Slashdot Mirror
First Human Clone Eight Weeks Along
Vegeta99 writes "An Italian researcher is claiming ground-breaking progress, and has successfully cloned a human, and the mother is now 8 weeks pregnant, according to this article. Now how long until I can buy my own clone?" It's worth noting that the Roman medical associations bioethicists denied Dr. Antinori permission to proceed with these experiments last month. So doing the math, Rome was a little late... If the pregnancy continues without miscarriage, the tyke may share a birthday with Marie Curie
The fonts.
The X11 fonts are so terribly, terribly, awful that I just cannot stand to use any web browser or word processor under Linux. It is back to Win XP for me every time that I try it.
You coders are getting close, but you are still so far - the fonts are TERRIBLE. The fonts are so bad, I just cant stand it.
The X11 fonts are so bad for web browing or word processing that I have to turn away when I see it. In fact, I never see it, because the fonts are so bad I won't even run it in the first place.
What is so hard about making an italics font? You would think it was fucking rocket science, cause you dirty GNU hippies just can't seem to figure it out. Yeah, go ahead and mod me -1 Troll now, but I speak the truth and you know it.
The truth that I speak and that you know is that Linux will never approach more than .5% desktop market share until it has fonts that are somewhat readable.
Even reading Slashdot is painful with the default Linux fonts under Konqueror. What do they call it? Micro 11 or something? More like micro shit. Here is a ticket for the clue bus, please catch a ride.
You will NEVER approach the desktop market until you create some readable fonts.
That is all.
This is not going to end well...
"I hope they legalize drugs so you hurry up and fucking die." Charles Bronson (the band, not the man)
Nice.
I'm a signature virus. Please copy me to your signature so I can replicate.
DataSquid.net, a little about me.
They're simply time-shifted identical twins!
-e
Most folk'll never lose a toe, and then again some folk'll...
But has there ever in the history of mankind been a case where scientific/technological research has been dropped because the goal was deemed unethical?
Clone: Hello! I'm #15
Cute Chick: Well hello hansome! What star sign are you?
Clone: Pyrex
Cute Chick: Ohhh baby!
And things go downhill from there.
Alas gallinaceas de urbe bovis volo
Soon I will clone myself, and take over the world!
No matter how you look at it, this is definitly amusing :)
http://www.xpurple.com
You wanna-be-ethical sack of shit.
First thing we should be looking at is the credibility.... ok moving on...
Are the steps taken in creating the cloned fetus repeatable?
I've always wondered about finger prints.. perhaps this will shed some light.
just thoughts.
"It's the Law of the Universe, and I'm the sheriff." Slash-cott 2/10-2/17
...to patent your DNA if its worth anything to someone.
Any sufficiently advanced influence is indistinguishable from control.
I just might get a first post:) Probably not, since I'm going to put some content here, but it's a nice thought.
I must say I'm a little torn on the issue. It's great if the technology can grow livers and hearts and kidneys and bone marrow and what have you, but I'm not sure there's any good reason to clone entire people. It'll be interesting to see how this all plays out, in any event.
High-speed Road Trip (18.000KPH)
"Cloning the human is very different from cloning sheep"
One has four hoves the other two feet
I'd hate to let the future of overpopulation go unsupported. God forgive us if more people went the other way, deciding to not have kids to help reserve the planets resources because they aren't so self-absorbed as to need create their own offspring. [Adoption, OTOH, is a nearly selfless act.] Cloning humans is just one more way humans show how we put short term self-gratification ahead of anything else. You and I both know that when the humans race dies off (whether pollution, depleted resources, war, etc.) it will most likely stem from that same belligerence.
What is this? Apocalypse hour on Slashdot? First the story on the implantable microchips, now clones...
BRx.
Life after capitalism? The participatory economics project
All Mammal clones possible so far are FEMALE!
You will never see this fact cited ever in a non-journal article.
I have looked carefully in every news release since the original Dolly wave of press hysteria.
Cloning will never be popular or interesting until telomere ends can be repaired in the zygote to prevent bio-clock failures (aging too fast).
Cloning will also never be popular unless the person paying for the service (a rich white or asian male) can replicate himself, or his son.
You read it here first... In 2002 only female mammals are capable of being cloned.
(maybe they try to reduce rna conflicts from differring mitochondrial dna)
These clones only clone the genes in the chromosomes alone and not the mitochondrial entities (entombed bacteria from billions of years ago in evolution).
Imagine the number of anti trust cases which would be running if there were 10 bill gates each with his own Microsoft[1-10].
err.. wait.. that wouldn't be a monopoly..
Sometimes the world is a strange place!
If it is a boy, would Adam suit?
I think that some people, when they hear the word "clone" used, they immediately think that it is literally a clone -- the same appearance, the same likes, dislikes, etc. However, that isn't the case -- it is just a clone on the genetic level. The child will grow up and have different experiences, will probably look different, like different things, etc.
Think twins. Sorta.
I hate to say this, but considering the fate of cloned animals, with genes misfiring or not turning on at all, not only will the clone be born on Marie Curie's birthday, assuming it even gets to that point, it will also share her fate; being short-lived.
It is ever-so-slightly worrying that the doctor in question, Severino Antinori, admitted in a press conference that Dolly, the cloned sheep, was suffering from premature aging. His defence, that the experiments were not conducted well, and that sheep cloning is vastly different to human cloning, does not inspire confidence.
This child (presuming it survives) is nothing more than a guinea pig for Dr. Antinori's ego. Will this child be able to live a normal life? No. Look at Dolly -- how many tests do you think she goes through on a daily basis?
Whilst I am reluctant to encourage animal testing, would it not be better for those in the same field as Dr. Antinori to perfect cloning of non-humans before moving onto humans? It seems the doctor is in a hurry to stake his name in history. If he is not careful, he'll get his wish, but it will appear closer to Josef Mengele than Marie Curie.
I suppose wanting to drive thing to the edge of what's possible is something that is built into human beings, but, in the case of cloning I think this just is irresponsible. Aside from all the ethical stuff (Like in The Boys from Brazil by Ira Levin) chances are that the child won't live long because on DNA level the child is as old as the mother, but there are no definitive conclusions on that. All in all I think it unacceptable to perform such extreme experiments un children (or animals) who don't have a say in their treatment.
If only human beings knew their limits when messing around with technology some of the worst atrocities wouldn't have happened, but some revolutionary things that have enabled to prolong life and welfare on higher age wouldn't be discovered either. Fortunately I am no philosopher, or I would be driven mad when trying to decide whether technology is a blessing or a curse.
Quote from Blade Runner:
Replicants are like any other machine, they are either a benefit or a hazard, if they are a benefit it is not my problem.
But i dont care, so CLONE THIS!
I don't think it's so controversial. It's just like having an identical twin, except at different ages. Twins aren't the same people, just as clones aren't.
;)
The genetic engineering scares me a bit, though. I'm not religious, but I know there can be serious risks. How about an airborne gene therapy retro-virus? Ever seen those two episodes of Outer Limits where they time travel into the future and see the results of genetic horrors? Yikes. But, putting it in perspective, it's just another tool, and tools are neither good nor evil. It can be used for as great good as evil. Just need to genetically engineer all the evil out of people and we'll be all set!
