Slashdot Mirror
Japan to Allow Human-Nonhuman Mixed Cloning
Sara Chan writes: "Japan has decided to allow combined human-animal embryos to be produced through cloning, which could result in mixed-species creatures. The intended purpose is to permit transplant organs to be produced in specially-bred animals. The original story is in a Japanese newspaper, but you can get an English summary here."
We got too many trolls already.
really. it is.
i can't see anythign going wrong with that.
That soon we'll be seeing Spiderman, Wolverine and The Thing roaming the streets?
This just smells bad.
Bart: "How would I go about creating a half-man, half-monkey-type creature?" Ms. Krabapple: "I'm sorry, that would be playing God..." Bart: "God schmod. I want my monkey man!"
I'm a signature virus. Please copy me to your signature so I can replicate.
How else are they gunna make all that anime into live cinema. You need animal-human hybrids.
A rabbit in the hand is worth 4 in the cage
Do you really think Tony Blair or G.W. Bush are fully human ?
"A door is what a dog is perpetually on the wrong side of" - Ogden Nash
Finally, a country with a sensible policy!
I was wondering when the Japanese would take the logical next step and transform cat girls from an anime fantasy to creepy reality.
-- This and all my posts are in the public domain. I am a lawyer. I am not your lawyer, and this is not legal advice.
America, being too based on illogical and pointless religious fervor and political emotionalism will treat this with the same idiocy that they treat nuclear power. "It's EVIL! OH MY GOD WE CAN NOT HAVE THIS!".
Because, after all, what is important in this country is whether Oprah and Jerry Falwell condone it. Other than that, whether it actually is useful, moral, logical or efficient is pointless.
On a more serious note, I think this could be really usefull; like they mention, the prospect of growing pigs with fully compatible organs for humans could be VERY usefull indeed.
We do not live in the 21st century. We live in the 20 second century.
Mix a human with an octopus.
Perverted tenticle fetish!
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
Is this a step forward for mankind, or a step backward?
Sig (appended to the end of comments you post, 120 chars)
wreed interessant
So... how long before we get Japanese cat women, like those found in certain anime series?! Rowr!
Without you I'm one step closer to happiness without violence.
Cross-clone humans with octopii, what do you get ? Tentacle monsters!
To stay on topic : even though they 'intended' this for organ production, it is still a very sick concept.
-Billco, Fnarg.com
So cloning will be outlawed in Japan, but we can have catwomen. Here puss puss puss . . . .
Fast, cheap & reliable. Pick two.
This got modded down within thirty seconds of posting. So much for my rush to get first post. But anyway, this does raise serious ethical questions if someone is creating human animal hybrids. Also, does this mean that we can breed a "Manimal?"
Remember, there were no nuclear weapons before women were allowed to vote.
Finally! Now I can buy a replacement for the vestigial tail they cut off at birth!
/.: What type of tail do you want?
Ask
Personally, I'm going for a big mog tail like from Spaceballs. That way I'm sure to get _all_ the chicks!
Bring on the catgirls!
Canthros
we all love Heather Donahue
I find it fascinating that in America, people freak out when they hear about human cells being cloned. But in Japan, they're discussing mixing animal cells with human cells. I wonder how Americans would react to such a combination? I don't think the Religious Right would handle this issue very well.
Well even a late Max is still "all good"
as bioehticists keep telling us, science says that a human is nothing more than a mass of cells anyway... japan is just taking what seems like a consistent next step. brave new world anyone..?
Is this a publicity stunt for the next Godzilla movie? Mad scientist clones mutant human/lizard and destroys Tokyo.
Needless to say the medical community would prefer the 'cut hunter' theory which is on the face of it hard to credit. Humand have been eating monkeys in that part of the world for millenia. What changed to cause HIV to hop from one species to another?
The people who promote these schemes in the name of science should not be allowed to claim (as they usually do) that opposition is due to ignorance and superstition. The Nuclear industry tried that one in the fifties, the result was Three mile island, Chernobyl and several thousand power stations throughout the world built on an intrinsically unsafe technology that is unecconomic to operate. If there had been more skeptical enquiry in the fifties and sixties we might have ended up with fission power systems based on intrinsically safe designs - CANDU, Pebble bed etc.
These issues are vastly more complex than the glib statements made by the genetics industry would have people believe. They don't really know what they are doing, if they did they would have decipherted the human genome and be able to explain how it does what it does.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
Given their preoccupation with penis-size, can you imagine the possible results of this?
I suppose that would give a whole new meaning to the expression "Hung like a horse".
Ryosen
One man's "Troll, +1" is another man's "Insightful, +1".
I find this disturbing. And I'm one of the people who can't understand at all why people are bothered by the idea of 'regular' cloning; I mean it really makes no sense to me. But allowing chimeras to be created? That's just something I never thought anyone would do.
Or am I misunderstanding what's actually going on. Are they simply doing things like creating human hearts in monkeys and the like? As with the tobacco plants we rigged up to create hemoglobin or insulin or whatever? I don't really see a problem with that, I guess.
I do see that they plan to ban 'regular' cloning, so I guess they don't want the whole 'mad scientist' thing going on. If it could really be used to ultimately cure sick people and make people more healthy then really (imo) it would be unethical to disallow it.
autopr0n is like, down and stuff.
Only wierdo organized religion freaks think humans are 'special' because of their awareness of 'god'.
Humans are the only creatures gullible enough to be convinced there IS a god.
This puts a new twist on the phrase, "You are what you eat."
-
ping -f 255.255.255.255 # if only
There's a lot of irrational emotional issue's ... but whats really amoral about adding a few human genes to make organs better suited for human implantation? Its not like they are getting a huge part of the human genome, or that they will suddenly get the capacity to become self-conscious.
We are talking trivial changes here, sure you can give ridiculous examples of what you COULD do with human-animal mixing and extend the moral issues with that to what is actually being done. The only problem with that line of reasoning is that ITS FUCKING STUPID.
Just because its hard to draw a solid line between what is acceptable and whats not doesnt mean there arent any area's where for all extents and purposes you can make that assesment, if you bother to think clearly for 2 seconds and not be taken in by the religious nuts trying to confuse the issues.
My roomate has a thing for cat-girls and he's pretty excited right now. I however don't like this idea one bit. I mean most wild animals can kick a human's ass. Imagine a lion/man or and elephant/man. Smart and powerful. They'll take over. Just like exo squad, if you've ever seen it.
The GeekNights podcast is going strong. Listen!
This cannot be allowed to happen. The article mentions the possibility of mixed species creatures. I think the bible mentions the Apocalypse as having a rain of frogs or something.
What if someone creates frogs with WINGS?!?!
trying to solve their succession problem?
If I had sex with a human-animal hybrid would it beastality? What If I hunted and killed one of them would it be murder? If I ate one would it be cannibalism? Think about it.
This is a humongous step forward in genetic manipulation, anyone else feel that the whole civilised world should get the vote on this?
Its alright saying this will enable us to grow organs e.t.c, but its the next bio-warfare tool also.
What's the take on this from religous people (i'm not one of them) I'd be interested to hear it.
I dunno. I just don't know. Hate to see humans, or humanoids, harvested. Hate more to see governments telling scientists which experaments they can and can't try.
--- Ned!
We can argue indefinately whether genetic manipulation like this is moral or is not. But either way, it is going to happen. I think we have to acknowledge that.
Got friends?
This won't necessarily be so bad. There are a few equine physical characteristics that might be useful.
I'm speaking of the ability to run quickly, of course...
Knunov
Why do users with IDs under 100,000 or over 700,000 usually have the most worthwhile comments?
Although many conservative religious leaders and followers will undoubtedly condemn this action, it will prove or disprove the point they have been arguing for centuries: that humans have a soul, and animals do not.
If the experiments are able to produce human-like creatures without coitus and traditional conception, the only reasonable conclusion that can be drawn is that the "soul" does not exist, and that humans are no more sophisticated than the most advanced carbon-based machine we can invent.
If the experiments are not able to produce creatures that demonstrate free will, emotions and feelings, and other characteristically human qualities, the inevitable conclusion will be that a soul does exist in each of us, and the religious will most likely be able to use this as a rationale for banning abortion, stem cell research, and other procedures that involve the sacrifice of young human life.
Although Pat Robertson et al will likely oppose this research, they do so out of the fear that their position will become obsolete. But instead they should see it as a natural step in the quest for truth, and learn to live with the outcome. It can help them just as much as it can hurt them.
~wally
"[...] which could result in mixed-species creatures."
I'd like to see a combination of Britney Spears and a lioness. The howls might be the same, but the striped fur and twitchy tail would rock! :)
A truly excellent pizza parlor is a delight unto the heavens. Treasure the sauce and the toppings!
IANAgeneticist, but what if these animal-halves that you start creating are sentient?
Join the Slashcott! Stay away entirely Feb 10 thru Feb 17! Close all tabs to prevent autorefresh!
Poor comic book places.. I mean, hey, who is going to want to read about Batman, Spiderman, etc etc when you can walk down the street and see it all in person?
Well.. eventually, maybe they'll have comic books with such creatures as just plain "Man". I sure hope it doesn't come to that, though.
Yomiuri Shimbun has an excellent English edition, which has an English version of the article in the Science section.
If they could make those then maybe the Spam that promises you will be hung like a horse will come true.
IANAGeneticist, but my understanding is that insulin for diabetics is produced by injecting human genes into e. coli bacteria. So, aren't we already making human-nonhuman (in this case, bacteria) hybrids?
I think this is the scariest frontline documentary I've ever seen:
Organ Farm
Watch "The Isle of Dr. Moreau" for a small glimpse of what it's like...
Mixing species is just asking for trouble... but who's to stop it..?
Humans and apes are 90-97% the same. What if I replace 70% of a human genome with the exact same genes from an orangutan or chimanze? How would you distinguish that from a cloned human?
Nevertheless, if I can do this to pig or a cow instead of a human being, so much better.
Transgenic implants are a terrible idea. The most credible theory on the origin of HIV is that it jumped species after a bunch of vaccinations with a trial vaccine that had been incubated in monkeys. The first known cases of AIDS turn out to map pretty well to the trial sites. .... These issues are vastly more complex than the glib statements made by the genetics industry would have people believe. They don't really know what they are doing, if they did they would have decipherted the human genome and be able to explain how it does what it does.
Your post takes a lot of unrelated scientific stuff, and tries to form a causal relationship. This is simply not acceptible. Ask your statistics teacher. It is all FUD. You have given no real data to back up your slamming of the genetics researchers.
