phone support, people who's only job is to load DLT tapes into the robots all day and other mindless ops chores, and yes those poor guys stuck in a windowless room imaging Windows onto PCs all day. Oh yea, most of these folks are also farmed out through some contract agency where they can be gotten rid of in 5 minutes and get no vaction or benefits, etc.

      This kind of stuff is "skilled labor" and not "knowledge work", but it's still considered tech work by the government and outsiders.

      So, you can sit at your desk and be one of those elite 1000% coders and you will never need a union and nobody will ever really try to unionize you. That doesn't mean that large parts of the tech sector couldn't use collective bargining to improve working conditions.

      I think the real problem is that those in the bottom tier of the tech industry doing phone support or whatever won't admit they're in the ghetto. They tell themselves if they can just pass those MCSE exams or learn Linux, they'll be out of there and be one of those elite highly-paid system admins. Sometimes - but I'd bet 90% in the 'ghetto' eventually wash out of tech.
      --

      --
      Business. Numbers. Money. People. Computer World.
    7. Re:ah, slashdot by A+Big+Gnu+Thrush · · Score: 2
      read a history book on the labor movement,

      Serious question: I'm a bit of a history buff, and I'd like to read a balanced history of labor unions in America -- any suggestions?

      I don't want something called Freedom Fighters: How the American Worker was Saved but rather a balanced history. I've never come across anything that looked particularly well done.

    8. Re:ah, slashdot by Anonymous Coward · · Score: 1
      "Nobody forces companies to accept unions,"

      I have a question. I am ignorant of Unions because I have never been in one. What if, let's say, I worked for a big tech company and up popped a workers union. What would happen to me if I didn't join the union? Also, let's say four months later a strike was called and I, not being a member of the union (assuming this is possible), refused to join it... what would happen to me? Could I expect to be treated with respect and allowed to do my job in peace or would I suddenly become "enemy #2" just behind corporate management?

    9. Re:ah, slashdot by partingshot · · Score: 1

      Amen brother. I think most people here are too young to know of anything but this incredibly good economic run we have had. It will end. The corporations have lobbyists squeezing congress. Tech companies just met with Bush. Who looks out for #1? What is your power compared to them? Do you think your company has your best interest in mind? Slashdotters think that unions are bad for them, don't they realize that a corporation exists to maximize profits? Once we hit the low end of the business cycle they can kiss their perks goodbye. No more having to kiss up to those damn techies!

      --
      Anonymous posts are filtered.
    10. Re:ah, slashdot by Dimes · · Score: 1

      Ok, so lets form a union so that our obsolete jobs don't disapear.

      Thats just silly. If you want an idea of what unions do to a tech industry, try getting DSL in most parts of the US. You think it takes so long cause the "phone company" doesn't want to do it?

      Nope.

      The Phone Co unions are 90% of the problem. I had to work with them, to help straighten out their networks for DSL. I was there to be nothing more than a thorn in the side of union workers, cause they couldn't even be convinced to work well with other CO's within their own company.

      There have been cases where union were good for a while, but let me tell you, in an industry where if you don't like your job that you can spend just a litle time improving yourself and end up with a better job....no, unions aren't the answer.

      Sure, HellDesk sucks....BUT it IS the bottom of the food chain. What do you want, there is no such industry where the bottom job doesn't suck. But this ins't some industry where it takes 10 years to lean a new skill(by the way, in a union you would not be allowed to learn/practice a new skill if it threatend one of your "brothers" job), it takes months or a year to be proficient enough to get a job.

      If you don't like your job, then move on. If you are on Hell Desk, and you don't think you can move up....well then its time to think about a new career. Remember, unions were invented because the ONLY employer in town was abusing its employees, and there was no way to get another job. That just isn't the case.

    11. Re:ah, slashdot by skuenzli · · Score: 1

      b) think a while about what's going to happen when the next big recession hits. Just because your skills are in demand now doesn't mean they always will be;or do you think PHP scripting and network programming are skills so integral to western civilization that you'll always have a job?

      Do you think that during the next big recession companies will go around shutting off their computers?

      I do not think (traditional i.e. non-dot.com) companies will shut down their websites, turn off their factory automation systems, or dismantle their networks. It's possible that companies will stop *expanding* their IT departments, but computers have had much to do with the increasing efficiency of businesses worldwide. Remember that much of our economic gains of the past decade have been attributed to rising productivity. Those gains in productivity are attributed to...computers. Somebody needs to be around to maintain the existing systems, at the very least.

      However, I do see your point. The lower-skilled IT workers may find themselves in a pinch in a recesion. Not everyone who works in the IT industry is what I would call an IT professional. Just as there are 'grades' of expertise in the medical field (doctor, RN, candy-striper), there are grades of expertise in the IT industry. Unfortunately, the industry does not have easily discernible credentials to identify these grades. This leads to all IT workers being clumped together in the same group. I do not believe the 'doctors' of the IT industry will have any problem come recession time. However, if you 'candy-stripe' for your local dot.com (I realize candy-stripers are volunteers, but I'm trying to draw a parallel with respect to skill level), then you might be hoping for a union because that's the only way you're going to have a job. From an economic point of view, I think the candy-striper should lose his/her job in a recession, because I don't think artifically creating/sustaining wages/jobs is a Good Thing. The people whose skills add cash to the bottom line will have jobs. If you don't, then you're gone (and I have no problem with that). I think if you want a larger organization to take care of you, a Socialist country like Sweden would be a better fit.

      Stephen

  181. Re:Unions by WeirdKid · · Score: 1

    Where does this idea of all automotive or factory jobs being unskilled mindless monkey work come from? It seems that some of you have been watching too much Charlie Chaplin!

    Being from Detroit (the home of the auto industry) and having a good number of family and friends in the industry, I can tell you that this is simply not true. Tomorrow when you get in your car and it doesn't explode three times on your way to the office, be thankful that your vehicle was assembled by people who are skilled and take pride in their work. Yes, it's repetitive, but so is designing and building apps that all look like nothing more than modified spreadsheets. And yes, there are those who do fulfill the stereotype, but there are slackers in every working venue in every industry -- look around you, for cryin' out loud!

    But there's one point that everyone seems to be missing here: part of the reason unions were formed was to ensure the safety of the workers. Losing life and limb in factories used to be a pretty common thing (and it still happens occasionaly). Imagine if getting distracted even just for a few seconds while at your keyboard meant that you'd lose a few fingers, all the while your foreman is yelling at you to work faster, harder, longer over the already deafening thunder and clanks of the other machines.

    Now, I don't actually believe that we in the tech industry have to worry about serious and life-threating injuries, but I do believe that we would need the combined strength of a union if we ever want to be allowed to grow up. What I mean by growing up is being able to work hours that permit a rewarding family life -- you know, like having stress-free pager-free time for a wife and kids and dogs and friends and trips to the Grand Canyon or London and...

  182. Unions NO: Professional organization YES by Anonymous Coward · · Score: 1


    Software developers should not look to unions to solve their problems. A better, and more appropriate solution is for a professional organization, similar to doctors and lawyers.

    This organization, in addition to providing collective bargaining and lobbying on behalf of its members would also impose strict standards and guarantee the quality of its members.

  183. Re:Things aren't always like the last few years by madrone · · Score: 1
    Thanks for that!

    I am 28 years old. For 32 years my father has been employed in the same job at the same factory (a paper mill), and has been president of the union for the majority of that time.

    In my memory, they have been on strike once, and that didn't last very long. I remember going with my father to the picket line and sitting and talking to the employees sitting out in their lawn chairs (I was really young at that time).

    The reason my dad got involved in the union in the first place is because he is a very smart guy, and factory labor didn't give him the mental stimulation he desired. He ran for president of the union local, and got it.

    For any of you to say that unions don't care about their members, you've obviously never dealt with a man like my dad. He busted his ass for years during his free time (which there wasn't much of to begin with) working for members of the union.

    He ended up getting out of the role of "Union president" because he decided he wanted to run for public office. He ran for 3 offices over time, none of which he won. (New guy, democrat in highly republican part of MI, and about 1/10 the money his opponents threw at their campaigns.)

    After the financial, physical, and mental drain of the campaigns he went back to work (actually he worked all thru each campaign, but I think you know what I mean) content to let the other guy in charge of the union stay there. He needed a break and went back to doing "just his job" for 8-12 hours a day, often going weeks with no days off. Thing is, he didn't MIND busting his ass that much because the union made it worth his while... and he made it worth the company's.

    Now, (and this leads to the part you may want to think about) 5 years ago his company was bought out by another. Guys at work came to my dad and begged him to run for union prez once again - contract negotiations were coming up with the new company, and these people know after having worked with my father for so many years that he is fair, tenacious, and works his fingers to the bone to accomplish things. He became president again, and it was business as usual.

    Here's the important part... On January 11th of this year management of the plant my father works for let the company know that they are closing on March 31st. Do not pass Go, do not collect 200 dollars - they are totally screwed. And management is trying to screw these guys that have devoted their lives to their jobs into getting less than they deserve. They've offered no severence package, and are trying to go around the contract.

    My dad is 52 years old, he has worked at the same place for 32 years. He has worked HARD and been a great employee during those years. There is nowhere he can go and make the money he makes now, and those 6 weeks of vaction he EARNED after so many years? He may as well forget about vacation time for awhile now.

    These sorts of things are happening more and more - do you honestly feel the tech industry is immune? Now? 5 years from now? 10? 20?

    I hope nothing like this every happens to you, or anyone close to you. If it does, you would be better off with a guy like my dad working round the clock busting his ass protecting YOU, with the Union behind him. Not all Unions are bad, not all leaders are corrupt. Not all companies are going to be around forever - and if they go, they certainy are not thinking about what's fair to YOU, the worker. Hopefully, someone with some pull is.

    **disclaimer**

    If this 'essay' is as disjointed and inconcise as I think it is...my apologies! Still haven't had any coffee :)

  184. A job is not a right... by motorcrash · · Score: 1

    A job is not a right... it's a privilege. A job is not owed to you by anyone. You earn what you're worth--that is, how much the results of your work are worth to your employer or customer(s). In dollars. Running a business is not easy, else you'd be running one. The founders of your business started out with a great idea and struggled make money with it. Maybe you're struggling with them right now. Chances are, you solicited your services to that employer, they liked what they saw, and asked you to help them, laying their terms on the table. And guess what--YOU AGREED TO THEM. My employer buys my skill as a programmer--based on terms we agreed to--and in return I do whatever they want while I'm sitting in the office they provided for me. If at any point, I feel the terms of the agreement aren't to my liking, I will alter the terms or leave. And I would never extort my terms or pay someone to extort them for me. Most of us in this industry are smart, talented people. I don't live and die by my computer skills. You can be anything you want--you and I chose this field, at least for now. Stop whining about being "put upon by the cruel world." Compared to other industries, those of us that do our jobs are taken care of very well. So get to work, or go work for GM.

  185. Just say NO by Aceticon · · Score: 2
    It's at the same time simple and complex but it will get you results. How to do it:
    • When asked to give estimates for something you hadn't had time to check, say you MUST have time to analyse it.
    • Check the task and try to divide it into component parts.
    • For each part that you feel you had enough experience doing it before, come up with a duration value and add 10% for problems (they always happen). If that part depends on something else (ex: having certain data from the costumer) the state it very clearly (and put it down on a note, you might need it if the other part doesn't deliver on time)
    • For each part that you do not feel you had enough experience doing it before, say so and refuse to give estimates. Never forget the argument that it's the manager's responsibility to come up with project times not yours (they get the money, they get the laurels so they should also get the blame).
    • If pressed from management with irrealistic estimates say they ABSOLUTLY WILL NOT BE ACHIEVED. Don't forget to tell your manager that you will reafirm the IMPOSSIBILITY OF DELIVERING ON TIME AND THAT YOU SAID SO TO YOUR MANAGER to anyone that asks you (or not), including the costumer and your manager's manager
    • If the management still decides to go ahead with impossible schedules no matter what then flattly refuse to work extra ours. If you usually work 10 hours/day immediatly reduce it to 8 hours/day so that they get the message. You might also consider VISIBLY looking for a new job (at the start of a new project that will make them go crazy).
    • Beware of working extra hour for any shitty-shit problems - if you are SEEN as willing to got the extra mile for small things you will be COUNTED UPPPON to always go that extra mile to finish irrealisticly scheduled projects on time. It WILL NOT STOP - for every project you manage to pull out against incredible odds you will be "rewarded" with at least one other project like that
    • Never forget that THEY need YOU more than YOU need THEM. When you leave the company might not go bankrupt but the project you just left might very well go belly-up (or have an incredible delay), and that will surely have a negative impact on the preson(s) responsible by that project
    The beter you are at what you do the beter it works!!!
  186. Re:Iron law of political science? by Omnifarious · · Score: 1

    Umm, what is the iron law of political science?

  187. Open & Closed Shops by jeffry_smith · · Score: 1

    Depends on the union contract & state law. If it's a closed shop, you either join the union or you leave the company. In an open shop, you don't have to join. If you're not a member, you don't have to strike. Of course, don't expect the union members (who are negotiating for all workers, not just the union members, in a right to work state) to be too sympathetic.