Anyway, the cloning is really cool. If anything, clones'll be used in psychological studies to resolve the personality from dna vs. experience debate. Except that scientists have no concept of analog. =)
Lets fast forward a little, as the reactionary arguements for and against cloning have pretty much been heard, and will continue in much the same vein.
Lets consider... what if any leagal framework might address the issue not of a clone itself... but a clone or a particular person who a) objects to having been clones, and b) objects to the clones continued existence.
Kind of knocks media copyright issues to the sideline no?
You think they would have learned from those damned sheep. The clone's chromosomes are the same as the person they were taken from. Which means they will be born with already damaged and shortened chromosomes. This will mean further complications down the road for the child at a much earlier age, not to mention all the psyche help the kid is gonna need. I know im gonna get hit for this one.... First Post!!!
That would be the desired outcome, but so far clones still have major genetic problems such as wiht Dolly the sheep.
I feel sorry for that kid already. You'd think they'd learn how to do it properly with the animals before trying to make a human.
cp -R / /clone
It's about time someone stepped up to the plate and attempted this.
Of course, now we have to put up with all the naysayers who haven't a clue - the ones who think cloning in this nature produces identical creatures.. Ignoring the fact that environment and a hell of a lot of other factors have as much, if not more, to do with personality/etc. than genes.
Well, they're better than the religious nuts who insist we shouldn't 'play god'. (Usually, they're from a certain church that has a body count higher than Hitler and Stalin's put together, a church that utterly decimated other religions, robbed from the poor to give to the rich, etc..)
The first type can be educated, or at the least, disagree with a manner of rational thought. The latter, well, they're out to preserve their own powerbase. At any rate, we need more scientists who aren't afraid of losing funding or popularity to keep carrying out research and experiments in 'taboo' areas. Fear should never stand in the way of progress.
Being Italian I know very well doc. Antinori and I can assure you that here his reputation is equal to 0, he's a fool who would do anything to get some articles on magazine and on TV. In the past he already committed many operations of this kind all absoloutely against any ethic.
Ask any identical twin if they had any choice in the matter. =) -Altaic
it makes me sick when governments try and get in the way to oppose research like this. it should however, be done with caution. we wouldn't want to see genetically engineered porn stars with 20" penises now would we (women, please refrain from commenting) :P
First of all: I do not believe this is actually true. Antinori really isn't better at cloning then the Roslin Institute, and they usually have a few hundred miscarriages for every successful pregnancy. Presuming Antinori did not have a few hundred women standing by to be impregnated, he really is very lucky to have a 100% success rate.
But anyway: Let's just assume this is an actual clone. Evidence is now coming through showing that dolly isn't quite as healty as we first expected.
Apparently she ages a lot faster, and has a number of diseases. Now imagine that, when the baby is born ('prototype clone'), (s)he starts getting all types of horrible diseases, limbs missing and what have you. That is when Joe Schmoe will understand you just can't copy people like you can copy a CD. Too bad someone has to suffer for it.
If an experiment works, something has gone wrong.
With Dolly the sheep, the 'failure rate' was running at over 150:1 success.
The failure rate was mostly failures to implant, spontaneous abortions as well as some very deformed births; mostly some that died in a few days, and some that were euthanised.
If this translates into humans in the same way, for every successful clone we can expect several deformed, live, births.But there are questions as to whether Dolly is really 'successful'; the sheep is suffering from arthritis at an unusually young age for example. If you accept this as a cloning problem, then the failure rate runs at 100%.
Ignoring the ethics of successful cloning; given this deformation rate, given we do not allow euthenasia of human infants; is this really ethical right now?
-WolfWithoutAClause
"Gravity is only a theory, not a fact!"First Post as in: My first post, not the First post
Prison should beckon for all involved.
TWW
"Encyclopedia" is to "Wikipedia" what "Library" is to "Some people at a bus stop"
For people who find this dehumanizing, remember the case of Louise Joy Brown--the first test tube baby. At first people found in vitro fertilization dehumanizing, then they saw a cute, well adjusted young girl brought into the world. It's hard to call a technology dehumanizing that creates cute, healthy babies.
The public will accept reproductive cloning as long as the babies produced by it are healthy and are born into normal, caring families. I will be interested to see whether cloned babies grow up healthy. If they do, then parents desire to have children will overcome any squeamishness they may have about raising an identical twin, and cloning will become common place.
More chicks for me, then. Zupa!
too much Dark Angel?
I can just see his labs now.
scary stuff!!!
Mark.
Nobody really knows whether or not cloned humans will have the same issues that cloned sheep have---apparently problems only happen to certain mammals.
But hey, we can always spread a little fear of the unknown, right?
Ass.
Things go wrong . . .
:)".
We'll have a re-run of the elephant man, and human cloning might be banned worldwide.
This might seriously hinder research stem cell research which might have many future benifits.
Regretably, If this turns out correct, you may have your real life... "clone billgates, take over microsoft, and selfdestruct". Now... many of you might say "What a plan!!
"clone president, take over country, and selfdestruct". Not such a wonderfull idea.
-Tim
since i was just planning on cloning SMG anyways, now that i found that i cant order the Buffybot at http://www.aibo.com/, yet...harhar!!
cu,
Lispy
What would the Pope say?
La vita no e bella
Cloning humans bad
Nobody really knows whether or not cloned humans will have the same issues that cloned sheep have
Well, that whould be even more reason not to mess with these kind of things!
[sarcasm]
I've got a medicine for you, it will make you, yes even you, smarter then anybody else. It killed sheep when testing it, but that shouldn't cause any fear for it. I'm sure you'll love to be the first one to try!
[/sarcasm]
I sure hope all the clones have chip implants like these , !
Real men don't need signitures!!!
I consider Dr. Antinori to be a rouge scientist in the tradition of Dr. Frankenstein. He is so anxious to get his name in the history books that he is willing to violate legal and ethical codes. What truly worries me is if the clone is brought to term. The reason so many cloning attempts end in miscarage is the horrific developmental defects. During the cloning of Dolly and other farm animals, some animals were brought to term with non-functioning lungs, unconnected organs, veins and organs on the surface of the body etc. With animals it is ethical to euthanise the animal, but with a human that would be legally considered murder. Any human being with such defect (and they are certainly possible) would live a a truly horrifying (but mercifully short) existence. Even if a clone was born that seemed normal, it would not be out of the woods. Many animal clones, as they have matured have developed truly bizzare diseases; spontaneous organ failures, degenerative nervous diseases and the like. In addition there are questions about long term genetic defects, predisposition to cancer and shortened life spans.
I hope, for the sake of the fetus he has created, that this cloning attempt fails.
This man belongs in jail.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
This wil surely offer some new possibilities to people who are asked to go fuck themselves.
"Honey, I feel a certain distance between us..." "Really? A 31ms ping ain't that bad..."
Looks likes its confirmed: slashdotters will finally be able to reproduce. Kinda. Of course, I didn't say anything about getting laid....
The sooner I can get my Dark Angel (Max) the better!
throw new CloneNotSupportedException();
dominionrd.blogspot.com - Restaurants on
Is the sex of a human baby determined partially by temperature, like in chickens? Could I technically have a female clone? If brothers and sisters often produce mutations in their offspring (bloody tasmanians), what is to happen if two people with the same dna reproduce?