They who would give up an essential liberty for temporary security, deserve neither liberty or security
Genetic engineering is still in its infancy. There is very little understanding of all the implications, and mistakes will be made. The thing is, though - we should allow them to be made. How else will we eventually get the desert-growing veggies that can feed thousands of people? The genetic cures for incurable diseases? Genetics is still in an "alchemy" stage, and it's expected that things will blow up, but with a lot of trial-and-error, I'm sure it will become at viable science within our lifetimes.
Last post!
Miracles don't happen. Supernatural events have never been recorded. Period.
If no one had ever told you about God, would you be aware of him? If he/she/it is out there, they don't seem to give a damn about what happens here anyway.
"I tell you the truth, this generation will certainly not pass away until all these things [end of the world, etc.] have happened." - Jesus, Luke 21:32, c. 2000 YEARS AGO
what more need I say?
No thanks. I just saw The Island Of Dr. Monreau last night.
Miracles don't happen. Supernatural events have never been recorded. If no one had told you about God, would you be aware of him?
Luke 21:32 "I tell you the truth, this generation will certainly not pass away until all these things [end of the world, etc.] have happened." Jesus, circa 2000 years ago. If any of his original apostles are still left, speak up!
Which half-human creature would you most like to have sex with?
- Cat-woman
- Lion-woman
- Tentacle creature
- Elephant-man
- Robmalda-man
domc
If this is true, then there is no hope for natural evolution ever again. Just remember everything that is beautiful in this world as you watch it be replaced with technology.
of how technology can be used for both good and bad. The power contained in our advances must be directed. Unfortunately there will be some who choose to mis use the information at thier fingertips. Kurzweil used the example:
Where all going to be standing kneedeep in in an explosive liquid waiting for anyone to light a match. Our only hope is to have enough fire extinguishers.
I assume that alot of the technique used by these labratories will be released in journals to the medical community... and to everyone else.
In this case I think laws are governments' only option, and I dont know if that is enough.
--
What is the sound of this sentence?
Forget about the clones. Here come the furries.
Burgundy Advocate doesn't fuck sheep.
Dragging people kicking and screaming into reality since 1996.
...and be damned with all those "they're playing god" types. Hell yes they're playing god - and if you aren't too, then you're less than fully human.
Nou Kees
The country that until recently had no age of consent, now its 13...... Japan is going off the rails, not enough independent thinkers to say "whoah guys hold up!! this is some serious shit, and we're askin for a disaster... lets chill and think about this."
Remember the big economic crash a while back?? caused by greedy banks and lots of Creative Accounting.
my 2 pee
Ali [ moc.nodnol@ ]
Japan's first transplant procedure in 1968 resulted with the doctor being charged with murder because it wasn't clear if the donor was brain dead.
Aparently the taboo has something to do with Japan's Shinto and Buddhist beliefs. Here's a link: Japan Legalized Organ Transplants from Brain-dead.
Yeah, well, sorry.
Is this a step forward for mankind, or a step backward?
That is a good question. I guess the only way to figure it out is if we try it and see what happens. The scientific method demands experiments! There is no other way to know.
It does sound scary and rather gross, but it will definitely answer a lot of questions we have about nature and human life. Plus if it turns out that intelligence is inherited then we will have quite the future ahead of us. Can anybody say Uplift?
Superficial reading of the Ananova article would give one the impression that they are talking about a partly human chimera (it is hard to read "combined human-animal embryos" any other way); which would be a horribly unethical monstrosity.
What they're undoubtedly talking about (though I can't verify it since I can't read Japanese) are transgenic animals which express human proteins which is nothing new and posses no real ethical challenges (other than those involving the safety issues of xenotransplantation such as the real posibility for introducing various pathogens into the human population).
Needless to say the medical community would prefer the 'cut hunter' theory which is on the face of it hard to credit.
If wild game is carrying a blood-borne disease that humans can get, the occasional human will get it.
Humand have been eating monkeys in that part of the world for millenia. What changed to cause HIV to hop from one species to another?
Why assume it didn't before? The proper question is: what changed to cause HIV to spread widely enough to be noticed by modern medical science?
So a hunter gets a disease that kills him in 5 or 10 years, passes it to his wife, maybe one or two others. Maybe from time to time in history it would decimate villages. That's as far as it goes. HIV is pretty hard to pass on, unless you butcher something that has it with cuts on your hands, have anal sex, or share needles. Any one incident of normal vaginal sex is unlikely to cause infection. AIDS wasn't initially called GRID (Gay-Related Immuno-Deficiency) for nothing; regardless of what's politically correct, this disease was spread worldwide by promiscuous homosexual men, and only later spread to heterosexuals (most likely through needle-sharing drug whores).
Look forward to the 20th century: some hunter gets the disease, passes it on to a traveller who travels the world by jet, regularly sleeping with male prostitutes or other promiscuous gay men, and spreads it to a or more dozen of them. The disease then has worldwide exponential growth until people hear about it.
There's the change! Easy worldwide travel, more toleration of homosexuality, the use and sharing of needles for injecting recreational drugs... social and technological changes.
I'm not saying it wasn't started with a vaccine, but I certainly wouldn't call the "cut hunter" theory "hard to credit."
...the scene in Galaxy Quest where they transport the creature Tim Allen was fighting on the dirt/rock planet to the ship. The teleport itself is successfull, except the creature arrives as a squealing quivering blob inside out and then explodes. Eeewwww.
Mix humans with birds to create angels! Hmm.. would that make the scientists God? That would be a fun debate to see.
Here is the English version of the same newspaper article.
From the article:
The hope is that human organs could be grown in other species and later transplanted into humans.
However, some said the decision opens the door to the risk of creating mixed-species organs, or possibly even creatures.
The article is about the publication of guidelines on research into human cloning. While allowing the cloning of aggregate embryos, the Wednesday announcement bars all other embryo cloning, citing insufficient debate about the ramifications of such cloning.
The research hasn't even begun yet. Maybe its possible to grow aggregate embryos, maybe its not. Maybe it will result in mixed-species, maybe not.
A Modest Proposal
but I know one guy who's sure to be lovin' it already...
The goatse man!
How is this a troll? he is right.. america will become the backwater of the science community.
The More Knowledge you have the Luckier you Get- J.R. Ewing
>Cloning, human and otherwise, is absolutely essential to the continued progress of science and technology. With Biotech, we could be looking at cures for cancer, AIDs, old-age, the mentally retarded, etc., etc.
9 /H arvell.html
I couldn't agree more, but setting aside the rantings of religious zealots, there are some excellent reasons to be cautious.
The most important (in my ever so humble opinion) is that our current disease fighting science is in it's infancy. We are still feeding people penicillin for common bacterial infections. We still can not cure HIV. HIV, as diseases go, is INCREDIBLY hard to catch. With few exceptions you about have to have sex with someone to get it. If AIDS were as infectious as influenza, do you think there would be anybody outside of Antarctica that didn't have it today?
As an excellent post pointed out above, the most credible explaination for HIV infecting our species was with a trial vaccine incubated in monkeys. Simply put the reasons that diseases don't readily hop species to species is that millions of years of specialzation have occured on both sides of the battle between disease and host. Anything that helps the diseases hop this gap is indescribably dangerous. The nice folk at cornell point out that even our planet's gradual shift to warmer temperatures is helping the diseases along:
http://www.news.cornell.edu/Chronicle/99/9.16.9
By creating hybrid humans we are creating living incubation chambers that will allow diseases that could not normally infect a human to evolve into ones that can. And unlike the race to build a better car, where the not-so-daring citizen can choose not to buy a cool new (possibly dangerous) model, there is no opting out of next Black Plague.
You see, Whatever created us gave us the ability to create life, and gave us the abilities we have by evolving us.
So anyone here who believes in god but isnt blinded by the bibles description of god, can understand that.
If we program a computer to do something the computer does what its created to do, whatever created us obviously created us to create and to destroy.
Thats basically our job.I belive theres supposed to be a balance in creation and destruction but right now we destroy more than we create due to greed.
If you use Linux, please help development of Autopac
Like the mosquitoes they're trying to develop that have a malarial protein in their saliva, naturally immunizing those they bite instead of spreading the disease?
Oh hell... now this is going to give all those greasy Otaku one more thing to fantacize about: real-life catgirls.
(Catgirls, a.k.a. "Nekomimi", are a popular fetish amongst Otaku. If you hadn't noticed, of course.)
Does it make you happy you're so strange?
To elaborate: They have taken full organs from genetically engineered animals, and placed them into animals of a different species, As well as taken cells from genetically engineered pigs, and placed them into humans.
In English, the noun is always pluralized; never the adjective. Thus, the plural form of "mother-in-law" is "mothers-in-law", not "mother-in-laws".
So what's news about this. H.G. Wells had thought up of such a possibility in Island of Dr. Moreau.
Is this a step forward for mankind, or a step backward?
It's a step. That's all that matters. Earth is a changing system. We stay put, we die. We keep evolving, we have a chance.
Your God (somehow I don't think it's so black and white as you say) will keep up I'm sure. Just don't piss the specially bread super-people off in his name and start a race war. Oh, yeah, back to that: animals have spirits to. One of these days you'll get that. We're not special.
I say, bring on Bart's Monkey Man! Oh, wait, we already are monkey man. Uh, bring on the, uh, oh heck, uh, spider men! Oh, wait, we're already trying spider cows. Uh, oh heck! The possibilities just overwhelm me....
It's true that CANDU is safer than the designs at Chernobyl or Three Mile Island, but they failed because of gross mismanagement. Both cases involve severely sleep-deprived workers, bad maintenance, and multiple human errors. Worse disasters have come from the same roots, involving chemical factories and other heavy industry.
Nuclear power was killed, and made uneconomic, by ignorance and superstition. With too few nuclear power stations built, each one was designed almost uniquely, and the trades involved were never developed. There was and is a ridiculous fuss over the waste disposal, which is actually a simple matter. Everything got tied down with a hundred times as much red tape as any other power source would.
Cornell Marine Disease Predictions
Beyond that, what the hell are you talking about with a reaction by Americans? Like no one in America is going to find out out about this, or that no one in America is going to react to this at all? They're reacting right now, go listen to what they're saying rather than asking pointless questions.
Cloning, human and otherwise, is absolutely essential to the continued progress of science and technology. With Biotech, we could be looking at cures for cancer, AIDs, old-age, the mentally retarded, etc., etc. This is no time to let theocrats like GW Bush and Pat Robertson dictate our public policy.
Ask yourself: do you want the US to become the backwater of the world simply because a bunch of fundies decide that Science is against a nonsensical and outdated code of 'ethics'?