    1. Re:Open & Closed Shops by dagda76 · · Score: 1

      There are a couple of other options. In most states you can refuse to join a union based on your religious beliefs. All states must honor the request of a "Beck Objector". Beck Objectors are those who exercise their right to refrain from paying for union expenditures that are not germane to the union's representation function. This right was established in the Supreme Court case, Beck vs. Communication Workers of America. Employees wishing to exercise this right should notify the union in writing that they object to paying for expenditures not germane to the union's representation function. Essentially, your responsible for paying your share of the basic collective bargaining function of the union and nothing else.

  188. Unions can't be worse than being ON YOUR OWN. by DarkEdgeX · · Score: 1

    Me, personally, I wish I had a union or some larger group to represent me at my last company. Management at the company felt it would be SPLENDID to work us 6 days a week, 10 hours a day. Under a union? I doubt that would have ever happened. Ditto for the time I was sick, and management disclosed the VERY SURPRISING revelation to me that "you don't get any paid sick time". Nice. My current company thankfully HAS paid sick time, unlimited in fact (beyond a month or so though, your disability kicks in). They also have flexible hours-- come and go as I please, as long as I a) finish my work on deadline and b) average 40 hours a week (pushing that theory, I could work 20 hours this week, and 60 hours next, and nobody would care). A union would have atleast been someplace to turn to, instead of having to deal with the BS from the last job. (And yep, it was a dot-com start-up...) To the folk who say unions have no place since we can all quit and have jobs in a few days/weeks-- I'm sorry pal, but those days are numbered. Eventually work like ours isn't going to be the specialty, it's going to be as common-place as auto-work related jobs. All those 'kids' in college majoring in Computer Science and other fields related to IT? Eventually they'll be out in the work force, and suddenly jobs like ours will need some sort of defense. Are unions the answer? I honestly don't know.. I've heard good and bad about them, but IMHO, SOME form of representation is better than NO representation. My 25 cents.

    --
    All I know about Bush is I had a good job when Clinton was president.
    1. Re:Unions can't be worse than being ON YOUR OWN. by lonesome+phreak · · Score: 1

      See, you didn't need a union, because you could just quit. Eventually, that company will go out of business because their employee policy sucks. If they had a union there, they would just implement their crueltly in other ways, and you wouldn't leave because the union would always "be working on it" for you. If you don't like the job, just quit.

      --
      Maybe we DID take the blue pill. You wouldn't remember anyway.
    2. Re:Unions can't be worse than being ON YOUR OWN. by DarkEdgeX · · Score: 1

      You missed the part where I pointed out that 'just quitting' won't work eventually. You know, job market thinning out, more people with this skill than jobs, etc.

      --
      All I know about Bush is I had a good job when Clinton was president.
  189. Re:Iron law of political science? by RandomPeon · · Score: 1

    The president's party always loses seats in both houses of Congress in midterm elections. Poli Sci types call it the "Iron Law" because it has only 2 exceptions since the Civil War - 1934 and 1998.

  190. Unions are... by GeneralEmergency · · Score: 1

    ...lockstep enforcers of mediocracy, and are therefore the very antithesis of creativity and exactitude, the very life's blood of IT.

    Wow... did I just write that?


    "A microprocessor... is a terrible thing to waste." --

    --
    "A microprocessor... is a terrible thing to waste." --
    GeneralEmergency
  191. Please explain again... by ignavus · · Score: 1

    So please explain again to me.

    Why is it alright for businessmen to band together to form a union so that they can reap the benefits of co-operation (we call it a "company", but it is an association of investors), but not alright for workers to band together to do the same?

    If employers want the right to deal with each employee individually, why can't we have the right to deal with each shareholder individually?

    And why do the people who invest financial capital get to elect the directors of an enterprise, but the people who contribute the human capital get no say at all?

    Unions exist as an external force on companies, because workers are excluded virtually everywhere from participating in corporate government in the same way that "shareholders" are ('shareholders' is understood in the narrow sense of those who invest financial capital, not those who invest their human capital in a firm.) Corporate government is still back in the ages when only property-owners could vote, the mere worker was entitled to no vote. This is still the case in most corporations.

    --
    I am anarch of all I survey.
  192. You can't stop unions by friedmilk · · Score: 1

    Unions are a natural and important part of any free economy. It is only through unions that workers are able to collectivly bargain with their employers, creating a natural balance of power. Also, it is foolish for any company to try and stop unions because people will become very defensive of their civil rights, especially in free societies like the US. Throughout history there are numerous examples of powerful companies and/or governments trying to exert too much control over their members, invariably leading to disaster.

  193. Union yes, byt not like the "old" unions. by mikethegeek · · Score: 3

    "Unions do nothing but promote mediocrity. They dont reward for being a better worker and they DO reward for being "just good enough" (Which in a union shop, is usually pretty bad)."

    You have a great point about this. Unions also are allowed to dip into your paycheck practically at will and they use this money soley to promote ONE political party that over 40% of union members do not support.

    Which is a stupid way to buy influence, the reason why the corpers contribute to BOTH parties is so that they have influence no matter WHO wins...

    Also, unions have had a lot to do with the de-industrialization of the USA. Back in the 70's and early 80's, virtually EVERY factory where I'm from (Ashland, Ky) ended up shutting down, mostly after the unions comitted job suicide by strike after strike during bad economic times.

    Now don't get me wrong, unions DO have their place, and at one time, in the early 20th Century did a LOT of good in getting reforms in workplace safety, the 40 hour work week, etc. But I think they have long outlived their usefulness in the places where they are still prevalent (heavy industry and government). Workers apparently realize this as well, as union workers are now a small minority of the total workforce.

    Will unions come to the tech professions? Sadly, YES. Why? Because of operators like the place I used to work for. The management treated the tech department like dogs, paid us nothing (and refused to give me a raise at mu annual review despite the review being near perfect). They took full advantage of West Virginia's "Chineese overtime" system (as it is called) and paid us far less than our hourly rate for overtime that at times we were FORCED to work.

    It should come as no surprise to anyone that the tech staff turned over 100% from the time I was hired until the time I left.

    So yes, I DO think unions will come to technicians, and other service workers. But it will be the beginning of the end of the tech industry as we know it.

    I just hope we are a lot smarter about it and keep control with ourselves, and not create a political self-serving bureaucratic machine like the AFL-CIO or the Teamsters (who had a president, Ron Carey who stole an election, called the UPS strike solely to try to save his own ass, and ended up settling for pay increases that would take the average UPS worker 5 YEARS to recoup the pay they missed during the strike.).

    We as a profession do NOT want to go down that road.

    --
    === The price of freedom is eternal vigilance
  194. Re: That 25 cents... by GeneralEmergency · · Score: 1

    You would only get to keep 23 of those.


    "A microprocessor... is a terrible thing to waste." --

    --
    "A microprocessor... is a terrible thing to waste." --
    GeneralEmergency
  195. We need to unionize, why? by alexhmit01 · · Score: 5

    Unions normally exist in a market with one employer or a few employers acting as one. The goal of a union is to stop monopsony power.

    The reason for this? The "menial" tasks that the anti-union people talk about in the auto-industry are actually considered skilled labor. They have valuable skills. However, if the "Big Three" decided that they would only pay $12/hr, these people would have nowhere to sell their skills, because there is only one employer. A union (monopoly of labor) and employer (monopsony of labor) negotiate, and you can something similar to a competitive market, but less efficient. However, it is more efficient than union/competitive industry or monopsony/exploited people.

    If you have a competetive marketplace like in tech, (there are 10s of thousands of employers, and even in areas with sparse tech, there are probably 15-25) with lots of potential employees.

    Unions will fail in tech, because "scabs" will laugh and cross pickup lines, and we're as a rule not imposing enough to scare them. Unlike the teamsters, I can't see tech unions working with the mob to kill scabs, but that's just me.

    Alex

    1. Re:We need to unionize, why? by dillon_rinker · · Score: 5

      Unlike the teamsters, I can't see tech unions working with the mob to kill scabs, but that's just me.

      Dude, you'd better be careful. I crossed a picket line once at a major ISP, and before I went on lunch, my name had been legally changed to Whee Ownjew, my medical history had been emailed to my girlfriend, and my picture was in every post office in the country, over a caption that said "WANTED! For Axe Murder!" By the time I got home, my bank account had a balance of 1.7 quadrillion dollars, and the bank's logfiles showed access to their mainframe from my IP address at work.

      I am now living in Sumatra, trying to make a living troubleshooting thin ethernet cable plants.
      Please remember, just because geeks won't kill you doesn't mean they can't take your life.

    2. Re:We need to unionize, why? by IntlHarvester · · Score: 1

      I was a union bag boy back in high school too, paid the $20/month dues, and here was the tally:

      + Got paid double minimum wage for what would have been a minimum wage job if it was non-union.

      + Got paid sick time and vacation which would have been unlikely in a non-union shop.

      + (Most importantly) All scheduling was based on seniority rather than management playing favorites. Sure senority is a arbitrary system that rewarded the 'lifers', but at the very least it prevented managment from engaging in the #1 dick-over tactic in these sorts of jobs - fucking with your time off.
      --

      --
      Business. Numbers. Money. People. Computer World.
    3. Re:We need to unionize, why? by driftingwalrus · · Score: 1

      Just remember, unions are the only thing that kept the US and Canada from becoming third-world countries. Before unions, workplace safety was completely nonexistant, workers where mistreated, payed low wages and could be fired on a whim.

      When the workers refused to work in these conditions, employers eventually had to give in. If that had never happened, the majority of the US and Canada would be living in abject poverty, in filth and disease. All the horror stories we've read about child labour and inhuman treatment of workers would be happening here.

      "Workers of the world unite, you have nothing to lose but your chains."

      --
      Paul Anderson
      "I drank WHAT?!" -- Socrates
    4. Re:We need to unionize, why? by Malcontent · · Score: 1

      The exact same thing can be said of the corporations. You average McDonalds president, vice president, ceo or whatever makes millions of dollars while paying their employees minimum wage. Corrpution occurs everywhere large amounts of money are exchanged wheather it be govt, corporation or union. In the case of a union the average Joe at least gets something (no matter how small). Maybe it's better wages or better vacation time or better working standards. You McDonalds employee get nothing except the right to be fired whenever the manager feels like it. Either way tho the fatcats live like kings and the shmucks do the dirty work.

      I will repeat. If you don't like the way a corporation is acting, if you don't approve of the way it treats its employees, the nevironment, or the public at large the absolute biggest punishment you can visit on them is to organize their employees. If you do so those fatcat CEOs will curse your name every night before they go to sleep.

      --

      War is necrophilia.

    5. Re:We need to unionize, why? by nekid_singularity · · Score: 1

      True only if the union is effective and not corrupt. Unfortuantly for some reason Unions tend to become corrupt, probably because of the relativley large amounts of money flowing through the system from dues. Dateline had a fantastic expose on the International Union of Hotel Workers and how horrifically corrupt the management was. They were getting dues from $8/hour maids and using it as their won personal bank account. The Union Pres had 3 homes, a $350,000 salary and his pension was almost as large, I think. Hell, the bastard even used Union funds to build a gym in IRELAND, that was of course named after him. It is a perfect example of just how wrong a Union can go.

      --
      Numbers 31:17,18 Now kill all the boys. And kill every woman who has slept with a man,but save for yourselves every virg
    6. Re:We need to unionize, why? by Omnifarious · · Score: 1

      I didn't get any of those benefits at all, and the job was above minimum wage (by 10-20%), but in my area that could easily have been attributable to market conditions, not union wages.

      We were lucky to have generally sane management not into playing games. The only ridiculous thing I was ever called out for was talking to the cashiers while working in ways they disliked, mostly because they were odd or above their heads. It actually was only one cashier, and she had seniority. *sigh*

      It's hit or miss. Unions can be just as evil as big companies. Unions can be good.

  196. Re:Amazing... - by Vip · · Score: 1

    Having worked in both unionized and non-unionized employments in the tech field, let me address some of this.

    Both have their pros and cons.

    Pros for being unionized:
    - Job Security. Getting fired because your boss feels like it is tough to come by. One myth about unions is that you can't get fired for nothing. You can, but it's much tougher for your boss to do.
    - Wage Security. Chances are, with a union you won't have your wages dramatically drop. It does happen, however that's in extreme cases where the union can see the company will not survive. But your union will negotiate a long-term contract saying what raises you will get and when.
    - Working Conditions. Under most unions, if not all, these tend to go up. You, most likely, will not be required to work 12 or 16 hour days if you don't want to. If you do, you will be compensated for it. Same for pagers and after hours. Your work area will be up to par.
    - Standards. You will probably have standards that will rule what you do, when you do it, how you do it. It won't be a free-for-all, today you are sys-admining, tomorrow you are installing software on a clients machine, next day you are debugging software from the guy that just up and quit.

    Cons for being unionized:
    - Lumped Grouping. You may end up in a situation where you, say a sys-admin, are lumped into a union with programmers. The prog's make $60k/year, but your job commands $75k/year. The company says to the union, hey, we'll give you prog's the $60k, but the sys-admin's get that too. 25 prog's, 2 sys-admins voting in the union on the contract. Who do you think is going to win? Not the sys-admin.
    - Seniority Rules. Seniority tends to be the thing in a union. The longer you are with a company, the better your chances of picking up jobs within the company. And the job doesn't necessairly have to be related. I've seen secretaries go from secretarial pool to 2nd tier help-desk support, double their salary, all because the union contract called for internal first, based on seniority, then external. 20 years in the pool, vs 1 year 1st tier help desk. Who wins? Who's more qualified?
    - Based Rate Salary. You get what everyone else gets, starting from a base. Perhaps you are in a group of programmers, and now high-level programming is called for. Because the programmers all get $60k, you get it too, even though your specific knowledge would command more on the open market. However, the salary is protected through market downturns.

