Slashdot Mirror


Studies Say Video Games Increase Violent Behavior

KyDaran was one of several people who wrote about findings in UniSci regarding two studies released in the April issue of the American Psychological Association's (APA) Journal of Personality and Social Psychology. The studies show a relationship between violent and aggressive behavior and video game playing. Check out the full journal study for yourself.

402 comments

  1. Re:Fuck Mind-Quacks! by Anonymous Coward · · Score: 1

    If Bill Gates had a dime for every time a Windows box crashed ... oh, wait a minute -- he already does.

    He'd be a trillionaire.

    -- AC

  2. Difference between "aggressive" and "violent" by Anonymous Coward · · Score: 1

    I was just pondering how a video game can help bring out peoples' aggressive tendencies. Many people with frustrated feelings of agression are drawn to video games as a means to express their violence and get it out of their system. It makes sense that people might continue to act out their aggression at a heightened rate once they stop playing. This is not necessarily a bad thing. Releasing pent-up aggression is healthy, if it is done non-destructively, e.g. through video games, or by engaging in "aggressive behavior". Most "aggressive behavior" is not actual "violence". I'm sure this study has some validity, but this doesnt mean that violent video games are necessarily evil or destructive. I noticed that many of the very defensive posts here are talking about violent behavior, while the actual study seems to focus more on "aggressive thoughts and tendencies". People are aggressive. Very agressive people play more violent video games. Violent video games encourage people to express their agression, by providing an outlet and getting the juices flowing. This is OK, as long as people have the decency to teach their kids not to be an a$shole or shoot anyone.

    1. Re:Difference between "aggressive" and "violent" by Score+Whore · · Score: 1

      Not to mention that in the last 10 years, during the recent resurgence of video games, violent crimes and such have gone down.

  3. correlation almost NEVER equals causation by Anonymous Coward · · Score: 1

    If there is ONE THING that I would like to teach the world, it is that CORRELATION ALMOST NEVER EQUALS CAUSATION. Most people don't realize that if one two things appear together one doesn't cause the other. It's called "lying with statistics" to convince the ignorant masses that your agenda is correct.

  4. Women more effected then Men? by Anonymous Coward · · Score: 1

    If this study were to be true, then why aren't women shooting up schools after playing a round of doom or quake? After all, DO become more violent then males after playing these.

    I'd like to see them do this same study with sports such as soccer and football, to see if its competitive things in general that cause this.

  5. Re:NEW STUDY; Alzheimers by Anonymous Coward · · Score: 1
    ...yet somehow they can determine that people can get Alztimers from it.

    Actually, that's precisely the point!

    (Mom is a Ph.D+M.D., geriatrics specialist)

    These people get alzheimers when they're 25, 30, or so. I think the odds are something like 1/10 to get alz^I before you die, or, if you prefer, that you'll live long enough to get it. But the dopefiends (dunno exactly what drugs tho, sorry) get alz^I REAL YOUNG! That is NOT bullshit.

    OTOH, it could be one in twenty thousand, but i doubt that; I'd guess somewhere in the 1/200..1/20 range.

  6. what about rap? by Anonymous Coward · · Score: 1

    does this mean that gansta rap will make me wanna kill a cop? no, nor will UT make me wanna pull out a sniper rifle and peg kryss in the head just because i did it in UT. head shrinks suck. ~~jeebus save me!!~~ -=homer simpson=-

  7. Studies show religion increases violent behaviour! by Anonymous Coward · · Score: 1

    Unlike a whopping 30 years worth of video game data, research spanning THOUSANDS of years show that more organized mass killings have resulted from RELIGION than FROM ANY OTHER CAUSE! OH. MY. GOD. (no wait, that what's killing people here). We need to ban religion! It's far more detrimental than video games could ever hope to be! AND MANY PARENTS FORCE THEIR CHILDREN(!) AS EARLY AS INFANCY TO BE SUBJECTED TO RELIGIOUS MIND WARPING SERVICES! Stop religion now, before the next massacre begins!

  8. Uhh.. by drdink · · Score: 1

    I've played hours of video games and I am not violent because of them god damn it. If anybody tries to tell me so, I'll break their arms and shove them so far down their throut that their fingertips cause their stomach to explode and they die of internal bleeding. I WILSAFJLKAWJR@#OI!$YU@#(!)*Y%UR#)*(.... See?

    --
    Beware, Nugget is watching... See?
  9. Re:According to the APA... by Ranger+Rick · · Score: 1

    Yeah, I was going to bring that up. The scary thing is finding myself actually agreeing with Dr. Laura on something. :)

    --

    WWJD? JWRTFM!!!

  10. I agree. by drwiii · · Score: 1

    I mean, we all saw what happened over the weekend.. Right?

  11. Re:Studies show religion increases violent behavio by Niomosy · · Score: 1

    That may be so. But we can also look to some of the color religion has added to our lives. The Spanish Inquisition anyone? ("noooobody expects the Spanish Inquisition! Our chief weapon is supplies!")

    I'm sure plenty of others will point out other such religious triumphs.

  12. Leisure Suit Larry by zaphod · · Score: 1

    Yeah, and Leisure Suit Larry games made me want to have sex.

    What's next? Competitive sports cause kids to want to compete with each other? This is starting to scare me....

    --
    Just because you're paranoid, doesn't mean they're not after you!
  13. This study is a red herring by Ih8sG8s · · Score: 1

    This is all bullshit. Here's what the problem is:

    A minimum wage earning parking lot attendant receives more training on operating the arm than people receive training on how to raise children.

    The attitude must exist in the first place in order for violent games to be acceptable.

    We don't see games that glorify genocide or ways to effectively starve a nation because these aren't acceptable scenarios. Violence and killing is. Look at any/every news broadcast in continental north america: "3 dead.... 5 people killed... a massacre..." It's no wonder.

    I have a three year old son who whips around on my computer better than most adults can. He plays games (racing games), and when he's old enough to distinguish acceptable behaviour in a game from acceptable real-life behaviour, he'll be playing whatever FPS is hot at the time.

    Everyone likes to point the finger, it's easy to do. Remember this: When you point your finger at someone else, you're pointing three at yourself.

    Everyone think 'crazy' thoughts, violent thoughts...thoughts that we would be embarassed to share for fear of being institutionalized. Anyone who denies this is a liar.

    The difference is that the sane person stops short of acting upon, or voicing those thoughts. Why? Beacuse they know better. They know better becasue they were raised to know better.

    "It's the video games.. it's the music.. it's the teachers... it's the school system --they are to blame for our children's behaviour"

    Bull fucking shit. Raise your children properly and none of this happens.

  14. What they should really be studying is... by Yakko · · Score: 1
    The relationship between stupidity and violent or agressive behaviour. Or, closeley related, the relationship between hasty kneejerk reactionism and violent or agreesive behaviour.

    Ironically, this was supposed to be a joke. <:o(

    I failed to read the article, but from my own experience, I can say that I had way less of an urge to hurt real people when I have some bucket of bits to kick around.

    --

    --

    --
    Me spell chucker work grate. Need grandma chicken.
  15. Severely OT: All I know is... by alumshubby · · Score: 1

    ...a close relative with psychological problems tried to kill two other members of my family with a gun. Having seen actual gunshot wounds up-close and personal, and dealing with the tragedy and its aftermath, playing Apache Longbow and Duke Nukem isn't all that appealing anymore.

    --
    "How many light bulbs does it take to change a person?" --BMcC-->
  16. NEW STUDY! by garcia · · Score: 1

    People who drink MILK are at a higher risk to take drugs, commit suicide, and to commit murder. News at 6.

    1. Re:NEW STUDY! by garcia · · Score: 1

      How is it offtopic? It is showing that this study is as ridiculous as my post.

      New studies supposedly show that Tofu reduces memory retention (an actual study). Also, there have been tests to show that the use of Ecstacy as a recreational drug causes long term memory loss and sleep disorders (although the use of it as a recreational drug has only been around for about 20 or so years (in large numbers)) yet somehow they can determine that people can get Alztimers from it. BULLSHIT.

    2. Re:NEW STUDY! by garcia · · Score: 1

      "It is an observed fact that people who are heavy users of pot lose a lot of motivation/spark. There are also links to depression. Whether is physiological or psychological I dunno, but it is observed."

      their wrong. There is NO loss in motivation, no loss in "spark". I am quite happy, and quite motivated (being an avid athelete). I am convinced that all studies are bullshit. :)

    3. Re:NEW STUDY! by garcia · · Score: 1

      "So, are you a violent video gamer that eats Tofu and uses Ecstasy recreationally?"

      I am not a violent person, actually I am rather mellow (probably the years of drugs and recently E). I play a lot of Quake1CTF but I am definitly not affected by playing.

      "You didn't provide a link so I can't tell if your
      reference to Alzheimers is actually mentioned in the study or an inference on your part based on the words 'memory loss'."

      I just tried USA Today's website (to no avail) to find the story (if they even have old articles), but it was in the paper on Wednesday of last week I beleive (right on the front page).

      I don't believe that a 20 year study would allow for a test of LTM loss. Especially if you are using it RECREATIONALLY. I am not talking about the people that use it almost all the time (serotonin disorder), I am talking about 2x a month (and maybe 2 pills in a night).

      As far as having sleep disorders (as in another reply) and relating these to a "bad roll"... Your experience was not rare, but the sleep disorders were. I have had bad rolls on several occasions, but never had any "cracked out" behavior lasting more than 48 hours. The effects of E on the mind *can* last up to 7 days but usually not more than that. This person's case was an exception. E is related to speed, etc, of course it is going to distrupt your sleep patterns, but it won't affect long term.

      As far as the USA Today article talking about this new research, they weren't pointing to CURRENT LTM loss and CURRENT sleep disorders, they were HYPHOTHESING that this will happen to regular users in the FUTURE. It is all bunk.

    4. Re:NEW STUDY! by garcia · · Score: 1

      "did that study take into account all the other drugs someone who regularly used ecstacy might be using as well, or were they able to limit their study to people who ONLY used ecstacy."

      it wasn't specific.. But as far as E users go (that I know) usually are into the other "soft" drugs: pot, shrooms, acid.

      from personal experience I don't believe ANY claims that ANY of those drugs listed cause brain damage or memory loss (long term anyway).

    5. Re:NEW STUDY! by garcia · · Score: 1

      "because who wants to be known as "that brain-damaged guy"?"

      actually.. My nickname is Dopebrain... Do you honestly think that I care? I maintain an above average GPA, and I feel that I am relatively intelligent.

      As far as your "brilliant" statement of using a personal testominal to respond, don't you see the irony of my response? Sometimes I wonder if I am Dogbert and the rest of the world is Dilbert...

    6. Re:NEW STUDY! by SEWilco · · Score: 1
      "Tofu reduces memory retention"
      "So, are you a violent video gamer that eats Tofu and uses Ecstasy recreationally?"

      I am happy to say that I don't remember why my I'm holding a railgun.

    7. Re:NEW STUDY! by Score+Whore · · Score: 1

      Assuming by personal experience you mean from usage rather than medical research, how can you know? If you are losing mental faculty will you be able to identify that you are losing mental faculty? :) :) :)

      Not believing the claims doesn't change whatever the facts are. It is ridiculous to use personal testimonials to try and change people's minds about drugs. Whether it's merely to get people to accept your usage or want to have people use with you or whatever.

      It is an observed fact that people who are heavy users of pot lose a lot of motivation/spark. There are also links to depression. Whether is physiological or psychological I dunno, but it is observed.

      (And no, I'm not going to go hunting for references online for anybody. It's out there if you are interested. If it was up to me I'd say let people do what they want as long as it has zero effect on other people. As soon as you start interfering with other people in even the minutest way... well... "bullet to the head." Guess it's a good thing I'm not in charge, eh?)

    8. Re:NEW STUDY! by Score+Whore · · Score: 1

      I think that you can determine if a chemical/food/protein can effect your long term memory without having to do a pure cause and effect observational study.

      For instance they might be able to indentify that eating tofu leads to certain neurological changes that are known to cause memory loss. Or certain proteins are known to have certain effects.

    9. Re:NEW STUDY! by ddwalker · · Score: 1

      Hmm...did that study take into account all the other drugs someone who regularly used ecstacy might be using as well, or were they able to limit their study to people who ONLY used ecstacy. As for the sleep disorders...well the one time I used ecstacy, I had a bad experience, and I believe an allergic reaction. Needless to say, I had sleep disorders and flashbacks for about two to three weeks following that.

      Its not that I approve of drug use, its more that I disapprove of tests that are fixed in such a way as to show something is bad for you. Wasn't it Mark Twain that said, "There are liars, damn liars, and statistics." Well these tests are just statistics...

    10. Re:NEW STUDY! by emby · · Score: 1
      Can anyone think of a drug user who admits that their favorite drug might have nasty side effects? Or a drug virgin who admits that the government's stance on drugs could be completely wrong? Hmmm...

      I've never smoked pot or used any other illegal psychotropic drug. I started drinking alchohol two-and-a-half years ago at the age of 29.

      I think that the War On Drugs is a excessive response to a problem (criminal drug dealing) which the prohibitions themselves have created. But I'm in favor of very strict controls on refined opiates, PCP, and other drugs with equally equally extreme effects.

      I think pot should be regulated much like alcohol.

      I think the jury isn't quite in on things like E, but it sounds like it can have some icky and insidious side effects.

      How's that?

    11. Re:NEW STUDY! by carlos_benj · · Score: 1
      "Also, there have been tests to show that the use of Ecstacy as a recreational drug causes long term memory loss and sleep disorders (although the use of it as a recreational drug has only been around for about 20 or so years (in large numbers)) yet somehow they can determine that people can get Alztimers from it."

      So, are you a violent video gamer that eats Tofu and uses Ecstasy recreationally?

      20 years is plenty long enough to determine a link between usage and long-term memory loss. You didn't provide a link so I can't tell if your reference to Alzheimers is actually mentioned in the study or an inference on your part based on the words 'memory loss'.

      carlos

      --

      --

      As a matter of fact, I am a lawyer. But I play an actor on TV.

    12. Re:NEW STUDY! by Contingency · · Score: 1

      As an experimental psychologist, I can agree that for the most part this study doesn't say much. Correlational measures are correlational, and do not demonstrate causation (nobody knows if tofu increases memory retention, because another variable could be responsible for both tofu eating and memory increases, if that is even a true research study). Hence, all of the ratings, scales, and cognitive measures can be dismissed, as people have noted. Unfortunately, there is one aspect of this study that may deserve more careful attention, namely "aggressive behavior is operationally defined as the intensity and duration of noise blasts the participant chooses to deliver to the opponent." There are some interesting analyses, but the following is really the most important result: "Most importantly, participants who had played Wolfenstein 3D delivered significantly longer noise blasts after lose trials than those who had played the nonviolent game Myst (M s = 6.81 and 6.65), F(1, 187) = 4.82, p .05, MSE = .27." What you see here is a difference in the means of 6.81 second duration noise blast for the Wolfenstein group and 6.65 seconds for the Myst group. Probability is less than five percent (p .05) of finding those results. But, the real difference between these groups is 6.81 - 6.65 = .16 seconds on average. An increased duration of noise blast for .16 seconds really doesn't strike me as "increased aggression" in any practical sense. The only reason that result is significant is because of the huge number of people in the study (187). Unfortunately, the results really don't provide the kind of evidence that would suggest violent video games increase aggression at any practical level.

    13. Re:NEW STUDY! by Chiasmus_ · · Score: 1

      Hmmm, you're responding to a guy who's just pointed out the futility of using personal testimonials in these kinds of arguments, and your brilliant rebuttal is... a personal testimonial.

      Sometimes I think the drug issue is to convoluted and emotional to ever make any sense of. No one will ever admit that their drug of choice is causing them brain damage, because who wants to be known as "that brain-damaged guy"? By the same token, no government agency will admit that the drug doesn't cause brain damage, because there's too much at stake. And, I hate to say it, but I doubt that more than 5% of the population, tops, can remain objective.

      Can anyone think of a drug user who admits that their favorite drug might have nasty side effects? Or a drug virgin who admits that the government's stance on drugs could be completely wrong? Hmmm...

      --
      "Beware he who would deny you access to information, for in his heart he deems himself your master."
  17. Re:Study shows being human increases violent... by Bilbo · · Score: 1
    > Conflicts in which religion is not the causal factor are few. Conflicts in which religion does not play a key motivating role for rallying people and troups, and inciting them to commit acts they would otherwise abhor, are almost nonexistent.

    It could also be argued that, following a set of "religious beliefs" is such a fundamental human characteristic that nothing is free of its influence.

    It seems that people here are confusing two independent characteristics:

    1. the tendency of people to believe in supernatural forces (i.e., "religion"), and
    2. the tendency of societies to behave violently, especially when they somehow feel somehow threatened by another group of people.

    A fundamental difference in this study is that they are talking about behavior of individuals, not societies. I'm not going to say that I agree with the study, but comparing the Spanish Inquisition with a couple of teens going in and shooting up an elementary school makes no sense.