There is the problem of building a better monster, but the genetic problem of "Evolve or Die" still persists. If we are not leading, we are following.
If we genetically remove defective genes from the human species, we remove the ignorance flaw which seems do drive all emotionally-driven Republican arguements. At this point the scientists have forgotten simple gene-truths for now. The current cloning methods make embryos "born old" as they don't effectively reset the genes. Even solving that problem adds another if that tech was used for rejuvination (a reset cell would start growing like a newly fertilized one and then all the rejuvinated cells would grow new fetuses bodywide).
"Face it, a nation that maintains a 72% approval rating on George W. Bush is a nation with a very loose grip on reality.
They wern't really using giant robots in evangelion, you know...
autopr0n is like, down and stuff.
I will attempt to explain to you the reasoning behind the "religious right" when they oppose this stuff (stuff = cloning, abortion, suicide).
r es )
There is a concept that is not much mentioned (certainly not in the (typically liberal) media), it's called sanctity of life. The idea is that life is a holy thing or that life has value. This comes into play in each of these situations.
abortion: convenience vs. life - The mother (and sometimes the father) don't want a child and but they want the sex, so the utilitarian answer is to get rid of the child and keep the sex (BTW - I won't debate what is and isn't a human, that's stupid, if anything can be a human there's no sense in calling it something it isn't. -i.e. a corpse is still human but no one ever mentions that)
cloning: is simply unnatural reproduction. Much like lesbians being fertilized. This unnatural reproduction degrades life to the point that it can be thrown around. Ever wonder why we have kids are killing kids...because their parents didn't value their lives and didn't pass along this sanctity to them. They see that murderers are paraded on TV, much less are true heros.
Suicide: Suicide (assisted or otherwise) is one thing, total rejection of any dependence on God. By taking your own life, you cement your belief that God does not have a will for your life and is not working for the good of those who love Him, through your pain. BTW, pain is how you grow stronger, ask any athlete, ask any mature person.
In conclusion, because life is not held as holy by secular humanists and secular humanists are the most vocal to serve themselves, all we here is this secular point of view, so that's all we know.
When asked in an interview why most of the evidence for creationism is ignored and evolutionism is heralded, Biologist Sir Julian Huxley replied, "I suppose the reason we lept at The Origin of Species was because the idea of God interfered with our sexual mores." (mores - http://www.dictionary.com/cgi-bin/dict.pl?term=mo
Humans 1000 years from now will look down on us
for performaning such atrocities against animals.
Animals are self aware beings. We have no right
to use them for this. People argue that animals
don't have feelings but any pet owner could tell
you otherwise. If animals could express what they are feeling in words maybe people would understand why its wrong for us to treat animals as objects.
Each animal has a personality and a family.
Finally! I can have a son with horns and a tail and hooves that will ram my enemies into oblivion!
Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
so what if he's been racist and a troll in the past. for better or worse, even if it is disingenous, his post communicates a valid point that is relevant to the discussion. mod it back up.
I find it fascinating that in America, people freak out when they hear about human cells being cloned. But in Japan...
Read the article, they are banning outright 'normal' human cloning. So obviously they share the same fears that people here do.
autopr0n is like, down and stuff.
Now they really can make a human with four asses.
... and got cheese and quackers.
Bantam Dominique roosters crow a four-note song. Once you've heard it as "Happy BIRTHday" you can't NOT hear it that way
Looks like I goofed. As can be seen by reading the English version of the article that someone posted here, the article truly is talking about partly human cell aggregates. However, the Ananova piece still constitutes bad reporting since "Ministers hope the move will lead to transplant organs being produced in specially-bred animals." clearly makes it seem like the guidelines are approving of the creation of chimeric animals which they are not.
With all these references to getting a tail, let me disspell the myth. No, you won't turn into a gigantic ape that's 10's more powerful JUST because you have a tail like Gokuu. Freaks. ;)
-
ping -f 255.255.255.255 # if only
Now I can get that pair of wings and tail I've always wanted.
Of course, the US government will probably preemptively outlaw this just like Bush is trying to do with human cloning, thereby guaranteeing another area in which the US falls behind in research like we started to do with encryption for a while, and are soon to do with security post-DMCA.
Those silly Japanese! Now we are going to have Pikachu's and Mewtwo's running around everywhere! I choose you human-cat-dog-pig-snake-baboon-weasel-achu!
...and it's just as bad with plants. Plants have feelings! We shouldn't eat animals or plants. It's morally wrong to kill living things. We should just learn to photosynthesize.
While most of the western world is arguing against the medical use of cloned human embryos to help the living (for "moral" reasons), its refereshing to see a country trying to take it to the next level.
At the very simplist aspect, I see (say) beef DNA being combined with (say) certain parts of fish DNA to make leaner beef, or fatter fish. They, of course, could never be released into the wild.
Being a Mac user, I think that the first creature that they should create is a dogcow. And they should name him Clarus. Dogcows would be cool -- you would have all the benefits of a cow (i.e. steak and milk) in the convenience of a dog.
Then, when he gets sick and has to be put to sleep, instead of just crying your eyes out, you could take him to the butcher and your family can have a nice steak dinner while remembering old Clarus.
Never before can I remember society banning science from developing beneficial technology. Its spooky the way that we seem to embrace technology that destroys life, but are wary about technology that saves, preserves, or creates it.
Remembering the idea from the Judge in the Simpsons, its about time someone issues a restraining order -- Religion has to stay at least 10 feet away from Science at all times.
...is that of thousands of rabid Furries creaming their shorts after reading this news story.
- A.P.
"Remember when the U.S. had a drug problem, and then we declared a War On Drugs, and now you can't buy drugs anymore?"
It's funny how people start talking about 'religion' and excuse 'religious' beliefs when they know very little about them! You can tell because they always talk about a Christian Framework of belief. Because this is their only understanding of religion - a priviledged post-christian one!
It's not the Religious nuts we are worrying about here, it's the irreligious ones!
It's what these cold hearted Scientists are going to do with such a free reign.
This is horrendous moderation.
autopr0n is like, down and stuff.
Imagine getting both frog legs and chicken wings from the same animal. I can't imagine what this chick-frog would look like though ...
hey!!! mod this up, person has a point
Why do they do this to us? All biology, genetics and ethics experts around here just won't be able to type fast enough!
Stick to goddamn computers, at least some people around here know something about that.
sic transit gloria mundi
here's a link saying why that's crap. Basically, the vaccine makers never used chimps in their research (there's no chimp DNA in the results). There is no SIV in the results.
The most telling line is this one though: Hooper argues that that theory lacks scientific proof and that no one has as yet produced scientific evidence to contradict his theory
In other words, "no one can disprove this, so it must be true!", or, in other words "It's total crap!". No legitimate scientist would ever say that, Its the same kind of crap spouted by people who don't believe in evolution or global warming.
autopr0n is like, down and stuff.
Japan today voted to change the official name of the island to "The Island of Dr. Moreau"
-
Remind me to never join Japan's police force.
/^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
In genetics we use somatic cell hybridization for genetic analysis and chromosome mapping. It is the process of fusing human mouse cells and culturing them in a lab.
Transgenic animals have already been created in many countries. Pigs with human genes to prevent rejection of heart valves come to mind.
In my opinion, the article was poorly translated and the initial post was misleading. People are having images of werewolves and such. At this point in time it would be impossible to successfully create a hybrid of this type. In 10 or 20 years this might actually be a problem. Until then, it's science fiction.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Call me cynical, but the use of genetic engineering is inevitable. If we're not going to allow it (and by "we" I refer to the world in general, not a specific country), some wacko in a lab is going to meddle with it on his own eventually. And once he gets some sort of result out of it, everyone else is eventually going to say "Oh look. It's safe!" and use the knowledge gained. We humans are a bunch of curious little buggers who so far haven't passed up on an oppertunity to find out what the exciting buttons do. With that in mind, wouldn't it be better to say "Fine. go ahead and make your experiments, but follow these rules we set to ensure it is done responsibly" rather than "Thou shalt not meddle with your evil scientific ways" and having someone do so anyway unmonitored with the consequences already mentioned by others as a possible result? Egads... I'm still having trouble beleiving my eyes every time I see someone assuming we can block basic human nature with religious texts and/or spook stories. Some of us were the kind of kids who looked at the instructions in our chemistry set saying "Under NO circumstance should you mix chemical A and chemical C" and asked "Why not?".
-----------------------
I pushed the red button
All these hybrid troll/moderators we've been seeing lately. Too bad they have already harvested their brains by the time they mature enough to post on slashdot.
You said: "Humans are limited by the natural capabilities of their brain; whatever they choose to do, they are acting as humans - nothing more."
Animals are limited by their current state.
Humans started beyond this from Cro-magnon times onward with the extension of capablitlies through technology - and the limit was the the human body/mind.
We are now reaching the stage where we can begin to lift even that limit - technogy reflexively removing limits on the bodies and minds that create technology.
THAT is "playing god".
THAT is what the superstitious types fear.
I simple cannot accept your blanket denial of the human soul unless you take the time to address these questions.
ever hear that old cliche "life is stranger than fiction"?
and is anyone else getting flashbacks to the "flamethrower" scene in Aliens 4?
personally, i think they should research cross-species bio-enhancements, like having a multi-million dollar surgery to be able to run as fast as a cheetah, or to climb as well as a spider monkey. how cool would that be?
my duckapotomus will be here soon.
sig - .
Being paralysed in fear, unable to progress because of some fucking superstition is stupid. I'm not calling for the wholesale abandonment of ethics but we should never take the next step because it might offend some creature that may or may not even exist.
Besides which, humanity is just an evolutionary step to a silicon based interstellar intelligence. Anything us meat monkeys do up until that point doesn't really matter.
I'm trying to teach myself to set people on fire with my mind... Is it hot in here?
It's too bad, then, that Japan is not composed of a single island.
Fuckwit.