Send lawyers, guns, and money!
because by 2020 or so they will have invented rechargers that will make you live for 500 years.
;)
oh and they will sell for $50/tablet weekly.
The real question is, what effect will this have on quantum computing ? =P
No, that should be reason to "mess with these things". You make it sound like this is some hack mixing DNA in pails in his garage.
Progress in medicine depends on experimentation. We'd still have shamans if people weren't willing to take risks and explore the unknown.
-Kevin
He has 500 women available for his experience! I am pretty sure he had his share of failure, miscarriage, abortion...
Nowhere is it said he has 100% rate, on the contrary. The first weeks are the one where he is most likely to have trouble, so after 8 weeks, chances are good that the baby is healthy and will get to term...
Black holes occur when God divides by zero.
Now this is not exactly a superhuman race of warriors (like the US presumably wants) but the facts remain. Humans have already been and are being cloned in laborotories.
I agree that technology by itself is not bad. However, the process that is followed to develop the technology can be. IMHO Experimenting on humans to refine a new technology is not a good thing.
Jesus Cloned! Now that would make a truely interesting news story!
The problem with slashdot is that most of its users were bullied and stuffed into lockers as kids!
Just so I don't end up with a flood of replies from the grammer nitpickers.
*sigh*
Its 7 am and I haven't had my coffee, yet...
Any sufficiently advanced influence is indistinguishable from control.
The point is, this experiment is being done knowing that the child produced could suffer physically in a similiar manner to the other clone experiments. Think about this from a personal standpoint. Picture being an 8 year old child who has a 80 year old body. Yes, there is a genetic condition which causes rapid aging of the cells, but in your case, it was not an acident of nature. You are just a test. They knew there were things they did not understand that were still going wrong when they made you. Rather than doing more tests to determine what were the causes of the failures, they just decided to roll the dice, make a mutant, become famous, and hope that you had the grace to die quickly, quietly, and with only a little pain.
I think the scientist should be executed the same day as the experiment dies because of "unforseen" defects. Yes, the human birth experience is a roll of the dice, but in this case, the scientist rolling the dice is doing it with the knowledge that there is next to no chance that things will turn out just fine. It would be another issue if we understood and corrected the problems with the other clones.
I personally have nothing against the idea of cloning. I do have a problem when science willfully ignores the individual upon which it inflicts suffering.
In a place beyond time and space, in a land far better than this, look for me there...
This announcement has got to be worth a good $15M in ticket receipts for Ep.2.
Cool, now I can "back-up" myself :D
----- Whats wrong with this picture? http://www.revoh.org:1234/whatswrong
Suppose I work at some hotel and I steal myself some Britney Spears DNA, maybe even an egg from a used tampon. Now I clone it. And sell the clones (you know people *would* pay). Would anyone object?
I saw another article in the paper last week that claims they have cloned rabbits. Yeah right, like, rabbits are so rare, and so difficult to breed. They may as well have just spent their time playing quake.
Microsoft - Where would you like to go today, Maybe Jail?
Thats not a troll, thats a funny. Moderators are w*nkers
"Like atomic energy, cloning can be used for beneficial purposes - to increase population and to open the window of genetic reprogramming."
Why the $%#@ would we want to increase the population of the world even further?
Yommorrow on slashdot: - First Human Clone Eight Weeks and One Day Along
0xC3
I feel shame to be italian.
Terming the U.S. ban as a violation of human rights, he stated that everyone had the right to transmit their particular characteristics to their progeny, or to use cloning to reduce infertility.
How can cloning be relevant to reducing infertility. I assume that cloning is a last resort to infertile pleople. If you clone an invertile individual you would just get another invertile individual.
it could be just me butit seems to me that this doctor has some very daft reasons for this cloning.
The DNA for Linus, the well known operating system developer is now available as open source. This has taken the open source movement by storm as the possibilities of Linus clones become fully realised.
"Normal operating system developers suffer greatly from obsessive compulsive disorders, which causes many problems with other team members. Now we have access to the DNA for Linus, we are able to determine the causes of these disorders, and develop a fix" said Dr Jeckal, a leading expert in developer cloning.
Microsoft, who have no plan to make Bill Gates DNA available to the public have been strongly opposed to this idea.
"Imagine a world where every operating system was designed by a slightly different Bill Gates, each with its own quirks and eccentricities. It would be total chaos."
Microsoft are currently fighting a court case in which Sun, Oracle, Netscape and RedHat are all demanding access to Bill Gates DNA.
"How can we possibly compete with Microsoft unless we are able to clone our own version of Bill to run on our projects."
Offtopic, Inflammatory, Inappropriate, Illegal, or Offensive comments might be moderated up.
Is the relaxing of moral views really such a good thing? Today we accept cloning. Tomorrow we accept euthanasia of clones who are not healthy. The day after, we accept killing old people who are not healthy. Then we accept killing all people with uncurable diseases. Sure, we have strenuous procedures and laws for all of these, but we're still guilty of clensing the human race. (Rememeber Hitler?)
These are all logical steps. Maybe not within 4 days, 4 years or 4 generations, but they are certainly possible.
The loss of high moral standards is not always a good thing.
Now imagine that, when the baby is born ('prototype clone'), (s)he starts getting all types of horrible diseases, limbs missing and what have you.
"Limbs missing" is not a "horrible disease." Having a child born without legs (but with fully-functional arms) can be a good thing for the parents because it means the little fellow can't run off as easily. Besides, it's cute.
Will I retire or break 10K?
Jonas Salk developed technologies which led to a vaccine for polio. With a vaccine you're injecting a weakened version of a dangerous virus into a person to combat that same virus. That to me seems terribly dangerous, yet its now one of the most basic elements of modern health care.
Both Fleming and Salk are examples of people cautiously exploring dangerous areas. I don't know that Antinori (the person responsible for this cloning attempt) did proceed cautiously. The United States, the Vatican and other governments share the blame for this however. They've banned research in the area and by doing so they've ensured that only the more cavalier will carry out investigations. Any suffering which does result from this is the fault of both Antinori and the governments who try to ban the research.
I'm not a biologist or doctor, but it seems to me the proper first steps would be the cloning of individual human cells then clusters of human cells and possibly functional organs. After problems were solved through these steps then it would be time to investigate a human clone, in the mean time perhapas diabetics could be cured with cloned pancreas tissue or people with heart disease aided with cloned heart tissue. We've jumped to the most lucrative possibilities of cloning but skipped over the most therapeutic.
Chris Kuivenhoven is a thief, beware
I read an article some time ago that Dolly the sheep had developed arthritis and was suffering from obesity, both of these conditions being extremely rare for her age.
This person that has been created may suffer from intense health problems. I consider this action to be extremely unwise, as it will play into the hands of extremists seeking a ban.
I personally would like to see cloning technology developed, but used on humans only when it is both safe and effective.
What makes a man, is it the power in his hands?
Is it his quest for glory?
What makes a man, is it the woman in his hands,
Just 'cause she has big titties?
Or is it the way, he fights every day?
No, it's probably the titties!
Now you're a MAN! (MAN!)
Now you're a MAN! (MAN!)
Now you're a MAN! (MAN!)
MAN MAN MAN MAN M-A-N MAN
YOU'RE A MAAAAAAWWWWWWWNNNNNNNN!