    Pros of being non-unionized:
    - Negotiated Salary. You get what you negotiate. Don't like their 3 weeks holiday rule, and negotiate 4? It's yours. Same for salary. Market rules.

    Cons of being non-unionized:
    - Indiscriminate Firing. They can let you go, when they want, how they want, etc. Yes, there are laws, but ask any labour lawyer how tough it is to win based on those laws. Layoff time? Your turn, so sorry.
    - Negotiated Salary. ;-) Market downturn for your position? Oh well, lesser pay for you this time around. Unions tend to protect against that. It's rare to see cuts in salary, except in extreme circumstances.

    These are some notes that just popped into my head. There are many more reasons on either side of the issue, but it's really up to the individual. I've met many people who love unions, and wouldn't try to work without them, and I've seen others who hate them vehemently. I've seen people switch sides so often, I got whiplash watching.

    I doubt there's any truly "right" answer, it does tend to be up to what the individual is looking for. If you don't want a union, you find a job in non-unionized shops. If you want one, you find a job in a unionized shop.

    Vip

  197. Re:Amazing... - by wholesomegrits · · Score: 2

    You can also see a model in some more activist unions of the union opposing things that aren't directly related to employment, but represent the beliefs of their employees. The National Education Association is probably the most notable such union -- much of their lobbying in education isn't related one way or the other to employment, but simply reflects what teachers believe are the best ways for schools to operate -- as opposed to what pundits, principles, school boards, and sound-bit-searching politicians think is best.

    As someone who will be entering the teaching profession in the near future, I can speak with some authority on this. The NEA is NOT a labor union. Consult their website, read their literature. In none of those materials will you find the NEA refer to itself as a union, or be affilicated with other unions.

    The AFT, American Federation of Teachers, is a union however. They are affilicated with the AFL-CIO, advocate strikes if conditions deteroriate to the point where they become necessary. The NEA does not advocate strikes on any level.

    Yes, the NEA lobbies all levels of government on a variety of issues not overtly releated to teaching, but in the view of the NEA, all issues relate to teaching. The NEA has an official position on gun control (less guns in schools=good) and nuclear weapons (they kill people) for example.

    The only national teachers' union, AFT, does not lobby for any issue not overtly releated to teaching. They have an official position on national testing, but leave gun control to others.

    The NEA is a teacher ONLY organization. If you are not a teacher, you cannot join. The AFT, on the other hand, says that any school employee from the counselors to the bus drivers can join. The philosophy being that everyone who works for a school has a vested interest in it being the best possible. However, management of the school (administrators and principals) are not allowed to join. The NEA leaves that decision up to the local level. If local branches of the NEA wish to permit administrators to join, then that's kosher. Most local chapters will allow administrators to join, so long as they were members of NEA as teachers, before moving into the management position.

    Calling the NEA a union is simply incorrect, despite them having a number of features which most unions have.

    --
    No sig is worth reading.
  198. Hey, I know... let's screw up everything! by osgeek · · Score: 1

    It's so very sad. The United States is the undisputed IT industry leader of the world. We have more jobs paying higher wages creating more engineer millionaires than anywhere on the planet.

    Even the crappiest just-out-of college student can find an extraordinarily well-paying job in the IT field here.

    So what do the socialists want to do? They want to fuck it all up buy unionizing. I just don't understand how anyone with half a brain working in the IT field in the United States would want to invite the evils of unions into our industry.

    Sure, if you're incompetent or a freeloader, you want to be in a union, but if you have even a minimum of self-respect for your ability to go out there and secure a job why on earth would you say, "Unions, Yes!"?

    Why on earth are you people so intent upon killing the goose that lays the golden eggs?

  199. Just get a job in academics. by TellarHK · · Score: 1

    The pay's not as good, the benefits are stable, and you usually get a union of some kind for State or Federal employees anyhow. And it's REALLY hard to lose a government job when you're on full-time, thanks to the anti-PHB protections that the government has put in place.

  200. Well, duh by Wansu · · Score: 1

    I guess the companies don't want the unions. If the unions get in, companies will have to treat people better.

    OTOH

    Q: How many teamsters does it take to change a light bulb?
    A: 15. You gotta problem wid dat?

    --
    Wansu, th' chinese sailor
  201. Re:Unions and Problems by jeffry_smith · · Score: 1

    As has been commented, your unskilled labor includes:
    Electricians
    Plumbers
    Pilots
    Teachers
    Nurses
    EMTs
    Airplane Mechanics

    etc, etc.
    Really unskilled there, anyone can just be a nurse, just walk into a hospital and sign up!

  202. Unions are outmoded by Dancin_Santa · · Score: 1

    The traditional industries in which unions are strong all have the same achilles heel. It is near impossible to move those jobs completely out of the country. Unions derive their power from the fact that industries can't survive without their workers and can't easily move production to another locale without breaking the bank.

    Information-based industry, though, has no trouble simply packing up code and shipping it off to Timbuktu. The cost of moving is trivial and developers are a dime a dozen. A modicum of training and voila! We've got XYZware.com now cranking out software from Swaziland.

    Unions are bound to fail in this industry because developers are in a very different position than, say, an auto worker. Whereas any single auto worker is completely disposable, good software engineers are individually important to the well-being of a company. The auto worker can derive strength by turning his interests over to a union who will bargain with management using the threat of large-scale walkouts. The software engineer, OTOH, gains essentially nothing through collective bargaining. He, in fact, would lose out in the case where the company decides that it is in its best interest to fire all union members and hire new engineers or change company locale altogether.

    Businesses are not interested in seeing unions form because they fear the strike. However, information industries have an ace up their sleeve, which is the relative (to other industries) simplicity of moving to another country whose laws may not favor unions as much as they do here.

    It's a really difficult and touchy subject, but I think it's an issue that will come to a head some time in the next couple of years. In the end, I predict that we will see the entire information industry unionization drive cracked by the unwillingness of many (if not most) engineers to join. Without enough numbers, unions would be effectively powerless, and with management's very real threat of moving jobs, it is likely they wouldn't have much power to begin with.

    Dancin Santa

    1. Re:Unions are outmoded by Dancin_Santa · · Score: 1

      I don't disagree with you. I think conditions are very favorable in the US for the tech industry. The infrastructure exists (though power is a little shaky these days) and the talent, for the most part, exists.

      I doubt that a company would up and move at the first sight of a union organizer, but it stands to reason that other countries (India, Japan, Singapore, Malaysia) are wanting in on this gold rush and are laying the foundations necessary to support this industry on their own soil.

      Currently, the pros of staying in the US far outweigh the cons. However, it is a matter of time before these emerging tech centers achieve parity with the US.

      Of course, that's just my opinion.

      Dancin Santa
      I'm glad elves will work for gingerbread cookies and free dental care.

  203. Tech Support by Anonymous Coward · · Score: 1

    One virtually ignored aspect is technical support. Dell computer burned through every qualified tech in Austin, then they burned through everyone who could operate a computer with halfway decent proficency. Then they burned through all the people temp agencies could drum up. Having a union might cost Dell a little more, but it would actually improve Dell's bottom line by helping to retain qualified employees, instead of having to move their tech support department, because they're under-paying their employees. This is not unique to Dell. Considering that most tech support departments are turning to auto-mechanics for their troubleshooting skills, I don't expect it will be long before they are unionized. And it will be good for those who need tech-support. The larger corporations might even think about training their employees on new products.

  204. So nice to see a good debate! by subbiecho · · Score: 1

    It's very gratifying to see my post get so much intelligent discussion!
    Unions may not always work, and may not always be a boon to every industry, but the truth of the matter is this: WE... the workers and citizens of the United States, deserve the right to form a union within the workplace if we see fit.
    It is corporations that profit from a lack of worker organization, not those of us putting in the long hours, and spending thousands of dollars on educating ourselves just so we can GET these time-consuming, energy-draining but albiet satisfying jobs.
    You've all heard of the Teamsters? Well.. they began as a Lawyers Union, in California. Bet ya thought they were all truck-drivers, right? Who would've thought lawyers needed a union? Who would've ever thought geeks did? Well, if there is this much hoopla.. apparently some geeks need it.
    How can anyone NOT support the right of workers to have a voice? Any workers! That's what I'd really like to know.

    yes, i realize this is buried waaaaaay at the bottom of the list and no one will ever see it. think that stops me? ;)

    --
    "We don't stop playing because we grow old. We grow old because we stop playing."
  205. Re:Amazing... - by WebCowboy · · Score: 1

    Whoa...Piloting a Jet is less challenging than coding?! Coding x86 assembler maybe. Airline pilots work long hours and if they screw up they can kill hundreds of people along with themselves. Of course they deserve a six figure salary! Joe Blow VB/Java/Perl coder hardly has more responsibility than that, and I'd say $50,000 (especially US$) is fair and generous compensation.

    I'm sure there are more senior technical people who work on critical safety systems that warrant a six figure salary, but that's only a fraction of the techies out there.

    As for pilots being unionised--their jobs are deemed quite important, so if the nation's economy is disrupted too much they'll just get canned anyways. Think back to the Reagan days...

    I believe Unions as they exist today in North America are obsolete. Labour relations should be more co-operative than confrontational, and from my observations "professional" unions (teachers, nurses and so on) have hindered those professions. They are not regarded as professional occupations in the same way managers and engineers are (although they definitely should be), and that has to do with the sometimes unprofessional, teamsters-style strategies employed by sometimes self-interested union leaders.

  206. It is your fault for letting them.... by MarNuke · · Score: 1
    We're not all young and single and without commitments. We're not all in full control of our work situations.

    I think you proved the point made. It is your fault you don't have money in an account to cover your ass when you decide to say to the hell with it. It's your fault that you have your commitments.

    Once you have a family and a mortgage, cars and educations to pay for, the whole "you can get another job" thing isn't quite as simple.

    Having a mortgage, cars, student loans, kids, family makes everything more complex, however, it does not make it impossiable to get another job. If you just have planned your life a little better, it wouldn't be that hard.

    --
    MarNuke
  207. Idiot by smartin · · Score: 1

    I happen to like my job, I happen to like my employer. I want to work for a company, be part of it, work with it for our combined success, I want to be judged, promoted and rewarded for my work and efforts, not the amount of time I've worked there and not on the collective effort of my co-workers.

    I don't want to work for a union, I don't want to work with unionized people, I do not want to work in an environment where it is "us the employees" vs "them in managment".

    Unions are for people that work in comodity positions where anyone can do the same job and exist to protect dead wood.

    --
    The difference between Canada and the USA is that in Canada healthcare is a right and gun ownership is a privilege.
  208. collective barganing: A great way to lower income by Kope · · Score: 2

    Folks, higher skilled workers earn more than lower skilled workers in this industry. Even when the lower skilled workers have more seniority. The reason is that we don't have collective barganing and each worker is free to negotiate their own wage.

    Moreover, we don't have a couple of hundred dollars a month sucked out of our paychecks to fund the organizer's pockets.

    The net result of all this is that those of us who are in the top percentiles skills wise get to make a shitload more money than if we where in a "union" shop.

    In the world of unions, every worker gets the same wage, regardless of differences in talent. They get the same raises based on years of experience. They have no power to bargain on their own behalf - no matter how much better they might be than their coworkers.

    And folks, there's a hell of a lot of difference between a top-end coder or data analyst and a mediocre one.

    Unionization will be a loose-loose proposition. Top talent will loose wages if they stay in union shops and union shops will loose top talent since they won't pay them what they deserve.

    Bad idea, folks. Really.

  209. Re:Unions by BigBlockMopar · · Score: 2

    ...machining brake pistons... $35/hr+ - for minimum wage work! I don't know. Can you build a car?

    Of course. I've built several of them. There's most of a 1974 Plymouth Valiant in thousands of individual Zip-Lock baggies in my living room at the moment. The clerk at Wal-Mart asked me if I was dealing drugs because I buy so many baggies.

    Building a car isn't easy, and anyone with sufficient knowledge of all the parts of a car that they can relatively successfully assemble one, will be paid more than minimum wage as a simple law of supply and demand.

    As for machining brake pistons, as an example, it's very easy. With ten minutes of training, anyone could do it. It makes mopping floors look like ir would need a PhD. I would suggest that $35/hr for such a job is rather excessive.

    I should ask, what does it take to have a good life in Toronto? What is the cost of living? How many hours would it take to earn at mininum wage to pay for an house? Apartment? Food? Bills?

    A lot. But you obviously don't know anything about supply and demand.

    Let's say that affordable housing for minimum wage brainiacs is a two hour commute away.

    If Taco Bell can't get people to mop the floors in downtown Toronto because all their minimum wage employee base is, by virtue of real estate costs, too far away from work, then Taco Bell is going to have to pay more money. Either to entice people who can live in the more expensive parts of the city to work there, or to offset the high costs of the commute.

    I think unions have a way to go to improve their image and their fuctions in a high-tech world, but they fought the good fight back in the 1800s for everyone to which I'm grateful.

    Great! Yeah, the 1800s were a time with no labor laws. The industrial revolution was in its infancy, and as society shifted from an agrigarian existance to an industrial workforce, yeah, unions had their place.

    But today? Nah. If you don't like your job, get another one. Can't find a better job? Read a book, then try again.