As I understand it, 5 patients have had surgically implanted artifical hearts since they were created. 1 is dead, 1 is on the verge of dying (the first patient, lasted several months), 3 are living. If you ask me -- the hearts failed in the first place because they _were_ human organs, and needed replacement. Why would I want some organ which hasn't genetically mutated into something that can handle the fat/cholesterol we intake today? I'm all for animal grown human organs in the short term, but somebody better keep working on the artifical types as well.
hey who knows... maybe the japanese want to switch the sex organs on their new royal baby
Sig you!
this actually isn't a horribly new idea, scientist (and "normal" people as well) have been talking about xenography for quite a while now, with pigs often being decided upon a suitable "donors" due to the plethora of pigs seemingly everywhere (uh... like porcine pigs, not cops [which also seem to be everywhere]), a similar body size to people, and other physiologic similarities. there are huge potential problems with xenography though, chief amongst these is host verses graft disease (organ rejection) by the recepient, which biotechnology is now struggling to conquer by humanizing animals (so the cells "look" human, although tissue-typing will also be an issue). however an issue with a much less clear-cut answer is the question of introducing potential pathogens into a virgin population. seldom are viruses, or other especially "non-living" pathogens discovered until they start causing substantial damage to one population or another, and while any organisms may harbor countless different microbes very few actually cause noticable morbidity (this population is known as the reservoir), but could very well be lethal to other species for the same reason that our cells are just different. it is for this reason that i could inject as much HIV into a cow as i wanted, but it simply wouldn't become infected (as bovine cells lack CD4 ccr3, ccr5, or cxcr4), but a relatively small dose of BIV (Bovine immuno-def. virus) would not make our cow a happy camper. similarily it is thought that pigs may latently harbor many potentially dangerous pathogens, and organ transplants may be a way of seeding these into a susceptible population, a potential example of this is PERV (porcine endogenous retrovirus); what does this virus do in humans?-who knows? (but it's cool that there's a virus called "PERV") but a retrovirus cannot be removed from living tissue by any feasible means today, and an organ cannot be 100% gauranteed to be retrovirus-free. new viruses, prions, viroids, bacteria, fungi, etc. one cannot rule them out, one can only try to correct anything that may potentially go wrong. but the potential to start some sort of wierd epidemic will remain.
With a few exceptions, secrecy is deeply incompatible with democracy and with science. --Carl Sagan
"Hey baby, I'm hung like a horse." Takes on a whole new depth.
Has anyone ever seen the movie Deep Blue Sea?
=]
actually, im wondering if these new pig/animals will be sentient. i think we could be seeing the evolution of the human form.
Dear Mr Troy,
If there is one thing sure to annoy our muslim brothers, it is a human-pig hybrid.
Yours sincerely,
A. Coward
don't worry, I M2'd the shit out of them
Huh. The first thing I'm reminded of is the animal hybrids in Masamune Shirow's Appleseed books. Like other things he's written, they'll no doubt happen eventually.
Sometimes he's really like a more scholarly Japanese William Gibson.
Human cloning? Far from being the "Attack of the Clones", nothing is more misunderstood than medicinal human cloning. Please, don't confuse the goals of The Human Cloning Foundation, the federation of misanthropes bent on finding a country willing to host their young Frankenstein adventures, with Medicinal Human Cloning.
The idea behind Medicinal Human Cloning (MHC) is to clone human cells at the cellular level, before cell differentiation. Cell differentiation occurs 2 weeks into the life of an embryo, when all the cells in the embryo stop being homogenous and, all at once, establish their own identities. Some become hand cells, some feet cells, some brain cells, some blood cells. This "magic" event is the point at which human life begins. MHC is the process of cloning human cells before this event.
The point of being able to harvest unlimited quantities of undifferentiated human cells is that these cells can become any cell in the body; they are "undecided", yet genetically matched to the recipient. The applications here are as numerous as you can imagine: tissue replacement, skin replacement for burn victims, manufactured organs custom-matched to the recipient. This is the promise we are debating; the lives of millions who could be saved by this procedure, from burn victims to heart attack victims.
This advance promises to revolutionize medicine. Not just technically, but from a societal perspective as well. If we understand anything about MHC, it is that it will be prohibitively expensive to apply to an entire population. An order of magnitude costlier than even heart transplantation, we are dealing with sums of millions of dollars per regenerated organ. And unlike transplantation, this technique will be able to prolong the life of anyone, indefinitely. As a society, we will soon be in the position of deciding the lifespan(s) of each of our citizens. Not because we control death; not euthenasia, but because we control life.
We've already seen this paradigm emerge with the "list" for heart transplants. The pathetic attempt at a "meritocracy" for deciding who receives a new heart has been a total failure, as evidenced by the case of David Crosby. The system is weighted in favor of the rich, against the poor. Will this paradigm dominate the field of Medicinal Human Cloning? Will only the rich live forever? Will money become the force of life? Not if we can help it. We will need to act decisively as events are set in motion.
We must establish a true meritocracy for the Immortality Revolution ushered in by advances in Medicinal Human Cloning. Like the Slashdot Moderation system, we could create a system of random "Moderators", if you will, who are picked secretly and randomly and given the ability to tag their fellow citizens as deserving or undeserving of the scarce asset of Organ Regeneration, financed by the state. You could rate your neighbor (-1 Stupid) for abusing his spouse, or your coworker (+1 Insightful) for fixing your printer connection. Those with the highest scores would receive the greatest medical benefit: Immortality.
Imagine a world where we never lost an Einstein, never killed a Bohr. Where great leaders like George Bush could advise us forever; where people like Noam Chomsky were but a temporary nuisance. This is the promise of cloning: not reproducing the husks of people but giving the gift of life to the greatest among us.
We must act swiftly when the time comes.
If guns kill people, then CmdrTaco's keyboard misspells words.
DMT1 is thought to be an autoimmunedisease in which case you'd have to recieve a pancreas with non-immunogenic beta-islet cells, considering they don't even know why they're immunogenic (ie which protien, but their best guess is it's a pre-insulin product in the pathway to insulin production, which of course is bad) i, unfortunately, wouldn't expect a foolproof pancreas in your lifetime... but if we could "cure" DMT1 in our grand-children's generation then i would consider it a battle won.
it's unfortunate that religion must so often stand in the way of actually helping people in the name of ethics, seems a bit of an oxymoron to me...
With a few exceptions, secrecy is deeply incompatible with democracy and with science. --Carl Sagan
Okay, so Japan's gonna make all kinds of human / animal creatures? So what? It's all just a part of the revival of God, as described by Scott Adams in his book God's Debris. It's destined to happen eventually, why not now?
And by the way, cat women? Good plan
I guess those people who say "when pigs fly" are in trouble
Sorry, but I won't bite... you fucking anti-american playa hater.
Geez. It's been bilingual as long as I can remember. Here's the link to the english artcle: Here
-- your Web browser is Ronald Reagan
but here it is
http://www.yomiuri.co.jp/newse/20011130wo72.htm
-- your Web browser is Ronald Reagan
Great, maybe we can have a real Clarus the Dogcow!!!!
That post was every bit as close minded as you people think fundamentalist, bible-believing christians are. I mean seriously, what kind of logic are you using here? You're comparing humans to computer programs? That's silly.
PIG MAN!
If this is true, then there is no hope for natural evolution ever again. Just remember everything that is beautiful in this world as you watch it be replaced with technology.
Well, I'm a robotics researcher, and I'd say some of the technology IS beautiful.... but humans buggered up evolution already - just by being human.
Humans don't evolve anymore. Evolution is based on survival of the fittest - who passes their genes on. When we were just walking apes, this was based on strength, musculature, straightness of limbs, etc - basically, what we now find attractive. But that doesn't correlate with our success as humans anymore. Hell, the ugly don't get weeded out, they just live in trailer parks. And if Jerry Springer is anything to go by, they breed more than anyone else.
And animals have pretty screwed up evolution these days anyway - most of them have their survival/prosperity determined what humans want. Animals like the Bulldog have gradually developed into species designed to look a certain way, not to be healthy, because of human interference in their evolution.
-- This post is about truth, beauty, freedom, and above all things, Karma
Where does this unnatural -> degraded implication come from? It's certainly not the case in my experience--if anything, the lesbian couples I know are much more loving and thoughtful in the upbringing of their children than many of the heterosexual couples I know. (I suspect this is due to several things: First, it's currently much harder to legally become a parent if you are in a gay couple, so only the truly dedicated gay couples become parents... contrast that to the situation amongst heterosexual couples, where being thoughtless and unmotivated makes it more likely you will become a parent. Also, gay couples tend to be more open-minded about allowing their child to be him/herself and not forcing any predetermined societal roles on him/her... for obvious reasons)
In any case, as far as I can tell a lot of people arguing this fact have never taken an honest look at gay families compared to traditional ones. Gay couples certainly aren't perfect, but life in the traditional family can be pretty damn disfunctional as well, even if it is more "natural".
BTW, pain is how you grow stronger, ask any athlete, ask any mature person.
I did, and they all agreed that exercise and hard work is the way to grow stronger. Pain (chronic or above moderate levels) is an indicator that something is wrong, not that you are growing stronger.
When asked in an interview why most of the evidence for creationism
Why did God hide all those fake dinosaur bones anyway? What a joker, that guy... ;^)
I don't care if it's 90,000 hectares. That lake was not my doing.
Perhaps we shouldn't be toying with God's creations. Perhaps we should just leave nature alone to its simple, one-assed schematics....
Butt-Chomp! Butt-Chewy-Chomp!
...to create my four-assed baboon.
grumble.
This reminds me of the Island of Dr. Moreau, I personaly think we are swimming in dangerous waters. We need to avoid this. Beyond being possibly unethical, it is risky. We don't know what we'll create, we are doing things which weren't meant to happen.
Sorry, but Bart's teacher is not named Ms. Krabapple, it is clearly Mrs. Krabappel. For more information please refer to Mrs. Krabappel's bio information.
pain is 'how you grow stronger', is it? Gosh, then I guess one should feel good about breaking bones, hitting one's head rapidly and continually against the wall, and slashing one's flesh with any useful sharp object? After all, it's all just helping you get stronger.
Pain is your body's way of telling you to stop. That's the reality of it.
And I won't even bother getting into the rest of your post, which was, whilst interesting, also perhaps a little slanted in bias.
For myself, those who hold the opinions that you describe above are the animals; they've never managed to see any further than their childishly simple worlds, bound by the biology and their father's great-grandfather's opinions. Avoid the promotion of such comforting but futile concepts as 'the established way of life', 'holy', 'guidance of the Lord' and so on. Realise that the reality is a great deal simpler. If two lesbians want a child, I assure you that they too think of life as a holy thing. Maybe a suicidal individual would rather put his faith in God to understand his reasons, forgive him, and allow him a place in Heaven, than to continue a difficult life in this imperfect world?
Oh, and there is no evidence for creationism other than that invented by the credulous many. Hard luck.
format c: /autotest works too.
Hail Eris!
if we look at history, we see that ethics are always changing, therefore, in science there should not be question of ethics since answer to that quetion is not constant.
to spare religions any dilemmas of doctrine.
So the priests and theologians of certain religions (which believe humans have souls but animals don't) will suddenly have to figure out what their doctrine is regarding human-nonhuman crosses. So what? Why should that be of any concern to the rest of us? If a non-human animal were somehow proven to have a soul and a belief in a god, that wouldn't threaten *my* religion a bit.