Now you're a MAN!
"That's Tron. He fights for the Users."
Human cloning will destroy the human genome by introducing hideous genetic mutation into the gene pool at an ever increasing rate. We may be able to struggle our way out but "homo-sapiens" will become extinct. So lets come up with a scientific name before the clone geeks do...here are my ideas..
Homer Sapiens
HS-V2R1
Homo-XP
Homo OhNo
Er, if this was genuine, would GulfNews.com scoop every other news site?
The Arab press is notorious for spreading rumours and poor journalism. (It usually has to do with "Jews controlling everything and killing everyone", but the general lack of journalistic skill due to the lack of free presses can also lead to crap like this.)
It's possible, but I'd want to see confirmation before believing any of it.
What's the legal problem? The original person is one individual, the clone is another separate individual. No matter how strongly you may object to my continued existence, there's nothing you can do about it within the law! ;-) Obviously you *could* shoot me, but then you'd be liable for murder as per normal.
However, you may be able to claim for assault against the person who took a sample of your cells to produce the clone.
Grab.
Let's just hope that the kid doesn't end up like the 3rd clone in Multiplicity.
"I like Pepsi" *puts pizza in wallet*
Live web cams
What are the chances that an individual with fertility problems won't produce a clone which also has fertility problems. What happens when that infertile clone wants to reproduce? What then? I know this 'should' never happen, but if cloning is allowed, who's to stop it? Then again, who's to say if it is right or wrong until cloning is proved a success or failure?
It's all just practice!
---
I support spreading santorum
This might be fatalistic, but if humans are dumb enough to repeat the same damn mistakes and cause our own destruction, so be it. As inhabitants of this planet, humans have been very self-centered and destructive. The sooner humans die, the sooner the planet can heal itself.
I find the doctors arguments weak. "We're doctors, we're not going to hurt anyone." Sure and no doctor has ever done harm. Like being a doctor some how makes a person more ethical, moral, or trust worthy. A title or degree does not grant an individual superiority. I'll stop bitching now. Since eager beaver doctors and scientists aren't going to listen anyways. Rapid progress is not always good. Learning to cherish life and live in the moment is.
I, for instance, would love to have a clone of my heart available when my own one needs replacement in a couple of decades (not entirely unlikely given the number of heart deseases in my family). Of course I wouldn't want to kill a full grown living and breading clone of me to obtain that heart but that may very well be unnecessary.
There is at least one person in the world who does keep a living heart donor on hand at all times, the Sultan of Dubai I think. Wherever he travels, he has a second private jet, kitted out with an operating theatre, a medical team... and the volunteer living heart donor.
Should the Sultan have a heart attack, the volunteer will be killed, his heart transplanted. This is a sought-after job, with a fixed term of a couple of years. There is a waiting list hundreds long, and even if you don't die in the line of duty, you and your family are richly rewarded.
Unless it's just another urban legend...
it's not about the karma, it's about the whuffie
What if a certain testicle zapper R&D'ed by Microsoft was used on a captured Usama bin Laden to get him to divulge the location of the smallpox bomb he planted somewhere in Chicago before it went off? I'd say the device would have served a good purpose.
Eat at Joe's.
(trolling) Haploid human life is life as well. Let's go out and protest against the murder of all the little ovums and sperms that never get the chance to join and live out their natural lives! / THS
All Mammal clones possible so far are FEMALE!
You will never see this fact cited ever in a non-journal article.
You will never see this "fact" because it really isn't a fact.
See this article from way back in 1999 about the first male mouse clone.
Luckily the experiment took place in Italy instead of USA, so there is little chance for a mega law suit :-)
/ TLTS
Will the clone have "Patent Pending" tattoed on it's butt shortly after birth? Is this just another publicity stunt for Star Wars Episode II? Will it's name have to be printed with a Trademark symbol next to it? Will the clone have 5 asses? If not, what use will it be? If it will have accelerated aging issues, will it be told about it's incept date and longevity? Will it know it's a clone? Will it someday hunt down it's creator and squish his skull?
If George and Co. don't help fund this project, they're gonna miss an important marketing tie-in.
Does anybody know the latest information regarding the telomere problem in clones?
Telomeres are long stretches on the end of the chromosome that are cleaved off through the life of the cell. When a certain number of telomeres are gone, the cell knows to undergo death. Some cancer cells protect these telomeres... and thus are immortal.
However, as clones are created from already aged cells... these clones have shorter telomeres. In theory, these clones should age differently. This may be the reason that Dolly already has arthritis, for example.
Anybody with new news on this theory?
Well, a bunch of the microsoft breakup people wanted baby-bills... now we have a second chance.
"Like atomic energy, cloning can be used for beneficial purposes - to increase population and to open the window of genetic reprogramming."
I'll leave it to you to comment on that.
hmm... for fun I enjoy launching DDoS attacks against 127.87.42.5
This could cause some huge legal problems. Say hypothetically an attractive poor girl decides to sell her genes to a greedy corporation. The corporation then decides to use the DNA to clone her. The clone is raised in a "well adjusted environment," and groomed to be a superstar. The clone now has no rights, since she was purchased, created and programmed (raised) by the company. We now have created exactly what blade runner portrays. How is the creation of slaves any better than all other attempts at slavery throughout the history of humanity?
It's about biodiversity. One day we'll get really good at cloning and then we'll clone everything, people, pets, endangered species... It will probably be fine for a while, until something unexpected happens. When a bacteria, or virus appears that the specific genetic tree we've been using is particularly susceptible. Understanding that some genetic code is more or less vulnerable to different attacks, all of the sudden the genetic diversity that protects us on a species level is gone.
TYRELL: The facts of life. I'll be blunt. To make an alteration in the evolvement of an organic life system, at least by men, makers or not, is fatal. A coding sequence can't be revised once it's established.
BATTY: Why?
TYRELL: Because by the second day of incubation any cells that have undergone reversion mutation give rise to revertant colonies -- like rats leaving a sinking ship. Then the ship sinks.
BATTY: What about E.M.S. recombination?
TYRELL: We've already tried it -- ethyl methane sulfonate as an alkylating agent and a potent mutagen -- it created a virus so lethal the subject was dead before he left the table.
BATTY: Then a repressor protein that blocks the operating cells.
TYRELL: Wouldn't obstruct replication, but it does give rise to an error in replication, so that the newly formed DNA strand carries a mutation and you're got a virus again... but all this is academic -- you are made as well as we could make you.
BATTY: But not to last.
if i'm a grammar nazi, you're an illiteracy nazi.
Seems Linus has been overwhelmed with kernel patches as of late, this could lead to the kernel forking. So..... let's clone him and make a beowolf cluster of Linus's!!!!!!
I need to get out more....
Omkhar
MCSE - Must Consult Someone Experienced
In our lawsuit-happy world, I would think so.
If I was this kid I'd sue the hell out of this doctor for any medical problems I might have, etc.
//m
The world is run by idiots because they're more efficient than hamsters.
:)
Prove it.
"Destroy science and religion. Science would re-emerge exactly the same; but not religion." - Penn Jillette, paraphrased
No, he's right. The did a study and it turns out that human clones eventually develop big floppy feet and a red nose.