    --
    Fire and Meat. Yummy.
  210. Re:Unions by BigBlockMopar · · Score: 2

    I disagree. The reason your car doesn't explode is because it's engineered that way. I am honstly awestruck when my auto mechanic friend pulls parts out of a vehicle to repair and they are in such a state of disrepair that you have to shake your head... I mean if your CV joints go, they usually cripple the vehicle instead of locking up and causing an accident. If your tie rods go... well then you're fucked but usually these things are built such that when a piece dies, it dies gracefully. I would hate to think what vehicles designed by web programmers would do.

    For sure! It's all about quality of design. Quality of construction is important, but the design should have sufficient tolerance for errors in the construction that nothing really bad happens.

    As an example of construction errors, a long held legend among Toyota dealership mechanics is that approximately 40,000 Camrys left the plants in 1987, missing a right front speaker.

    A speaker is a little harder to miss than a tiny little C-clip that retains the active ingredients in your brake master cylinder! And Toyota has, unquestionably, some of the best assembly quality in the industry. (Note that they're not unionized, either, and yet Toyota employees are better paid than many union factories.)

    Actually, the fun thing about Toyota is that they pay their staff a small minimum. And then the assembly line workers get generous bonuses based on the quality of their work. The net effect is that everyone is paid what they're worth, because your pay is inversely proportional to your defect rate.

    Sadly, UAW is very much against this sort of practise. I think that's telling.

    If a job requires a level of skill then pay for it. Don't pay the twitt stamping out metal pieces $28/hr to watch a machine work and take the product and put it on a shelf for post-processing. That is promoting mediocrity.

    For sure! And remember, most of the people in these manufacturing jobs *are* mediocre. They're there because they were too lazy or unmotivated to go to school, or to learn about something like computers on their own. And therefore, when you give them a union, they become mediocre with an attitude.

    --
    Fire and Meat. Yummy.
  211. How the Mob Deals with Squealers. by BigBlockMopar · · Score: 2

    If you were, you would be more likely to know that most unions are run by the mob.
    (Posting anonymously because I don't want to be buried under Giants Stadium)

    No, they don't do that anymore. Too messy.

    Now, they take you to a Jersey wrecking yard, toss you into the trunk of a toasted Caprice Classic, and then you get to ride through a Newell shredder.Ouch.

    That's the leading Hoffa disappearance theory, too, BTW. If you've never seen a car shredder, lemme tell you, there'd be nothing left. These things can shred forged nodular iron crankshafts.

    --
    Fire and Meat. Yummy.
  212. Re:Unions by BigBlockMopar · · Score: 2

    How about the automotive CEO's that make 60-70+ million a year? Now that is wage inflation, at least the guy making pistons is producing something.

    I think $60-$70 million is a little more than what the CEOs get paid.

    Now, as for what the CEO does. He organizes the company, provides a vision and an outlook, and helps to ensure that the shareholders get a good return on their investment.

    The guy who machines brake pistons does something that can be taught with ten minutes training.

    If you lose your CEO, you'll have to use $$ to lure one away from another company.

    If you lose your brake piston machinist, you can train any McDonalds counter-schlep to do it in under ten minutes.

    I fail to understand how you can equate the CEO with such unskilled labor and suggest that any wage parity is warranted. That's sheer idiocy.

    The automobile has its purpose, commuting isn't it.

    When the alternative is riding on public transit with unionized hotel chambermaids and other smelly dregs of society, yeah, the car's purpose very much is commuting. And if my government won't allow me to drive to work, then my quality of life is impaired. I will then take my talents and skills and move somewhere that allows me some standard of living for my hard work.

    Canada is a capitalist economy, I do know that for sure.

    To the same extent that France is capitalist. Sure. Any further to the left, and the national passtime of hockey will be replaced by shredding copies of Pravda for toilet paper.

    I'm not sure how much your capitalists rely on the government though.

    Northern Telecom gets over $100 million in government subsidies every year. Canada has a population of approximately 1/10th of the US tax base from which to draw those subsidies.

    You probably have a more represntive government, which allows such things as nationalized medical care.

    I'd rather have the option of paying money and geting health care where I don't have to sit three hours in a waiting room with a chatty homeless heroin addict as I wait for a strepped throat prescription.

    Here in the US...

    Wanna do something illegal?

    Here's a suggestion. You seem disenfranchised with the US. I'm disenfranchised with Canada. You want something more left, I want something more right. I'm 6'4", 185 lbs, brown hair and eyes, 26 years old, no criminal record. If you've got similar stats, we can pull an ID swap. How's that?

    You'd be able to vote for the Socialist Workers Party next Canadian election, and I'd be able to vote Libertarian next American election.

    The scary part is, I'm only halfway kidding.

    --
    Fire and Meat. Yummy.
  213. Re:Unions by BigBlockMopar · · Score: 2

    Labour law falls under provincial jurisdiction. The difficulties in organising vary greatly from province to province.

    True.

    And while there are many things I don't like about Mike Harris, his stance on unions is one of the reasons I helped to re-elect him.

    --
    Fire and Meat. Yummy.
  214. H1Bs vs. Unions by swb · · Score: 2

    I'm not quite sure what the linkage is, but does anyone smell a rat where pro-H1Bs and anti-union sentiment can be found in the same place?

  215. Unions in creative areas by Animats · · Score: 2
    Unions make a lot of sense in several situations. Jobs like phone tech support are obvious candidates for unionization. Lots of people doing the same job in the same place.

    But it doesn't stop there. Some creative jobs are organized. Hollywood is very unionized; actors belong to the Screen Actor's Guild (SAG) or the American Federation of Television and Radio Artists (AFTRA), musicians belong to the American Federation of Musicians (AFM) directors belong to the Director's Guild of America (DGA), drivers belong to the Teamsters, and most of the support people belong to the International Association of Theatrical and Stage Workers (IATSE). Lucasfilm's animators and CGI techs in Northern California belong to IATSE, which is trying to organize online entertainment shops. If you're doing web design or involved in running a web site, it might be worth talking to an IATSE organizer. They send people to ACM SIGGRAPH meetings in SF, so they're not hard to find.

    A union shop is a great advantage in an industry with heavy time pressures. It gives the employees an effective way to push back. Anybody in those unions who works a 12-hour day gets paid major overtime. Get called in for a weekend emergency, and big bonuses apply. This discourages employeers from understaffing and overworking their employees. If a job needs to be done 24/7, it takes four full-time employees.

    Organizing in the US is very tough. Over 90% of employees who try to organize a union are fired, even though this is illegal. Canada, for example, has stronger labor laws, and it's much easier to organize there. This is the main reason for declining union membership in the US.

    Despite the obstacles, temps at Microsoft have successfully organized a union, and won a lawsuit against Microsoft.

  216. Can we get the benefits of collective action... by otis+wildflower · · Score: 2

    ... such as collective pricing on insurance, registry of good/bad employers (our own black/white lists), legal counsel, etc. without a traditional labor union?

    There are features there that I'm interested in, particularly since it would help reduce the risk in going independent.

    Someone mentioned the idea of a 'guild', which is really very interesting, and probably the best fit. SAGE is AFAICS a mostly skills/interest group, what I'd be interested in is something like that but with the addition of services at group prices. I can get 25% off ORA books with a Usenix/SAGE membership, howsabout 25% off Sun or Cisco hardware? ;)

    Your Working Boy,

  217. Re:Amazing... - by Cederic · · Score: 2


    Although the easy answer here is to be multi-skilled. e.g. I can do Java, Delphi, architecture design, OO design, test design, technical writing, IT strategy design - and implementation, business analysis, requirements gathering, and a few other software engineering tasks.

    I can also run a business team of 10 people - but if you tell my boss this I will slap you, I'm trying to keep it quiet so that I don't have to. But I do get involved with business process design, with reviewing business practices and with creating corporate strategy.

    I'm not saying I'm any good at any of these things. But my company thinks that I have enough skill in each of them that it employed me (and has since promoted me) ahead of people with more specialised skillsets.

    (Just to confirm, I do have extremely well developed skills in some of the above areas. And I really suck at some of them. I wont say which :)

    ~Cederic

  218. Re:Now I get it... by Tony+Hammitt · · Score: 1

    Well, that's certainly true. I'd much rather have a nice, short program that did the same thing.

    The point is, whether new or just updated, the lines of code edited per year has been dropping steadily. I think that this is because of the large number of newbie programmers flooding the marketplace, not only bringing the average down with their output but also by taking time away from the experts for trivialities.

    When it comes down to it, the average productivity has dropped, no matter what scale you use. Propping up mediocrity, as all unions do, is more inappropriate for the tech industry because of the wide variance in productivity. Take the best UAW worker versus the worst, how much more productive is the shining star? ALmost not at all, they are on an assembly line, it goes a certain speed. Take an Alan Cox or some other genius versus the most clueless newbie, the productivity ratio is enormous.

    Let's get rid of the unproductive programmers who will never amount to crap and get back to work.

  219. Union of ONE by JBMcB · · Score: 1

    I have my own Union. My company can fire me at any time, and I can come in, pick up my coffee cup, and say "I'm GONE" at any time. They'll be the one whose screwed, I can find another IT job anywhere, it'll take my replacement at least a few months to get up to speed on what I've been working on. I'm happy working here, if I'm not I'll quit and get another job. Employee/Employer loyalty is a fabrication of the unions, if a company is screwing you DON'T WORK FOR THEM.

    --
    My Other Computer Is A Data General Nova III.
  220. Unions are harmful in the IT industry by kurokaze · · Score: 1

    All a union would accomplish is allow some 2-bit,
    half-ass programmer to claim similar pay and
    status as their more experienced and talented
    peers.

    I bet that you're not going to find any highly
    skilled and paid individuals rushing to join
    a union because they not they don't need it!
    Their skills speak for themselves, not some
    200lb gorilla which claims to be a voice for
    the workers when really they're just bullys.

    In the IT industry, competition is King. If you can't take the heat then you have no place here.

  221. Unions look out for noone but themselves by ipxodi · · Score: 1

    I worked at UPS during the Teamsters strike a few years ago. I can tell you how much the union was looking out for their people: They gave their members $55 per week in strike pay. Then they took out the union dues. Some people went home with $13 paychecks with which they were supposed to feed their families. Yeah, I can see how much the union cared about its "brothers and sisters"..... What a f***ing crock, they cared NOTHING about their members.

    --
    load "windows7" ,8,1
  222. Re:Amazing... - Point #4 is flawed by dbrutus · · Score: 1

    While you won't move your primary production to one facility in E. Europe in one shot, you might want to take a look at Rational Software's methodology. By breaking down projects into small pieces that cycle quickly, each cycle leaving useable artifacts, you have the basis for distributing your code to many shops in many countries all of which use this methodology (30 day free trial available at www.rational.com) to get requirements and manage changes. Great tools (expensive as hell though).

    You end up having your high level folk in the US, gathering the requirements and managing the process while the bulk of the work goes on in 2nd world nations saving costs.

    DB

  223. Re:Amazing... - by bigdavex · · Score: 1
    Imagine if all the programmers in the US refused to work for less than, say $55,000.
    Then those people who couldn't assure $55,000 worth of value would lose their jobs. What about co-ops? How did they get started?
    Free-loaders wouldn't be justifiable anymore, and anyone who was good enough/hard-working enough would be even better.
    Are free-loaders justifiable now?

    I suspect that genuinely good programmers are underpaid relative to their less productive counterparts. I suspect that a union doesn't help them.

    --
    -Dave
  224. Now I get it... by Tony+Hammitt · · Score: 2

    There is a startling difference between the traditional laborer and the tech industry: The very best tech workers can be up to 100 times more productive than the average. There is no way in hell that a manual laborer could be even 2 times more productive than average, they are slowed down by physics and the other workers around them. Not true of tech workers, someone else's slowness is independent of your own speed.

    Good programmers know that they can crank out thousands of lines of code in a day if the requirements are well defined. The industry average for lines of code per year dropped to 6500 from 9000 per programmer. Is this because the requirements aren't there? Probably in large measure, but in any case, the average productivity stinks. You elite programmers out there: doesn't the average year of output sound like a slow month?

    I'm using this to conclude that we do not need a union for the tech industries. There is no need to try to protect the other half of the bell curve. They can get a job that they can handle, and stop trying to pretend that they are techies. If they want unions so bad, let them go make cars.

  225. Oh great... by squiggleslash · · Score: 2
    I'm not suggesting the topic is a troll or anything, but with so many Slashdotters:
    • Convinced that anything slightly anti-business is "communism", and that "communism", regardless of what it's describing today, is "evil"
    • Americans, and therefore subscribers to the notion that Unions are just a way of channelling money to the Mafia
    • Convinced that all programmers are single, young, and in a job market where they can pick up any type of job they wish, and therefore able to choose the Linux based open source employer of their dreams with no dreaded clueless salespeople to screw up the objectives and with benefits that'd make those poor sods in "socialist" countries like, er, every single country other than the US, weep.
    Is there any way that this topic could end up being anything other than a flamefest?

    It's just one of those topics I'm surprised you'd want the Slashdot crowd to contribute to. Next stop: "Should Government Trustbusters Nationalise Microsoft?"?
    --

    --
    You are not alone. This is not normal. None of this is normal.
  226. Re:Unions can protect against discrimination??? by mcwop · · Score: 1
    Not always. Come to Baltimore where the Unions leaned on Politicians not to prosecute a crooked cop caught on camera framing an innocent black man with a bag of crack. It was a police sting and you can read various articles about it in the Baltimore sun. Unions only enforce Discrimination against management. When it is perpetrated by their own members it is ignored.