I don't know. This idea that men are the wimps of the animal world is a bit overdone, I think. Pre-human North America was chock full of huge critters that would make the Serengeti look like a suburban park. Then people got here and wiped 'em all out in a geologic wink of an eye. Let's face it -- even armed with weapons made from sticks and flint chips man is the most dangerous animal on Earth.
Of course it's the giant brain, opposble thumb and social cooperation that makes man really formidable, but it's hard to imagine a chimera that takes full advantage of human and, say lion capabilities. Can you have the lion's formidable claws and still keep dexterity? Or its powerful killing jaws and a mouth capable of articulating language?
Even some characteristics that at first seem like liabilities aren't. Our lack fur, scales, and general light build for example. On one hand, it leaves us relatively defenseless. On the other hand, it makes us offensively more formidable. A well trained runner can chase most game animals until they collapse of heat prostration.
Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
My ex girlfriend is a cross beteen a human and a total cow... and she didn't have a heart,
:)
now not only will she get one, but she'll get shipped to japan since it's the only place it'll be legal. Everybody wins
--- Metamoderating abusive downgraders since my 300th post.
Pic at bottom. Not quite the same thing, but wonder if that's the sort of thing they're trying to accomplish.
(I love that "uber rooly" phrase- I stole it from some Young People)
People have to consider that you really don't want beings that are exactly half human/animal, because what we want are girls with wings *and nothing else* or cat-girls anime style. If you don't get to control the exact mix then your angelic winged girl could have a beak and the cat-girl could have cat-breath.
graspee
Ok, most of the negative stuff you here about cloning is just plain garbage and full of rhetoric from people who don't really understand, I generally am in favor of cloning.....However mixed cloning in such a way that cross species gestation occurs....well that just plain scares the hell out of me
Something I've always wondered is if humans and some other primate species - chimps, gorillas, orangs - could cross breed with each other. (Go ahead, insert crude joke here - I'm serious). Horses and donkeys can mate to produce mules and there are other examples. How do we know unless we try? Who knows if somebody already hasn't tried this? And if it/he is a cross breed with a gorilla, would it be eligible for the NFL draft?
and what would you call it?
I'm sure they meant well. So did the makers of Thalidomide.
So, would eating a human liver grown in another animal count as cannibalism?
Is there some actual reason you're in favor of this or does it just appeal to your anti-religious bigotry?
I've been saying for several years that 100 years from now people will look back on our time and laugh at how much we feared and tried to stop cloning and genetic engineering. Yes, this needs to be done carefully, and yes, we're playing with a whole new kind of power when we undertake this type of research. But it's inevitable and the only question is does the US want to be a leader or a follower (and, therefore, one of the countries who pays huge royalties as a penalty for not being first)?
And it might be possible to "create" creatures which also have souls. But I wonder what they will feel, if they get to know they were "created", "produced" in some labors. I wonder if they will be able to lead a satisfied happy life.
Pinocchio never bitched when he learned that his "father" had created him.
Will I retire or break 10K?
It was said "In fact, nuclear power is economical. It is also the most environmentally clean power source in places where space limitations prevent things like hydroelectric and wind power."
This boy, who wrote this, just came out of a brainwash center . . . hey dude, may I draw your attention to the fact nuclear power-plants PRODUCE NUCLEAR WASTE - damn, who can, with a little intelligence still speak of 'clean power'?
Some of this waste will still radiate when our Sun has stopped to shine . . .
Japan has just taken one great leap forward ethically and morally. Plus, Japan stands to reap huge profits as the boby boomers need some meds which will be comming only from Japan. I tend to invest heavily in biotech and I will be seriously looking at Japan's biotech industry.
The Christian religion has been and still is the principal enemy of moral progress in the world. -- Bertrand Russell
The benefit of this type of hybrid research is that you grow an organ in an animal, which you can then kill to 'harvest' the organ. The question then becomes "Is this creature human or animal?"
IMHO, a sort of "soul," or part of humans which sets us apart from animals would be our sentience i don't think imparting human cell parts would also impart this "soul" into any animal incapible of pondering its own existence. we've been whipping human genes into mice for probably longer than you realize and thus far no one (that wasn't a crackpot) has put forth the idea that engineered mice have human "souls."
... , respectively what lymphocytes use to "see" other cells and determine self vs non-self) are still pigs. it's this sort of biggoted ignorance and anthropocentric thinking which leads to religion and "morality" standing in the way of actual social contributions of science. biotech is a step forward, and if you don't think so then you might as well reject all technology which religious zealots decried when first implimented in the name of morality or "playing god..." birth control giving us control of life or death?-how about antibiotics: let nature run it's cource, god'll clear up that pseudomonas pneumonia no problemo if he's "meant" to live... like the above absurd statement most religiously based statements about "playing god," or whathaveyouwhatnot have little if any socially redeeming qualities, rather they are bound by tradition and outdated dogma, as a humanist i see these arguements as groundless in the face of what these technologies may potentially bring to our species, and as an atheist i find the "moral delema" pathetically humorous.
there's nothing wrong with the idea of combining human genes with other life forms, nor throwing desirable genes from other sources into ourselves. it's a perfectly natural thing, it's not like each species is in 100% isolation of one another, bacteria have swapped genes with other bacterial species for epochs, many viruses "grab" genes from their hosts and then "put" them into new hosts (which is why many retroviruses cause cancer), tomatos with fish genes in them to survive the frost are still tomatos (although they taste like fish and henceforth are no longer on the market), staph with an R plasmid for gent acquired from strep is still staph, and pigs with HLA instead of SLA (Human Lymphocyte Antigen & Swine
With a few exceptions, secrecy is deeply incompatible with democracy and with science. --Carl Sagan
Maybe this will allow "directed evolution" of humans, just like Linux evolves (microcreation, but macroevolution). As long as the mods are Open Source, so that the species doesn't fork, that is. Unfortunately, the laws in most countries will push the research into the proverbial "back alley"....
[100% ISO 646 Compliant]
SVM, ERGO MONSTRO.
only if you call having the truth a bias
bound by the biology and their father's great-grandfather's opinions
I never knew my great-grandfather. My grandfather is an atheist. My father is dead. I think for myself.
If two lesbians want a child, I assure you that they too think of life as a holy thing
I disagree, naturally women have hormones that drive them to have babies. The same thing is almost constant in men. We call it a sex drive. Hormones have absolutely nothing to do with paradigm.
Maybe a suicidal individual would rather put his faith in God to understand his reasons, forgive him, and allow him a place in Heaven, than to continue a difficult life in this imperfect world?
Let me tell you about someone who was being killed because of his beliefs and teachings. He had every ability to avoid his death sentence and every ability to stop the process of his execution. But he did not. He allowed his oppressors to kill him in a manner that was disgraceful and excruciating. His name is Jesus. If he would have prevented his death, there would be no escape from the sin that is in everyone. To directly respond to your comment, God understands pain and suffering better than we ever will, not only has he been there but he designed us and knows exactly what makes us feel good or bad. If suicide was allowed to escape a difficult life in an imperfect world, then there would be no living Christians (at least not for long). The gift of eternal life that God gives comes not by understanding or compassion but by belief and conviction. He has compassion on everyone, even you. But that does not guarantee anyone a place in heaven, rather the belief the Jesus died to free us from our sins and rose to prepare a place for those of us who believe.
You can find evidence for creationism at www.answersingenesis.org Remember while we are still sinners, God loved us so much that he sent his own son to die for us. I'm praying for you, AC.
---There is a concept that is not much mentioned (certainly not in the (typically liberal) media), it's called sanctity of life. The idea is that life is a holy thing or that life has value. This comes into play in each of these situations.---
It is MOST dishonest for you to frame the discussion this way. Asserting that your opponents have no morals, or place no value on life, is a cheap tactic of cheap rhetoric. And these "liberal media" tropes are getting very tiresome...
---- I won't debate what is and isn't a human, that's stupid---
In a certain sense, that IS stupid, because simply being an object that is genetically "human" shouldn't have any bearing on our moral judgements.
---This unnatural reproduction degrades life to the point that it can be thrown around. Ever wonder why we have kids are killing kids...---
Are you asserting that this is a cause effect relationship? Because where is your evidence? Yuo provide nothing more than unfounded angry implication. And I certainly don't see how helping women who otherwise couldn't have children is "degrading." I've certainly never met any lesbian mother who thought that having a child is "degrading."
---Suicide (assisted or otherwise) is one thing, total rejection of any dependence on God.---
Hunh? First of all, not everyone believes in God, so if you want this claim to be taken seriously, you'll have to a) prove a god exists and b) prove that killing yourself involves rejecting god. Because funny thing: I've never heard of a suicide note that reads "I am doing this to demonstrate that I totally reject any dependance on God."
---In conclusion, because life is not held as holy by secular humanists and secular humanists are the most vocal to serve themselves, all we here is this secular point of view, so that's all we know.---
And you finish up your tirade with a flatout lie. Almost every secular humanists I know loves life and values it very highly: not just their own lives, but everyone's lives. Even, in some cases, the lives of animals too. You aren't going to win any arguements by simply slandering your opponents in an effort to sound more sensible and moral yourself.
I haven't seen any article mentioning this law in any Japanese newspaper today, print or web--the Yomiuri site linked from the /. post is the front page, not the actual article. Can someone post the actual link?
Just ten words...
"Get your furry hands off me, you damn dirty ape!"
Very similarly, the flaw in the argument is that it is not possible to have a new thought or to invent anything. which is of course silly.
unless you subscribed to the idea that all thoughts come from some god, in which case everyone was a robot. This is the same flaw as in the argument that everything has been thought of before. pure bunk.
Now some people Steal their Ideas, but that is something else indeed.
What I am concerned about is the quality of life for human animals hybrids.
I am not enamored with the idea of a race of morons created for our pleasure and to do our bidding, despite what certain very big companies and politicians might aspire to. How would you like to live that life? Would you wish it on anyone, well, besides Bill Gates?
"It is a greater offense to steal men's labor, than their clothes"
...you'll want all the technology you can get.
All it takes is nukes and nerves.
The Japanese have produced:
* A maggot with the head of a human being
* A human being with a giant maggot head
This is progress.
We hold life to be sacred, but we also know the foundation of life consists in a stream of codes not so different from the successive frames of a Super8 video. Why then cannot we cut one code short here, and start another there? Is life so fragile that it can withstand no tampering? Does the sacred brook no improvement?
and why do you insist that the human genetic code is "sacred" or "taboo"? It is a chemical process and nothing more. For that matter we are chemical processes and nothing more. If you deny yourself a useful tool simply because it reminds you uncomfortably of your mortality, you have uselessly and pointlessly crippled yourself.