That's right. And the same thing with murder. They banned murder so all murders are their fault. See, if they didn't ban it then everyone could do it and you wouldn't have these fringe people doing it. Oh wait, that makes no sense. Just like your post.
//m
I seem to remember an article in Discover about how things age. Basically, they suspect that there is a protien locked in the end of a gene, and as the cell replicates and "ages" blocks of this protien drop off. When the protein is completely gone after many generations (say when a person hits middle age) all sorts of regenerative bits start shutting down... skin cells stop producing colligen(sp), bones and cartilage no longer replenish, neurons start dying at an accelerated rate.. stuff like that. So the newborn clone has already ages 30 or so years genetically speaking, by the time she takes her first breath. A girl could develop breat cancer the instant she hits puberty, some poor dude could get alzhiemer's when he is in his 30's (early onset arthritis too) ...Rough stuff actually.
I would think that unless they figure out this process, this TYPE of cloning should only be done on young sources. So someone could take a sample shortly after birth and use it later in life. Well, you could also get into a kind of moral snafu when you have parents losing a child very young to some sort of accident and then having them cloned so they get another crack at it...
But I am not even getting into the ethical side of this maelstrom.
My friend asked if the clone was of the woman herself. Without knowing either way I realised that carrying your own clone might be really dangerous. The body knows where the mother ends and child begins by the foreignness of the tissue. I'm wondering how long it will take before someone tries this? Unfortunatly my Biology ends at 8th grade, Anyone have any clue how it would turn out?
Quoth the fetus:
- "Me Stan. Pachewie-chomp, pachewie-chewie-chomp."
There you have it, a shocking report from the exciting world of genetical engineering!--
"Outlook not so good." That magic 8-ball knows everything! I'll ask about Exchange Server next.
You can know what subjects the girl will be good with before she does!
You can understand why she doesn't obey you!
You can know which boys she'll find attractive!
All this, and more can be yours! All it costs is $299.95 per attempt.
And, for a limited time, the first 20 attempts are free!
What do you have to lose, except your individuality?
Free unix account: freeshell.org
Lets see, 5 billion people and growing. Spending huge amounts of money on artificially generating people when it can be done easily already via sex and when we don't need a bigger population anyway. Really frigg'n brilliant. If this guy wants to make a name for himself he should work on generating a human being without blind selfishness.
It is by the juice of the coffee bean that thoughts acquire speed, the teeth acquire stains. The stains become a warning
The citation you listed said :
:
"After I left Geron, they evidently agreed that therapeutic cloning was the way to go, and they set up the collaboration with Ian Wilmut, the man who cloned Dolly at the Roslin Institute. Dolly came from a sheep that I think was about six years' of age, from a cell grown in the laboratory from breast tissue. So obviously they named Dolly after Dolly Parton. In 1999, they announced that cloning did not reset the clock of aging in cells (13). In other words, they claimed that Dolly is "a sheep in lamb's clothing." That she is older than she appears to be.
Ian measured the clock of aging, the telomeres, in the blood cells of Dolly. The telomeres are like a burning fuse. They measure how many cell doublings have passed and the life span of these cells. And he said the telomeres of Dolly, or the cellular age of Dolly, was quite old. Her telomeres were shorter than would be expected for normal sheep of the same age. His data were very preliminary, and it has been difficult to pin down, but I guess the best estimate is that Dolly appeared to be older than six years of age, even though she was in reality only one year at the time her cells were analyzed."
But the article does not prove that they have a way to clone a male mammal and simultaneously also reset the telomere time clock (as discussed in legendary April 96 or 97 issue of Scientific American).
In fact the stock swindling con artists that wrote that interview to rob people of investment money claims that their undemostrated research is SECRET!!
Here is an excerpt of a reply to a question
"LEF: So we need to get a clear idea of why your method allowed for a reversal of the cellular aging clock, and why the method used by Westhusin and by Ian Wilmut did not.
West: I don't think we want to elaborate on that at this time."
Ha Ha Haaaaa!!!!! Hucksters and LIARS!
"I don't think we want to elaborate on that at this time !"
No proof, no reproducable results, no expanation, no witnesses.
Thus Dr. Michael West is (was?) possibly a deceitful liar looking for investement money $$$ and dreaming of a huge IPO for him to cash out of his share$.
Cloning will never be popular or interesting until telomere ends can be repaired in the zygote to prevent bio-clock failures (aging too fast).
The problem is that there is good scientific reasoning to show that a cloned mammal will not be a normal, identical copy of the original -- reasoning that thus far has at least preliminary support from the sheep experiment.
It's not just simply fear of the unknown -- it's fear that something will occur that we have reason to suspect will occur.
DNA does not copy with perfect fidelity. There are a number controls that limit transcription errors, the ulitmate limitation being protein complexes called telomeres on the end of chromosones which, in effect, prevent a chromosone from being replicated more than a fixed number of times. One way of assesing biological age is by how close one's chromosones are to this limit. An infant clone from a 30 year old man will, in one sense, be a 30 year and nine month old baby. This is apart from the issue of mutations that will inevitably occured to the 30 year old's DNA.
This guy is monkeying with a very complex system which nobody fully understands at this point. Normally this would not be a problem, but there s a human life that will be greatly affected by these uncertainties. Is he fully prepared to take responsibility for the results of his actions? I doubt it.
Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
Didn't Ridley Scott present this concept to us twenty years ago?
::Colz Grigor
If we've never empathized for Roy Batty and always rooted for Rick Deckard, maybe we ought to turn that around?
(Note: I've read Dick's Do Androids Dream of Electric Sheep. Scott did far better at presenting this particular facet of replicants than did Dick.)
As far as I know, we're doing just fine with the task of increasing the human population of this planet without the help of cloning. (And isn't one of the better-known applications of atomic energy used to decrease the world's population??)
But what I'm concerned about is this: Why don't these infertile people consider the fact that, right or wrong, justly or unjustly, they're not meant to conceive on their own? If they want children that badly, I believe they should consider adopting an unwanted child before launching off on some science adventure to make copies of their (apparently) defective genetic material.
There are thousands of children around the world that could benefit from being placed with a loving family, able to provide for their care and upbringing. Obviously, the families interested in these cloning experiments really want a child--so why risk creating a Frankenstein when there are so many living, deserving children in need of a good home?
Look. The only thing that is going to push mankind forward is science and technology. I think you need to look beyond your own selfishness and think of what these scientific advances can do for us. I just read the other day (here on slashdot) that a "bubble boy" was cured due to gene therapy using stem cells. The same sort of cures may (or may not) come out of cloning. But the most important aspect of this whole situation is *education*. Mankind cannot move forward unless there are technological and scientific advances... such as cloning. ~Turd
As far as cloning, we HAVE taken risks and we HAVE explored the unknown via research on animals and found that cloning produces horrific results.
The SUCCESS rate in animals is typically much less than 10%. There is no reason to believe this doctor can achieve a FAILURE rate of only 4% to 6% in a species that has never been cloned before!
Since there are no human experimental data to draw on (no living human clones), I have to conclude this is nothing more than a self-serving prediction he pulled out of his ass. I fear for this child (and it's mother).
Is a good example I can think of.
That male rat was such a poor yield its worthless to cite as progress.
So far all "celebrated" successes of cloning are always females... though progress in cloning a male mammal is quite interesting though its still a fact that its practically impassible with current methods.