    --
    Your Servant, B. Baggins
  18. Dammed Heretics or Good Christians ... by bbcat · · Score: 1

    After defeating the town of Beziers, near the
    Mediterranean coast, the French army is faced
    with how to tell which inhabitants are
    "dammed heretics", and which are "good Christians".
    Simon IV of Montfort comes up with his infamous
    solution: "Kill them all, for the Lord will know
    his own."

  19. It's more likely to give you the shits. by bbcat · · Score: 1

    Tofu, when I tried it back in Waikiki in 1975
    I thought I was being given some kind of poison.
    That stuff tastes awfull.

  20. Deers are one of the biggest danger on the roads. by bbcat · · Score: 1

    If you'd ever drive in the suburbs of Paris (MI) you'd come to realize that the more of these animals eliminated the more people you'd protect. In European countries drunk drivers are the most dangerous on the roads while here in America deers are.
    I've been very lucky so far having only hit scunks and birds but I know people who have hit many, as many as ten in the past few years.
    The stupid animals should know better but they are too stupid. The best thing is for them to become food for the hungry.
    Here we have ways to take care of the free meat found on the highways : in French and In English.

  21. Re:SShock2 by F13 · · Score: 1

    Damn system shock 2 I can't even get passed the first level as the game makes me sick and give me shocking headache ... something to do with the motion of it (it never looked quite right to me)

    anyone else have this problem ?

  22. Ignorance of Slashdot readers by Gepard · · Score: 1

    Flamebait Material Ahead

    Slashdotters know everything there is to know about psychology when it comes to writing about video games! Hey, Jon Katz writes that the instances of violent crime have gone down instead of up as the popularity of violent games increased! Hey, there must be a correlation!

    Bullshit.

    On average, /. readers know next to nothing about anything except computers. A cool shopping cart CGI script? Easy. Perl poetry? Easy! A raytracer? Maybe not that easy, but doable. A relationship? Forget it! So why do people all of a sudden think they are experts in a social science? Face it---the vast majority of this audience is not.

    Numerous studies in the field have shown that there exists an undeniable correlation between viewed violence and acts of violence. I know about the criticism about cause and effect. Studies have been performed that do indeed check that correlation. This is exactly the sort of thing controlled lab experiments are for. In 1961, Albert Bandura (et al.) found that preschool children were more likely to attack an inflated doll after watching an aggressive adult model than after watching a nonaggressive model. More recently, a 1988 study (Schutte et al.) found that children are more likely to hit another child after playing Karateka than after playing Jungle Hunt (a nonviolent game). Wood et al. (1991) show that exposure to aggressive models increases aggression.

    I wish I could post links to the studies above, but they are not recent enough to be archived anywhere I know of on-line (at least free of charge---I'm sure most university libraries will have these articles in both paper and electronic form).

    Folks, I know that no one here wants to believe that Quake causes anyone to kill. I play Quake, and I strongly suspect that it will never cause me to pick up a gun and blast everyone in sight. We are not talking about individuals here. We are talking about trends, i.e., average kids will on average be more inclined to hit someone after playing a game of deathmatch. Let's face it and stop denying this simple fact. Most /. readers strongly believe that game violence is OK, but hopefully most people here are intelligent enough to realize that the intensity of a belief should not be confused with its validity.

    Sources

    Bandura, A., Ross, D., & Ross, S. A. (1961). Transmission of aggression through imitation of aggressive models. Journal of Abnormal and Social Psychology, 63, 575--582

    Wood, W., Wong, F. Y., & Chachere, J. G. (1991). Effects of media violence on viewer's aggression in unconstrained social interaction. Psychological Bulletin, 109, 371--383

    Schutte, N. S., Malouff, J. M., Post-Gorden , J.C., & Rodasta, A. L. (1988). Effects of playing videogames on children's aggressive and other behaviors. Journal of Applied Social Psychology, 18, 454--460

    1. Re:Ignorance of Slashdot readers by Jeld · · Score: 1

      Someone please moderate this post up. It is very rare indeed to see a slashdot post with a bibliography. This guy has a valid position and defends it with a lot of skill. Even though it is not a popular position on slashdot this post should be moderated. ( personally I think psychology is a pseudo-science as well as computer science and later is made to make better violent games for me to play... hmmm... port those games to linux first though ).

      --

      Everybody Lies. But it doesn't matter since nobody listens.

    2. Re:Ignorance of Slashdot readers by The+Cookie+Monster · · Score: 2
      • Microsoft software makes me more agressive than Quake.
      • Ignorant idiots posting on public forums and letters to the editor make more agravated than a violent video game (irony not intended).
      The bullshit is in the ideology behind the study, not that the study found a correlation. The study will be conveyed as showing that it was not continual bullying that made them plan revenge, it was not windows crashing or Word messing with their assignment that made them violent, it was not violence on TV since age 5, it was DOOM (at the expense of trenchcoats?).

      Don't you think that to be valid the study really should have put the correlation into perspective - Violence induced by video games vs violence induced by traffic. Instead it's going to be used as evidence that games cause killings.

      I do agree with you that I'm no psych expert and neither are most people here. However my opinions on that relevance are coloured by the only person I know [that I know] has a psych degree saying the only thing this taught her was that they don't know squat (I don't think those were her exact words, but I can't remember them). That and the fact that you don't need a psych degree to have introspection and social interaction to draw from, both of which are more educational than anything a psych degree can teach you (of course, a psych degree is extra).

  23. Re:Well, Duh! by ACK!! · · Score: 1

    I don't buy this at all. People who are part of a culture and a society make the games. This cultural influence is reflected in every tv show and video game available today. Even when people protray different societies they do so from their own biased perception (ever read early settlers warped accounts of Indian traditions?).

    Fiction is often exagerrated but almost always reflects events and people that live in the real world. The real world is not like Kingpin but if you live in the world of crime, guns and depravity it comes far too close. There are sick people out there sir and you are the one that is a victim.

    If you believe that Quake makes and forges people into killers, then you are playing into the sort of hysteria gripping the same tv culture you seem to yell against.

    It is instead a society competitive and obsessed with violence that creates the kind of atmosphere that these games come about in. The masses play the games because they like the games. They like the games because our culture has taken the sting out of the violence and it is ok to kill in the virtual world.

    Before video games people said that Heavy Metal music made commit suicide and before that in the fifties it was comic books that forged teenage deliquents. We always come up with an excuse without facing the problem.

    --
    ACK /ak/ interj. 2. [from the comic strip "Bloom County"] An exclamation of surprised disgust, esp. i
  24. Re:Look at this study for what it is... by Harlequin · · Score: 1

    The thing about scientists is, whenever they set out to prove something they want to prove, they invariably find a way of proving it.

    That effect is called "confirmation bias". It is a problem when researchers only seem to look at evidence that backs up the theory they're trying to prove. I don't see, necessarily, evidence of that here, though.
    The reason you might think that "whenever [scientists] set out to prove something... they invariably find a way of proving it." is because the media usually doesn't report stories where people disproved their theories. I'd also guess that researchers are more likely to spend the time publishing their results if they proved what they set out to do. So, what you get may be an apparent bias where not really exists. That's just something to keep in mind before you go generalizing about "The thing about scientists is...".

  25. violence towards women by Lx · · Score: 1

    Interestingly, she also found that 21% of the games portrayed violence towards women.

    Oh, whatever. Why didn't she find that 79% of video games portrayed violence against men? Women are in fighting games, so what - they have somewhat equal representation, and if they weren't there, there'd be complaints that women weren't actually portrayed at all, much less being portrayed being attacked.

    They make it sound like there's some game out there where the object is to batter women. All the women in these games fight back, and Kitana always kicks my ass, but then again, I'm not very good.

    Now I won't say that beating up on a woman in a fighting game won't negatively influence some people, especially ones that are rather stupid to begin with, but I think that it's going a little too far and misrepresenting the facts when the study talks about 'violence against women', using it as a hotbutton phrase.

    -lx

    1. Re:violence towards women by Stonehand · · Score: 1

      *snicker*

      And, considering that women are rather more than 21% of the population, that's discrimination! Sue! Sue!

      :)

      --
      Only the dead have seen the end of war.
  26. Well, yeah. by Requiem · · Score: 1
    Yesterday afternoon I was sitting down, studying for my astronomy final, when lo and behold, who should sit down beside me but the class brain?

    Perfect, I think to myself, drawing out my blessed rustproof +5 Serrated Dagger of Doom.

    Poor little Billy never saw it coming. He was dead pretty quickly, and I was left with one corpse on my hands. What did I do?

    Why, eat it, of course. Many years of nethack has taught me that if you want some kind of intrinsic (say, amazing knowledge of astronomy), you have to eat the corpse of something that possesses it.

    So anyhow, after eating poor Billy's brain and liver, I'm guaranteed a 90% on my final tomorrow.

    I owe it all to nethack.

  27. Ok everyone. 1.. 2... 3.... by jabber · · Score: 1

    Yeah, I know, it's obvious. But just in case SOMEONE doesn't yet get it...

    Blame Canada

    Sheila: Time's have changed
    Our kids are getting worse
    They won't obey their parents
    They just want to fart and curse!
    Sharon: Should we blame the government?
    Mrs. Cartman: Or blame society?
    Dads: Or should we blame the images on TV?

    Sheila: Heck NO, blame Canada
    Everyone: Blame Canada
    Sheila: With all their beady little eyes
    And flapping heads so full of lies
    Everyone: Blame Canada
    Blame Canada
    Sheila: We need to form a full assault
    Everyone: It's Canada's fault!

    Sharon: Don't blame me
    For my son Stan
    He saw the darn cartoon
    And now he's off to join the clan!

    Mrs. Cartman: And my boy Eric once
    Had my picture on his shelf
    But now when I see him he tells me to fuck myself!
    Sheila: Well, blame Canada
    Everyone: Blame Canada
    It seems that everything's gone wrong
    Since Canada came along
    Everyone: Blame Canada
    Blame Canada
    Guy on TV: There not even a real country anyway

    Mrs. McCormick: My son could've been a doctor or a lawyer it's true
    Instead he burned up like a piggy on a bar-b-q
    Everyone: Should we blame the matches?
    Should we blame the fire?
    Or the doctors who allowed him to expire?
    Sheila: Heck no!

    Everyone: Blame Canada
    Blame Canada
    Sheila: With all their hockey hubabaloo
    Mrs. Cartman: And that bitch Anne Murray too
    Everyone: Blame Canada
    Shame on Canada
    The smut we must stop
    The trash we must smash
    Laughter and fun
    must all be undone
    We must blame them and cause a fuss
    Before someone thinks of blaming us

    --

    -- What you do today will cost you a day of your life.
  28. New study just out: Linux, Windows and Libido by Bongo · · Score: 1

    After two years of intensive Freudian psychotheraputic analysis conducted on a group of Linux users, and a separate group of Windows users, the research team has just published their findings. "We see that the Windows Experience(TM) has helped users to achieve a significant and deep re-integration of their unconscious libido drive, allowing them to channel their creative energies 'like a laser beam'.. they are productive, happy and well integrated. The Linux group, however, was found to have had excacerbated symptoms of pre-phallic neuroses, oral compulsive behaviour and post modern dissasociation of oedipal complex shadow regression."

    The researchers' solid evidence has been verified by many intependent groups..." we are lucky to have had ample funding for this work so that we can catch this danger to society in time.." remarked one of the researchers, who is now undergoing intensive therapy after exposure to Linux during the project. "It's really screwed up my life!"

  29. Re:The experts have an opinion, or three by Optical · · Score: 1

    Offtopic, but..

    Vitamin C is water soluble. Excess amounts of it leave your body, along with the water. Doesn't really do anything harmful; but if you don't get enough of it, say goodbye to your immune system.

  30. that's a no-brainer by iosphere · · Score: 1

    Why is a study like this even considered news? And what did you think kids would do after playing a violent game, hug each other? Of course they're going to try to reproduce what they just did on their playstation.

    My friends and I did the same thing when we were kids. We'd go see Star Wars, then come back and start wacking each other with sticks. If we had Mortal Combat back then, I'm sure we would've been trying for decapitations.

    1. Re:that's a no-brainer by undertroll · · Score: 2
      If we had Mortal Combat back then, I'm sure we would've been trying for decapitations.

      What a pity you didn't.

  31. I'm Clueless by __aaedhn419 · · Score: 1

    I don't understand this study well enough to say anything.

    I doubt most of you do either.

    However, a good methodology could test for whether people were more aggressive after playing than before.

  32. Re:Studies show religion increases violent behavio by Medievalist · · Score: 1

    You have to wonder why the original post was moderated to "funny". The slaughter perpetrated in the name of redemption is amusing to someone? I guess they haven't lost any close friends or family members yet.
    Irony isn't neccessarily humorous. But of course irony is an unknown dimension to most Americans, we're too used to hearing the word misused every night on network jellovision.

  33. Re:Well, Duh! by Forrest+J.+Cavalier · · Score: 1
    Measure over just 7 years!? Why not go back 15, 30, 50, 100.

    There are going to be peaks and valleys in any measurement. It just happens that there was a horrific increase 1986-1994. Sure is convenient to measure over the last 7 years and not the last 15....

    Want to see teen involvement in homicide: http://www.ojp.usdoj.gov/bjs/homicide /teens.htm

  34. freshman psychology by option8 · · Score: 1

    the one thing i learned in freshman psychology that stuck with me (aside from all the weird freud stories) is the difference between a CORRELLATION and CAUSE/EFFECT

    a correllation means that two things happen to appear together. for example, the first study (the interview) showed a correllation between aggressive tendencies, video game play, and lower grades. what this tells us is ONLY that the three seem to appear in the same people, not that playing video games causes violent behavior and lower grades. it is just as likely that aggression causes an increase in game play and lowered grades. the first study only shows that the three items most likely share a common cause, not that any one of them is the cause of the other.

    the second study, on the other hand, does show a cause/effect relationship between playing a game in which the goal is to kill everything that isn't you, and one where the goal is to solve puzzles. the effect is that those playing the point-and-shoot game, immediately afterward, punished an 'opponent' more vigorously than did the puzzle-players. this, to me, says one thing: playing first-person-shooters engages a part of the brain typically reserved for responding to physical threats, increases levels of adrenaline and other chemicals, and temporarily increases one's aggression - similar to an avid fan watching a game of football. puzzle games do not have the same effect, most likely because they engage a different part of the brain - one better suited to solving puzzles, and less apt at finding the 'aggressor' and fighting or fleeing. in any event, the effects are only studied for short amount of time afterward. it shows nothing of the length of the effect or, indeed, the long-term effects of extended exposure.

    so, to cite these studies as proof that violent video games cause violent behavior is farfetched. the first only cites a correllation, and the second shows only the immediate effect, and notes only a slight increase in aggression, and nothing even approaching 'violent' reactions.

  35. Argh! by TWR · · Score: 1
    When I finish this game of Q3A, I'm going to kill the f*ckers who wrote this paper...

    -jon

    --

    Remember Amalek.

  36. Re:Time to ban the Football team... by Felinoid · · Score: 1

    >We should all be passive drones, with no passiosn, no individuality, and no opinion other than what we are given by the News. Don't blink too often, act depressed, or get too excited, or you will be medicated down with the rest of us.

    Ohhh no you don't... No news for you...
    Don't you try slipping that one over on us.. we is smart.. yah... we is knowing things like video game is of the satan ya know...
    No.. news teaches violents.. people copy cat murders... get ideas from news.. ignorence is bliss.. we will monitor your books as well. Only nice shiny happy thoughts

    --
    I don't actually exist.
  37. Re:Studies show religion increases violent behavio by kvajk · · Score: 1

    Again, a modern day cult of personality is still a cult, and inherently religious in nature.

    In other words, you define "religion" to mean anything fanatical with which you disagree. Sorry, but I don't buy it.

    Fanatacism is what kills people, and religion is just one of the many thing which fanatics throughout the ages have committed atrocities in the name of.

  38. Re:Studies show religion increases violent behavio by kvajk · · Score: 1

    satanic symbolism employed by the Nazis, such as the Swastika

    I don't know about Satanists, but I know that a lot of other people throughout the ages have used that same symbol.

    Usually it represents the rotation of the night sky around the north star or the procession of the zodiac, in which case the direction (clockwise vs. counter-clockwise) depends on which hemisphere you're in.

    I've seen it in SouthEast Asia, usually with four dots in the cross, used as a good luck symbol.

    But yes, I do agree that the high-level Nazis had some weird mysticism stuff going on. So what? The Nazis committed their worst atrocities (genocide) in the name of science. The fact that it was scientifically flawed and horribly immoral doesn't change the fact that their motivations were not religious. And the other groups mentioned were explicitly atheist. I do not see a cause and effect relationship between religion and violence.

  39. Re:the real reason for Columbine by kvajk · · Score: 1


    First you imply that Elian's family should have been using guns to keep him here, then you say he should have been taken anyhow. Next you imply that it was in fact the US government which blew up that building in Oklahoma.

    No offense, but I don't much like the thought of you carrying a gun.

  40. Youth violence dropping by robwicks · · Score: 1
    How come if video games spur violence among the young, that violence among the young is dropping to its lowest levels since the depression.

    There is an article in Scientific American that suggests that legalized abortion may have something to do with this. The most likely children to be aborted are probably the most likely to be neglected, and therefore most predisposed to criminal behavior. By aborting them, you get rid of a lot of potential criminals.