Instead of a summary, you can read the article in
English because Daily Yomiuri runs an English version of its website, with all articles translated.
http://www.yomiuri.co.jp/index-e.htm
The article is in the "science" section.
Yoroshiku
See here.
The page before loading Slashdot was this:
Then I was thinking of the coold day when bioengineers would finally create actual amazing, jaw-dropping, beautiful angels, mermaids, and unicorns of death!
This is a little more than off topic, but, if you clone yourself, and have sex with your clone, would you be masterbating?
-Medgur
So we would basically have vats/farms of super dumbed down humans tweaked to be resilient, have certain bloodtypes, have well formed organs etc. etc., receiving perfect combinations of nutrients and be genetically engineered to be totally uncomprehending.. not aware of what is happening.
Sounds pretty messed up.
Then again, we eat meat.
Hell I love meat.
does this mean i can go around saying
"your mother was a hamster" and it would not be an insult
Rambo is a pussy!
i am somewhat frustrated by talk about this issue. i'll at least try to be fair of where i'm coming from.
the issue of human cloning, genetic modification, human-animal gene manipulation is not particularily abhorrent to me. It is true that almost all of our food has been modified. And for all purposes, this has been positive. but there is a point here. the God of the Bible has given us authority over the things of the earth. however, we are uniquely created, and have differences in us from everything else on this planet. It says we are created in the 'image' or 'likeness' of God. A fundamental fact about God is that His will is the highest will. For anyone wishing to follow him from this basis, then seeking to obey this will is more important than any apparent 'benefit' from not. In the measure of all things, it does not make sense to disobey the ultimate will, because anything else will simply be less.
Creating animals with human organs may have a very real and life impacting effect on many millions of people, but it seems that God is more concerned with eternal life than the limited life we have on earth. Perspective wise; its just not worth it.
I'm just sayin'... I hope I get to be Eyes Only.
Albuquerque PC
I'll agree that evolution seems about as safe a bet as newtonian mechanics.
I'll even consent that there *may* be a small trend of the planet getting warmer since the 'little ice age' 300 years ago.
But, I won't agree that that trend is long term (See the 'medieval warming' period just before the little ice age; apparently it was somewhat warmer then than it is now.)
But, I won't agree that humanity has affected any such warming trend, if it exists, more than an unmeasurable epsilon.
At least without proof from non-cranks. (I note that most climate models have huge fudge factors, and don't take into account such things as clouds. I do not consider them anything more than mental masturbation.) Note, I am asking proof for anthropogenic caused global warming of more than a trivial amount.
I think I remember of once hearing about a study that found HIV antibodies in samples taken from people who died in the very early part of this century.
Furthermore, there is such a thing as chance and coincidence and unexpected correlations. For example, the influenza epidemic of 1918 might have been very little, had there not been the transport architecture we have now in place. It also was probably a chance mutation that just happened to get a whole lot nastier all of the sudden.
Similarily, smallpox presumabely started off as a case of the more mild cow-pox that mutated into the scourge that killed tens (hundreds?) of millions (billions?) of people. This also happens to predate modern medicine by a long shot.
Look it up yourself, if you don't believe me.
Besides, if I wanted to contribute to entropy through my language, this like write would I. Yoda I am not.
And why must you disparage Eris? Someone had to put all that chaos there!
no mofo, you got dem white keys, press dem and dey play dischord, press dem black ones and dey play dat chord.
Would this make Rob Schnieder a visionary? I can see it now. Doctor:"Mr Johnson your dog-human heart transplant went wonderfully, now could you please stop humping my leg, and Mrs Johnson don't be frigntened by your husbands new fear of the vacuum cleaner."
Genetic engineering is still very much an infant. The truth is that we're in the dark about most aspects of reproduction and development. Setting up loose guidelines for research is a necessary step, but rules of any real precision will end up by necessity restricting many promising avenues of research, while leaving open massive loopholes allowing unethical conduct.
... but we don't know how to fix it, can't predict what kind of phenotype will result from its genotypes, and, in any case, we keep discovering new genotypes that cause it.
For example, our genetic material contains vast regions of so-called "junk DNA" (introns) that don't appear to play any part in mRNA synthesis. Traditionally, introns have been thought of as line noise in the great communications protocol of life. But recent evidence suggests that introns have some kind of function -- we just don't know what it is, though everyone has their pet theories. Without knowing what introns are and what they do, large-scale genetic engineering is going to produce a lot of non-starters and instabilities.
Another example is the phenomenon of "imprinting," in which phenotype is dependent upon the gender of the parent from whom a particular allele is received. Imprinting, known about in one sense or another since the '20s, has only been recently intensively studied, and the practical effects of imprinting on genetic engineering are still unknown -- except that gender-specific methylation suddenly increases potential complexity a *whole* lot. (As one example, creating a child from two parents of the same gender ain't happening for a long time to come.)
The genetic code also contains a lot of internal redundancies (checksums in the communications protocol, to extend an already pretty homely metaphor), and once you get past the astonishingly complex genome, you end up in the proteome, which could, as a second-order effect, exist in a space orders of magnitude more complex than the genome that creates it.
Right now, we know a lot about specific genetic syndromes, many caused by a single homozygous allele. But our knowledge is nowhere near advanced enough to map geneotypic->phenotypic instances for 99% of the traits in existence. Trying to do more than that is simply beyond our current capabilities, and the daunting complexity of the issue places everything but simple corrective therapies and spooky biomechanical hybrids like the earmouse a long way in the future.
The upshot? You can change an allele or a dozen, but you may not be able to accurately predict the effects. Advances in genetics will continue to be specific and targeted discoveries that at best help small numbers of individuals. "Islands of Dr. Moreau" are comfortably far enough in the future that it may be our childrens' children who have to deal with the ethical issues.
To get an idea of just how little we know about genetics, read some of the synoptic literature concerning phenylketonuria, probably the most intensively-studied genetic condition out there. We can diagnose it, environmentally control it, even perform gross genetic therapy to cure it (by replacing the liver outright)
Still, I'd like to someday hear a dogcow go "Moof!"
Crossbreeding Spiders to humans, the ultimate DDR Machine.
Non impediti ratione cogitationus.
Good troll by the way. But really, shouldn't you be getting to bed? Mom says tomorrow is a school day.
Trolling on these subjects is not that hard.
Pick a tougher subject to troll on please.
Genetically Engineered...
Bansai Anime Pleasure Drones.
I bet there's some species of animal where the female copulates and then leaves immediately. (without killing the mate, if you please)
Once again, I'm looking to the porn industry to lead the way into this new technological realm.
My opinions are my own, and do not necessarily represent those of my employer.
They have taken full organs from genetically engineered animals, and placed them into animals of a different speciesBR>
...And the whole project was a ctastrophic failure. The idea was to engineer pigs with the DNA of another animal, in the hope that this new "common bond" would mean that the animal on the recieving end of the transplantation, in that case, a babboon, would not reject the heart. Hundereds of babboons did not survive the surgery, and of the few that did (through the help of massive amounts of anti-rejection drugs which also produced massive cancers etc.) they died shortly after, in agony with massive complications. The company behind the project, Imutran, collapsed. To avoid a scandal (as they initially hailed the project as a success) they moved to America, and there has been no word since of how they have progressed, mainly because they operate entirely behindd closed doors now. Full diaries of the failed experiments were leaked, and they won't allow such an occurence a second time.
Xenotransplantation may never work, because animals are far too different from one another. Merely modifying DNA is not going to break down the species barriers that prevent this from succeeding. It would also create fresh problems, such as making another species vulnerable to the diseases of another.
Anyway folks, before you start hailing this as a success for medicine, learn the facts. At present, we can't prevent human organ rejection, let alone animal. The companies who conduct these experiments are the ones who market the anti-rejection drugs, and hence have a financial interest, certainly not a benevolent one, as has been evidenced by prior conduct. So, no, xenotransplantation has not been conducted, and never will. With Japan's approval, today marks a very sad day for the future of medicinal science.
"We kill to cure, with cures that kill" - Skinny Puppy
What about God? What about your atom bomb?
If you want to heap every rape and murder, every innocent upon a persons religious faith, then I can at least heap on the atom bomb on your "technological truth" you are selling me.
How has that nuke bomb research (probably the one thing the US has put more test money into than anything else) done but make the world a more dangerous place? I'm not talking about reactors or radiology... I'm talking bigger bombs. That is a great example of mature thinking. Just because we can, doesn't mean we should. Your attempt to tell me that it is a fear of the different. Typical scientist. It certainly wasn't Oppenheimers fault. He didn't do anything that anyone else would do. Riiight. Bohr thought the original nuke test was going to kill all life on earth, but they looked at him and pushed the button anyway. Pure monkey genius.
You haven't run into a high school with guns blazing yet, have you? Why? BECAUSE IT IS NOT SANE. Its the same reasoning that keeps you alive. That reasoning should tell you that zebra people are not cool. That some things should be left to nature. Insanity happens on a planetary and scientific level.
"Your God" indeed. Where is yours? Where is any of your aspirations of humanity? My God cares. You, my friend, are hung up on something earthbound, and not looking at God's big infinite picture... and the fact that you are a monkey with a little brain, and will never command the universe. Ever. Not a million years of humanity. Never.
I want my children to be happy humans... you want them to be some kind of modified freaks that think they can beat death. Well, all things die according to their design. Even Galaxies and stars. Twisting humanity's design won't change that. Better is a relative term. I have no problem stopping disease. However, immortality is a hilarious concept... which is what you and other Godless ones are striving for, just like all of us, but it won't save you. Matter of fact it frustrates you.
Your kind of thinking doesn't take into consideration morals. You know what? That's fine. You make your own choices. We all do. Just don't think that I am going to sit by and watch while your "purely scientific" quest for knowledge releases another one of those fucking brilliant atom bomb ideas again.
Even Albert Einstein was a deeply religious person. But according to your criteria, that would make him a fool. Yes. Fool indeed. A brilliant fool.
That was the man that blueprinted the idea of an atom bomb. Spent his whole life trying to put the genie back in the bottle. Think about his perspective. Then think about all things. Science is a discipline, not a God.
We wouldn't see catgirls, we'd see the sort of deformed, unrecognizable things I'm sure a few of the trolls are going to link to.
If they look like Jessica Alba, I am totally down with GE. (I guess you'd have to be a Dark Angel fan to understand that reference...)