    --

    "I don't think it's selfish, to eat defenseless shellfish." -NOFX

  227. Unions and Problems by gaijin99 · · Score: 1
    I'm pretty pro union, but I'll admit that I don't see much need for a tech union, right now. Tomorrow? Who knows

    I do notice a lot of anti-union sentiment here, and I don't think is really well thought out. Many people seem to object to the entire idea of unions based on one bad experience. This isn't really a good way to judge an entire issue, the first time I tried to install Linux it crashed and ate three hours of my time, should I decide that Linux sucks based on this alone?

    While, admittedly, unions can sometimes do bad things, look at the way it was before we had unions. Go back and read about the working conditions under Rockerfeller or any of the other tycoons, it sucked much worse than any of the problems you've had with unions. Also, unions have a positive affect even in industries that aren't unionized, the fear of unionization sometimes keeps a corporation from doing anything really nasty.

    I think some of the rest of the problem is that mostly people only hear about unions when they go on strike, the times when the union negotiates with a company and they come to an agreement are usually left out of the news. Any union worker has better pay, better benefits, and more job security than a non-union worker. In our era of increasing corporate power I can't help but think that any check on that power can't be bad.

    --
    "Mission Accomplished" -- George W. Bush May 1, 2003
    1. Re:Unions and Problems by sirket · · Score: 1

      Before we had unions? Unions were created to give unskilled laborers power through numbers.

      We are not unskilled labor. We are not without power. I can leave my job any time I want to and I will have another job waiting for me. I can start my own company if I want to. We have a lot of options open to us and I do not believe unions will help us in any way now. You are right, maybe in the future they will become a necessary evil.

      But evil they definitely are as I think the last Verizon strike proved how useless unions are. That strike got the unions nothing that Verizon would not have given them. It did however get the union ring leaders more money and more members. All the workers got was a pidly raise and lost pay for a week.

      No thanks, but unions are not for me and I will not work for a company that has them.

      -sirket

  228. You have no clue. by XBL · · Score: 2

    The point of the union is to help people get a good, stable income and benefits so you can raise a family, or whatever, with peice of mind.

    People don't realize that a union is a safety net, so that the worse case scenario doesn't happen.

    The UAW (United Auto Workers) has directly affected the quality of my life while growing up. There were a lot of tough times in the 80's and the UAW helped my family through it. There were stikes and shutdowns, etc. It all worked out in the end, and my family and the company are both doing well.

    In fact, I would be willing to say that if the UAW did not exist, I would not be where I am today, with a good tech job and having the free time and interest to write this post on Slashdot.

    Just because you have not benefitted from a union does not mean that MILLIONS of other middle-class people have not. Many people's quality of life would not be as high, plain and simple.br>
    Also, considering the fact that I would not feel very comfortable raising a family while working for a .COM, a union is definitely a viable option here. Working together is a good thing.

  229. Unions can protect against discrimination by SwedishChef · · Score: 1

    While few of you highly skilled techies are likely to spontaneously become Asian or Native American overnight, you are certain to grow older. (Or die, of course.) Look around and count the number of employees over 50 (or even 40) you work with. Now count the number of years you have left until you are old enough to be considered outdated. (Oh, I know... you are going to always keep your skills up to date... yeah, right.) Unions aren't perfect, but they stick up for all the workers not just the super-talented ones. They negotiate for the older workers who bring with them a history of why things are done the way they are as well as the worker who was injured in an accident and is disabled.

    I can hear you say, "but discrimination on the basis of age or disability is illegal." Only if you can prove it. If you are in a union, you know you at least have someone who will be on your side when your company decides 35 is too old to be a good programmer.

    --
    No one ever had to evacuate a city because the solar panels broke!
  230. Re: That 25 cents... by DarkEdgeX · · Score: 1

    Shrug, I'd rather have someone to represent my interests. I think I gave a prime example of why as well-- your only comeback is that I'd lose some money to union dues. Big deal; atleast I wouldn't work 50-80 hours a week and then be told it wasn't enough on Sunday.

    Granted, I'm still not in a union and my current job is amazing. Excellent team, nice hours, good pay and very flexible management.

    But, as I said, wait another 5 or 10 years. IT will change, eventually people will want a lot of things from employers like--

    a) paid training to keep current on new technologies.

    b) better pay to keep up atleast somewhat with the rising costs our society always has.

    c) better positions, or new positions dealing with newer technology-- not legacy technology that's "on the way out" (along with your job entirely).

    The problem as I stated earlier, is that it seems a vast majority of posters here (so far, this topic just started so I'll hope for more pro-Union or atleast pro-organized labor) aren't for Unions because they view their jobs as safe, and the demand for their work as endless. It never crosses their mind that the same colleges they were through is bulging with fresher IT workers that are willing to take cheaper wages to pay off those expensive college loans.

    Unions might not be the answer, but there must be some way of keeping our rights respected and our pay reasonable-- because honestly, I see this job and I'm happy with the pay, but I don't see myself in this job four or five years from now. And why? Because technology moves ahead at speeds that would require someone to go back to college every 4-5 years for new training and/or hit up seminars and/or read a library of books to keep up.

    And the interval between new languages, technologies, hardware and software is only shortening.

    I'd gladly give a union a portion of my pay, if it meant represntation and fair pay for new and old workers alike, and retraining where needed.

    --
    All I know about Bush is I had a good job when Clinton was president.
  231. Re:Unions by AdminMan · · Score: 1

    Labour law falls under provincial jurisdiction. The difficulties in organising vary greatly from province to province.

  232. Re:Unions by hrieke · · Score: 2

    Look at the automotive industry. It's full of people who do menial tasks like machining brake pistons. And yet, their unions are so strong that they get paid $35/hr+ - for minimum wage work!
    I don't know. Can you build a car?
    I should ask, what does it take to have a good life in Toronto? What is the cost of living? How many hours would it take to earn at mininum wage to pay for an house? Apartment? Food? Bills?
    I think unions have a way to go to improve their image and their fuctions in a high-tech world, but they fought the good fight back in the 1800s for everyone to which I'm grateful.

    --
    III.IIVIVIXIIVIVIIIVVIIIIXVIIIXIIIIIIIIVIIIIVVIIIV IIVIIIIIIVIII...
  233. Probably seniority issues by Rix · · Score: 1

    Unions often force employers to promote based on stagnation as opposed to merit...
    Cheers,

    Rick Kirkland

    1. Re:Probably seniority issues by MikeFM · · Score: 2

      Exactly right. Don't get me wrong I do think promotion on who's been loyal to the company longest can be a good system but only provided they have equal skills for the job.

      --
      At what price learning? At what cost wisdom? The price is a man's peace of mind, and the cost is his life.
  234. What happens when... by loki29 · · Score: 1

    You mentioned foreign workers here in the US.

    Consider this, if unions were forced upon tech companies, you'd see a lot of farming out to countries (take your pick out of India or any of a half dozen countries in that area) where they don't have the kinds of standards that we in the US have. They are doing that enough as it is, and forcing unions upon the industry would cause this to happen anymore.

    The end result would be less jobs here, and companies farming out to countries whose standards, etc., are far below the US.

  235. Re:I'll join by sirket · · Score: 1

    Fabulous idea.

    Let's introduce a bunch of corrupt union ring leaders into our ranks. Let's not get better pay, or better jobs but instead have to pay union rates as well. THE HELL WITH THAT.

    Get your head out of your ass. If you were a good admin you could get a good job that doesn't involve your sitting in some tiny cube overworked and underpaid. I work 9-5, make 6 figures, and I love the power that leaving at any time gives me. I am incharge of my group and we work well together. We work with each other not for each other.

    My suggestion, get a better job and do not ruin things for the rest of us. If you were any good you would be able to get a job that you would actually enjoy.

    (And you could do it on your own if you tried.)

    -sirket

    (Sorry for the inflamatory post but I will be damned if I will let a bunch lazy people freeload off the hard work that the rest of us put in. Good jobs are out there and are not hard to find. Or better yet, found your own company and make things better.)

  236. Re:example difference union anti-union attitude by Dancin_Santa · · Score: 1

    How many of the non-unionized employees lost their jobs because the company was forced to pay non-productive employees for 3 months and provide them with massive benefits? How many jobs could have been saved?

    Companies are not bottomless moneybags. If they are forced to pay for something in one sector, expect that another sector is going to be screwed out of their share. All you have shown is that pro-worker laws at the non-US location sucked valuable monetary resources from the US location, forcing a larger number of layoffs in the US.

    Dancin Santa

  237. Its really a bad idea by Rix · · Score: 1

    It actually lowers our value, by encouraging company loyalty. Given that we are in demand, having people move around more results in a more active market, resulting in higher average saleries.
    Cheers,

    Rick Kirkland

  238. RE: profoundly ignorant comment by dbrutus · · Score: 1

    Any economy gets run by supply and demand. The only way you can bid up the price of labor so that these countries get out of their hole (and I'm thinking more about 2nd world countries, not 3rd world) is to send more work their way. Code outsource is a relatively clean and easy way to give them relatively high paying jobs (in their local wage scale) while saving the job exporters enough money to increase total employment.

    As for your anticipated glee at the insertion of back doors by outside the US programmers, that's why you compile from source after checking it. Besides, anything that malicious that it bankrupts a company is going to have some competent forensics people going over the mess. They'll trace it back to the outsourcing company and the hacker goes to jail. Most of the adults know this and thus don't hack from work no matter what country.

    DB

  239. The Whole Union/No Union Thing by DoofusRufus · · Score: 2

    I am not amazed by the incredible range of emotions this topic has spurred. I am totally saddened and angered at the elitism, racism, generalities, banalities and for the most part a reliance on anecedotal evidence for the arguments. Where is this alleged intelligent IT professional?

    I would venture to guess that a large part of this audience is young and too specialized to see a large world of which they are a part, and how much of the opportunity and easy pickings they have are because people died at the hands of company/government supported efforts to keep workers as thralls and chattel. And you have the gall to think that it does not continue to happen and will not continue to happen?

    A sense of community should go way beyond the buds you play Evercrack with and include all the 'sheeple' out there who have bought into the silicone snake oil scheme. That demand for product, whipped up by the media and marketing is the only reason you have the job opps that are there now.

    Booms don't last forever. Talk to the folks who make the physical existence around you possible. Think about how recent the reliance on computing is. Think about how only half of the U.S population owns a computer, or uses one in the workplace (and sales suck). Think about how hard the push is among Big Corp America and the lackey government that paves its' way to turn every kid into a tech wizard. Soon you will be the old farts trying to get a job maintaining some 6GL code you've never seen.

    As more of us who are currently old farts start to realize that all we have learned in those worker dog jobs translate into tech skills, and small corps realize that two stable adults that need a little training are worth more than one unstable whiz kid, you may just wish you had some protection.

    I just had to add some flame bait didn't I?

    --

    'Looking back to a better day, feeling old and in the way.' -David Grisma

  240. Re:Amazing... - by Kisc · · Score: 1

    >>>2. Tech companies haven't been above screwing employees. People get let go a couple weeks before their options come due, often for fabricated reasons. H1-B visas get rammed through Congress to drive down IT salaries. Imagine if the Big Three automakers tried to import tens of thousands of foreign workers and then pay them substandard wages!! It can only happen in IT.

    >>>This sounds racist to me. If other people are willing to do your job for less, and they're just as capable as you, why shouldn't they get the job? Because their skin is a different colour?

    No. That's wrong. I used to work for SeraNova. We built web sites. The company was run by a guy from India. The parent company is called Intelligroup. The CEO and his friends would bring in a bunch of developers from India. Sure they worked cheaper. But if one of them did ASP dev, he sure didn't do C++, or PERL, or even Visual C++. After they laid off of most of the IT and programming departments (me included), because the company was losing money, our little part of the company started losing money and clients as fast as the rest. Why? Because all these kids they brought in from India were paper Unix, or paper MCSE, or paper whatever you java people are, had no experience with anything, are completely unwilling to work on or learn about anything not directly related to their specialty, and don't seem to have much imagination at all.

    Please, shut up. I'm not being racist. I'm telling you about the people that came to Provo Utah, from India, and couldn't cut the mustard.

    The few guys that are left over from the old company have to work harder. The kids who used to just do HTML had to learn java, unix, etc, to get everything done themselves. I'm sure Cliff and Nick exaggerate, but not by too much. The "Unix Specialist" they hired knows telnet, knows IRC, knows how to chat, and that's it. They had to outsource their actual hosting and management of Solaris machines to a guy that used to work there (he made a little hosting company just for them).

    So. Not racist. Just PISSED. We had a fun, profitable, working little company going, and Intelligroup/SeraNova fscked everything up. With cheap imported labor. Happily, that includes themselves.

    Failure is not an option.

    --

    Failure is not an option.
    It comes bundled with Windows.
  241. Re:Amazing... - by darkwhite · · Score: 1

    Whoever moderated the parent offtopic better get their shit together...

    --

    [an error occurred while processing this directive]
  242. Things aren't always like the last few years by zzyzx · · Score: 1

    Based on the comment, "I'm only a co-op student," I'm guessing you've never experienced a slow economy. Sure right now it's extremely easy for a programmer to find a job. Maybe it will always be easy for the best programmers (and don't be that sure that you're one of them) to find a job. However, as the economy slows, it will become harder for good programmers to find jobs. Enjoy the good times while they're here, but make some plans for bad times. If you live under the assumption of, "Don't try to tell me it's hard to find a new job--it's easy if you don't suck," you might be in for an unpleasant surprise.