    "Logic . . . merely enables one to be wrong with authority"
    --

    Logic ... merely enables one to be wrong with authority. -- Doctor Who

    1. Re:Youth violence dropping by robwicks · · Score: 1
      eriously, think really hard about what you're saying here. If we abort (kill) these children, they won't be able to commit violent crimes. So why stop there? Let's take this line of reasoning all the way to its end. Why not just kill anyone who has a propensity for violence, or anyone who is a potential criminal? Then go ahead and label it a retroactive abortion; the courts will call it a Constitutionally-protected right.

      The problem of violence isn't going to be solved with more violence -- especially violence against the unborn.

      No argument from me. I didn't recommend aborting babies. I was just offering a contribution to the discussion on youth violence. If the study is correct, that would explain the dropping rates of youth violence. Video games may or may not contribute to youth violence, but I doubt the effect would be as pronounced as millions of people not being here because they were aborted. Even if it could conclusively be shown that crime is substantially reduced by massive use of abortion, I would not support it. Even so, I don't much go for forbidding knowledge, or candy coating studies because of the fear that they might be used to justify horrible policies.


      "Logic . . . merely enables one to be wrong with authority"
      --

      Logic ... merely enables one to be wrong with authority. -- Doctor Who

    2. Re:Youth violence dropping by jnd3 · · Score: 1
      By aborting them, you get rid of a lot of potential criminals.

      Hmmm, sort of like the Final Solution of the Nazi regime.

      Seriously, think really hard about what you're saying here. If we abort (kill) these children, they won't be able to commit violent crimes. So why stop there? Let's take this line of reasoning all the way to its end. Why not just kill anyone who has a propensity for violence, or anyone who is a potential criminal? Then go ahead and label it a retroactive abortion; the courts will call it a Constitutionally-protected right.

      The problem of violence isn't going to be solved with more violence -- especially violence against the unborn.

      JimD

    3. Re:Youth violence dropping by Alex+Belits · · Score: 2

      Every idea can be turned into absurd when taken to extreme and beyond. In this example the extreme opposite to yours one will be to ban male masturbation and condoms as it kills "unborn babies" in the form of sperm.

      --
      Contrary to the popular belief, there indeed is no God.
    4. Re:Youth violence dropping by Alex+Belits · · Score: 2

      Every idea can be turned into absurd when taken to extreme and beyond. In this example the extreme opposite to yours one will be to ban male masturbation and condoms as it kills "unborn babies" in the form of sperm.

      --
      Contrary to the popular belief, there indeed is no God.
  41. Driving Games increase Road Rage by FatSean · · Score: 1

    After a few hours of playing Tokyo Extreme Racer, I find my traffic sorting skills are finely honed. I go out and cut through traffic on i95 at 120MPH plus. Wooohoo!

    Actually no, but when I play the game I road rage at the stupid hick-em-up trucks that cut me off when I've driving.

    NewsFlash: Video Game Studies Increase FatSean's Violent Behaviour!

    --
    Blar.
    1. Re:Driving Games increase Road Rage by Red+Eyes · · Score: 1

      Yup, and after hours of playing Road Rash, I get the urge to hop on a motorcycle, grap a meter/yard of chain and start attacking other motorists. Outrunning the cops is tricky since the ones around here only ride in their cruisers.

      Oh, I almost forgot, I need to find the cyclist with the tazer so I can wreck more havok. Don't even get me started with the pedestrians...

  42. I thought /.'s Karma Whores were bad by Biff+Cool · · Score: 1
    On April 20, 1999, Eric Harris and Dylan Klebold launched an assault on Columbine High School in Littleton, Colorado, murdering 13 and wounding 23 before turning the guns on themselves. Although it is impossible to know exactly what caused these teens to attack their own classmates and teachers, a number of factors probably were involved. One possible contributing factor is violent video games. Harris and Klebold enjoyed playing the bloody, shoot-'em-up video game Doom, a game licensed by the U.S. military to train soldiers to effectively kill.
    "Hey if we do something on Columbine it's sure to get published... especially if we point it out right at the start".

    Conscience is the inner voice which warns us that someone may be looking.

    --

    Conscience is the inner voice which warns us that someone may be looking.
    -- H. L. Mencken

  43. Re:Lock Me Up Right Now by Mike+A. · · Score: 1
    Funny you should mention anime, a form of violent entertainment from a nation with one of the lowest violence rates in the civilized world...

    Rather lends support to the idea that violent entertainment lets us sublimate our violent urges rather than act them out, doesn't it?

    Of course, Japan's suicide rate is astronomical. Does violent entertainment make you suicidal? :)

    --

    --

    --
    Do I look like I speak for my employer?
  44. Interesting approach by RPoet · · Score: 1

    The study claims, as I understand it, that violent behaviour can be caused by playing computer games not because of the games themselves, but because the player doesn't understand that the game increases his affective arousal.

    In other words, NN plays a game of Quake, which he thinks is fun, and after that he feels a lot of anger inside him, which he can't understand where comes from. He definitely will not blame Quake, so he finds something else to blame. Be it an innocent person, to whom he attributes his anger, and frags him. Ugh.

    --
    "Oppression and harassment is a small price to pay to live in the land of the free." -- Montgomery Burns.
  45. Re:Off- Topic by Chronoforge · · Score: 1

    > Students or deer - what's the difference?

    Simple; students are human, deer are not.

  46. Re:A very good point! by Moofie · · Score: 1

    Yup. Violent video games have completely destroyed any empathy I might have for the fictional characters in the video games I play *. Violent movies have removed my capacity to feel like anything real is happening on the movie screen.

    How this has any influence whatsoever on any emotions or actions I might feel or commit in the presence of any other sentient lifeform is totally unclear to me.

    *'Cept for Aeris. I cried...

    --
    Why yes, I AM a rocket scientist!
  47. A PERFECT example by FascDot+Killed+My+Pr · · Score: 1

    "The studies show between violent and aggressive behavior and video game playing."

    This "sentence" is a perfect example of why grammar and spellchecking are so very important. Show WHAT between? If Hemos meant to write "a cause-effect relationship" that would mean that one behavior (violence or vg playing) caused the other. If he meant to write "a correlation" it would mean that both behaviors usually occurred in the same people, but nothing could be said about which caused which (or IF one caused the other). Clearly these two things are very different and it matters which one is meant.

    Thank you Hemos, for this excellent example of why you need to clean your act up a little.
    --

    --
    Linux MAPI Server!
    http://www.openone.com/software/MailOne/
    (Exchange Migration HOWTO coming soon)
  48. Tired of this! by BeemerBoy · · Score: 1

    I'm tired of hearing about this video game/violence nonsense!! The next group that publishes another one of these idiotic reports, I'm gonna frag BIG TIME! (As soon as I finish the current level of Duke Nukem 3D, that is...)

    --
    Buzzing the information Superhighway at Warp speed
  49. Re:Look at this study for what it is... by ConceptJunkie · · Score: 1

    You know correlation != causation and I know correlation != causation, but most people do not make a distinction. Furthermore, even if their govermental representative _can_ make the distinction, their general lack of spine and principles will cause them to knuckle under to the hysteria.

    It sounds like a good study with clearly stated results, but I'm sure the anti video game crusaders are already drooling.

    --
    You are in a maze of twisty little passages, all alike.
  50. Re:Video Games ain't the only thing then... by mrzaph0d · · Score: 1

    I knew a guy who was a serious blackbelt in Karate. I don't know what degree, but from his demonstrations and from other things I'd heard, he was telling the truth. I found him to be a really great guy. Always polite, never forceful. He seemed to know that he had a skill but he also knew that he had a responsibility to use that in the proper manner.

    of course I've also met a few others who had some degree of fighting experiance (ranging from real training like the guy above to just plain streetsmarts), and I will admit that most of them were very arrogant about their skills. But, it was that first guy who convinced me that my son will have no problem getting my approval if he wants to sign up for lessons.
    "Leave the gun, take the canoli."

    --
    this is just a placeholder till i send back my real sig from the future.
  51. 20th century thing by delmoi · · Score: 1

    All of those atrocities have occurred in the 20th century. While Religious atrocities have been happening since the beginning of human existence. Actually, I'll tell you what kills people; it isn't religion per se, its ideologies. People who believe in something so much, that anything is worth it to acquire their goals. Those people killed millions of people because they believed in something, just like the religious murderers believed in god. They believed with their whole hearts. And they thought what they were doing was for the good of humanity.

    A fanatic is the most dangerous kind of person.

    The effects of video games, are comparatively nothing. Anyway, I'd call into question any 'scientific study' that starts out with the words "On April 20, 1999, Eric Harris and Dylan Klebold launched an assault on Columbine High..."

    --

    ReadThe ReflectionEngine, a cyberpunk style n
    1. Re:20th century thing by carlos_benj · · Score: 1
      "All of those atrocities have occurred in the 20th century. While Religious atrocities have been happening since the beginning of human existence. Actually, I'll tell you what kills people; it isn't religion per se, its ideologies. People who believe in something so much, that anything is worth it to acquire their goals."

      You're not really making the assumption that since the examples cited were all taken from a relatively recent timeframe (historically speaking) that there were only religious despots in prior centuries are you? I think you come a little closer to the truth when you mention that ideologies might be a better term to use than religions, but I'd press still further to find a root cause. Certainly ideologies give a group something to wrap its collective thoughts around and may become a rallying point, but I don't think that ideologies in themselves can bear the blame. There are many ideologies (including religious teachings) in which such activites would be anathema. I would consider myself a fanatic (based on the definitions of others) but my beliefs would never allow me to participate in a single killing, much less massive destruction.

      All of these incidents may even carry a 'religious' fervor, but doesn't it really boil down to one (or a few) greedy individual exploiting the fears of others to create an atmosphere that makes the unthinkable seem-in the minds of the followers-inevitable. That greed may be for wealth, or power, or something else entirely, but isn't that really the common denominator in all of these large-scale human atrocities?

      The Spanish Inquisition didn't really have anything to do with religion. Those in power were corrupt and either wanted to preserve or expand their power. Theirs was not a quest for God, but a lust for more power. Religion was simply the springboard for them to accomplish their goals. The 'church' was the politics of that day. Today one might use politics or business or even, yes, religion to further their own personal goals. And we blame the ideology.

      carlos

      --

      --

      As a matter of fact, I am a lawyer. But I play an actor on TV.

  52. Flawed study. (I think) by delmoi · · Score: 1

    I think one of the critical points that these people don't realize is that human beings are violent, to start with. We enjoy violence; we like killing things, in fact our violent tendencies are a necessary part of our evolution. We needed to go out and kill wild animals. Animals that, without technology, could have killed us. If you look at any large mammals, their children play violently with each other; it's a natural state. There is no reason to think that humans are any different. The article, witch I have not read in full, talks about knowledge structures, and societal constructs. And yet they offer no solid evidence. In fact they state " But, none of the studies distinguished between violent and nonviolent video games. Thus, none test the hypothesis that violent video games are uniquely associated" when talking about correlative research (meaning that its just possible that more violent people like video games). And of there experimental research, they state " The extant experimental studies of video games and aggression have yielded weak evidence also.... However, none of these studies can rule out the possibility that key variables such as excitement, difficulty, or enjoyment created the observed increase in aggression"

    They go on to say " violent materials tend to be more exciting than nonviolent materials, so the observed effects could have been the result of higher excitement levels induced by the violent games." Meaning that the 'violent' play that was observed in laboratories could simply be an artifact of the heightened excitement caused by the games.

    I play video games all the time, as do millions of people, and while I enjoy seeing my opponents in quake explode in a bloody mass (although, its more likely to happen to me :( , I have no desire to see them destroyed in real life. The question here is not whether or not video games cause a heightened desire for violence, but whether or not they cause a person to loose there own moral compass, and bring there desires into the real world. Video games, unlike television never feel real to a kid. They know it's a fantasy world, and the only lesson kids learn is that violence is acceptable in virtual environments.

    The lesson that violence is not acceptable in the real world is something that parents need to give.

    --

    ReadThe ReflectionEngine, a cyberpunk style n
  53. When the mother dies, by delmoi · · Score: 1

    the father gets custody, its a simple as that.

    However, this was a messy, and complicated situation. Its over, so now we can all shut up.

    --

    ReadThe ReflectionEngine, a cyberpunk style n
  54. Re:A very good point! by delmoi · · Score: 1

    I donno, probably the same way they did it in vetnam...

    --

    ReadThe ReflectionEngine, a cyberpunk style n
  55. Re:Off- Topic by delmoi · · Score: 1

    Nothing wrong -> er, it's murder

    murderThe unlawful killing of one human being by another, especially with premeditated malice.

    --

    ReadThe ReflectionEngine, a cyberpunk style n
  56. Re:Look at this study for what it is... by SEWilco · · Score: 1

    Carrots are safer now than in 1820. Everyone who ate carrots in 1820 is dead. Obviously an extremely bad year for carrots.

  57. Face up to facts by BeanThere · · Score: 1

    It doesn't look to me like the people who did the studies are confusing correlation with causality (as many here have stated), not at all: read about the second study - random "experiment group" played a violent game (Wolfenstein 3D, to top it off, which is a cartoon compared to new games like Soldier of fortune) and a random "control" group played Myst. The experiment group behaved more "aggressively" afterwards. They did not choose aggressive people for the experiment group.

    As much as we may hate seeing the media blame video games for incidents like Columbine, we should not simply go into denial and 'adopt a defensive stance' the moment anyone makes any mention of the possibility of even a vague link. Consider for a moment that this (intelligent) study may have some substance. Many studies have already shown that watching violent behaviour on television increases violent behaviour (any first year psychology course), this is known, and there is no reason why video games shouldn't have similar, perhaps even worse, effects.

    This does not mean that games are evil, or that they should be banned. We should just learn to deal with the fact they can have effects. What this study should be telling us is not that games are evil, but that playing of games does need a certain amount of moderation, maturity, and an understanding that violence may solve video game problems, but not real life problems (duh). Well-raised adults can thus handle playing violent games, but parents have to be responsible parents, and have to teach their kids that violence is not a solution to real life problems. 10-year old kids shouldn't be playing Soldier of Fortune in the first place. That means that parents have to actually start "parenting" their kids.

    The people doing all the poor rationalizations on this thread should (with all due respect) get their heads out the sand.

    Remember, acknowledging that this study may possibly be right does not, in any way, mean agreeing with the stupid mainstream media articles about how video games are responsible for Columbine. We know that this obviously isn't the case - Columbine, it seems, was caused by a complex combination of factors - untreated mental illness, endless harassment and alienation, loneliness etc.

    If the scientific method is to mean anything, then we have to treat studies like this objectively, and acknowledge that they may be right even when we don't agree with what they are saying. That makes for the distinction between "scientist" and "zealot".

  58. Re:the real reason for Columbine-Guns by phee · · Score: 1

    Your constitution was written in 1776 when there was a very real threat of a British reinvasion. Well guess what? I think the threat is over.

    You need to reread Jefferson's letter. He clearly was not talking about the British when he wrote that.

    Now, personally I hate guns. The best thing that could happen would be for all weapons to just suddenly vanish from Earth. But that's not very likely, is it? The cat is out of the bag, Pandora's box is open, there's no way (without a time machine) to get rid of them all. So the only other solution is for everyone to have them so that nobody has an advantage over anyone else. And what if there were no guns, anyway? People would use knives to hurt each other. And if there were no knives? They would throw rocks. No rocks? They'd use their fists. It is perfectly possible to kill someone using your bare hands, no weapons required. If these kids hadn't had access to guns, they would have found something else to retaliate with.

    The real solution, the real and only truly lasting solution, is to remove the URGE to kill. Video games, no matter how violent they are, will never *CAUSE* someone to turn into a homicidal maniac. It would be just as valid to say "Well, all these kids who shoot people breathe oxygen; we need to remove oxygen from society to save the children!" Damn near every child in America has played video games; what percentage of them have then killed someone, too? I'll give you a hint: it's a DAMN small percentage. They kill because they were predisposed to killing, not because they played one too many games of Doom. They kill because they feel helpless to change things any other way. They kill because they have the Psychopath Gene. There are a thousand reasons someone might turn into a killer. Video games ain't one of them.

    Let's look at the example of Australia. They banned guns a year or two ago. Since then, what has happened? Violent homicides are up over 300%. Why? Because nobody can PROTECT themselves anymore. What if EVERY kid in Columbine High School had been armed that day? Those two boys wouldn't have lasted 5 seconds after pulling out shotguns; they'd have been plastered to the wall by 500 rounds of ammunition shot by every OTHER kid in the place. It's likely nobody ELSE would have died at all!

    Everyone says guns are "too accessible." There's no way to make them UNaccessible; if you ban them, there's always the black market. I say, guns aren't accessible enough. If every high school student was given a handgun and trained in how to use it, you would see a dramatic decline in school violence, bullying, and the general nastiness that kids indulge in. Throw a wolf into a flock of sheep and it'll gorge itself on defenseless flesh; give all the sheep guns, and the wolf doesn't stand a chance.

    Think about it.