That male was a one in 500 thing and may have been a fraud or mistake (sequencing to prove its not an ovum from a relative rat is too costly)
I hardly trust Wired, though your point is made.
The only 'ethical' problem I have with it is how said cloned human is treated once conception occurs.
As long as the person is treated normally, as any other child would be, I have no problem with it.
The *REAL* danger is when we start viewing clones as sub-human.
Yes, it is an experiment. And when this child is born, and grows up, he must be free to not participate.
lets just hope its not a clone of mouselinni (sp) or some other super villain.
no off to read the article!
... Imagine a beowulf cluster of these!
ScienceSeeker.org
In the Bible, God says "Go forth and multiply." He doesn't specify HOW.
If the baby is fucked up, will the doctor go to jail?
Its all been well published in April 96 or 1997 Scientific American article.
It was a landmark issue.
But the solution to the telomere time-clock is a solution for IMMORTALITY.
If you can fix the telomere count down you can ELIMINATE the normal desire to make a clone of yourself (except for spare parts) because you can live three times longer or more probably.
Plus if you are a male you are in better luck, because all truly successful cloning methods on mammals are females... just as the worlds first human clone will undoubtably be a female.
They should spend more time researching ways to clone a male and fix telomere chains.
There is one coniving lying researcher who is requesting money for his starup that has a secret unpublished method for fixing telomers in clones... and he just wants to create a huge startup IPO and get-rich with his schemes. IT would be fine if iT was the truth.... but its not the truth.... they cannot fix the telomeres in a 2002 clone except in theory.
The issue refers to Telomeres alone, not the many-years-later measurements of Dolly's shortened Temomeres (as posted altready in this thread (change browse level to spot except and link)).
Literally.
The most popular method (Dollys mehod) for integrating alien nuclear material in a host egg cell is to electro-shock it. Other methods use chemicals. The underlying reason for why an electrical or chemical shock works is not yet understood.
At 5 billion and rising WORLDWIDE is this a bad thing? Are you proposing we keep up with underdeveloped nations in some sort of baby race?
They only claimed to succeed one time with a male.
Seems like Hawaiin professors might have made a mistake or realize their method is practically fruitless.
Cloning anything other than organs, ie in vats
not from a cloned body is indolent indulgence.
Evolution will not be served by having various copies of michael jackson and madonna around
for several hundred millenia.
The idea is to come up with something new.
ie mix it up.
this is true fucktard dumbwittery.
God Save us.
Twins Can be Genetic Clones.
Therefore you are foolish, and just as Psychology is a "soft" science, so is your theory that you need clones for study in psychology.
There are plenty of twins (genetic twins) to study.
They used it in the 1952 Minnesotta twins study to prove that genetics was a prime determinant for IQ potential.
That is why some quasi-races are smarter than others on average (whatever ethnic races "are" or could be if there were such a thing such as breeds of Dogs)
no need for clones
I was shocked beyond belief when I read this story and at first thought is was some kind of joke!
I don't have moral objections to most cloning research and perhaps one day when we fully understand how and why genes work the way they do we might think about helping infertile couples but we just DON'T know enough today. Remember, this isn't an experiment on the parents, it is an experiment on a human life about to be created! (who, btw, didn't sign a consent form)
Heck, apparently the doctor is using the same technique that failed on Dolly (sure, he *THINKS* he knows how the fix the problem but I have yet to see a conclusive paper on this in any reputable journal!). Worst of all this is being done to simply to fulfill the vanity of the parents, however culturally influence the vanity might be. When messing with a new human life don't *THINK* you know what your doing, *KNOW* you know what your doing!
It's not that you are illegal, or that you could be deformed, mentally incapacitated, or worse.
What if you are just one of a string of successful clones, all from the same genetic source?
One of the givens of being human, that we are all unique, will not apply to you; instead, the inverse, that you're a copy of a copy of a copy, and that you are somehow connected with a bunch of strangers who share your exact genetic makeup, your genetic twins.
Not to mention that, depending on the country, you may be alive simply as a tissue harvesting candidate for the original genetic donor.
Freaky.
Human rights will have to apply.
Big Daddy, Johnny, Burp, Aunt Zelda, Scott, Slurp, Big Momma
it seems the fix is still a little ways off.
named "BSOD"
MadCow.
I used to have a sig, but I set it free and it never came back.
Actually, telomeres are not the key to organism immortality... only cell-lines. Scientists have developed several immortal cell lines... all from cancer cells.
The human body needs cells to die on a regular basis. Older cells are more likely to have genome damage... and thus work less well and fail to accurately pass on genetic materials to future cells lines.
Don't forget that we have "Alan Cox on a Chip", so there is no need to worry about losing our operating system developers! And now that the FDA Approves Implantable Microchips, how long must we wait before we can all have Alan Cox chip implants?
cpeterso
and how this news was presented. How can you quote such a ridiculous statement in the headline as "Now how long until we can buy our own clones?"
That is total ignorant stupidity.
Of course nothing like this will EVER happen. Why stir the pot, obviously someone has such a flawed view of this subject and is aware of this to the point that he must pull idiotic statements out of his ass to feed the fire of mindless activists. Get real. ok?
Do you REALLY want an army of Bill Gateseses rampaging across the world? Say no to cloning!!! Clone Linus instead! Open source clones for all!
Just because you can mod me down, doesn't mean you're right. Shoes for industry!
It just gives further example...that just because there is legistlation stating that something shouldn't be done here in the US, it doesn't stop it from actually happening somewhere in the world...even in the US. Take for example RIAA/MPAA attack on MP3s/DivX...It's still going to happen whether it's legal or not.
_______________________________
"I'm not Conceited...I'm just a realist..."
A lot of people who are against cloning feel that way due to moral beliefs. They may say it's because of concern for the newly created human being but it's really that they don't like man playing God.
Personally, I don't know where the science will lead us and maybe it's worth investigating. I don't like the idea of creating human beings just for the sake of doing it. We don't have a shortage of people on Earth.
The race isn't always to the swift... but that's the way to bet!
(to the tune of Home on the Range)
Oh, give me a clone
Of my own flesh and bone
With its Y chromosome changed to X
And When it is grown
Then my little clone
Will be of the opposite sex
Clone, clone of my own,
With its Y chromosome changed to X
And when I'm alone
With my little clone
We will both think of nothing but sex.
An oldie but goodie....
~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
"First things first -- but not necessarily in that order"
-- The Doctor, "Doctor
If you'll kindly take note, the author of the offending quote:
"Now how long until I can buy my own clone?"
was Vegeta99, who is not one of the active authors on slash dot. It was posted by chrisd who is listed.
The job of a media source is to quote news submissions as they are received, not steal the scoop and rewrite the tag lines as they see fit.
It's also not the responsibility of any media source to judge the future implications of a news submission.
That's why we have forums to discuss these topics, and while you may believe the concept of purchasing a clone of yourself is ridiculous, some other "ignorant stupid" person with a "flawed view of this subject" might find it not so offensive.
For Pete's sake, who ever thought they'd transplant a monkey's head?
GREAT, that Italian researcher should be shot!
imagine a clone reading beowolf
Actually, the date listed on the gulf news report, is 3/4/2002.