  243. Another opinion.. by mindstrm · · Score: 2

    Unions bad/good? It all depends.. they can be both.

    What bothers me, these days, is how often a perfectly happy workplace is interrupted by 'outsider' union organizers who come in to try to convince the staff that they should unionize, under their guidance, because it will benefit them.

    We aren't talking about several employees getting together and saying 'we need solidarity, so we can change things, because we don't like what's going on here', we're talking about outsiders coming in and brainwashing (or propagandizing) the staff into thinking that it's GOOD for them to unionize.

    THAT is my problem with it...

    If I ever own a shop, and people try to unionize, I *WILL* shut it down.

  244. Why would I need a Union? by loki29 · · Score: 2

    (just a reference, I work for one of the computer biggies down in Austin)

    I am well compensated for the work I do.

    I am quite happy with my environment.

    I know that if I am not happy with my conditions, whether it's pay or environment or management, I can go elsewhere and do just as well if not better.

    I find the idea of having to pay a part of my salary to somebody to represent me, in a word repugnant. I can go in and talk to management anytime I want to and they will listen to me.

    I find it scary that if I were in a union and they decided go on strike/work stoppage, even if I didn't agree with the rest of the union, it would affect me directly. This is the flip-side of the coin, if their interests did not represent mine, my voice would be silenced.

    Unions cannot stop me from getting laid off, so what's the point of wasting money on dues?

    Maybe it's the Texan in me, but I just don't cotton to other people "representing" me. I like to do my own negotiations :-)

  245. We Don't Need Unions, We Need A Guild by Gladivus · · Score: 2

    Folks
    Unions don't help in the long term. They are for profit organizaitons that use harsh tactics to intimidate both employers and union members. I've seen this done for over 10 years. In other trades that my family members belong to.

    As a developer, I strongly feel we need representation that will not cost us a dime! We need a guild that will represent our needs. A non profit organization that will be our voice.

    Unions don't work. Only the tatics employeed by unions work. Unions encourage their memebers to perform illegal acts against a company when certain working/contractual conditions are not met. This is not good for our economy nor is it good for the future. Large IT companies will go offshore and hire unskilled laborers, programmers etc.. to do the work that can be done here in the states.

    Don't be against some kind of organization, make sure you think about a guild, that doesn't profit from our hard work. We need some kind of a foundation. Something like the Free Developers Guild (FDG), Free Network Engineer's Guild (FNEG)
    etc...

    The Guild's can force companies to make working conditions better etc.. by notifying the media, political representatives etc..

    The Guild's will never engage in illegal activities, like sabotage(sp), violence against employers and employees.

    This what we need to work for.

    Peace

    James T. Romano

    --
    Don't look for a needle in a haystack. Look for a needle with other needles
  246. I'll join by jamesneal · · Score: 2
    I'll be the first to sign up, and here's why.

    As you'll find in the SEC filings of almost any public company, the primary goal of a public corporation is to improve the value of the company's stock for the shareholders.

    My primary goal is to give myself and my family a good life.

    These goals aren't always compatible. My job (sysadmining) requires that I work long (10-15 hour) days in uncomfortable working conditions. Pay isn't an issue. A senior UNIX sysadmin doesn't want for money.

    As far as the hours are concerned, the only thing that can change the situation is if there are more qualified sysadmins in the market, or of my company stops growing.

    As far as the uncomfortable working conditions are concerned (sitting on my butt in an over-crowded cubicle since we have no storage space), the only thing that could make my life better are improved ergonomics. Since my company isn't required by OHSA to do anything about the ergonomics of my workspace until after I'm already in pain, they're not going to do anything.

    Right now, the only weapon is leaving or the threat of leaving. What kind of weapon is that? For the first three months at my next job I have to pay COBRA rates for heath insurance, I have to completely adapt a new environment to my suitings, and at the end of it all, I'm just working for another company for 10-15 hours a day, in cramped and uncomfortable work spaces, in a sea of cubicles so noisy that I can barely concentrate on my work.

    I want better working conditions. I want better hours.

    ..And I can't do it on my own.

  247. Educate yourself by Dancin_Santa · · Score: 1

    For as much as Americans believe that their's is the land of the free, you live in one of the only places (if not the only place) in the western world where you do not have this right by law.

    No American law prohibits the formation of a union.

    Dancin Santa

  248. Clarification about "volunteer" fire department? by clary · · Score: 1
    Do firefighters on a volunteer department get paid anything more than a token stipend? Was this your father's primary job?

    If not, then my response to the suspension would have been a hearty "bite me...fight your own fires."

    --

    "Rub her feet." -- L.L.

  249. Real Life -- The Onion by istartedi · · Score: 3

    Manager Says Union Not Needed

    This just in. In an important new development in labor relations, managers at leading firms have determined that unions are not needed. Despite widespead speculation by management that this was the case, positive proof was lacking until recently. An executive at a leading technology firm, Cobalt, was quoated as saying:

    "Because clarity on issues like this is important, we have updated the Employee Handbook expressly stating Cobalt's position that a union is not needed here,"

    When asked about safety regulations, taxes, reports to stockholders, and equal rights; management had no specific comment other than that they were "cautiously optimistic".

    --
    For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
  250. Another thing about Unions & computers. by loki29 · · Score: 1

    Unions are the reason we pay so much for cars out of detroit.

    If the computer industry unionized, the price of computers, parts, software, etc., would skyrocket.

    As somebody said, people get paid $35 an hour to perform menial tasks. What do you think the biggest expense is in building a car??

    Could the computer industry survive a rise in prices due to unionship? Would we want that?

    I don't know about you guys, but I like paying $130 for 40G Hard drives. I can remember paying $300 for a 100M Hard drive. I have no desire to go back to those kinds of prices.

  251. Unions don't fit HERE by VasLor · · Score: 1
    I admit that back in the day and in some cases, the present, unions were and are needed in the instances of corporate abuse. The entertainment industry is kept in check with unions such as Actor's Equity, which has a very noble history in this country. At a time where theatres, managers and promotors were exploiting actors and performers (those who felt compelled to perform despite the pay), the performing community at large got together and said no more. Entire casts would be stranded in the middle of Kansas due to a producer or manager skipping town without the receipts. Costumes, hotel and travel expenses and sometimes scripts were paid for by the performers themselves. There was nothing resembling residuals and forget fair and equitable salary. As one, the community of performers got together and went on strike. Actors Equity was formed and basic rights and demands were laid out. The business community supported them. the public supported them. And they won. Today, Actors Equity still provides those same protections. How many horror stories have you heard about the entertainment corporations trying their best to deny the actors their due, when that actor makes milions for the company? Without the union, the company would run rough shod all over them. But in the IT industry its different.

    My skills are in demand currently as a developer. I can spit and find a great paying job. I am not worried about someone else taking my job. If my job is eliminated, I get a week or two off while I go get another one. Even the lower paying salaries in my field are damn better than most. In my field, with one major project, I can GET NOTICED by the CEO or upper management and given more responsibility and thus, a raise. I have the freedom to move from job to job if i want, always increasing my yearly income until I retire. I work for a major southern Telco and the people that started out here 30 years ago are amazed that people move up so fast. They remember when it was normal to stay in one department for five years before moving up. Now, the rate of advancement keeps climbing, especially now with the incredible demand for skill developers.

    With a union, all of that changes. You know when your next advancement is, because its in your contract. You don't have the freedom to jump around, especially if your entire career sector is unionized. You certainly can't volunteer to accept a new responsibility because somebody else may file a grievance with a union if they feel you are encroaching on their job. Even if the jobs are disimilar, its like a protracted court case. Do you have the time, energy and money to fight that? And what if your union strikes when you feel in your heart it is wrong? You must strike or quit. Because crossing that picket line can get you blacklisted in other jobs that fall under the same union. Scabs are not to be suffered. So therefore, you change careers or starve until the strike ends. Remember the UPS strike. Not everyone in the union wanted to strike, but they had to because to cross that picket line was to risk threat of injury to yourself or family, or to your career.

    At the major Telco I work for, the customer service and technical support people were complaining about their jobs. They wanted to unionize. Nobody could understand why, it seemed they just wanted to complain about working at the low rung of the IT ladder. Its a crappy job sometimes dealing with the public. These people started out at least 30k-40k, got two weeks of vacation, free medical, personal and sick days, bonuses, discount stock purchasing plan, free tuition toward training, a FREE MBA in business, a free cell phone and a whole slew of other benefits. This job rocks as an entry level! And all they did was answer the phone and provide technical and customer support or answered email. Not a glorious job in IT, but hey, we all have to start somewhere. I did, and 3 years later I make over double in salary with a cushy office job developing web pages. I can go where ever i want now. But these people wanted to Unionize over some perceived threat by management. What they didn't realize was, that once they start union proceedings with the company, all bonuses and benefits freeze, for the entire company until a contract is agreed upon. Do you think the rest of the company is going to be happy with them? I doubt it.

    The point is, the thought of a union in my field is scary and disconcerting. Those who want protection for their jobs in the IT field are usually those who don't have the skills to find other work if they suddenly are the victim of downsizing. I'm sure I'm painting with a broad brush, but I have the power to bargain my own contract, not rely on some organization who is going to tell me when I will advance and what I can't do as part of my job. The fact is, if you have the skills, you don't want for a job. The job wants you.

  252. Very true! by ishrat · · Score: 1
    If any company liked Unions, they'd probably be guys who went along with their workers and if that be the case, a union wouldn't be required in the first place.

    At the same time we all know politics is dirty and yet we all love to point out how dirty it is.

    --

    There's always sufficient, but not always at the right place nor for the right folks.

  253. "Nobody forces companies to accept unions" WRONG by Rix · · Score: 2

    In my juristiction (and pretty much everywhere, AFAIK) there's absolutely nothing an employer can do about a union. They either accept the contract, or they don't do business.

    And since the union pretty much decides who gets hired/fired, you'd better not talk to loudly about disolving it.
    Cheers,

    Rick Kirkland

  254. Re:Amazing... - by Tackhead · · Score: 2
    > I watched a supermarket go union. The promoters came in, and over a year and a bit, took a place where everyone *liked* the boss, [ ... to a place where ] everyone just bitches about their 'contract' instead of liking going to work every day

    Anyone interested in unionization or revolt against their capitalist masters should read George Orwell's "Animal Farm".

    Workers of the world, unite. You have nothing to lose but your chains.

    What the union organizers won't tell you is that you're only trading your chains for their chains.

  255. I will vote NO if asked by sulli · · Score: 2

    Unions cause poor quality and regimented, unhappy workforces by promoting conflicts between managers and employees, and by pushing for stupid work rules that cause overstaffing. As a consumer, I want nothing to do with unions but am forced to deal with them (airlines, telcos, public sector). As an employee, I don't want any part of such activity. If my company treats me badly, I'll quit and go somewhere else - I'm confident in my skills.

    --

    sulli
    RTFJ.
  256. Gather round children and hear the tale by gelfling · · Score: 2

    So most of you are coming off the greatest economic boom seen since the invention of cross border sea trade in the Mediterranean with the Minoans. And so most of think that either bad things can never happen to you or bad things can't happen.

    tsk tsk tsk you poor innocent children. Let me educate you.

    You work a bunch of hours now and say it's ok because you feel you're being compensated for it. Look out into the future. You're now older, have more responsibilities are expected to work the same or more hours and since the Great Downturn of 01 you haven't had a raise or much of one for 6 years, your job is less stable than ever and your CEO just cashed out to the tune of $100 million dollars because he/she train-wrecked the company the likes of which we haven't seen since Mike Armstrong managed to take ATT the most powerful monopoly in the country and screw it into the ground.

    There's a new crop of freshly scrubbed help desk meat coming the door and they are grateful for the opportunity to get shit and shot for a few months at maybe 60% of what a geezer like you makes. But still you're confident. After all you're the greatest fucking programmer since the invention of hex and as long as the company keeps making the doorways big enough to fit your ego through you're good to go! But what's that sound - OH YEAH the phone's ringing and your manager wants you to sit down with a consulting company to give them skill sets and develop requirements for the new programmers that are going to be outsourced in Ireland and India. Yeah I know - tough break, you tried to get all those H1B's in the door at start your own internal group but you couldn't get the numbers and REAL AMERICAN programmers cost too much. You want to fork back your equity to pay for them?

    So you passed on the management track to 'Stay Technical' and now you're not in a position to decide your own fate. You the alpha nerd are now the target of every cost reduction scheme. Dozens of other alpha nerds and nerdettes (AN/AN-F) are looking over their shoulders hoping its not them that gets the ax. All of a sudden project status meetings stop. You can't decide if its because the projects are dead or simply because managers are afraid to share any information with each other anymore. Sr. Team leads are 'encouraged' to look for savings in their own ranks. Remember 1 AN/AN-F = a multiple of baby nerds so you have to decide do you toss some qualified experienced bodies on pyre or do you commit the children to the flames. Either way, the only way out is up the chimney. 3QTR analysts hammer the stock and your options are officially so far under water you'd need the Glomar Challenger to get them back. Now you become aware that the work groups have been informally broken into 2 factions. The An/AN-F's and a junior group headed by new junior team leads who are going through the same exercise as you, looking for places to carve flesh. Flash forward. It's the next day and whole development group is scattered in a bloody heap. Scraps of bodies here, carnage, gore, goo over there. All killed off in a paranoid orgy of hate mistrust miscommunication and manipulation. The executives that are left are bought off to the tune of millions, the development assets are sold off to the offshore company and company ceases to exist. The workers did the knacking job themselves because they had no power position in the company and no stance from which to apply leverage to management.