    "The best weapon of a dictatorship is secrecy, but the best weapon of a democracy should be the weapon of openness."
    --

  59. Re:the real reason for Columbine by phee · · Score: 1

    AMEN!

    It's very gratifying to see there are others out there with a clue. I was beginning to think I was the only one who realized that as soon as guns are outlawed and only outlaws have guns, the outlaws will be our only defense against the government corruption that has been running rampant in America almost since its inception.

    History lesson: Hitler gains power in Germany and immediately disarms the population. How could the Jews defend themselves then?

    People who say things like "Oh, the Second Amendment was only put there so people could hunt for food" are clueless morons. Hunting for your dinner with a rifle was a given back then... if you didn't shoot things, you didn't eat. The entire purpose of the Second Amendment was to ensure that the population would always be able to defend itself against all enemies, FOREIGN OR DOMESTIC. A "domestic enemy" is one that attacks you from within... i.e., the government itself. And we, my friends, have been under attack for centuries.

    Wake up, people. Stop believing everything you see on CNN. Let me give you an example: Elian Gonzalez. I saw, live, that pre-dawn raid on the home he was in. I agree that they should have returned him to his father, but not the way they did it. They went in and waved M-16's at everyone, grabbed the kid at gunpoint, and then on their way out, they sprayed everyone in the place with pepper spray and tear gas. You didn't see THAT on the reruns, did you? It only appeared on the LIVE footage and they never mentioned gas or sprays again... but they damn sure showed all the people that were in that house weeping their asses off, trying to give us the impression that they were just upset. Now, if CNN can twist the truth around like that in a case this simple, what's to prevent them from inventing the truth whenever it suits them?

    Oh, still don't believe me? How about another example? Remember the Oklahoma City bombing? Sure, who doesn't? But how many people besides me saw it WHILE it was happening? That's the only time you can catch glimpses of the truth. EVERY eyewitness they interviewed said there were TWO blasts, two distinct and separate explosions separated by almost one second. And as if that wasn't enough, CNN itself was reporting that in addition to the truck bomb out in front of the place, they had found FOUR unexploded bombs strapped to the remaining support pillars in the basement! In other words, that truck bomb was a diversion, and the real damage had been done from WITHIN. If you look at the blast damage from just afterwards, it's VERY obvious that that building blew up From The Inside Out. Speculation continues as to what REALLY happened that day and who was really responsible. I'm sure Timothy McVeigh had something to do with it, but (just like Oswald) he and Terry McNichol were patsies. Ask yourselves, also, why they were in such a hurry to bulldoze the place and permanently destroy ALL evidence about anything that happened there? Their pitiful excuses of "It's to minimize everyone's bereavement; out of sight, out of mind" was just that -- a pitiful excuse.

    My point? Never believe anything CNN tells you, including "Gun control is the answer to violence! Save the children -- Gun Control Now!" If you ever want to get something banned, just claim (whether true or not) that it threatens children, and if enough people hear and believe it, they'll clamor for its banning until the legislative bodies in question have no choice but to do so or be thrown out of office.

    It wouldn't surprise me one bit if the US government was behind every assassination, every terrorist bombing, every school/church/nursing home shooting, and every other sneaky bit of nastiness in recent history. Not One Bit. Everything that's happened since about 1900 has seemed to be leading towards the government and/or Big Business being in control of All Things. How many of you knew that the US Constitution specifically says, in the Tenth Amendment, "The powers not delegated to the United States by the Constitution, nor prohibited by it to the States, are reserved to the States respectively, or to the people"? Do you know what that means? That means that the STATES in the US are supposed to have more power than the federal government, and should be allowed to decide for themselves all things that aren't *specifically* granted to the Federal government in the constitution. Have you EVER seen the federal government exhibit that behavior? Nooooo. What they do is say "Okay; if you don't enact such-and-such a law, we'll cut off funding for, say, your highways." This is coercion, plain and simple. The federal government is no better than the Mafia telling a shop owner "Yeah, ya needs to pay us 'insurance' to make sure nothin' bad happens to ya..."

    Go ahead. Call me a nut. They called Galileo a nut for saying the earth rotates around the sun. They called Columbus a nut for saying the earth was round. They called Louis Pasteur a nut for saying diseases were caused by tiny little invisible creatures that got inside your cells and did bad things. They called Orville and Wilbur Wright nuts for attempting to fly. They called Ben Franklin nuts for flying kites in lightning storms. But no matter how outrageous the claims, they were all right, weren't they?

    In case anyone still doubts the opinions of the Founding Fathers and what they had in mind when they wrote the Constitution (and especially with regard to gun control), here's a quote from a letter Thomas Jefferson wrote to William Smith on the subject:

    "What country before ever existed a century & half without a rebellion? And what country can preserve its liberties if their rulers are not warned from time to time that their people preserve the spirit of resistance? Let them take arms. The remedy is to set them right as to facts, pardon & pacify them. What signify a few lives lost in a century or two? The tree of liberty must be refreshed from time to time with the blood of patriots & tyrants. It is its natural manure."

    (You can find the whole letter here if you're interested.

    Read that quote over and over and over until you understand it completely, and realize what he was saying. We have lost the "spirit of resistance." Our rulers believe us to be the sheep we are, and are taking advantage of it Right Now. Not a day goes by anymore that they don't take away one liberty or another from us, because we LET them take them away. Do we have the courage to "set them right as to facts, pardon and pacify them"? Thomas Jefferson knew the truth. The rest of the founding fathers knew the truth too. But somewhere between then and now, something happened and everyone forgot history... so now, we're repeating it, presumably until we get it right.

    Let's get it right this time, people... Think Of The Children! :-)


    "The best weapon of a dictatorship is secrecy, but the best weapon of a democracy should be the weapon of openness."
    --

  60. Re:the real reason for Columbine by phee · · Score: 1

    Where'd you get the idea I said Elian's family should have used guns? As for "he should have been taken," he should have... his mother kidnapped him and transported him across the border to another country; the fact that she unfortunately died in the process doesn't change that. If an American mother had taken her child from its father and transported him across even state lines, she'd be a wanted fugitive; soon as she was caught, the child would be returned to its father. How is this any different? Because he's a cute little 5 year old Cuban boy? Please. I was criticizing the raid on their house not on the basis that they should have let the family keep him; it was on the basis that they went in and pepper-sprayed and tear-gassed everyone in the place with no reason. I'm surprised they didn't arrest them all on the spot, but there definitely was no need for chemical spraying; it's just highly demonstrative of the attitude prevalent in the government's enforcement agencies these days: "Rights? You have no rights."

    And on to OK City. Read again the things I mentioned about that incident. Explosive devices found in the basement (the ones that *didn't* go off); history records "there was just one bomb in the truck," and that has become "truth" in spite of the fact that people have videotaped news reports stating otherwise. Eyewitnesses insisting there were two explosions close together, not just one as history now records as the "truth" -- also in direct contradiction to videotaped eyewitness testimony. The clear evidence of an outward explosion from within the building (just look at any photograph of the place). Their insistence that the whole building, chock-full of hard evidence, was bulldozed over before anything even approaching a full investigation was done. To me, the evidence that I have seen with my own eyes contradicts and makes impossible everything the government claimed in all of its statements about the event, whether via spokesperson on TV, or in a court of law under oath. But that's hardly surprising, I suppose; if Clinton can get away with perjury, they sure can...

    And I don't carry a gun. But random strangers bent on mugging, harming, raping, or killing me don't know that. And if people carrying guns was the norm in this society, they would more than likely keep not knowing that... because they would be far less likely to tempt fate and find out for sure.


    "The best weapon of a dictatorship is secrecy, but the best weapon of a democracy should be the weapon of openness."
    --

  61. Re:Well, Duh! by Wah · · Score: 1

    From the Japanese/American angle.

    It seems to me, like you said, the J tend towards one on one style human confrontation, from Bruce Lee to Goku to Street Fighter (the game not the movie, although I guess you could argue either). A's tend to go for the One Man VS The World scenario, from John Wayne to Rambo/Commando to Quake.

    America is a violent culture, but I think that's more a reflection of the highly competitive social structure than anything else. One thing the article doesn't (unsurprisingly) cover, is the cathartic nature of violent games. If I'm pissed at something, a good 20 minute Quake session tends to provide a positive (or at least neutral) outlet for that agression. At least the people I'm trying to blow to bits (pun) are trying to do the same to me.

    --

    --
    +&x
  62. Re:Well, Duh! by functor · · Score: 1

    Many social psychological studies show catharsis not to be effective, i.e., the popular perception of aggression through games as being 'venting' is actually untrue. It only serves to reduce the effectiveness of the barrier to violent acts.

  63. People do seem to have an agenda... by tommyk · · Score: 1

    I'm sorry, but if you look at the top page (/) for this site, the blurb all but says they have proven there is a causal link between video games and long term violence.

    The rest of the paper dances around the subject, but they imply that "pac man" might be a violent game. I mean, let's get real...

    Sometimes it's easy to forget scientists are humans, but what they have here is a blatant attempt to grab attention with a half baked study. It's research at it's worst, trying to grab headlines and have lots of blurbs that will play in the media so they can get funding.

    Sorry, but that's how I see it. There is no good here, they've trivialized their own research, I now doubt their intentions in publishing this. Not to mention, their methods are clearly flawed in the second study mentioned. Gee, people who are violent tend to gravitate to violent games and people who play lots of video games tend to have lower GPAs than people that don't.

    Duh. I could say the same for football. Lower GPAs than average and a higher tendency to violence. What does that prove? I mean, maybe it's a start, but in a real paper, it would be a footnote. I don't believe taking away people's footballs would reduce violence in the world. That's how some people are.

    Well, partly, of course if you ask me, almost all of this goes back to the parents. I mean, how are these kids getting and keeping aresenals that some revolutionary splinter groups can only dream of in their bedrooms? What we have is too many cheap guns, and as a society we fail to take this stuff seriously and actually act on it.

    You know why Columbine happened? Because the first time those kids acted out in a violent fashion, they were given a stern talking to instead of being expelled. That's what's changed between 1950 and 2000, not the kids, not human nature: access to assault weapons, and a system that no longer is willing to deal with violence swiftly, and if I may say, aggressively.

    Sorry, the fact that the APA published this as a major breakthrough on their site just proves they have low standards, and are publicity hounds. What garbage.

  64. Re:Studies show religion increases violent behavio by Score+Whore · · Score: 1

    Offtopic alert.

    No, atheists do not have blind faith. They just make the decision not to believe without some kind of evidence. It's not a matter of choosing to believe something, it's a matter of not believing something. Saying you don't know one way or another is merely philosophical pandering and basically the argument that we can't "prove" anything. What makes a supreme being so special that you are willing to believe other things without "proof" and yet the jury is still out on god? I mean, look at gravity. There is no "proof" and yet believing in gravity is not considered a matter of faith. And just like in science, being an atheist doesn't preclude the possibility of changing your mind in the face of new evidence.

    Have a good day. :)

  65. Re:Deflecting Blame by Score+Whore · · Score: 1

    Right on. It's important to realize that any single influence that is magnified and focused will have a detrimental effect on a person's psyche. It doesn't matter what it is you will end up with personality abberations. Watching Power Puff girls or Sailor Moon 24/7 will screw you up. Saying in a general sense that video games cause violence/aggression is complete hogwash.

  66. Re:Um, the father had ALREADY lost custody of Elia by Score+Whore · · Score: 1

    It doesn't matter what her last wish was. When she died Elian's father becoma the child's guardian. Custody isn't a physical item that is passed along like a family heirloom.

    It has nothing to do with where Elian should grow up. It has everything to do with whether the government should be deciding on arbitrary terms whether a family should be together or not. Do you want the government to go around to each house and say, "Welp, you don't make $75,000 a year so we're taking your kids." Or "Gosh, you drive a Volkswagon, we're taking your kids." Or "Sorry you're Methodist, we're taking your kids." Or "Dang, you voted Independant, say goodbye to your kids." It's one thing to protect a child who is being abused. It's another to break up a family for political reasons.

    Finally, you do realize that the major problems in Cuba right now are not the fault of the Cuban government. It's the fault of the US's policy towards Cuba. The revolution was welcomed by the populace of the country. In general people like living there.

  67. Re:Not a surprise. by Score+Whore · · Score: 1

    What about effects? Doing a proper controlled scientific study will not show you whether having a gun/knife/videogame/bouqette(sp?) is right or wrong. Right and wrong are not scientific truths. Such a study would only show that there was an effect. In this case I'm willing to say that this person's father learned to respect, control, take care of, etc. his gun. Merely having a gun or playing a video game doesn't turn you into a serial killer or mass murderer.

  68. Re:A very good point! by Score+Whore · · Score: 1

    You realize that the constitution doesn't say hunting rifles, handguns, or shotguns. It says arms. Which means that constitutionally I should be able to have a 1000 round/min machine gun if I wanted to. Unfortunately the supreme court is in many ways the tool of the administration and often interprets the constitution in ways that the original founders didn't intend.

    It should be obvious that if the framers of the consitution expected people to need guns to defend against a corrupt government, they wouldn't say "you can have a little gun, but the big guns are the sole domain of the government." They would obviously expect that you have a weapon that would actually be of use.

    And actually yes, a hunting rifle is rather practical when it comes to shooting people. Not to mention that an armed revolution these days would almost certainly involve local regiments of the national guard siding with the populace. How many husbands, sons and brothers will abandon or even arrest their families.

  69. Re:Studies show religion increases violent behavio by Score+Whore · · Score: 1

    That's not proof. That's just what you've observed. You can't possibly prove that every single time someone jumps off a building they will notice soon enough. It's the philosophical argument that nothing can really be proven.

  70. Re:Off- Topic by Score+Whore · · Score: 1

    So you like, asked those beans if they wanted to die? You brush your teeth this morning? What about all those poor germs you killed? Murderer! Do you wash your dishes in hot water? Boil your food? Murderer! What's so fucking special about a nervous system that it makes something to special to kill? Come one, give one logical argument that isn't based on emotion that shows that plants are better to eat than animals.

    Responsible hunting is certainly better than no hunting. Ever learn about natural processes of controlling populations? The enviroment certainly is healthier if a certain number of animals of all species are killed. It's purely natural you weenie.

  71. Re:Look at this study for what it is... by Score+Whore · · Score: 1

    Personally, I'm afraid of psychologists.


    Which is why the Arizone legislature passed a law several years ago requiring psychologists in court rooms to wear pointy hats and robes with stars and moons on them. Also they had to have a long beard. And whenever they had a specific point to make they had to punctuate it by gesticulating with a wand. Unfortunately the damned governer vetoed it. The bastard.

    Truth.

  72. Re:Time to ban the Football team... by Score+Whore · · Score: 1

    He wasn't found guilty because it turned into a circus rather than a trial.

  73. Re:Missing the point by Score+Whore · · Score: 1

    Also, I play Quake 3 with my son. We play capture the flag and are usually on the same team. I run and he blocks. We work together and feel a real sense of accomplishment when we trounce another team.

    Good fucking man! Or woman. This is probably the most important comment in this whole thread so far. Wish I had moderator points for you.

  74. Re:Well, Duh! by Score+Whore · · Score: 1

    Our brains are neural networks, which learn by patterning and repetition.

    Neural networks are a simulation of a theory. There's a lot more to the human mind that mere pathways, patterning and repetition.

  75. Re:Well, Duh! by Score+Whore · · Score: 1

    Or do you really think real life is like Kingpin...

    You'd be surprised. People can be very depraved.

  76. Re:Studies show religion increases violent behavio by Pont · · Score: 1

    I, and I'm sure many otheres out there, take offense at you calling the swastika a "satanic, or rather pagan" symbol.

    First of all, the Nazi symbol is a swastika going counter-clockwise. The original swastika generally, but not always, goes clockwise.

    The swastika is an ancient symbol used by many peace-loving religions in India.

  77. Could it have been done better? by Dexx · · Score: 1

    From what I've read, most of the posts are pointing out the problems with this study.
    I'm just curious:
    Is it possible to design a better study?
    If so, how?
    Is there anybody out there willing to do so?

    Just idle early-morning musings from a guy with not enough sleep.

    -Dexx

    --
    Feel the fear and do it anyway.
  78. I bette rbe careful then.. by Junta · · Score: 1

    Around my place of work, when people are between large projects, typically most of us get on our workstation, load up quake, and go at it. Evidentally this means that we will likely end up mounting machine guns in our cubicles and lobbing grenades over the walls. I think this is simply people going with what the public wants to believe, that something is to blame . Myself, I love getting in on these games occasionally, but I've always been known as/felt about as mild mannered as people get in real life. Everyone says I'm kind and accomadating and considerate, and I personally feel no malice, even with people who are not exactly the most agreeable in the world. People in fact complain that I'm so passive it gets annoying. The most violent people I know never play computer games at all. The study may have discovered a correlation between violent video games and violent behavior (which in and of itself can be questionable) but did they actually figure out which one was the cause and which was the effect?

    --
    XML is like violence. If it doesn't solve the problem, use more.
  79. Re:A very good point! by infodragon · · Score: 1

    Ever heard of the Michigan Militia or any other militia organizations?