There is no America. There is no democracy. There is only IBM and AT&T and DuPont, Dow, General Electric, and Exxon
This reminds me lively of the movie Alien: Resurrection aka Alien 4... where they genetically joined Ripley and the alien.
Way to go you White Superhuman. I'd be ashamed of spelling my native language as badly as you do. Or even English, which is my second language...
Well, to those of you hoping for cat girls or whatever: don't get your hopes high.
What they would be aiming for is a pig (that looks like a pig, walks like a pig, and talks like a pig) that has a kidney with genetic makeup compatible to a humans (or a particular person). I'm sure you've all seen pictures of mice with human ears on their backs. Basically, they just want the organs; not a monster.
What they might get, in the process, is a mutant that most likely would not be capable of life (most severe mutants simply can not survive), much less procreate. So, if they do get a monster, it'll most likely die before birth, or while it's a baby monster, that has no way of making more little baby monsters.
That doesn't sound too bad does it?
Personally, I would be more inclined to question the ethics of the direction medicine in general is moving. It seems like our goal is to become infinitely upgradable...to defy death. But organisms are meant to die. Humans are meant to die. We, you and I, are meant to die. I think people should try and improve their qualities of their lives, rather than concentrate on living any longer than we're meant to.
But well, that has nothing to do with anything, I guess.
You know, I can see why the japanese geneticits are doing this... it's simply a way to exploit a loophole in the international cloning treaty -if you want to clone a human to harvest the organs for transplants, all you have to do is alter it's genetic code in some superficial way, in this case by splicing in a bit of animal dna, and then you're no longer cloning or subsequently killing a human. top marks go to the japs for initiative if not ingenuity... personally I think doing this shows a digraceful lack of respect for life -both human and non-human. Why not just wait untill the technology is available to clone individual organs or body parts without making a living being with a body and a thinking mind attached? Sure some people would die waiting for transplants but in this case its really the lesser of two evils...
I've figured it out when I get older. There's only one truth and that is that anyone who says they know the absolute truth is either ignorant or lying or both.
If nuclear power was clearly economically *un*-viable, why would France produce >70% of their energy that way?
Maybe there was corruption and/or gross inefficiency in state-owned nuke plants in UK? That is, after all, the hallmark of any state-owned business with a monopoly.
Only thing I know is that the atmosphere is crappy enough as it is and the less coal we burn the better for everyone. 1st world can build nuke plants that are much much less likely to kill you than pollution from fossile fuel plants which *does* kill people. Let the developing nations have their shot at producing electricity with cheap initial costs of coal..
Chernobyl is still operational, too. The reactor design was not really faulty, the safety procedures/equipment were.
Biggest joke around these parts is that choking power plant investments, politicians are in fact promoting use of russian nuclear power. Those guys actually plan to build a few right across the border so they can sell some electricity to us. Whoo-pee. Much better than making our own, no?
Who wants their own pet Cthulu? I know it'd be nice to unleash on all who dare oppose me.
http://movies.go.com/movies/A/animalthe_2001
if that's what the japanese are planning, err...no thanks!
I'm sorry to hear about your sickness. I PRAY that medical science advances quickly enough to help you.
I want to see you praying in his situation!
Keep up the good prayer buddy, it's gonna work, yes it's gonna work.
Is there a Turing test for spirtuality? If you can fool the average human being into thinking a program was an intelligent being, could you fool one into thinking a program (or a highly trained animal) was a being with a soul? And what of those humans who deny they have a soul?
Religious beliefs aside, does this not bring horrible memories of WW2 when both japanese and germans worked on race eugenics (germans doing weird experiments including vivisection with non-arian twins and the japanese testing biological weapons over the chinese people)?
Is the world going to allow this?
You Write: My ethics ascribe nothing special to the state of being human
Some people eat cows, pigs, chickens, and other animals. I'm one of those people. How many human genes in a pig before it becomes cannibalism?
Is this a question of taste?
--- -- - -
Give me LIBERTY, or give me a check.
Watching anime sometimes makes you wonder about the japanese people.
Vandread seems normal , but when you consider the audience and the background story it really raises some questions about human values. A planet's entire population gets mixed into a juice to be spareparts for earth's humans.
I actually enjoyed when the fan-subber got tired of one of the characters and inserted fake lines like "shoot for god's sake" when he walked in front of a friendly gunsight.
To make nuclear weapons, you need nuclear plants. Most countries adopt nuclear power enthusiastically for this reason, surely? The G8 developed their programmes during the 60s and 70s (the cold war). Nowadays, that threat has subsided. So instead we see Pakistan and India, Iraq and Iran keenly pursuing the same strategy.
First, let me give the obligatory "Waiii! Nekomimi!" shout. Waii, Nekomimi! Now maybe I can get a non-evil woman (Or at least evil in a good way.) with sexy ears.
:P
Now for the rest. "This is bad, they're playing god." Your god, whatever one you believe in, is dead. Save us your speeches - we know, you've blinded us all. You people are the type that would have us all living in mud huts and toiling away on the fields, because the Church needs to buy its priests a new cadillac. You are the types that would have humanity be damned for all time, because of your fear and ignorance. You cannot face life, you must cling to your stories as if they were truth, but you will not win. Your time has passed, and your ignorance and arrogance will be your death.
Now that I've bashed the morons, I can continue to the good points.
1. Freakin' yay. Genetic matches for people who are sick/injured. Finally, maybe those with diabetes will stop having to stick themselves each day.
2. Not as life threatening/quality of life threatening problems can be remedied. Such as poor eyesight. Of course, we'll have a few nuts who want the eyes of an eagle, and we'll have the religious zealots screaming and wetting themselves over that, but if we can ignore them for an eternity and discuss this rationally, I'm sure we can come up with some ground rules for cloning uses in people who aren't really having their lives threatened or majorly inconvenienced.
I know I'd settle for normal human 20/20 vision.
3. Genetic diversity. This is a good thing last time I checked.
how close is Japan to Brando's Private Island of Dr. Moreau? Keep that pesky Kilmer kid, and that obnoxious Falwell guy out of the way, and this could be a good thing.
Eloi are stupid, throw morlocks at them!
I'm sure you could give a human a mouse gene or two without making any important difference. You might arrange for the gene never to be expressed, for instance. Thus you could have a human/mouse hybrid that's indistinguishable from a human. Maybe they accidentally essentially legalized human reproductive cloning in Japan, or maybe there are some details there I missed.
Tee hee.
The subject says it all.
Among all species
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
Cool! Now they can make us a real-life Max.
Aagh!
"Free rein", not "free reign". The phrase comes from equestrian rather than political usage.
Here's the blurb on Michael Marshal Smith's SF novel 'Spares': "Imagine a future--next year, perhaps?--in which the wealthy clone themselves at birth to provide spare parts for their bodies as they become needed..."
:)
So in our world it's gonna be slightly different. Instead of planting a tree in the backyard when your child is born, and see them grow together, you'll buy him a dog that'll have the right insides to match the child's and then when anything happens, the pet can double as a spares repository
But I suppose that's too gruesome. Here's the more plausible scenario: instead of growing the spares in a pet, we'll grow them in cattle, put them all in a dark place, lock it up and throw away the key until we'll need to slaughter them. Now, that's civilized!
Sorry, had to be said. WHo knew that what started as a movie would turn into a prophecy of the future...
If you're interested in directed evolution and improving humans, you may be interested in the Extropy Institute. They have healthy attitudes toward this sort of thing. I'm looking forward to the future....
To eat sushi -- that is the law!!
"The advanced societies of the future will be driven by competing systems of psychopathology." -JG Ballard
i wanna be tick.
How far are we allowed to manipulate genetics before we no longer allow a being human rights? For example, in the United States, how different does a being have to be from "human" before we don't allow them the opportunity to to become a citizen or to vote, before we stop allowing them in our public schools, before we don't allow them the opportunity to pursue life, liberty, and happiness?
Keep in mind that our laws today protect low-functioning humans (people with medical and mental problems that prohibit them from leading a "normal" life - some in near vegetative states) - how far will we be willing to go to protect these new beings?
Personally, I think our first impulse will be to treat these beings as test creatures, with no rights of their own. Our tendency will be to use them as a slave race, denying them their humanity. Would we ever find a Stephen Hawking within one of these created species if he existed, or would we have already destroyed him because he seemed to be incapable of living?
There is a VERY important question here. While religious, it is not ONLY religious - what IS a human?
People have been going on about how various religious leaders will oppose this prospect. I thought it might be helpful to show some things the Judeo/Christian ones might quote (dug out from the 'Unmotivated proscriptions of mixing' section of Loren Petrich's "Biblical Satanic Verses"; all quotes are NIV):
Leviticus 19:19:
"`Keep my decrees.
"`Do not mate different kinds of animals.
"`Do not plant your field with two kinds of seed.
"`Do not wear clothing woven of two kinds of material.
Deuteronomy 22:9-11:
9: Do not plant two kinds of seed in your vineyard; if you do, not only the crops you plant but also the fruit of the vineyard will be defiled [or, "be forfeited to the sanctuary"].
10: Do not plow with an ox and a donkey yoked together.
11: Do not wear clothes of wool and linen woven together.
These are rather puzzling. Other parts of today's Pentateuch show some signs of having been carefully engineered with an eye to a something like a working knowledge of memetics. It's conceivable that the architect(s) of the Law figured that rigid adherence to and faithful propagation of the Law demanded a people who thought in terms of rigid either-or distinctions; a meaningful response to borderline cases might bring people to start assigning priority to the structure they saw in the world rather than to the structure ascribed to the world by the Law. Perhaps the architects were trying to ingrain a notion that anything that appeared to violate conventional (and thus religious) conceptual divisions was somehow unnatural or not of this world, the better to draw attention away from the conceptual division that got violated. But I'm not sure that that would quite explain these verses; they're pretty weird.
Certainly though a lot of people here have been saying that creatures challenging the boundary between the traditional conceptions of "human" and "animal" will cause issues for any moral system that takes these conceptions to be God-given, no-thought-required absolutes. The thing I find weird is that I've never seen these verses cited in any such context. The believer may display hysteria about how it's evil and playing God and somehow threatening (?!) some principle cherished on faith (like "the dignity of man") and so on to do something that invalidates the heretofore self-evident assumptions underlying the religion's conceptual structure, but they never claim these particular verses in defense of that hysteria. I don't get it.
Now I can replace my guard dog with a guard bunny:
.... With Big Sharp pointy teeth!
As a forenote, I am not the AC to whom you are responding with this post.