    If you think this story is scary just consider that it is true.

  257. Re:Unions by tzanger · · Score: 1

    Being from Detroit (the home of the auto industry) and having a good number of family and friends in the industry, I can tell you that this is simply not true. Tomorrow when you get in your car and it doesn't explode three times on your way to the office, be thankful that your vehicle was assembled by people who are skilled and take pride in their work. Yes, it's repetitive, but so is designing and building apps that all look like nothing more than modified spreadsheets. And yes, there are those who do fulfill the stereotype, but there are slackers in every working venue in every industry -- look around you, for cryin' out loud!

    I disagree. The reason your car doesn't explode is because it's engineered that way. I am honstly awestruck when my auto mechanic friend pulls parts out of a vehicle to repair and they are in such a state of disrepair that you have to shake your head... I mean if your CV joints go, they usually cripple the vehicle instead of locking up and causing an accident. If your tie rods go... well then you're fucked but usually these things are built such that when a piece dies, it dies gracefully. I would hate to think what vehicles designed by web programmers would do.

    Back to the point: I am not disputing that your relatives are dedicated, hardworking people. The thing I'm disputing is that that has anything to do with the vechicle not working when it gets out. Auto plants are built with so many checks and balances that bad product just doesn't get out of the place: It's either reworked or scrapped. Take a moment and think about the ratio of QA-related tasks to actual assembly tasks and you'll see what I mean.

    If a job requires a level of skill then pay for it. Don't pay the twitt stamping out metal pieces $28/hr to watch a machine work and take the product and put it on a shelf for post-processing. That is promoting mediocrity. Make him responsible for making the product good (maintaining the machine, etc.) or pay him minimum + seniority. That's my opinion, anyway.

  258. Unions by the+eric+conspiracy · · Score: 1

    A lot of folks are speaking out against this because they don't see a need in the high tech industry - they have technology skills that are giving them a good living.

    However these unions are not aiming to organize the highly skilled professional - they are aiming at the thousands of lower skilled workers in the technology industry - the customer service reps working phone banks, the warehouse workers, etc.

    These are people who are often forced into very poor working conditions, sometimes with little regard for such niceties as pay above minimum wage, sick leave, and so on. If you are such a worker a union can be a positive.

    Management that comes out in a aggressive manner to fight a organization makes me wonder why they feel the need. If a company is treating it's workers well, they have no incentive to organize. It's the companies that are treating their workers shoddily that get organized.

    1. Re:Unions by pangloss · · Score: 1

      It's only because of sheer tenacity and Big Three ingenuity that Detroit has survived

      Survive? Please. GM and Ford occupy two of the top five slots in Fortune's Global 500 list.

      Unions have helped millions of non-union workers too. Remember when 12-hour work days were "normal" for the working public? Me neither. Unions played a great part in allowing us to take paid vacations & holidays, pensions, health care, grievance procedures for granted so that we can instead worry about whether our employer is going to include enough beer in the next WebVan purchase.

      There certainly are problems with labor unions, but demonizing them is just an corporate-brainwashed, intellectual cop-out. Labor unions don't exist because corporations make a habit of treating their employees as ends in themselves rather than as an expendable means to greater profits.

      Disclaimer: I'm not a union worker

  259. Re:Unions = No Motivation To Perform by peterandre · · Score: 1

    Keep in mind that unions establish minimums, not everybody gets paid just the minimum. I'm a member of the Writers Guild (movie-television industry), I get paid considerably more than the negotiated minimum as do most of my friends. There are union members who get millions of dollars per screenplay -- but no member gets less than the minimum. I also get portable medical insurance, residuals (wouldn't tech workers like to get those?), a retirement plan -- this for %1.5 of my paycheck). I'm still totally freelance, going from employer to employer every few months. On the other hand, the entertainment business has very few employers.... so the tech industry may not be ready.

  260. Re:Amazing... - by Ubergeek26 · · Score: 1

    4. A lot of anti-union people scream "I'm too good for a union - unions are for idiot construction workers." But many industry that depend on highly skilled labor are highly - pilots, aviation mechanics, teachers, athletes, actors. It obviously works for other "knowledge industries".

    You are kidding right?

    They are very greedy. Let's look at teacher's unions. They are against standards for teaching and for performance based evaluation. As a result of their "union" power there are a vast majority of teachers that suck and don't give a piss about their students.

    What really needs to happen is there needs to be more recruiting on the part of Colleges and Universities for their tech programs. What you see happening with a vast majority of tech companies is that they end up making their employees work overtime to compensate for the lack of qualified professionals. I know this is a major problem with Amazon, as my friend's fiance works for them and is constantly working overtime every single week, and not just a couple hours. As long as this continues in these types of companies the tech companies will continue to burn through us tech geeks.

    I am against unions for one particular reason, and one alone. In the end once the "good work environment" becomes a standard it will the be about the Union's interest and not mine. Right now if I am not going to be treated well, as someone has so deftly stated I can go elsewhere for work, and usually an increase in salary.

  261. www.workersoftheworldunite.org by SubtleNuance · · Score: 2

    Evry industry is nearing a effective monopoly or oligopoly - they collude and 'palm push' at the top, setting agendas for everyone.

    Havnt we all heard of the WTO? of the WIPO? FTAA? etc etc? What is happening is the Capatalist System is hitting a peak. It takes money to make money, and TransNationals are realizing it is easier to share in profit than really compete. Have a look at the auto-industry.. seen any real innovation, anything 'market shattering' there in the last 30 years? No.

    The barrier to entry for a worker is at the bottom - and their is no effective difference (in inherent rights or ablity) between one person and the next (outside skills which im sure we could argue werent that varying). Where as _any_ business is being 'sown' up these days - the barrier to entry is skyrocketing in almost every sector. What this leaves us is with one group that can set demands very effectively to the other (Business to Person).

    My point? Well, when we realize that the 'free market' for employment is really not 'free' at all - that we are all forced to operate in a climate where their will always be someone willing to do your job (just as well) for just a little less (or another interview-ee willling to accept a little less) labour will realize its only opportunity is to try and work together. TransNationals are certainly doing it - people have nearly zero bargaining power in the employee marketplace.

    Some people are going to pipe up saying "I make $120K a year - and could walk away into another $150K job in a week": I say good, but right now times are good for everyone, dont kid yourself - when 'times get bad' you'll wish you had any job at all. The TransNationals make money even when the economy is crap, and be certain: The transition to 'outsourcing' and 'contract employees' and its ilk will assure that when times appear they might get bad, all the really ruthless TransNationals will start chopping people left and right... it has to do with being nimble and having a more disposable workforce.

    Workers of the World Unite!

  262. Unions = No Motivation To Perform by CritterNYC · · Score: 4

    One of the biggest problems the unions have had in breaking into the tech sector is most tech workers (rather correct) assumption that unions protect workers regardless of ability and productivity. They rely on seniority and other nonsense. These things don't fly in the tech industry. More ability and productivity = more pay. It should always work this way. Unions have never been structured to handle this.

    This applies in tech and just about every other industry. The perfect example is my grandfather. He worked for Stanley (the US company that makes tools) way back before they were a union shop. He was a tool and die maker, dealing with 1/1000ths of an inch daily. He had good steady hands and a keen eye and could fix just about everything in the shop. He was a higher level tool and die maker because of his abilities. Then the shop unionized. He and the other high-level makers got pay-cuts, so that the lower-level (and lower-skilled) tool and die makers could get a raise and make the SAME money that he now did. Gone were raises, promotions and perks based on ability. Now things like seniority mattered. The work suffered, the tools suffered, and it was never the same through the rest of the time he worked there. But it was considered *OK* because now everyone made the same money and even the unskilled tool and die makers were now *protected* from the evil company that only wanted to make a buck.

    You had to see his face while he told this story to fully comprehend it. He used to love his work, before he was in a union.

  263. Unions not necessary by kirkb · · Score: 1
    Back when children worked for 4 cents per day in the coal mines, unions were necessary to stop employers from exploiting employees.

    Nowadays, unions serve to enable employees to exploit employers.

    Unions are a great way for a group of paint-sniffin' dropouts to use strongarm tactics to get more than their fair share out of life.

    Considering that most tech folks (especially programmers) are wildly overpaid, I don't think they'll need to resort to union tactics anytime soon.

    --
    Slashdot: come for the pedantry, stay for the condescension.
    1. Re:Unions not necessary by ljavelin · · Score: 1

      Here's what I know.

      I'm routinely TOLD to work 15-20 hours of overtime a week - UNPAID. Sure, they promise bonuses. But then again, they made me big promises with the stock options a year ago - something I now know was just a carrot to get me in the door. My last $500 "award" for 100 hours of overtime works out to $5 an hour. McD's is lookin' sweet!

      I can't afford a 3 bedroom house in the city where I live.

      My CEO has a $3 million house and a few nice Jags and a pricey house in the US Virgin Islands.... where he spends three out of every four weeks.

      Yeah, I don't need a union - YET. But do you know what? Once the economy goes sour and they REALLY start to screw us, I'll sure wish I had a union to protect my rights.

      Right now they're making a ton of money off of my labor. And I know that when the economy gets tough, they'll misuse me even more.

      If unions are for paint-sniffers, bring out the paint. My company routinely screws their own "team players". Good thing for this good IT economy - otherwise, I'd be totally fucked. Happily, next friday is my last day!

  264. Unions can be useful by Platinum+Dragon · · Score: 5

    After viewing the wide array of "Unions suck/Unions are for the lazy" posts here, I figured I should throw in my Cdn$0.02.

    A couple years ago, my dad and another firefighter were suspended for speaking out at a town council meeting. The volunteer department found out through a 1-inch town newspaper item that their ladder truck was being farmed out to a nearby large city for a while, despite being told four weeks before the truck was staying in town. The firefighters had serious concerns about farming out the truck; the town has several tall buildings on the south end, and the ladder would have been moved to a department a good ten minutes away from where they normally were. The chief, who was involved in the decision to transfer the truck, said nothing about the decision to the crew.

    At the next town council meeting, most of the department showed up. One firefighter, a lawyer, spoke for the group in front of the council about their concerns, both about the transfer of the truck and the secrecy in which the deal was shrouded. Despite being very civil and calm, the council ripped him, then called the chief up to back them up. After he was done speaking, he nearly ran out of the chamber. My dad followed and had a somewhat heated conversation with him. After the council meeting, my dad spoke with media that were on hand.

    A couple days later, letters were delivered to my dad and the other firefighter. Indefinite suspensions! For speaking! My dad might have been suspendable for arguing with the chief, but the lawyer/firefighter was clean; there was no reason to suspend him. After a month, both firefighters were brought back on board. Soon after, some of the firefighters started looking into organizing. Despite several attempts to avert the organizing by the chief, the fire became a member of the Teamsters, and the first organized volunteer department in Canada.

    The union wasn't brought in to increase wages, or let the firefighters be lazy; on the contrary, lazy people don't risk their lives around open flames on a regular basis for fun. They were brought in to preserve job security, to ensure fairness in disciplinary situations, and to ensure the firefighters have a group to defend them should the town try something stupid like that again.

    So, yes, unions are still sometimes necessary in this age. If nothing else, tech workers might find them useful in making sure they aren't overworked by fly-by-night dot.coms that are likely to end up on FuckedCompany.com in the near future.

    Much like big corporations, unions aren't all bad.

    --

    Someday, you're going to die. Get over it.
  265. Pro Teachnology Unions by a-optic · · Score: 1

    My father belonged to a union at one time. It is a pain to pay in the NOW, but in the future the union protects jobs. If not a new person can take you job making severely less then they pay you and they lay you off because it is cheaper to higher him then keep you. see my logic? If you work at a company for 10 or more years this is useful...because you depend on that job!!!!!!

    --
    "Before God we are all equally wise - and equally foolish." -Albert Einstein
    1. Re: Pro Teachnology Unions by Dungeon+Dweller · · Score: 2

      A lot of the "high skill" tech jobs out there are easily replaceable. There are only a very few that the industry actually utilizes that, at least on paper, it doesn't look better to hire the cheapest guy on the block. If you have ever read the mythical man month, you would know that replacing you DOES cost the company more money in the long run, but the premise of that book is that management doesn't understand that.

      Unless you truly specialize in some area that isn't in the realm of widespread knowledge, there are a lot of people who can hash out web pages and perl scripts in a snap these days.

      --
      Eh...
  266. Unions = Solution, DotComs != Problem by Felinoid · · Score: 1

    Unions are a solution to a problem... However Unions have extended themselfs so far they try to insert themselfs when they are NOT nessisary. The inherent problem with Unions is they can wreck ideal working conditions.

    Ask yourself... Can you leave at a moments notice and tell your boss "Go stuff it"?
    Ask yourself is your boss working with you?

    If you can answer no to both then you should consider a Union..

    Look at the tech industy today. Attempts are made to lock employees in. Skilled workers are very valuable.

    Unions will NOT prevent the insain work contracts that give away your work to the company. They will not protect your rights. And while they are at it they'll nuke your perks.