    Most of the serious members are trained! I don't belong to any of them but I do know the leader of the Michigan Militia. He is a retired general of the US army. In fact I bought an AR-15 from him. Gee that M-16 ammo will work quit nicely in my AR-15 and gee all the ammo we got from the last raid also came with guns which we picked up. Boy all those retired military types who are part of the militias do know how to drive a tank they know how to fly the helicopter. Boy you now have the same knowledge as the US military but in very small groups who are very hard to hunt down because they are small and more mobile than the US army. Kinda like the Vietcong during the Vietnam war. Guerillas in the trees were how successful? How many American lives were lost? Now they were defeated because of the intense bombing raids. Would the US military bomb American soil effectively destroying their support?

    A little forethought would have stopped you from your post. When you find 7.62mm ammo from a raid usually there is a matching gun that can be used with it. Again these are tactics of Guerilla Warfare!

    --
    If at first you don't succeed, skydiving is not for you.
  80. Re:Video Games ain't the only thing then... by Malvolio · · Score: 1
    anyone know _any_ karate student without _any_ ego or tendency to violence? - personal experience here
    I've studied karate for several years, and many of my friends study karate or some other martial art. None of them have any tendencies to violence, and none of them are arrogant or boastful of their skills.
  81. Study for Everything... by Diamond+Slicer · · Score: 1

    Studies can be used for anything. If I wanted I could do a study that would prove that video games are a great way to relax and release tension. The study also could be taken to say instead of:

    "We found that students who reported playing more violent video games in junior and (senior) high school engaged in more aggressive behavior"

    to

    "We found that students who were more aggressive in junior and senior high engaged in playing more violent video games"

    Studies like this prove something - but what is hotly debated. All I know is - I play Quake I,II,and III, and I am probably one of the most non-aggressive people on the planet - being a undertall lightweight programmer (meaning I avoid fights as much as possible - however I still get revenge).

    Oh well - another day another study - another condemnation...

    --
    Is it progress if a cannibal uses a fork?
  82. Weasel Words by csbruce · · Score: 1

    Slashdot Title: Studies Say Video Games Increase Violent Behavior

    "The studies show a relationship between violent and aggressive behavior and video game playing."

    It has already been pointed out that this study is about a correlation between video-game playing and violent behaviour. However, the media's need to sell advertising (and Slashdot's too??) will probably result in article titles like the Slashdot title above, and John Q. Public will be duped again by weasel words and false reporting. (Not that JQP is all that bright in the first place if he is suckered in by this stuff.)

    People with violent-behaviour problems probably also have attention-deficit/impulse-control problems and probably order out for pizza at a statisitically significantly higher rate since they don't have the patience to make their own meals. Therefore, eating pizza causes violent behaviour and PIZZA MUST BE BANNED IN ORDER TO PROTECT THE CHILDREN!!

    "New studies show that 100% of all smokers die."

  83. Re:Columbine by nullset · · Score: 1

    > Study reeks of Columbine backlash.

    You didn't read the actual article did you? The very first paragraph speaks of Columbine.....

  84. This "study" is infallible!!! by Loopy · · Score: 1

    Now, in case you don't want to read all this gobbledygook, I'll distill it down for ya. The study opens with the abstract. The next paragraph starts with, "On April 20, 1999, Eric Harris and Dylan Klebold launched an assault on Columbine High School in Littleton, Colorado, murdering 13 and wounding 23 before turning the guns on themselves." Can you say, "bandwagon psychology" boys and girls? I knew you could. Strike one for the pundits.

    A couple of sentences later we see, "Harris and Klebold enjoyed playing the bloody, shoot-'em-up video game Doom, a game licensed by the U.S. military to train soldiers to effectively kill." Do these people ever stop? OK, I've played the U.S. Marine modified version of DOOM and it doesn't train marines to kill. What it does is train them in what is called fire discipline. By that I mean that it trains them to use less ammo (because if you run out before your enemy does, you're dead) and it trains them to not shoot their fellow marines in the back. It also teaches them to employ fields of fire--everyone is assigned an arc of fire so they don't shoot the same targets and waste ammo. Also, the kludgy interface (relative to the human body) teaches the marine to slow down and take aim rather than just blast away and to wait until the enemy is closer before opening fire. Granted these are skills needed to effectively killeth thine enemy, but the characterization is that DOOM makes U.S. Marines stone killers. I'm laughing pretty hard right now...feel free to laugh yourself. Stike two.

    A couple of paragraphs later, we read, "The research to date on video game effects is sparse and weak in a number of ways. Indeed, one reviewer (and many video game creators) has espoused the belief that "video game playing may be a useful means of coping with pent-up and aggressive energies" ( Emes, 1997, p. 413). In brief, what is needed is basic theory-guided research on the effects of playing violent video games." So, there isn't really any definitive research on how games affect aggression? Wow, that's nice of them to tell us this. Basically, we don't need to read any more because everything below this line is theoretical (read: guesswork by someone with a Piled higher and Deeper degree). Strike three.

    Next, according to the report, the data obtained on each subject's prior/current 'hostility factor' was done through an APA questionnaire. As a typical subject might respond, "Gee, I'm sure to put down all the times I thumbed my nose at the teacher or told my boss to kiss off behind his back. Yep, I'm going to be totally honest about my own aggressive tendencies, especially since I'm 12-16 years old and am already sooo trusting of adults in general. Not to mention the fact that I'm going through puberty and am hormonally imbalanced and generally pissed at the world. Sure, I'm going to tell you something that might get me put in a special school or mandatory psychiatric counseling. Yep. Oh, and by the way, I have a bridge in Brooklyn that just went on the market. I'll make you a great deal." *smirk* Strike four.

    Lastly, if they are going to test something for violent content, why pick something like Wolfenstein 3D? Why not pick something like Quake 3 or Team Fortress Quake? Or even better, why not use Blood 2??? I mean, wouldn't it be a better study to use a game in which the lead character (which you're playing first-person) makes wisecracks after reducing some poor sap to little bits that might not fit on a toothbrush? Oh, wait--Blood 2 wasn't that popular so it wouldn't make a case against the psychological decline of modern society. I could just as easily argue that Nascar Racing or Demolition Derby or California Racing games cause people to experience higher levels of road rage, couldn't I? Oh, but geeks are the problem, not rednecks. And rednecks aren't a threat to anyone; we're here about geeks, right? Right?!?



    Loopus Maximus

  85. Re:The problem with this study by SlydeRule · · Score: 1
    that it doesn't really control for the affects of physiological arousal.

    But they did. From report for study #2:

    These two games did not produce differences in systolic blood pressure, diastolic blood pressure, heart rate, or mean arterial pressure (all ps > .3).

    It may be that Myst is just as exciting as Wolfenstein 3D

    There's a difference between exciting and physiologically arousing, and this didn't escape the researchers:

    However, Wolfenstein 3D was rated as more exciting than Myst (Ms = 4.81 and 3.40, respectively), F(1, 27) = 10.46, p .13.

    And:

    A 2 (game type) × 2 (gender) × 2 (trait irritability) between-subjects analysis of variance (ANOVA) was performed with State Hostility as the dependent variable and with Game Excitement as a covariate.

    And:

    A 2 (game type) × 2 (gender) × 2 (trait irritability) between-subjects ANOVA was performed on Aggression Accessibility with Game Excitement as a covariate.

    And:

    In Study 2, games were selected to create equal arousal states as measured by heart rate and blood pressure. Furthermore, excitement ratings were used as a covariate to further ensure that this route was closed off in this investigation.
  86. Re:A very good point! by Firinne · · Score: 1

    guns teach kids responsibility.

    Parents teach kids responsibility. Guns are just an object lesson. If the parents aren't willing to teach kids to act responsibly, no amount of guns (or the absence of same) is going to do it. Similarly, if the parents are willing to teach kids to act responsibly, a kid can play all the video games and own all the guns he wants, he isn't going to do anything violent.

    --
    -- "God, Root, what is difference?" - Pitr, "User Friendly"
  87. Worldwide mass murders! by Reziac · · Score: 1

    Yesterday 26 million DOOM players went on a rampage and killed the entire population of planet Earth!! Researchers now find that playing DOOM confers immunity to being killed in a mass murder!!

    --
    ~REZ~ #43301. Who'd fake being me anyway?
  88. yeah but . . . by Snoobs · · Score: 1

    I can ellectrocute you if you try anything funny. Remember Dahlsim was the worst carracter in SFII (fun to get good at and beat people with though).

    ...all at the touch of a button (quick punch if I recall)

  89. slow down there, cowboy! by zzzeek · · Score: 1

    What a violent reaction....maybe you should cut down on the quake!

  90. The Three Stooges...next by jazman_777 · · Score: 1

    After watching 3 hours of Three Stooges, I wanted to poke my fingers in a friend's eyes. Fortunately, he also watched, and put his hand up to his face, defeating my move. Nyuk nyuk nyuk!

    --
    Slashdot: Failed Car Analogies. Amateur Lawyering. Anecdote Battles.
  91. any studies looking for the reverse? by skimmer · · Score: 1

    The opposite seems true in my opinion. If anything, video games allow inherently violent people to 'get it out of their system' so to speak. I knew many kids like this growing up --if they destroy something up on a tv screen they'd look around for something real to destroy instead.

    1. Re:any studies looking for the reverse? by ludwig · · Score: 1

      Actually the authors of this study unintentionally provide evidence for the "catharsis hypothesis". Note that *women* generally delivered longer noise blasts than men. The authors are a bit surprised at this, and muse that maybe it's because they're "less familiar with video games". Of course, wanting to prove what they want to prove, they don't follow up the obvious implication, which is that people who play more videogames become less aggressive thanks to having vented more of their natural frustration with life.

  92. Re:I am passive by JakusMinimus · · Score: 1

    Couldn't have said it better myself!
    My wife and I are both pacifists (although she DOES have a biting problem ...) but I love to play Q3A until the wee hours. Add in the fact that my wife isn't particularly impressed with the concept and playing style of quake and I get this great quote,

    "I just can't see how a pacifist can enjoy a game like quake."

    And I told her, after having a good laugh, that if I do have any violent tendencies (I don't, the worst I get is "frothing-at-the-mouth-angry" and feel compelled to hit inanimate objects), this is the perfect outlet to rid myself of them. There is something to be said for pumping three rails in-a-row into some chump with armor and 200 health and then sprinting to the next frag through the ensuing pretty, red mist. =)

    --

    --

    You can be an atheist and still not want to succumb to some weird cross-over sheep disease -- AC
  93. Look, it's true, deal with it. by stienman · · Score: 1

    Anyone who honestly believes that violent games don't encourage violent tendencies is lying to themselves.

    But one cannot say that video games alone are what is causing people to murder other people. It takes years of careless crafting by unloving parents to create a real killer. I suppose some people are more disposed to violence than others. In that case the video game can be the straw that breaks the camel's back, but the real problem in this society is that parents are not raising their children well.

    See more of my views here: Who is Raising Our Children?

    -Adam

    What's done to children, they will do to society.

  94. Re:Yet Another Study.. by stienman · · Score: 1

    I would be interested in finding out why you believe that violence among youth is at its lowest since the depression?

    It appears that the worst problems schools had to face in the 1940s were talking out of turn, chewing gum, etc. Now the worst problems are rape, drugs, etc.

    -Adam

    Creed of the Engineer:
    Measure with micrometer,
    mark with chalk,
    cut with axe,
    hammer to fit,
    paint to match...

  95. Re:No Slashdot, NO! by ronfar · · Score: 1
    Ok, but wouldn't it be better if violent people didn't have the benefit of simulator training before they went on actual killing sprees?
    Heavily armed, violent sociopaths do not need simulator training to murder unarmed, defenseless people. All they need to be able to do is point their guns in the direction of a group of people and pull the trigger. It doesn't require skill or marksmanship, just access to decent weaponry and the desire to use it.

    Quite aside from that, the New York Times article mentioned in this post, points out that the vast majority of rampage killers do not have an interest in video games. Recently, I heard a story of a 60 year old guy who shot up his neighborhood association, he killed two people and injured other. I'm am absolutely sure he never touched a video game in his life, but he did have a history of violent, anti-social behavior.

    You can continue to push snake oil at people if you like, but only fools and the APA will be buying. I just hope the fools don't out number the intelligent people.

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  96. Re:Several worrying aspects in the Paper by ronfar · · Score: 1
    Oh, the BBC has already picked up on it, if you want to read their take on it:

    Video games 'increase aggression'

    However, to be fair, the U.S. already has insane-military-guy-who-wrote-a-book in all the reactionary venues, so this is just going to bolster up his arguments (bad, but he was already here.).

    I don't know if you remember the anti-video game AD campaigns that the Church of England ran a while back, now they were scary...

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  97. Re:The experts have an opinion, or three by ronfar · · Score: 1
    Let me tell you, the last level on System Shock II is hard. I'm up to the Rickenbacher but I can't get past it.

    Oh well:

    Iä, Iä, SHODAN Phtagn!!!

    Sigh, just have to wait for SHODAN to get here, she'll purge the world of non-believers...

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  98. A few comments by Broccolist · · Score: 1

    First, _of course_ people playing wolf3d would be more aggressive than people playing Myst. I would say it's due to the boredom-inducing effect of Myst rather than the violence of wolf3d. Personally, after 15 minutes of Myst I'd be sound asleep :).
    Second, as others have mentioned, there's nothing in their study to show that it's the violence and not the competitive behavior that causes agressiveness. I get pumped up much more after a 1on1 of Tetris Attack than of Doom (because you don't lose in doom, you just get behind a frag and reappear).

    Third, they mentioned they lost the data for 3 people due to "computer failure". It kind of lowers the credibility of their study that they were probably running '95 for their test programs :).

    But nevertheless I'd say they have a point. I enjoy killing scientists in Half-Life as much as the next guy, but is it really necessary to have actual physical violence in order to have a good game? Not really. Imho, the only reason non-violent games are generally less fun than violent ones is because all the good developers spend their time on the latter, and so the "genre" has evolved much more. I think if they went back to abstract video games en masse, there would be a wealth of new styles, parents would have nothing to complain about, and we'd all be better off for it.

    I'm not saying everyone should start spouting out stuff as boring as Myst, though. But it's possible to have something as fun as Quake, minus the guns.

  99. John Carmack to release INS:DaiAssaultRifle! by Cmdr+Taco · · Score: 1
    SANTA CRUZ, CA (UPI) - 24 Apr 2000 - Jon Carmack, best known for first person shooter games like Doom, Quake, and the recently released Daikatana, is announcing a soon to be released game based on the frog outfitted shock trooper style raids carried out by the INS upon the orders of Der Fuhrer Janet Reno under Dark Emperor Slick Willie, entitled INS:DaiAssaultRifle.

    The game casts the player as an INS agent who must successfully travel from Wachington D.C. to Maimi, FL, without attracting the attention of the omnipresent media. Once in FL, the player must navigate, fight, and get past the roving bands of angry protesters on the street and the random fires and rock/bottle attacks. Timing and strategy are critical if the player is to avoid the promised "human chain" from forming around Elian's house which is said to be impenetrable. Once there, the player must render unconscious several protestors with the butt of his automatic weapon, gas many unarmed women and children, and then enter the house causing as much collateral damage as possible on the quest to hunt down Elian like a dog (don't believe the promises that "no resistance will be offered by the family if agents come to take Elian"!). Extra points are earned for making people scream, panic and for making Elian cry. Other points are earned based on time to capture Elian (quicker is better), number of protesters beat up (more is better) and for duping the public into supporting your heinous actions by releasing poll after poll to CNN that proclaims that "68% of the American people support the forced siezure of Elian". The game is slated for release in early May and carries an ESRB rating of E (Everyone) because if none this stressed the real Elian and their family, then surely it won't bother anyone else.

    1. Re:John Carmack to release INS:DaiAssaultRifle! by Chiasmus_ · · Score: 1

      Yeah, I'm pretty sick of hearing about him, too.

      In fact, I'd like to run him over with a semi... and then mow down every journalist keeping the story alive with a machine gun... and then hit that 21-year-old Cuban chick with braces with a flamethrower.

      Anyway, Slashdot's boring. I'm going to play Grand Theft Auto 2 for a couple more hours.

      --
      "Beware he who would deny you access to information, for in his heart he deems himself your master."
  100. Studies, schmudies. by TheTomcat · · Score: 1

    There are studies for everything now. Some make sense, some don't. A study to see if a certain percentage of people feel that the ending of a film was stupid and needs to be changed makes sense. A study to see if people like the new NBC lineup makes sense. A study linking video games to real life doesn't make sense.

    I'm a firm believer that if you try hard enough, spend enough money, and have the 'blessing' of the right people, you can prove ANYTHING through obscure statistics.

    I'm getting screwed on my car insurance. Why? Because I'm a male, and I'm 20 years old. My monthly insurance payment is only a little less than my monthly lease payment. I pay around $250/month for insurance. My driving record is spotless. I have (female) friends my age who've caused accidents who pay a lot less than I do (studies and statistics prove that in my age category, males get into more accidents than females.

    Makes sense, right? Well, what if a study was conducted to see if black people get in more accidents than white people. Or homosexuals in more accidents than hetrosexuals?

    Well, that would be just WRONG/prejudiced/racist, wouldn't it?