So if the baby was reported 8 weeks along by March, that would put the birth in September?
Ironically, a Virgo sign (Aug. 23-Sept. 22) may be a little more appropriate, being the first cloned human.
The legendary sci-fi kid will then be listed with the likes of Stephen King (September 21st, 1947) if you think the kid is a nightmare,
or Christopher Reeve (September 25th, 1952) if you think he is a positive icon in the scientific and medical field.
Jonas Salk developed technologies which led to a vaccine for polio. With a vaccine you're injecting a weakened version of a dangerous virus into a person to combat that same virus.
(Pedant) The Salk vaccine is a killed-virus vaccine. Sabin developed the first live-virus polio vaccine.(/Pedant)
Big debate back in the 50s and 60s about the relative merits of each. Sabin won - his vaccine was cheaper to make and could be taken orally. Mmm...yummy polio virus...
.siggy
Every parent makes the choice to have a child knowing that the child will suffer then ultimently die. The only difference with clones is that it is more likly that it will happen. But the same basic parenting principles apply. The Mortality rate among humans is still 100 percent. There are no survivors.
You can't judge a book by the way it wears its hair.
A: Hi B!
...
B: Hi A! What you doing tonight?
A: I'm going to drink six pints and drive to Dallas! Wanna come?
B: Don't do that!
A: Why not? It sounds like fun to me!
B: But think about the consequences. First you'll get drunk, or at least intoxicated. Then you might lose control of your car. Even if you don't end up killing yourself or anyone else, the cops will probably pick you up and throw you in jail. With your record, your license will be suspended for sure. Your girlfriend will be mad, and probably throw you out of her apartment. You won't be able to drive yourself to work or anywhere else. If the school district finds out, you'll lose your job as a phys ed teacher. No other school will want to hire you. There's a good chance you'll end up a skid-row bum, begging for money to get drunk on. So you better not drink and drive!
A:
A: Why, that's nothing more than a slippery slope fallacy! Ha!
listen up brothers and sisters come hear my desperate tale
i speak of our friends of nature trapped in the dirt like a jail
vegetables live in oppression, served on our tables each night
this killing of veggies is madness, i say we take up the fight
salads are only for murderers, coleslaw's a facist regime
don't think that they don't have feelings, just cause a radish can't scream
Chorus:
i've heard the screams of the vegetables (scream, scream, scream)
watching their skins being peeled (having their insides revealed)
grated and steamed with no mercy (burning off calories)
how do you think that feels (that it hurts really bad)
Carrot juice constitutes murder (and that's a real crime)
Greenhouses prisons for slaves (let my vegetables go)
it's time to stop all this gardening (it's dirty as hell)
let's call a spade a spade (is a spade is a spade is a spade)
I saw a man eating celery, so i beat him black and blue
if he ever touches a sprout again, i'll bite him clean in two
i'm a political prisonner, trapped in a windowless cage
cause i stopped the slaughter of turnips by killing five men in a rage
i told the judge when he sentenced me "this is my finest hour"
i'd kill those farmers again just to save one more cauliflower
Chorus
how low as people do we dare to stoop,
making young broccolis bleed in the soup
untie your beans, uncage your tomatoes
let potted plants free, don't mash that potato
oh spare the spud! Eat a cow instead!
I've heard the screams of the vegetables (scream, scream, scream)
watching their skins being peeled (fates in the stir-fry are sealed)
grated and steamed with no mercy (you fat gourmet slob)
how do you think that feels (leave them out in the field)
Carrot juice constitutes murder (V8's genocide)
greenhouses prisons for slaves (yes, your composts are graves)
it's time to stop all this gardening (take up macrame)
let's call a spade a spade
(is a spade, is a spade, is a spade, is a spade......)
Power to the peas! Give peas a chance!
all we are saying, is give peas a chance
-- The Arrogant Worms
God save our Queen, and Heaven bless The Maple Leaf Forever!
Right - I'll play the devil's advocate - quite possibly literally in this issue, and say it. "What's the problem with cleansing the human race?" Evolution did that for millions of years to *produce* the damn thing, why let it stop there?
That means that killing old people is not an option - they've already reproduced. In a civilized society such as ours, I don't see killing as the answer to improving our race, but sterilization. There's no point to killing people when they can be sterilized. Better than that, though, is the solution in this slashdot article - removing undesirable eggs from the mix altogether.
What's wrong with wanting a society without Alzheimers? Without diabetes?
The huge problem comes when people add "Without blacks or catholics" into this mix, and start killing them off. The main point is who gets to decide what is undesirable? It can't be by majority - "you can't have 4 wolves and one sheep vote on what to have for dinner".
I also think that the parent should have the final veto. They can have whatever kind of child they want.
There are issues that have to be dealt with, but I hardly view the improvement of the human race as a bad thing, just a sensitive one. After all, if we don't start improving ourselves now, we'll have no chance at all when the robots come.
Last post!
Actually, if you're not a reactionary idiot bent on finding any possible reason to oppose human cloning that won't require you to engage your brain, it makes perfect sense.
Your analogy with murder, however, makes no sense to anyone who doesn't require a power winch to correct their rectal/cranial inversion issues.
Since you seem to have comprehension problems, let me spell it out for you: the only reason it doesn't make sense to you is that you're an complete idiot.
as the article references an Islamic -medically friendly country.... hmmm, makes me amused at the irony of possible location of research being in the "[in]furtil[ity] cresent."
electryc monk(ie)
As is often the case, there is little, if any, discussion about the long-term effects of new technologies. However, if a discussion about the long-term social effects of a technology takes place, then we would be stopping progress based on whether the vast majority find the technology or progress socially acceptable. This would obviously hold back important advances. Take for example darwinism - should a discussion have taken place about the long-term social effects of allowing Darwin to continue his work?
wait till version 3.1, most of the aging problems and DNA problems will be solved and all we will be stuck with is a tendancy to loose track of what they are doing and a strange blue skin colour when they get tired and need to sleep for awhile / reboot :).
seriously though, this is just the first stages of the human cloning process...and sooner or later the problem rate will go down low enough to be standable
Do i support this? not really...i think we have enough humans being produced we do not need more creative ways of making children. people...there are 6 fucking billion of us!
GENERATION 26: The first time you see this, copy it into your sig on any forum and add 1 to the generation.
Star Trek the Next Generation had an episode featuring a society of clones. They use DNA from Riker and Pulaski to create clones of them. Riker feels violated and kills the clones while they're still developing.
It was an abortion rights metaphor originally but now, it's becoming a frightening take on an actual issue.
Since I had no say so about my conception can I sue my parents for conceiving me? What if I had wanted to be a different sex?. Can I sue for that too? I have to wear glasses and I have artifical dentures - another suit??
What next? Do we sue God for creating mankind, which resulted in our birth?
Just how STUPID is this world going to get before we finally wipe ourselves out??
/rant
If you are talking to most Americans, then no, they haven't seen Ariel Sharon for what he is, the latest Adolf Hitler, Pol Pot, Joseph Stalin, Slobodan Milosevic, or Saddam Hussein.