    At the bargoning table everything can go. Unions are known for trading off better pay for other stuff and managment will just fork it over so they can own everything you code.. and add additional rules like you can't have a personal computer of your own.. You can't have your own website.. you can't go shopping on-line..

    If you can quit at a moments notice you allready have more bargonning power than any Union can bring you.
    The only power a Union has is for one guy (who really dosn't know what your problems are) to pull your entire work force.

    It's a very blut tool and this isn't a blunt problem...

    No I don't want to sign away my rights to my code or be locked out of work for a year. I'll work some place else if nessisary. But I won't sign.

    Hell I don't even sign NDAs.. and they aren't that bad.. but I can chouse not to..

    With a Union it's all or nothing... most of you will sign reasonable NDAs.. Would you like to lose your friday pizza so that "I".. the only idiot who wants this... dosn't have to sign an NDA? Do I want to be forced to accept an NDA becose NOBODY ELSE cares? See the problem?

    It's for major issues... like my freaking life is in danger becouse I'm working next to a lithazic acid poison cannister that is breathing into the work space.. That level of stuff..

    It may not be so blatent.. made to work when sick.. not given a proper amount of days off so working hard when not quite awake.. dangerous work conditions becouse fellow employee running fork lift was working 12 hours non-stop...

    Unions are a good thing. Security guards, Supper market staff, oil refinerys...
    Thies people are far to easy to replace.. Individually they can be thrown away.. as a group,... a union.. they get decent working conditions and decent pay...

    But the tech industry is getting far better than decent working conditions with far better than decent pay..
    This isn't an industry that needs a Union... It's an industry that needs less managment.. not more...

    --
    I don't actually exist.
  267. Moot point by BeanThere · · Score: 2

    Chances are that if you're being offered stock & options, you aren't at one of the many companies who are screwing their employees big-time, so why would you want to strike anyway? Striking is for those who are being screwed by their employers, i.e. those that aren't being offered stock, don't get compensated properly for their many hours overtime, etc. And it happens more than some people here care to realise, many seem to shrug it off with "I'm such a damn brilliant amazing programmer that everyone is just offering me really amazing jobs all the time etc etc." Come on .. who are these people fooling? A "great-sounding job offer" is not the same as a "great job" - job offers are supposed to attract you - they almost always sound a lot better than they really are. And sure, salaries are super high in silicon valley, but then so is the cost of living, so you blow a lot of it on rent etc anyway. And while there may be a lot of demand in Silicon Valley for skilled tech workers, the situation is NOT the same elsewhere in the states - there are places in the States where it is fairly difficult to get a tech job, and you *can't* just walk out of any job and walk into any other job you want to, anytime. The same everywhere in the world.

    Sorry .. went into a bit of a rant there .. :)

  268. Speak for yourself by BeanThere · · Score: 2

    "They only make sense for people to stupid and unimaginative to know they can walk away from a job and join a competing company or start their own company if they don't like where they are"

    Firstly, not everybody WANTS to start a company (duh) - quite frankly, thats much harder work and longer hours than a 9-hour a day programming job. Secondly, not everybody is in a situation where it is at all possible to just walk out of their job and walk into a new super-amazing spiffo job tomorrow - if you don't happen to live in high-cost-of-living silicon valley, there are many areas in the States where the demand for skilled tech workers is very mediocre. And, believe it or not, not everybody wants to move across several states just to get a nicer job.

    Speak for yourself. Consider, just for a brief moment, that maybe other people have different situations to yourself.

  269. All noble goals... by tzanger · · Score: 1

    ... But I am positive that this is what every union in existance has started with.

    And if you think you can just LEAVE for another job, think again. The dotcoms have fallen. The party is over.

    Only for the people who have no skills and aren't living up to what they said they could do. I'm a pretty damn good embedded systems designer (HW+SW) with "enough" skill in DB and IT to get a decent paying job no matter where I go. The party is still in full force for me, and will likely continue to do so until I decide I don't want to play anymore.

  270. Tech Unions by DarkbladePDX · · Score: 1

    Folks, we're overlooking who we are. We are the people who make information happen. Information is power, if used correctly. A dot-com tech workers auction site (tech workers auctioning their services to employers) in close conjunction with a F*cked-companies type site is the thing. The real ly neccesary thing about the auction board is that it needs to be open bidding (all bids public) and all resumes public (except for personal info- name, address, etc.). This is how it works in a physical auction, from Sotheby's to a farm auction in Amish country. The potential bidders get to look at the item (the CV's are openly published) and the bids are repeated aloud by the auctioneer (openly published on the site). As long as workers post followup info to both sites ("Yeah, i took this offer here, and it is as advertised and the company is just great" or "I took this offer and got hosed this way and that way") and followup if the worker and company part ways, the system should work fairly well. Early adopters on the worker side are going to have a bit of a hard go, but so do all early adopters. Might work, yes?

  271. You mention 8 hour days/weekends off.. by loki29 · · Score: 1


    It's almost irrelevant nowadays, if an employer here said "You have to work 12 hour days, 6 days a week". You can bet they'll have problems filling the position if they aren't putting up the money (and a lot of it) for something like that.

    The problem with tech support, is every company does it differently, using different platforms, different applications, etc. It would be very hard to have some kind of "guild system" when you have such a large variance in that job. Tech support isn't something that you can train 5,000 people the same way and then send them off to 100 different companies and everybody's happy.

    And different companies do it different ways. Some companies have large databases of tech info, and if a customer calls in, they ask a question, the operator (for lack of a better word) types it in the database, the database spits out an answer, and they give that to a customer. Others, smaller places usually, the tech support personal who answer the phones are expected to know a lot.

    Every company does their own thing, and a guild system would not work in that situation.

    As far as unions in tech industry as a whole, the biggest obstacle, is the fact that we, the workers, are the ones who control our lives, so to speak. If I don't like a company, I'm not going to go bitch at some union rep who makes more than me about it, and expect the union to strike, thereby causing a lot more tension, and in some cases, problems for both the company and myself.

    If I don't like a company, I switch jobs. I have had half a dozen friends in the past year here in Austin do it, and they have all gotten much better jobs with little effort. Maybe most other places are not like that, and jobs might be scarce, but hey, you go where the work is.

  272. I hate unions by treat · · Score: 1

    I would never join a union. I would never work someone where many of my coworkers were in a union.

    My explanation about why I hate unions is best given as an example. I worked at a large company where all the maintainance/construction people had a union. Anything that was their job, you would get in serious trouble for doing - for example changing a lightbulb or emptying a garbage can. I saw a lot of laziness from these people, but the example is the day I saw 10 guys digging a ditch. They each had shovels, but only one person was digging at a time. They would dig for a minute while everyone else watched, and then switch to someone else. Complete laziness.

  273. Re:Amazing... - by IntlHarvester · · Score: 1

    It may only be a matter of time before everybody's management gets their act together to suppress developer wages. I'm not saying they would be wrong in trying to do so - that's their job, minimize expenses.

    It's happened before -- back in the 70s there was deliberate industry plan to train all sorts of unqualified people as COBOL programmers (Don't laugh youngsters -- COBOL used to be the standard for internal development) This was very successful in depressing programmer wages. Of course most of these retrained secretaries were laid off when COBOL went out of fashion in the 80s, and then the real COBOL guys had to come in and clean up the mess for Y2K, but from what I've heard it really sucked to be looking for programming work in this period.

    Another analogous event happend just in the last couple years with the MCSE debacle. Hard to believe, but in the mid-90s, NT admins were actually paid higher than Unix admins. But after the market was flooded with lots of imcompentant book trained people, NT system admin is probably the lowest paid ops job in the business.

    So, it's easy to think that one's skills are sharp enough that they are immune to these sorts of tactics, but just remember It Could Happen To You. Even if you are 100x better than those other guys it does make picking up the phone and getting a better/higher-paying job harder if the market were to be flooded with people that look similar to you on paper and charge half as much.
    --

    --
    Business. Numbers. Money. People. Computer World.
  274. Re:Clarification about "volunteer" fire department by Platinum+Dragon · · Score: 2

    Do firefighters on a volunteer department get paid anything more than a token stipend?

    About $20 per call. Since the department's coverage area increased a year ago, there have been a lot more calls.

    Was this your father's primary job?

    No, he's also an electrician at a Big Three auto plant (here's a hint; one of their concept cars, debuted at the Detroit Auto Show, runs Linux).

    If not, then my response to the suspension would have been a hearty "bite me...fight your own fires."

    And then it would have happened again to another couple firefighters. These guys see it as a duty; it's not exactly fun, but they do it anyway. My dad's been doing this for 25 years, and it's only in the past two or three that the town has started trying to pull crap like this. They felt it was better to organize before things got too bad, rather than let the morale of the entire department be tanked by a bunch of politicians. All, except for one vehemently anti-union guy, backed the union drive, because they all knew (from watching it happen live, in person) it could just as easily happen to them.

    --

    Someday, you're going to die. Get over it.
  275. Training and Benefits by travis77 · · Score: 1

    My brother is 5th generation sheet metal worker and so are my cousins, needless to say it is a family tradition. They are not teamsters or just general labor. To become a journeyman you have to go through the apprenticeship program that lasts four years. During the day you are assigned to a journeyman and 3 times a week you go to class to learn things from bending a flat piece of metal into anything you can think of to drafting and cad. I feel the IT industry could learn from this approach, the union could handle things like training, certification, and maintain professional competence. This approach could also eliminate the need for a bunch of certifications from different organizations and companies by bringing standardization. As it stands now either someone has a degree or they have a wallet filled with certs and everyone knows how qualified a MSCE is, or better yet, the ultimate ubergeek "The A+ Certified Tech." Who knows maybe I'm being an elitist.

    On the benefits side, I like my company but I would rather have a decent matching 401K like the rest of my family. Stock options that are just an incentive to make me work harder because I am an owner of my company but not a big enough shareholder to change my work environment. And on the statistics side of things union workers make more money. I had a decent childhood we had vacations, nice clothes, safe neighborhood, and strangely enough my mom was a housewife in the 80's and 90's.

    Travis

  276. Re:Amazing... - by RandomPeon · · Score: 4

    Although I am clearly biased on this point, I just dont see any other need for a tech-union, perhaps someone else can enlighten me on this issue.

    1. Any group has more power acting cohesively. Imagine how much money we could pull in if we had real bargaining power with all the companies in the industry. Imagine if all the programmers in the US refused to work for less than, say $55,000. Free-loaders wouldn't be justifiable anymore, and anyone who was good enough/hard-working enough would be even better. Look at pilots - they're less bright than coders by a lot, (I speak from USAF experience), but they're highly skilled and unionized - most airline pilots bring in $100,000+ for doing a job that's substantially less challenging than writing complex code. Did I mention they have unions?

    The problem is that right now we're settling for less than what we should expect. There are some fabulously profitable companies out there. But all of that money was made by coders, who got a generous amount of money, but in all honesty deserve more.

    2. Tech companies haven't been above screwing employees. People get let go a couple weeks before their options come due, often for fabricated reasons. H1-B visas get rammed through Congress to drive down IT salaries. Imagine if the Big Three automakers tried to import tens of thousands of foreign workers and then pay them substandard wages!! It can only happen in IT.

    3. Marketing practices of today may become labor practices of tommorrow. If a company is willing to screw consumers with "content protection" do you really trust it not to screw its own employees?

    4. A lot of anti-union people scream "I'm too good for a union - unions are for idiot construction workers." But many industry that depend on highly skilled labor are highly - pilots, aviation mechanics, teachers, athletes, actors. It obviously works for other "knowledge industries".

    5. Technology unions probably would be different than old-school unions - it would have to be easier to get rid of people, since it's easier to freeload than it is in manufacturing. Contracts would probably be shorter term, grievance procedures would be streamlined/scaled back, working condition issues would be much less important, etc.

    I know of *no* industry where unionization has decreased wages or really adversely affected employees.

  277. I am a Computer Engineering/Microbiology Double... by primenerd · · Score: 1

    ...and I for one know what C++ is. I agree with you position on unions, but come on, Biology majors != dumb. I would love to see you try and recite the stages of RNA transcription and all the fucking enzymes that are involved! Just because they didn't go into CS doesn't mean they are stupid. Liberal Arts majors however are a different story...

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  278. Weak unions are America's main problem... by kalifa · · Score: 2

    ...and it's also a symptom of collective brainwashing.

    There is obviously a problem with the fact that, in such a wealthy country, most workers do only have two or three weeks of holidays, a neanderthalian protection in case of disease, and very few days (sometines no days at all, they are considered as "sick days"!) for a woman who's having a baby.

    I'm sharing my life between the US and my native country. In my native country (it shouldn't be difficult to guess where I come from), I have 9 weeks of holidays/year, I will get my full salary even if I'm sick for a very long period (that is, much longer than the number of "sick days" in America of than a short-term disablility period -during which you usually lose 25% of your salary in the US-), my wife will strop working three months if she has a kid and get a full salary (she'll even stop 6 months starting with the 3rd kids), etc... I'm not saying it's a panacea, nor that it's not going too far. I'm saying that America is scandalously backward on these issues, because everything has to be sacrificed in the name of competitive business.

    In the name of economic competitivity, a preoccupation which really has become hysterical in America under the Reagan-Bush era, American workers have accepted the most extreme sacrifices on their working conditions, their free time, as well as their retirement and healthcare systems. This truly is brainwashing, and could not have happened if strong (and smart, which apparently was the problem in the US) unions had been there.