    I've learned to take 'scientific' studies with a big grain of salt.

  101. Which article did you read? by Illserve · · Score: 1

    As far as I can tell, they did find an effect: >Most importantly, participants who had played >Wolfenstein 3D delivered significantly longer >noise blasts after lose trials than those who >had played the nonviolent game Myst (M s = 6.81 >and 6.65), F(1, 187) = 4.82, p .05, MSE = .27. Now don't get me wrong, I disagree with the idea that video games are Bad with a capital B. People will do as they will do. But as far as I can tell, their study did find an effect. -Illserve

  102. Stat Significance of Violent Game Study by spank · · Score: 1

    For me, the biggest issue of the study was that it was (as I read it) significant at the .05 level - there is a 95% chance that the study is "true." While statistically significant, I would put more value to the study if hit at the .01 level - a 99% chance that the study is "true."

  103. "Violent" to Begin With? by akiy · · Score: 1

    Who's to say that the people who are drawn to violent games weren't/aren't "violent" to begin with?

    --

    --
    http://www.aikiweb.com - AikiWeb Aikido Information

  104. Fuck Mind-Quacks! by tilleyrw · · Score: 1
    Screw them all! How dare they say that playing Unreal Tournament is bad.

    Fuck 'em!

    Look at all the skills I've acquired. My trigger finger is faster than anyone! What about the intense pleasure I feel when my opponent goes up in a fountain of blood!

    Fuck the MAN! Anarchy ru13z.

    --
    This post encoded with ROT26. If you can read it, you've violated the DMCA. Handcuffs please, sergeant.
    1. Re:Fuck Mind-Quacks! by Ig0r · · Score: 1

      Heh, UT and Q3 *are* bad.
      Oldschool Quake 1 is still the best :P

      --

      --
      Soma: because a gramme is better than a damn.
  105. Re:A very good point! by Field+Marshall+Stack · · Score: 1

    The traditional tactic for supressing rebellion is to assign military units to areas as far away from their hometowns as possible. So presumably if there was an armed rebellion in the US, soldiers from Seattle would be machine-gunning citizens from Florida, New York national guard units would be machine-gunning Californians, and so on. Very few soldiers would be ordered to kill anyone they actually knew.
    --
    "HORSE."

    --
    "HORSE."
    -Flaming Carrot
  106. Studies on other types of games? by Snoochie+Bootchie · · Score: 1

    I wonder if any studies have been done on a connection between playing violent sports and violent behavior. This would seem obvious (look at all the off-field criminal activity in football). However, the question we return to is: does the game cause people who would otherwise be non-violet to be violet personality types? Or, is it just that violent people are drawn to the game? Not all football players are violent off the field. I have never heard any study or media outlet talk about parental ratings for sports or whether a child should be allowed to watch such sports. If people think games like Quake cause problems, why do they not also mention a sport like football (a sport which I happen to like)? Why did the people who sued iD over the school shooting also sue the NFL? NHL?

    1. Re:Studies on other types of games? by Kris_J · · Score: 2
      I wonder if any studies have been done on a connection between playing violent sports and violent behavior
      Thank You!

      In everything from soccer hooliganism (sp?), to Aussie-rules players being charged with assault and rape, violence surrounds traditional sport - probably more so than computer games, yet no-one bats an eyelid.

      I can tell you why we don't see studies theorising that football promotes violence - it's because it's popular, and anyone that speaks out against it is publicly hanged (hopefully more metaphorically than physically, but it's getting iffy).

  107. Finding exactly the answer you were looking for by Zanguinar · · Score: 1

    I started reading the report, and it immediately opened up with a recollection of the Columbine High School shooting. While at first this study seemed interesting, I prefer to read unbiased scientific studies. If you go into a study and have already decided in your mind what the results will be, you will find a way to prove that it does turn out that way. Now, I am not going to completely deny that this correlation exists, but as so many before me have said, the study was not properly conducted, and a correlation does not necessarily imply a cause and effect.

  108. Re:Doom? Wolfinstien?? Mortal Kombat??? by Hnice · · Score: 1

    This is exactly what I said. I mean, it probably hurts my stand (that VGames aren't that bad for you, considering), since blowing a guy's head off now looks a lot more like blowing a guy's head off.

    Plus the mario brothers stuff was hysterical. sure, and chu chu rocket's a violent game, too, what with all them cats eatin the mice.

    --

    god is just pretend.

  109. Pokemon by Hnice · · Score: 1

    It would have been nice if they'd at least addressed the social impact of their assertions. How do we fit this study in with the fact that Pokemon games have held four or five of the top ten weekly sales spots for the last 18 months or so? Add in a sports game, Donkey Kong 64 (best selling game in us last year, accdng to Nintendo), and the great bulk of games being sold (not to college students, but to everyone) wind up being rather non-violent. I mean, look at these charts (from ign64.com, 2dec99):

    1. Pokemon Yellow, Nintendo, Game Boy
    2. NBA Live 2000, Electronic Arts, Playstation
    3. Pokemon Blue, Nintendo, Game Boy
    4. Pokemon Red, Nintendo, Game Boy
    5. Resident Evil 3: Nemesis, Capcom, Playstation
    6. WWF Wrestlemania 2000, THQ Inc, Nintendo 64
    7. Pokemon Pinball, Nintendo, Game Boy Color
    8. Pokemon Snap, Nintendo, Nintendo 64
    9. NBA 2K, Sega, Dreamcast
    10. Knockout Kings 2000, Electronic Arts, Playstation

    Where's doom? Where's Mortal Kombat? OK, resident evil is pretty f-ed up, but it's a flash in the pan compared to the *five* pokemons on there, most of which are still on the charts right now.

    Let's not overstate the dangers of video games. even if they're dangerous (which they're not) most of them are pokemon, or jet force gemini or ape escape or zelda, so who cares?

    --

    god is just pretend.

  110. Mortal Combat? by Hnice · · Score: 1

    I haven't gotten very far into the article, but they'd be carrying a lot more weight with me if they'd spelled Mortal Kombat correctly in the headline.....

    --

    god is just pretend.

  111. This is total BS... by Bedemus · · Score: 1

    ...and I'll kill anyone who says otherwise! :)

  112. Wolfenstein 3D vs Myst by xerx · · Score: 1

    The comparison of these 2 games is flawed, since the games differ in many ways other than just violence. The results may be the affect of an "action" game vs. a "non-action" game. They would have been better served to also use a non-violent action game like an auto-racing game vs. Wolfenstein 3D. Then use an auto-racing game vs. Myst, those results might be more meaningful.

  113. Re:Look at this study for what it is... by Rhys+Dyfrgi · · Score: 1

    There are two studies; the older one shows a long-term correlation between violence and violent video games. This new one shows that playing violent video games has a short term causatory effect on violence. There has not been any demonstration of long-term causation.

    It's also important to remember that the violence in this study is removed; it is not direct, there is no one harming anyone else physically.


    ---
    --
    END OF LINE
  114. Re:Look at this study for what it is... by DreamerDude · · Score: 1

    Is there anything wrong with this? Take someone who studies martial arts. A big part of that is to increase your own scripts for self defense. To be able to defend and counterattack with learned techniques without thinking. This is the entire point and there's nothing wrong with it.

    I guess If i get into a violent situation, i can hold my hands in the air in front of me, and wiggle my thumbs up and down.

  115. Re:The Quote... by daala · · Score: 1

    You are totally right. The right and wrong of any issue are moralistic statements therefore cannot usually be applied to inanimate objects.

    But you could say they do make LIFE-ENDING products!!!!!

    --
    "The way she used to say Rimmer as if it rhymed with scum" Red Dwarf
  116. Re:Look at this study for what it is... by Electric+Keet · · Score: 1

    Unfortunately, most peoples' faith in the APA is so great, that if they (the APA) even hint at a link between video games and violence, everyone is going to say "See, I told you. Ban the games, they're dangerous!"


    Come now, we can think more conspiratorially than this. Let's say a certain unnamed organization recently discussed at length here realized that tracking those playing these games would be, in effect, tracking those at high-risk for violent behaviour...



    And so they encouraged these games to be on the market, with large organized methods for the players to deathmatch...



    And then sit back and watch, let the kids play, and collect data to be sold to schools and other interested parties.



    I'm not saying it's been done, or that anyone on the other team is smart enough to do it, but don't assume these studies will mean the BANNING of these games.


    *grins like the Devil, having sown seeds of discord*


    --
    A digital picture is worth 0x01F4 dwords. - Jessie Tracer / Electric Keet
  117. Re:Studies show religion increases violent behavio by Anonymous+Colin · · Score: 1

    The Nazi swastika is NOT a satanic symbol. However, there is a satanic, or rather pagan, symbol very closely related to it. If you draw a swastika but reverse the direction that the ends of the arms go (sort of a mirror of the Nazi symbol) you generate this ancient symbol. What does this mean? Beats me.

  118. Re:Stupidity (To paraphrase Homer) by froz · · Score: 1

    One can find statistics to back just about anything

    35% of all people know that.

  119. Rebuttal by veldrane · · Score: 1

    I really don't need to delve on your opinions on murder and responsible hunting as I feel other responses did a very adequate job of introducing a new word to your vocabulary, "ecology."

    I am genuinely interested in your opinions on how we should handle some of these notorious 'murderers':
    For the sake of homogenity(sp?) I am assuming you view the death of fish as murder as well.

    Big cats (lions, tigers, et al)
    Wild dogs (including dingos, wolves, foxes, etc)
    Whales
    Sharks
    Bears
    Centipedes
    Birds of Prey (Eagles, osprey, falcons)
    Snakes & other reptiles

    How do you view these? Acceptable? Non-relevant? Part of nature?
    Should we start a crusade to have them wiped out?
    Or should we try and convert them to vegetarianism? (They kinda are...they eat vegetarians. ;)
    I can't imagine you have a bumper sticker that says, "Kill the Whales!" but I can only guess on that point.
    Humans are part of this ecosystem that is called Terra. Part of nature. As a species, we aren't herbivores nor are we carnivores. We're omnivores.
    You know, part of the "Circle of Life" and all that.
    As a rather nasty species, we've done a real good job of removing the natural predators out of most habitats that we've touched. Usually in the name of greed and "protecting the children."
    Unfortunately, in order to preserve the ecosystem, we need to either reintroduce those predators (good luck!) or fill that role ourselves.

    Personally, I don't have much use or respect for "sport/trophy hunters" because they are so wasteful.

    If you don't believe me that animals can be a pest, just read some of the other posts. Or take a trip to the Gettysburg memorial and the overpopulation of deer there. Its such a beautiful site is it not?

    Another thing, deer *love* soybeans. If it comes down to you vs. whitetail deer for that food, you can put your money on the fact that the deer will trample and gore you with no second thought to get that food.

    And as for the attack on my evil tendencies: I view things as either necessary or not necessary. I tend to remove my emotions from those types of decisions so I can be as efficient and objective as possible. A little cold, yes, but nature/reality isn't some warm cuddly Disney flick.
    If I'm going to get emotional about snuffing the life out of something, I won't use weapons, I prefer to use my bare hands. (for reference, see my autobiography where I go out to the garden as a child to kill a few carrots by uprooting them.)

    -Veldrane

    P.S. I don't trip. I get enough enjoyment out of reality.

    1. Re:Rebuttal by veldrane · · Score: 1

      how does eating battery hens help the eco-system?

      Just what, exactly, is a battery hen?

      how does clearing the rainforest to produce beef help the eco-system?

      This is a strawman argument.
      I don't support the clearing of the rainforest. The slash-n-burn techniques are not used because they want more land to produce beef. Its primary use is to produce food-bearing flora because of the rich soil.

      how does killing most of the whales help the eco-system?

      This is yet another strawman argument. I don't make any claims regarding whale harvesting other than they aren't vegetarians and some people seem to think that not being a strict vegetarian is a problem.

      how does drinking cow's milk help the eco-system?

      Yet another strawman comment? Wow, before you ask these questions in an attempt to distract, how about asking how your eating habits "help" the ecosystem. There isn't a hyphen, btw. How does soymilk help the ecosystem?

      I do have a genuine question for you (whether you answer it or not remains to be seen): Do any of your information sources come from things other than those little propaganda pamphlets that litter college campuses?

    2. Re:Rebuttal by veldrane · · Score: 1

      I can imagine the dairy farms you've visited and I know how humans waste natural resources to produce numerous things, grain crops included.

      For me, too much of any one thing is bad. From the things I've witnessed first-hand, I believe I can say that nature (and the ecosystem) agrees with this perspective. The ecosystem is a fragile, yet sometimes cruel, system of checks and balances.
      The genetic engineering of plants to make them bug resistant, for example. Why do people feel that is a necessary endeavor? Because they are going from the basis that insects can be VERY devastating to crops. Why are they devastating? Because the crops are concentrated into very close locations so insects can gorge themselves without having to do a lot of searching. With the removal of natural predators, deer and rodents also become significant parts of this equation.

      Another problem with such large fields is that they are usually planted with the same crops each year (soybean, canola & corn are all high profit crops) and this will leach nutrients out of the soil. I'm sure its not as bad as the suffering of an animal but its a scar upon the Earth nonetheless.

      Other things I detest in the agriculture market are feedlots and commercial dairy farms. Dairy cattle are being bred (not the same type of genetic engineering as messing directly with the genes but still engineering) in many parallels to those deformed goldfish many people think are cute.

      But just because someone uses Napster to pirate mp3s doesn't mean Napster and every single person who uses it are criminals.

      Hens in small confined cages, alongside a seemingly infinite row of cages just for the eggs is wrong. Waste management and pest control just to name a couple reasons without hitting the "moral/ethical" reasons.
      A small number of chickens in a free range environment where a caretaker collects the daily remains of the hen's period is not bad. The chickens seem happy enough to boot.

      As far as leaving more or less water, unless you're planning on a space flight, I don't see how eating beef instead of a vegie burger makes a difference. I won't discuss my dismay over the whole "casket" funeral thing. I am just very disappointed that its illegal to be buried in a pine box in the hills of home without my corpse pumped full of preservatives. Such a waste.

      I guess the main reason that I don't draw the same conclusions is that I have seen quite a lot. From both sides of the fence and with a lot of the prejudice and bias that is out there. Is it a shame? Hard to say. If it is, my perspective is that its a shame that you haven't seen enough to draw similar conclusions to the ones that I have.

      Its a tough claim to state that you stand on firm ground about a subject when you claim that its either all good or all bad. I have yet to see any topic that is either all good or all bad.

      Say for example fishing. I don't personally approve of people who catch what they consider "junk fish" only to leave them on the bank to rot. I also don't see it as strictly a recreation. I also see that in some locations, it is an activity that needs to be regulated so as not to destroy it. But I do find that fish make an excellent source of food as well. I also feel that it is ok to get some level of enjoyment out of the activity just as one would get harvesting food out of a garden.
      I also don't approve of large fish farms because that introduces a lack of variety which is highly vulnerable to problems.

    3. Re:Rebuttal by DrSkwid · · Score: 1

      how does eating battery hens help the eco-system?

      how does clearing the rainforest to produce beef help the eco-system?

      how does killing most of the whales help the eco-system?

      how does drinking cow's milk help the eco-system?
      .oO0Oo.

      --
      There are places where the networks are not touching,and there are places where they are-Boeing's Lori Gunter
    4. Re:Rebuttal by DrSkwid · · Score: 1

      A battery hen is a hen that is kept in a shed in a 3foot cubed cage with two other hens along with hundreds of other cages.

      info from leaflets? some is. Mostly as decisions made from things witnessed first hand from working on / visiting farms to see for myself.

      If you can adequately justify the dairy industry over the soya milk industry based on the degree of suffering then I'd be interested to hear it.

      I embarked on my economic choices during the ethiopian famine back in 85. As I read up on the way in which humans waste so many natural resources to produce one set of foods I decided maybe I could do my small part to reduce my consumption. Meat & dairy went our of my diet and I feel much better for it.

      I hope I help the ecosystem by leaving more water in it than if I lived on milk and beef.

      My comments here are often trite and inflammatory and usually as a knee-jerk to some pro-hunting posts.

      I can see that you may have studied this subject and it's a shame you don't draw similar conclusions.
      .oO0Oo.

      --
      There are places where the networks are not touching,and there are places where they are-Boeing's Lori Gunter
  120. Re:Well, Duh! by Stonehand · · Score: 1

    Well, you have to take into account several cultural, geographical and political differences.

    * They're far more homogeneous, and thus far less room for internal tension (and what there is, often isn't seen...).
    * They're far more tolerant of government.
    * Japan is an archipelago that shares no island with other nations. Combined with the previous point, they can control trade far more rigorously.
    * Traditionally, most people weren't well armed.
    * This means that they can control the availability of, say, firearms, with a much higher degree of rigor.

    It's hard and rather pointless for most unarmed people to try rampaging.

    On the other hand, occasionally they DO have problems with, say, people with swords trying to off an MP on the floor of the Diet (happened), or a kid beheading other kids.

    And nobody would call Aum peaceful.

    --
    Only the dead have seen the end of war.
  121. Re:No Slashdot, NO! by Stonehand · · Score: 1

    When was the last time people circle-strafed in a gunfight? Or, for that matter, stayed *standing up* in a firefight, with no cover?