I am probably what you'd call a Deist though I still drink heavily from the trough of doubt from time to time. I have many Christian friends having grown up in the Southern U.S. and I most certainly respect a person's right to their own beliefs. Most of my family is Protestant Christian. Your belief in the sanctity of life is well-presented, though it is arguable that Jesus knowingly going to his death is committing suicide via inaction. It is also arguable that many self-professed Christians have little regard for this same sanctity when it comes to day-to-day life.
However, I must take exception to your reference to answersingenesis.org as being "evidence for creation". It most assuredly is not. At best it attempts to debunk the theory of evolution (which it does a terrible job of) without presenting a competing "Theory of Creation". Every argument I've ever seen from that site has been thoroughly debunked, most of them on talkorigins.org. It may behoove you to do a little more of that "thinking for yourself" before endorsing such an intellectually bankrupt site.
Is this the original article?
l
http://www.yomiuri.co.jp/04/20011128ic44.htm
Because if it is, I'd like to see how well my father-in-law translates it, versus the CafeGlobe.com Japanese==English conversion site.
http://www.cafeglobe.com/cafe/wotg/index_en.htm
Sure, it doesn't handle everything, but I'm able to read the article and infer what's missing..
Support FSF: Stop thinking with your wallet, and think with your imagination. (cc/non-commercial)
Maybe we can find a way to apply this to change people who are already living. Then they can be come appropriately enhanced.
contrary to popular opinion sharks do get cancer, and actually almost all living things do, truthfully we know very little about sharks, so it's no small wonder that misplaced ideas about their biology exist. AFAIK all animals will contain cells capible of becoming cancerous, the very nature of the way our bodies are constructed more or less assures this, if we exposed a shark to enough mutagen chances are some of the cells will sustain damage to tumor-suppressors or other vital genes regulating cellular proliferation, and thus will acquire cancer... this is now an "old" story, so i dunno if you'll read this or not, but what the hell?
With a few exceptions, secrecy is deeply incompatible with democracy and with science. --Carl Sagan
Rob Schnider in The Animal. Does that satisfy your requirments?
;o)
Seesh!
Soon Monster Island will be a reality!
**>>BELCH
You might not be aware of the fact but MIT also happens to have a large faculty and many non-faculty research staff. As is pretty well known on Slashdot I was a researcher there about ten years after I got my doctorate.
This kind of direct answer wins many points in a discussion. Thanks.
Your digression on statistics would have more weight if you were familliar with the material. The probability that one HIV strain would wait until 1952 to jump from monkey to human is not high, the probability that the first known case would be discovered in Kinshasa a year after one of the first polio trials occured there is also not high.
But HIV is not one virus, it is two, HIV-1 and HIV-2 are completely different strains. What is the probability of two money viruses changing species within the same narrow geographical area in the same time?
I fail to see how my lack of knowledge in the origin of HIV relates to my extremely simple point that safety in a nuclear reactor has so little to do with genetics that it shouldn't be worth mentioning.
Pot, kettle, black.
Granted. Keep in mind that the pot and the kettle are still both black. I would disagree with you, though, about the high ratio of "blackness" that is implied.
You attempt to dismiss statements on grounds of authority you do not posses.
My original post was an attempt to dismiss an inflammatory post which preyed on people's fears. If you disagree, look at your statement about geneticists: "They don't really know what they are doing, if they did they would have decipherted the human genome and be able to explain how it does what it does". Your broad statements are only backed up by assumptions and general vagueness. I don't really see you defending your original post here, since even you don't seem to know the "probability of two [monkey] viruses changing species", etc. I'm obviously not an expert in the field, so I don't really see it as a rhetorical question.
Slashdot is not the best venue for this kind of discussion, anyways, as there's no real back-and-forth. Things usually remain unresolved here. If we were sitting down and talking, there would be no issue, as I could immediately ask you for supporting data to something that seems hurriedly said. I believe that you should have some supporting evidence when posting here IN YOUR ORIGINAL POST, because people don't expect you to respond to their responses.
Regardless of what you may think, I don't want this to turn to name calling. There's just this vibe here that feels like you tried to pick apart posts that disagree with you, regardless of their valid points. I have better things to do with my time than bandy words over that kind of matter.
They who would give up an essential liberty for temporary security, deserve neither liberty or security
That way Pigs will fly and my Mom will buy me my GameCube.
"It takes many nails to build a crib, but one screw to fill it."
Everytime i hear that story, i still come no closer to understanding why you find it so plausible. God decided to set up a situation in which God would be killed, all in order to appease God?
Next time I owe someone $20, i'll be sure to tell them that, since they got a $20 paycheck from their employer, I've already had someone pay off my debt for me.
it's OK to grow human bits in animals (or animal bits in humans) but cloning human cells are not OK?
what kind of reasoning could accept the former and not the latter? Surely cloning human cells would bring more immediate medical benefits than trying to get the same to grow in a different animal?
Wow! talk aabout anthropomorphic pigs! When are they gonna start talking like that cow in "the restaraunt at the end of the universe"???
All employees must wash hands before using the bathroom. - The Mgmt.
cool! go japan! i've always wanted to see myself as a cat!
Read what i said about people blinded by mans description of the creator of all there is.
If something creates all this is, and didnt want us to do something, it simply wouldnt be possible.
Can you avoid death? no you cant. can you read the future? no you cant. Can you travel deep into space? no you can.
To think that the creator of all there is, doesnt know exactly every single possibility there is, and exactly what we will do, I mean come on,
if something is god, it KNOWS everything the human race will ever do PERIOD.
Whatever we do is part of a plan.
If you use Linux, please help development of Autopac
First, who says the creator has to "APPROVE" of anything
Anything thats POSSIBLE is approved of.
Free will? If you created the universe, if the entire universe is just a thought in your mind, then technically, theres no such thing as free will, does a robot have free will? hell no.
Proof that we dont have free will? Destroy the universe and then you can prove we have free will. Literally BREAK the universe!
Oh right, you cant break the universe! Hey neither can anything else in the universe because its all perfect!! Hey I wonder why that is? I wonder why some super intelligent aliens experimenting milliosn if not billions of years before us didnt completely break the entire universe?
Because its IMPOSSIBLE.
Thats an ability we do not have and will never have.
We can destroy, we can create, but we cannot stop the cycle, we cannot END all creation and destruction. It will go on forever, as will the universe, no matter how smart we get, we will NEVER be able to stop the universe and destroy it.
The day we have that ability is the day we have free will.
Having the ability to choose right from wrong, is not free will, a computer can choose left and right, 1 or 0, even 1 AND 0, but a computer can never truely change the rules, even if it learns to reprogram itself, it can never change the fact that theres 1 and 0, the day computers can all of the sudden have free will is the day computers somehow take over the world like in terminator 2.
Free will means the ability to choose, but something is giving us the choices we are choosing from and until we have the ability to choose something which isnt given to us, like to stop the universe itself, then, we are no diffrent than a computer program which chooses between 1 and 0.
How do you know our bodies arent just, machinery, how do you know that conciousness is not god? Conciousness is not proven to be part of the physical body, if its proven to be beyond, then COnciousness is not following the rules of the universe, meaning conciousness may have free will but this doesnt change the fact that your body doesnt.
Conciousness could be the force of god itself, thats right making us all part of god.
Open up your mind, and accept the fact that anything is possible. You do not KNOW what god wants and does not want, do not assume you do, You do not even know WHAT god is!!! I dont know but i'm at least admitting it. I have opinions on what i think god may be, But i'm not sure.
So dont be so sure yourself. I say if something is possible, then something else in the universe has already done it. If whatever created the universe didnt want it to be possible until we reach a certain state, then like gravity, forces would prevent us from doing it until we are enlightened enough to maturely handle it. Just a few hundred years ago people thought men werent allowed to fly. Now they are in space, the forces prevented you from flying, whatever created the universe obviously created these forces with a purpose. To prevent idiots from doing what they arent ready to handle.
Give a monkey a gun and he wont know how to properly handle it, let the monkey create the gun and things may be diffrent.
If you use Linux, please help development of Autopac
as all involved will have gone through the same arguments as have been covered here. :)
still,
Cabbits would be cool
Japanese are well prepared for this. They have many Cyborg shows (those Power Rangers like shows) that discussed the topics of human/animal hybrid. If you are a 30+ years old Japanese, grown up with shows like Masked Riders, surprise like a human/insect hybrid isn't too ridiculous. In fact, I had a feeling that they are obsessed with such an idea ...
20 years later, when they look back. When they see that the rest of the world has gone to the point that the USA has to depends on the "immoral" states to receive the latest medical assistance, they will be regret for what they are doing today. It's not a moral or immoral thing. These countries don't necessarily have to play the same game. The fact is, USA is not doing it, and if we do it, we have a much greater chance to be the next super-power. Do you think China, Japan and numerous anti-USA countries will let this chance pass easily. They don't even have to fight a real war with the United States! When their biotech becomes so advanced, the power of USA will certainly fade.
With all this talk of Oprah, Jerry Fallwell, the religious right and wrong, has anyone stopped to think about whether it's useful? I don't give a shit about the "playing god" arguments. Or if it is moral. The one thing that becomes important is the fact that our planet is far overpopulated - and population is growing exponentially. People need to start dying. As we find more and more ways to keep our old farts alive, less and less of them die, and more and more people go hungry because the food supplies are being used up by those who should, by all natural accounts, be dead. Worse yet, medicine keeps them alive, but they are useless. Living corpses. A waste of precious resources.
Apparently for all those lost souls who wish to have a tail, wings or other appandages. There's a whole fandom of these creatures and humans who like to be like that. It's called the furry fandom, perhaps it's nice for those who want to know more about it to take a look. Among the literally thousands of sites around this subject, some nice ones are: http://www.furry.com http://www.furnation.com http://vcl.ctrl-c.liu.se/vcl/ http://www.furry.com/whatisff.htm
Robin Cook, well known medical fiction author, postulated something similar to what you suggest already, in his book "Chromosome 6", which discussed transgenic organ transplants from primate clones created using a modified version of the primate DNA, specifically replacement of the histamine complex known to be on the "bottom" half of chromosome 6.
In his novel, the chimpanzees used had higher intelligence because of the genes.
It totally ignored the Hayflick cellular division limit, and it ignore the senesnce of the resulting organs, as well, given that they were cloned from animals with a greatly reduced (comparatively to a human) lifespan.
Interestingly, I tried to point out this same issue of premature senesence to the news media following the announcement of the cloning of "Dolly", and was met with incredible disinterest, despite the fact that it was obvious to me that the telomers would be shortened as a result of the adult donor genes, and therefore incapable of reproducing as many times.
Do you really want a replacement heart which will only last, say, 10 years, before it will need to be replaced again? Talk about a captive market...