Sharon is guilty of mass genocide. Outside of the USA, where the media and government aren't so heavily Israeli biased, Sharon is known as the butcher of Beirut - because back in 1982 he had 1000s of innocent civilian women and chilren rounded up into a camp and brutally killed. Not only that, but international committees have recognized that Sharon has committed crimes against humantiy... however, for some reason, Israel is above the law... Sharon is never going to appear in a War Crimes Tribunal, even though he should. Not only that, but Israel has continued to neglect to respect a decades old UN ruling that it must allow the Palestinians to return to their homes. What is a people supposed to do when the legal avenues are all blocked?
Need I remind you what "sparked" this latest conflict? You can even found this out on CNN, a very biased news source in this entire conflict. It started when Sharon visited a Muslim holy place. Again, in case you don't get it, this would be the equivalent of Hitler visiting the wailing wall.
And all the while, this Israel v Palestine conflict is shown on TV (in my home, the USA)... Arafat is the bad guy and Sharon is the good guy. Black, white. My side, your side. Alpha, Omega. True, False. Tit, tat. Eye for an eye. Life for a life. War for peace?
He who lives by the sword, dies by the sword.
The next logical step would be to run around having gay anal sex! After that, it would be with animals! And of course, this is all a gateway into hardcore drug abuse of crack-cocaine. Oh, what about the children, the poor children?
Seriously for a second, if anything is going to go wrong with society, with regards to cloning, it will be all of these weirdo anti-cloning people who will not treat clones as real humans with the same rights of sperms.
Great, this is just what we need. I'm a proponent of cloning. I say if you can do with with the same or lower error rate as naturual reproduction, great. But as far as I know, we can't (am I wrong). There are a lot of bugs to be worked out before we should be trying this on humans.
This girl is going to be fucked up, no doubt about it, and it's going to set back the feild of cloning by decades. (maybe that was his plan all a long?)
autopr0n is like, down and stuff.
Religion is only useful for one thing: War. Isn't it obvious that religion is a total load of horse shit, as there's no evidence to back their claims? For instance, the bible said the earth, the sun, and all the lifeforms on earth were created in one week in the year 4,000 BC but this has been proven to be one bag of shit.
Why should science be held back by deeply religious people who believe in something that was made up by some fwit who needed to give his people a reason to go to war. That's ALL religion is; something made up with absolutely no reason behind it so people can go to war over it.
Now why is there so much controversy about human cloning and stem cell research if religious groups can't back their claims?
What if you are illegal
...you could be deformed, mentally incapacitated, or worse
Then the establishment will probably have to change. Being religious was illegal in the USSR at one point, too.
Yup, all of which could happen without to a non-cloned person as well.
What if you are just one of a string of a successful clones, all from the same genetic source?
Well, then I guess he'd be a clone. So?
One of the givens of being human, that we are all unique, will not apply to you...
(I'm going to modify your sentence to be "genetically unique", since otherwise your sentence would be quite biased). At one point, being vulnerable to smallpox was a given of being human. That's changed. This can as well.
Not to mention that, depending on the country, you may be alive simply as a tissue harvesting candidate for the original genetic donor
Yeah, as opposed to a genetic vessel for your parents to carry on their genes?
Cloning may be a bit different, but it's hardly some hideous, awful thing. I don't see why everyone gets so worked up about it.
May we never see th
At this rate at least we still have time to prepare before the Clone War
No sig for you!!
...minime.
[insert witty comment here]
i regret that i did not catch these original posts (on thursday) because i was busily reading 1984 and Brave New World, I came out of my hole today saturday and see this and the id chips, and have decided that I will climb back into my hole now
Now official, Netcraft confirms: *BSD is dying
Yet another crippling bombshell hit the beleaguered *BSD community when recently IDC confirmed that *BSD accounts for less than a fraction of 1 percent of all servers. Coming on the heels of the latest Netcraft survey which plainly states that *BSD has lost more market share, this news serves to reinforce what we've known all along. *BSD is collapsing in complete disarray, as further exemplified by failing dead last [samag.com] in the recent Sys Admin comprehensive networking test.
You don't need to be a Kreskin [amdest.com] to predict *BSD's future. The hand writing is on the wall: *BSD faces a bleak future. In fact there won't be any future at all for *BSD because *BSD is dying. Things are looking very bad for *BSD. As many of us are already aware, *BSD continues to lose market share. Red ink flows like a river of blood. FreeBSD is the most endangered of them all, having lost 93% of its core developers.
Let's keep to the facts and look at the numbers.
OpenBSD leader Theo states that there are 7000 users of OpenBSD. How many users of NetBSD are there? Let's see. The number of OpenBSD versus NetBSD posts on Usenet is roughly in ratio of 5 to 1. Therefore there are about 7000/5 = 1400 NetBSD users. BSD/OS posts on Usenet are about half of the volume of NetBSD posts. Therefore there are about 700 users of BSD/OS. A recent article put FreeBSD at about 80 percent of the *BSD market. Therefore there are (7000+1400+700)*4 = 36400 FreeBSD users. This is consistent with the number of FreeBSD Usenet posts.
Due to the troubles of Walnut Creek, abysmal sales and so on, FreeBSD went out of business and was taken over by BSDI who sell another troubled OS. Now BSDI is also dead, its corpse turned over to yet another charnel house.
All major surveys show that *BSD has steadily declined in market share. *BSD is very sick and its long term survival prospects are very dim. If *BSD is to survive at all it will be among OS hobbyist dabblers. *BSD continues to decay. Nothing short of a miracle could save it at this point in time. For all practical purposes, *BSD is dead.
Fact: *BSD is dying
Does a clone have the same fingerprints as the original copy?
If it was possible to close a person with identical fingerprints what kind of security problems would this cause?
As we get into the future with biometrics and DNA scans, how will clones "fit in". If you make 20 clones, should there be a law to make them genetically and biometrically different? If so, how do you do that, should you do that, or would that be against their constitutional rights?
Please bear in mind most children have two (biological) parents. Should they both get a say?
There are reasons why democracy does not work nearly as well as capitalism.
-- David D. Friedman
So your a jew??
Right - and there are more than one parent in the the world. By saying "the parent", I was referring to a set of people, not to a single, over-riding Parent. Specifically, I was referring to anyone who could be referred to as a parent of the child in question. Of course, that brings up the question of sperm donors, etc. They could be considered a "parent", but probably shouldn't have any say in the outcome of a child they'll never meet. IANAL, I was just outlining one of the *many* guidelines that would be required in a gene-manipulating world.
And now look at me - I thought your sig was part of the comment, and got all defensive. Ah well.
Last post!
My thought exactly {well, almost.}
There are reasons why democracy does not work nearly as well as capitalism.
-- David D. Friedman
For that to be ethnocentric, he would have to be delaring that his own ethnicity (race) is superior to another ethnicity (race) simply because his race has a different view on nuclear families. In fact, he never brought race into the discussion. Furthermore, the concept of a nuclear family is aligned with only one race or subset of races, so he can definitely not be declared ethnocentric based on what we have read.
Likewise, one cannot call the nuclear family an anthropo[lo]gical aberration without first establishing that the vast majority of humans were born outside of the nuclear family. Since we already know that the majority of humans are in fact raised within a nuclear family, we also know the concept of a nuclear family is not an aberration.
Looks like it's back to the drawing board for you. Time to find a new cause -- this time, pick one that doesn't require the use of such big words -- stick with ones that are shorter than, let's say, 4 letters.