    Does the fact some airplanes still crash mean that maintenance is useless?

    --
    Only the dead have seen the end of war.
  122. Re:the real reason for Columbine-Guns by Stonehand · · Score: 1

    We're not an island, our borders are fairly porous, and there are *already* numerous firearms here.

    Confiscation is therefore, essentially, impossible.

    Same issue with ammunition. There are VAST quantities of ammo out there. HUD could try to blackmail/sue EVERY U.S. gun/ammo manufacturer into oblivion tomorrow, and the supply would last a LONG time, even if Customs were 100% successful in stopping imports. So the "let's mega-tax the ammo" workaround also doesn't work.

    The conclusion: Deal with it. Recognize the reality that unless one makes firearms obsolete through completely insane SF technology like personal force fields, or invokes a *massive* police state with house/house searches, firearms are in the U.S. to stay.

    Then read Lott's "More Guns, Less Crime". He's got some interesting stats re: CCW laws, for instance. "some" being a gross understatement, given he surveys every county in the US...

    --
    Only the dead have seen the end of war.
  123. Re:Military/police should use these games by Stonehand · · Score: 1

    Most kids...

    a) lack combat training/experience,
    b) are taught to, at most, duck and cover,
    c) don't fire back.

    It's a lot easier to hit a motionless, defenseless target at close range, compared to your average armed perp who *really* doesn't want to go back for another 5-10.

    --
    Only the dead have seen the end of war.
  124. Re:Man! they are reaching... by Stonehand · · Score: 1

    Actually, take a look at the second study's conclusions. I'm no psychologist, but they appear to comment to the effect that women's aggressiveness was increased *more*, and then speculate on a few reasons why...

    --
    Only the dead have seen the end of war.
  125. Wait a sec. by MKalus · · Score: 1

    MMhh

    I am an avid Sim Fan (well, not much time anymore) and I could basically rattle you down all the different kind of Weapons, their effectivness etc. in the Sims. I read Janes etc. etc.

    I also played Doom, Quake and their like, but I don't think I ever got any more aggressive.

    What surprsises me though is the fact that a country that is so gun loving as the US is so against knowing that their kids COULD defend their country in case of an attack, after all that is why you have this thing in your constitution about everybody having a gun.

    I am not a friend of weapson or violence, but I know that i watched a lot of violent movies, played games etc. But I would say my overall violence level is rather low. IF somebody kills somebody only because he CAN has something to do with his character, nothing else. So even IF the games increase your ability to be violent there are still things IN you that should hold you back.

    --
    If you want to e-mail me, use my PGP Key.
  126. Re:A very good point! by Kvort · · Score: 1

    It seems to me what you're talking about is dehumanization. (I don't know if that's a word, but it looks good)

    I don't go around hurting people because I don't want to see people in pain. If you convince yourself that the people you see are not the same as yourself, then you can effectively circumvent your empathy. (Or conscience, or whatever you call it)

    Racists convince themselves that persons of other races are not the same as them. They believe they are superior. This is how some of the nicest people (from a similar-race perspective) can exhibit some of the most loathsome, disgusting, and unforgivable behavior.

    I will agree that this missing empathy is the problem. Too many people today lack any feeling for other living beings. I don't really know what the problem is, but I do not believe that it has anything to do with video games. During the world wars, groups of American kids got together and played at wargames in the otherwise peaceful fields surrounding their homes. The split into teams, and threw non-harmful projectiles at each other. For countless generations kids have played these sorts of games. How are these different from "Tribes", except that it requires that much less imagination?

    Violent movies are a possibility, except that for the most part they fit into a non-realistic ideal, which are much like grown-up versions of wargames from childhood. Some movies fit into a more realistic type of mold, like "Saving Private Ryan"; but truth be told I almost cried at the end of that movie, which would have been the first time in several years.

    As I said, I really don't know what has caused this lack of feeling, but I don't like it.

    >>>>>>>>>> Kvort

    P.S. MASH is a very cool show, but I would suggest that your example in human feelings will be infinitely more imporatant than any other influence; from your article, I have faith in those examples.

    --
    -Don't mind me, I'm personality-deficient and mentally-impaired.
  127. Re:A very good point! by vecna_99 · · Score: 1

    The United States may be needing another war of independence in which guns would be very practical.

    do me a favor, will ya? explain to me how "practical" your hunting rifles and shotguns and handguns will be when pitted against the artillery and armor and aircraft of a modern army, which is who you would be facing in any "war of independence."

    c'mon, gun nuts - i'm serious. who out there really thinks that they and their hunting buddies could hold out against the U.S. Army for more than, say, 24 hours?

    -steve

    (yeah, so what if this is Inflammatory? i'm pretty freakin' Inflamed about seeing this same stupid argument over and over again. if you want to spout idiocy, that's fine, but to do so on a subject as important as firearms is just irresponsible.)

    --
    --- "We also were guided by the unlikelihood that anyone would face supernatural evil armed only with technology."
  128. Re:No Slashdot, NO! by DocJohn · · Score: 1
    >> The game type effect as well as all two- and three-way interactions between
    >> the independent variables were nonsignificant (allps > .05).

    >The key word here is "nonsignificant". In other >words, this means that when they attempted to >find an increase in aggression due to playing >violent video games, they completely failed. >There was no measureable increase in aggression >due to playing violent video games.

    Sorry, but you're completely wrong on this point. That's what happens when people quote things out-of-context. The part you quoted was describing the results of just one part of the study. What you say is true insofar as the results of that one questionnaire. What you failed to mention was the additional tests and measurements used by the researchers where significance was found:


    "Aggression Accessibility scores were higher for those who had played the violent video game (M = 5.54) than for those who had played the nonviolent video game (M =- 6.69). In other words, the violent video game primed aggressive thoughts. This result suggests one potential way in which playing violent video games might increase aggressive behavior-by priming aggressive knowledge structures."

    "Most importantly, participants who had played Wolfenstein 3D delivered significantly longer noise blasts after lose trials than those who had played the nonviolent game Myst. In other words, playing a violent video game increased the aggressiveness of participants after they had been provoked by their opponent's noise blast."

    "Playing the violent video game increased accessibility of aggressive thoughts and aggressive behavior but did not reliably increase state hostility."

  129. if I only had the time... by eshaft · · Score: 1

    Spending 10+ hours playing Quake 3 Arena in my office leaves very little time for me to inflict violence on the general population.

    BTW, if you look at the documentation with Quake 3 (yes, that means you'd have PURCHASED IT ;) then you'll see that id is VERY careful not to mention "kills," "blood," or "violence" (instead we get frag, gib, etc.)

    --
    lf.o
  130. Re:Look at this study for what it is... by Melkman · · Score: 1

    There's no statement that this proves anything. Exactly, this whole "study" is conducted to support their "GAAM" theory. They expect that playing video games increases agressive behaviour, both in the long and the short run. Step one they take to prove that is showing the correlation you mention. But as you said correlation != causation. The second experiment is not just that, it's worse. Basically what they say is:

    Our GAAM theory predicts that playing violent games will cause people to be more agressive because of playing violent videogames directly afterwards and in the long run.This test shows that if somebody has played a violent game for twenty minutes they tend to be more aggresive directly afterwards (dubious). Therefor our theory is correct and people will be more agressive in the long run.

    This study stinks bigtime. Proving a theory with wishfull thinking is NOT scientific.

  131. Surprise! by Borealis · · Score: 1

    Hmm, let's see what else we can think of:

    - Football, definitely violent.
    - Rugby, makes football players look like pansies (they wear padding after all)
    - Hockey, it's not a real hockey game until somebody bleeds
    - Driving in rushhour (damn near makes me psychotic every day)
    - Mothers/Mother in laws. 'nuff said.
    - Stupid studies performed so that congress can make spurious laws so that we all end up playing video games based on Barney the Dinosaur. Makes me feel downright treasonous.

    --
    Unbreakable toys can be used to break other toys.
  132. Does it matter? by supabeast! · · Score: 1

    Gee, you'd think the people that do these studies might do studies about how MURDERERS ARE FUCKING CRAZY PEOPLE!

    All psychology is just pop psychology. Psychologists just say that people who go against the grain are mentally ill and need help. They have been doing it for decades, and will never stop. If you really want to have fun, find a christian psychologist, and ask him if he believes that God created everything, created Jesus, had his son Jesus killed to forgive the sin of the world, and then brought him back to life, and now watches the world and everyone in it all the time so he can send anyone who doesn't agree with him to hell.

    He will of course, say yes.

    Then tell him you are the second coming of Christ mentioned in the book of revelations and that the world is about to end. Ask him if he thinks you are mentally healthy.

    Anyone who trusts a psychologist is an idiot. The only good psychologists do is sorting out the people with physical illnesses that cause mental problems (manic depression, schizophrenia) and send them to a good psychiatrist so he can medically evaluate the situation. Other than that, they are all a bunch of quacks.

  133. Random Polling by Aerolith_alpha · · Score: 1

    Personally, I believe that any such study can be very cleverly crafted to say just about anything provided the people in charge have an adequate knowledge of statistics. By my way of thinking, they can either A) modify the exisiting data to their liking by taking specific cross sections that do not represent the true 'average' of the data, or B) they can simply sample a very specific population in a random way. Due to the randomness of their sampling within the specific population, they can claim that the entire study is truely random, and therefore valid data. One last parting shot that I will not back up--I personally believe that violence on television being shown to very young children is the cause of more violent behavior. I enjoy a good action movie as much as the next guy, however if taking violence off the TV entirely is the only way to guarantee that the children do not see it, I am all for it. Besides, then they could make an all simpson's station--and wouldnt that be cool? ;)

    --


    mov ax, 13h
    int 10h
  134. Re:Look at this study for what it is... by Grog6 · · Score: 1

    Check out the first paper, Esp. the labels in Figure 1. I can see Frasier Crane playing quake and yelling, "Die, Mr. poopypants!!"
    This Study basically says : Men are Naturally Violent. They must instinctively have some propensity for violence. Damn. I always thought that we (humans) were top of the food chain.
    No telling how many less successful predators helped shape our minds.
    Now some morons have went and spent millions of dollars to prove that men like to hunt, even virtually, more than solve puzzles.
    Now, in my neck of the woods, the women are just as vicious as the men. More, if you just fragged them.
    These guys found enough correlation to get some headlines, and that will probably be enough. No one else will read the papers, just the headlines.

    --
    Truth isn't Truth - Guliani
  135. Re:Studies show religion increases violent behavio by jmp100 · · Score: 1

    I think you should rent "Apocalypse Now" and pay attention to the bit at the end. Marlon Brando's character was at the center of a cult. No god was involved and yet it was a cult, and therefore religious in nature. He was clearly their "living god."

  136. Re:I am! by jmp100 · · Score: 1

    I think the electrodes those quacks like to strap to peoples' heads probably cause a lot more memory loss than tofu.

  137. Re:Studies show religion increases violent behavio by jmp100 · · Score: 1

    The backwards swastika was also used in Scotland as a fertility symbol. Only the uninformed connect paganism with Satanism. After all, pagans don't believe in Satan.

  138. FRAG those guys!!!!!! by ReadbackMonkey · · Score: 1

    I play violent video games all the time, and I'm not psychotic... WE SHOULD FIND THESE PSYCH GUYS AND FRAG 'EM QUAKE STYLE!!!!!!!!! Just wait till I get a hold of the Plasma rifle on level 32.. then there will be trouble.

    This crap is just like the 80's when they told me that my 50 hours a week of AD&D would make me become evil and wicked.... I showed them with my invisibility ring and my +5 STR Sword of Slaying. Banished forever to the realm of Urgot the stench-ridden. That'll show 'em.

  139. Re:NY Times Report by para_droid · · Score: 1

    surely all 'rampage killers' are mentally ill? by definition, a sane person could never go on a 'killing rampage'.

    Abashed the Devil stood,
    And felt how awful goodness is

  140. Re:Thoughtless posts are more damning than good by omnifrog · · Score: 1

    Kind of reminds me of the time when everyone was scared that their kids might be playing Dungeons and Dragons. A person could spend hours talking about weapons. According to myth, AD&D was even responsible for making kids into satanists (not that there's anything wrong with that). Once something newer comes along, this whole thing with video games will blow over. And when knitting clubs become the mainstream outlet of youth culture in the year 2525, people will yell that knitting is causeing all of society's ills. (Unless Cleopatra 2525 is right, in which case we'll be fighting the evil surface robots.)

  141. Re:Missing the point by Brighten · · Score: 1
    But is this limited to computer games, or does it extend to other activities? I would argue that any competitive activity will lead to increased aggression over my normal, fairly passive self.

    While this seems reasonable, and competitive activities probably do lead to arousal of some sort, they may not lead to aggression. My psychology text for this semester mentions a relevant study on p. 362-363:

    ...repeated exposure to violence desensitizes observers to the implications of human suffering. The shock and upset that most people would otherwise associate with acts of extreme violence become extinguished by repeated presentations of violent stimuli...

    Evidence that desensitization can occur comes from several sources... [In one study] subjects were attached to a machine that measured their emotional reactions, as "bumps" of arousal in their galvanic skin responses. The first watched a videotape of either an exciting volleyball championship or a violent program. ...the tapes were equally arousing. Later, subjects briefly viewed what they thought was a real confrontation resulting in physical violence and property damage. ...[T]hose who'd seen the violent TV show reacted less to this than did the other group. Watching the TV violence presumably made them less sensitive to "real life" violence.

    So it appears that it may be not just the competition or excitement, but actual violence that is key in producing desensitation to violence.

    That said, tjwhaynes made a good point in saying that not all aggression is necessarily bad. For example, perhaps shy individuals could use a little extra aggression to stick up for their own rights. But that doesn't make this study bad; it just helps us understand aggression better.

  142. The Truth is.. . by rpsoucy · · Score: 1

    The Truth is this. The Human mind develops as a result of what it is exposed to. So of course if you expose young people to violence sutch as Television, Video Games, etc etc.. . In there earily stages of development (up to 17 years old on average) they will develop into being a more violent person. Personaly, I play video games every once and a while and enjoy them, but the difrence between us and most people is that they don't know what wrong from right. Parents stik there 5 year olds infrount of the tv and give them video games to avoide getting a baby sitter. Parents should have there kids Read insted of watching TV. I'm not saying that people shouldn't watch TV or play video games so please don't insult me by saying that I am ; however, I am saying that video games and movies, even televesion should be for people that are mentaly developed, not for young people. Once you teach a child and help it develop it's mind you reach a certain point where they have morals. When that point is hit there IS a need to expose them to violence, teach them about the past, the holocaust etc etc.. . so they can see how wrong it was, and how wrong violence towards fellow man is. But not before.. they shouldn't be exposed to the dramatic violence we see in video games and television before that point, because television and video games have a tendency to glamorise violence. Name one decent video game that the point of the game isn't to kill as many people as you can? But like anything violence is intresting, it makes life seem less dull. But when we expose young people to this, they don't realise that it's wrong, and it's not real, they see it as glamoris, and they try to copy it.
    Of course violence and hate don't come entirely from video games. Religion is the primairy cause of preduce in the world, causeing people to belive that THEY and only they are right. Also causeing them to fear others, and fear leads to anger, anger to hate, hate to suffering. People don't relise how much truth there is behind that line. For our world to become one whitch is plesent, one without crime, poverty, and hunger.. Humans would need to take the next step in evolution, a mentle one, Money, Religion, Government, they all need to go. Video Games, and Television need to be steped down as well.. I belive that if we don't change soon, that our generation (X?) will see world war three. And when ww3 does happen, It will bring down the earth population from billions to hundreds of thousands.. . Everything we worked to build in the last 1000 years will be destroied and only then will humanity relise that they were wrong. I know I'm getting a little deaper then Video Games, And I'm probly seeing this for more then it is. But I belive in The Human Race, and Science. Not False Religions that keep everyone back in this world. I also belive in 0% Violence, No Person should be in a posision where they would become violent ; however, this is unlikely to happen before we relise it's too late, because there are alredy so many people who have been hurt and neglected. And it probly will take a war that will whipe out the bulk of humanity for us to relise that were wrong. If you wanta make comments to me, post them here or email them to me at : rpsoucy@zzweb.net Thanks for your time. (Even though this will most likely be moderated down ;)

  143. Re:The experts have an opinion, or three by period3 · · Score: 1

    Um, explain to me how Vitamin C is useless?
    Maybe you enjoy scurvy, but I prefer to stay healthy.

  144. I wouldn't call me violent by Dark_Yoda · · Score: 1

    I play all the games i can find...
    First person shooter
    Real time stratagry
    Puzzles
    Role playing
    Chess/checkers

    sure i dont mind a good gib every now and again...
    but i mostly enjoy having my stratagies wipe out
    the other persons stratagies

    P.S. - CounterStrike Rules! :)

  145. Study Shows Video Games Cause Friendships to Grow. by geekguy · · Score: 1
    I have conducted my own study of myself and my family and friends.
    In my study I found that
    1. I am closer to the people that I have fraged or have been fraged by.
    2. All of us have been playing violent games for an extended period of time and none of us have thought to hurt someone else.
    3. Video games remove agression- by letting you destroy things in the virtual world you get out your aggressions and don't feel the need to destroy things in the real world.
    4. Games don't train you to be a beter shot(none of us can shoot straight).

    on top of all this I have found that even though games can be violent they are no more violent than NEWS reports or anything else in real life.

    --

    --
    -- Any comments seen here are not mine, but a mixture of alchohol and lack of sleep.
  146. Lock Me Up Right Now by geekguy · · Score: 1
    Yesterday I spent most of the day going on a killing spree in Goldeneye (I am waiting eagerly for Perfect Dark). I have been playing violent games since they were invented. On Friday I watched Akira. I enjoy anime and other forms of violent media. I am an antisocial geek.

    Conclusion: I am a threat to society and am likely to go on a killing spree and take out half of my college.

    --

    --
    -- Any comments seen here are not mine, but a mixture of alchohol and lack of sleep.
  147. Lying with stats by Legion303 · · Score: 1
    What I found interesting about the paper is that nowhere did I see the actual number of respondents from the pool who answered in a particular way (I skimmed through the paper, so I could be mistaken). All I saw were the alpha coefficient ratios. These ratios are completely arbitrary and depend on the statistician's idea of what is "significant" for a particular factor. In other words, if they decided that 10% of people responding that video games made them feel more aggressive was a "significant" amount, then they can claim that it is, and the alpha coefficient doesn't reflect the fact that the actual percentage is small. This is what I remember from my stats course, but I'm a theoretical mathematician, not a statistician, so if anyone knows more about stats than me, please feel free to correct me. :)

    -Legion

  148. Re:Military/police should use these games by frank249 · · Score: 1

    Of course the kids were not firing back but this kid's marksmenship is phenominal considering he had never firered a real weapon before. The other point is the first time you actual kill something where it is a deer, pedgeon or person is a tramatic experience. Most people breakdown, puke or just shake. This kid went on to kill 6 more people all with head shots. The relationship to video games, marksmanship and desensitizing could'nt be clearer.

    --

    Today's vices may be tomorrow's virtues.

  149. Re:the real reason for Columbine-Guns by frank249 · · Score: 1

    How many more kids have to die before Americans realize that too many readily avaiable guns are bad. Your constitution was written in 1776 when there was a very real threat of a British reinvasion. Well guess what? I think the threat is over.

    --

    Today's vices may be tomorrow's virtues.

  150. Military/police should use these games by frank249 · · Score: 1

    If a kid that never fired a real weapon before can go into a classroom and kill 7 kids all with head shots, then the video game he had played must be one hell of a simulator. Do you know how hard it is for trained pers to get head shots? Most dont even try it as it is a low percentage shot.

    --

    Today's vices may be tomorrow's virtues.

  151. U.S. is not the only place that has video games by primenerd · · Score: 1

    This study means nothing, video games have become ever more realistic in recent years and violence has gone down.(Dead or Alive 2, is so realistic I should run out and beat up people like those HOT! women in the game.) Also, the Japanese dominate the console video game market, and "violent" games have a much greater penetration into youth culture in that country. However, Japan is one of the safest, most peacful nations in the world. Gee... I wish I could make money by writing reports that state useless facts.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  152. In Whom is Violent Behavior Increased? by tubist · · Score: 1

    Well, here's my take on the whole violent games and violent behavior issue.. Everytime a story like this is posted, hordes of people post "no, stupid! It doesn't! I play violent games all the time and I've never killed anyone!" or something similar.. Well, I was thinking about who reads slashdot and thus who comments.

    Frequenters of /. are generally more acquainted with computers and technology.. they are more likely to understand how the game works.. Not neccessarily the programming, but rather that, for example, that man with the Uzi is actually a bunch of organized colored dots on the screen. The computer or game console isn't a magical little box that opens up a gateway to a new world exactly like ours. Tech people will inherently have a better understanding that the game is A GAME and not reality.. Even if they don't consciously think about all the workings of the game/computer when they blow someone's head off.

    Little Jimmy, however, only knows how to turn on his Nintendo and how to boot up the computer and start a game; he doesn't know anything about the machines or software themselves. These games open up new worlds for him to explore and interacte with.. To him, they are actually NEW WORLDS.. Not a bunch of textured brushes put together and AI routines he has to outsmart.

    Personally, I love video games.. Because I know that that's what they are: games. You all realize that too. An average person playing a first-person shooter may not realize it, however, deep down. He _knows_ it's a game, but he doesn't _realize_ it and subconsciously see it as nothing more than a game.

    I can believe that in some people violent video games (or literature or television or movies or cartoons) could lead a person to violent actions. But it all depends on the person. I still remember downloading the shareware v1.1 of Wolfenstein 3D on my 2400 baud modem from a local BBS. Throughout these years, however, I understood that it (and others) were computer games only.

    It all depends on the percepetion of what is being fed to the brain. People on /. making fun of violent(games + behavior) surely have a different perception of the games than an average person.. Computer people can see the games for what they really are, not what they attempt to resemble.

    OK, those were just my thoughts on the whole issue.. Hope I wasn't just repeating what someone else has already said before.

    Thanks,
    Charles Blachly

    --
    So information wants to be free? What's your Social Security Number?
  153. violent teens by glgraca · · Score: 1

    Video games only really induce violent behaviour when you try to take them away ;-)

  154. Re:Janet Reno Play These Games? by sredding · · Score: 1

    If it were my 6 year-old, you can bet your ass I'd take him back by gunpoint if necessary.

    The politics are irrelevant. The media hype is irrelevant. The father has right to expect the return of his child.

    This may come as a surprise, but believe it or not, there are actually people living outside of the United States that are happy to do so. Imagine that!

  155. Re:Look at this study for what it is... by sredding · · Score: 1

    The six o'clock news won't report that the study shows a correlation, but not a causation, between video games and violent behavior. They won't bother to define "violent behavior". They'll simply scream "Latest studies show a link between violent video games and violence in our schools!!!!"

    Read the title of the UniSci article. It doesn't say, "Video Games and Aggressive Thoughts, Feelings, and Behavior in the Laboratory and in Life". It says, " Violent Video Games Seen To Increase Violent Behavior". If the Daily University Science News can't publish the story accurately, why would one expect the evening news to do better?

    There was another story posted on /. last week from the New York Times. Statistically, we have more to fear from people with mental disorders than we do from Quake players. Personally, I'm afraid of psychologists.

  156. Re:Maybe father lost custody because he was abusiv by sredding · · Score: 1

    But cubans are granted automatic residency and asylum as a matter of US policy on Cuba. Therefore, the whols custody case is now a US issue.

    Where is the law that states this?

    Isn't this in the realm of FL family courts? INS decides citizenship/residency issues. The Atty Gen deals with the constitution. The wrong parts of the system are involved here.

    The Florida family courts have no business dictating parental rights of non-citizens. If the child's father were a citizen of the U.K. instead of Cuba, this wouldn't even be an issue. The father would have custody immediately. They held Elian simply because the United States is at odds with Cuba.

    I have to believe that parental rights take precedence.

  157. Re:Maybe father lost custody because he was abusiv by sredding · · Score: 1

    The question to ask is why did the father lose custody (in the Cuban family court system) of Elian? If he was abusive, then custody should certainly not rrevert to him if the mother dies.

    Is this a question for the U.S. court system or for the Cuban court system?

    The child is an illegal alien with a living parent in another country. He should be sent home and quit wasting taxpayer dollars on political grandstanding.

  158. Re:Analyse by j0nb0y · · Score: 1

    Even if such a study could be done (which I highly doubt because it would have to be done on humans), it would still not result in doom (or any other violent game) becoming illegal. At worst, it would mean that it would be illegal for minors to play violent games. Not that this is a wonderful thing, but it is the worst possible scenario. I find particularly interesting the study which looked at the short term effects. More aggressive punishment by those who played wolf3d. Less aggressive punishment by those who played myst. I think the lesson we can learn from this is clear. Balance your violent game-play with Myst.

    --
    If you had super powers, would you use them for good, or for awesome?
  159. Re:Not a surprise. by retep · · Score: 1

    You're dad may not have shot anyone. But what about general effects? You have to do proper controlled and scientific studies designed to find cause and effect relationships to be able to say that.

    Those studies BTW have never been done on smoking due to ethical reasons. This is one of the main beefs the tabacco industry has had... Of course the fact that getting rats to smoke always game them cancer didn't deter them!

  160. Re:Well, Duh! by retep · · Score: 1

    The big reason for the declining crime rate is that the 60's and 70's were a period of social unrest. *Of course* they had a big spike in crime rates then. What do you expect with all of that and lots of younger people to boot?

    It's only natural for crime rates to fall.

  161. Re:Hi, I'm Billy! by [Bruce] · · Score: 1

    I started playing wolfenstein when i was 9. I hav been playing voilent games ever since (im 16), and havent even got into a fight at school. my friends that play voilent games talk with me about blowing people away but are the least violent people in school.

    --

    ---
    Just because life sucks, it doesnt mean you have to care.
  162. Re:SShock2 by [Bruce] · · Score: 1

    I went into a strange mesmerised state. I belt up anyone who tried to talked to me for a month until I finnished it. ...your flesh betrays you...

    --

    ---
    Just because life sucks, it doesnt mean you have to care.
  163. Re:Deflecting Blame by [Bruce] · · Score: 1

    I am only sixteen, and WAS brought up on those games. I wasted most of my spare time in primary school playing wolfenstien and doom, and I havent killed any body yet. At least not that i know of i could have been filled with blood lust and just can't remember but, no.

    --

    ---
    Just because life sucks, it doesnt mean you have to care.
  164. Re:Look at this study for what it is... by palinurus · · Score: 1

    corollation != causation, agreed. however, several long-term case studies in the eighties made a causal link between tv violence in early childhood and aggressive behavior in later life. there was significant corollation between violent television in early life and aggressive behavior in high school, but no significant corollation between aggressive behavior in early life, and watching violent television in high school. this is how you make the jump from corollation to causation, and it has been verified by many. violent video games are a step beyond violent television. convincing studies may have yet to be done, but causation still makes a reasonable hypothesis (though maybe it's wrong, as you point out). here's a more general commentary on the discussion we've seen thus far (not directly on this email): you know, i love to play violent video games. i like to watch violent movies (though i like movies in general). i did a lot of psychedelic drugs in high school. what amazes me is the extent to which people believe that their own experiences in each of these things generalizes to the people at large. "i do acid all the time and i'm fine." "i live in a quakeworld server." it's like hearing people say "my great-great grandmother smoked twelve packs a day for 800 years and still runs on the treadmill everyday before going climbing and ...". tell me if this isn't a contradiction: you arrogantly protest (not the writer of this email, who makes a sound point, but many others who have posted before) a study with scientific backing, which makes a plausible generalization based on fact, because it indicates that something you value might be "bad". What's the device for this protest? A strong belief in a generalization based on nothing but personal experience and the experiences of a few friends, some drug culture lore, and no kind of serious consideration. the point's been made by a few posters already: games, media, weapons, do not instill or damage responsibility in children; leaving them alone with these things when they haven't even learned what it means to love the people around them, when their world is still a unidirectional landscape centered on "me", and it's a crap shoot. it's unfortunate, but people who say things like "studies are all bullshit" just don't know what they are talking about.

  165. Games causing violence, or just an outlet? by Tommy_H · · Score: 1

    I feel obliged to respond to this, because it really bothers me. I'm in my early 20s and grew up playing video games. I've had a computer in my home as long as I can remember, and always had plenty of games, especially violent ones. I seem to remember this one game on my C64 called "Barbarian",or something like that, where two guys with swords would duke it out, and if you did the right move with the joystick, you would decapitate the other guy. That game was fun. To this day, I still play bloody and violent games. I've played the games in the Quake series, as well as many of the other games of that style. These days there are two reasons I play games: for enjoyment, and for stress relief.

    Yes, you heard me, stress relief. If I'm angry about something, I'll just sit down, turn on my Nintendo 64 or my computer, and kill things. Doesn't matter if they're monsters, Soviets, spies, Nazis or cute little bunnies. I'll play for a little while and suddenly realize I'm not thinking about whatever it was that has been stressing me out, and I feel a lot better. Imagine that, finding an outlet for my anger.

    When I run around killing monsters, causing blood to squirt all over the screen, I don't get violent. I'm not at all a violent guy. Last time I was in a fist fight was 1990. "There you go", the 'experts' would say. "You were fighting because of those violent C64 games as a kid". Last time I checked, kids that age got in fights before there were computers in anyone's home. Even before TV shows got so violent. Its a phase you get over, in most cases. And guess what? I'm a big guy, there were probably 10 guys in my high school bigger than I was. The football coach at one point begged me to play. So I could have run around my school smashing in noses and breaking arms without a problem, and there were some people that did get me angry real fast, but I never took them up on the offer to fight.

    Another thing that annoys me about this article, the relation between video games and grades. They quote, "We also found that amount of time spent playing video games in the past was associated with lower academic grades in college."
    Hate to say it, but I've got a 3.0 (out of 4 possible), and its that low because I'm a beer-drinking up all night kind of guy here at school. If I remember my psychology class correct, a corelation between two types of activity does not automatically mean a cause and effect relationship. It certainly doesn't in my case. Sure, there have been times when I played video games when I should have been studying, but everyone in college finds excuses not to study, whether its video games, drinking with their buddies, watching TV or whatever they want to do.

    So to sum up, I've played a lot of violent video games, but here I am with decent grades and no anger problems. So in my opinion, the video games themselves aren't the problem, I believe its the people who are playing them. But they must have some problem. Maybe its a chemical inbalance, maybe its a problem stemming from how they were raised. I sure don't know. All I know is that I play a lot of violent games and I never plan on killing a person. Sorry guys, back to square one. Go start some more research to waste my tax money.

  166. Re:No Slashdot, NO! by cybermage · · Score: 1

    Ok, but wouldn't it be better if violent people didn't have the benefit of simulator training before they went on actual killing sprees?

    If they're still violent after playing these games, it would suggest that they are not providing a release, as has been suggested.

    --

  167. Here's what I wrote to the APA by xaqar · · Score: 1

    To whom it may concern: Thank you very much for publishing the most ignorant study I've seen in a very long time. I find it wonderful that such a horribly skewed study will be placed on the market for all of the media to blow out of proportion. The main problem with your study is the games which are used, Wolfenstein 3d and Myst. It is obvious that agression levels will be higher after playing Wolfenstein. Let's take a brief look at the two games. I've played both games quite extensively. In Myst, it would be quite easy to wander around for 15 minutes (even two times) and never become remotely frustrated. You can wander around and take in the gorgeous sites, and never even run into the fiendishly difficult puzzles (which I guarantee, that after a longer period of time would frustrate and infuriate the subjects). The play control in Myst is also as simple as it could possibly be. You simply click the mouse on where you want to go. No chance of frustration at all. Wolfenstein on the other hand, has ugly horrible graphics (why did you choose such an old game that looks so bad...it would put me in a bad mood too!), and play control, which, to a gamer is simple, but to others, is horribly frustrating. It took me far far more than 15 minutes to get a handle on the control in Wolfenstein, and before that I was frustrated by it. Also, the fact that excitement levels were higher in Wolfenstein than in Myst is also no surprise. Myst is a very slow paced game. You're not in a hurry to do anything, you can spend 5 minutes looking at the screen and not doing anything if you want. In Wolfenstein, quick reflexes are required, and you must always be doing something. Add this to controls that people just don't quite get, and you've got frustration, and excitement. It's very obvious that this study was produced in order to find a certain result set, and was not objective in the least. Videogames are not to blame for Columbine. I firmly believe that no one thing can be blamed for such a tragedy. It's partly the parent's fault, partly the media's fault, partly the school's fault, partly other student's fault, and partly games fault...but mostly, it's the kid's fault who went in and shot at people. I've been a "nerd" for all my life. In that time, I've played countless hours of video games, I've been made fun of for many many years, I've even played role-playing games. And you know what? I've never killed anyone, I've never even hit anyone. I don't drink, I don't smoke, I've never been involved in "delinquent behavior". I think it's time that we as a society stop trying to find a scapegoat in one thing, and realize that it's many many factors that contribute to a tragedy such as Columbine...and not forget that one of the largest factors, is the perpetrator themselves. Thank you for your time, Seth Ristow Hopefully this gets routed to the proper people. I suggest everyone send something to them, and try and get this study discredited! Xaqar

  168. If this was true... by kperrier · · Score: 1

    I would have gone postal and killed all of my cow-orkers a long time ago.

  169. Re:Well, Duh! by Andrew+Cady · · Score: 1
    Uhm? That data doesn't contradict my post at all. Was it supposed to? What do age trends have to do with this? This more clearly shows the relevant data -- and again, it does not contradict my earlier post.

    Were you disagreeing with me? I have to assume not, given your linked data.

  170. Why is being agressive bad? by wide-eyed · · Score: 1

    It occurs to me i am very agressive. I drive fast, Swerve often, get loud at work, saucy at interviews. Often i find myself fairly distructive. Yet depsite all of this i am a valuable member of society that has not a smidge of homicidal tendencies. Did i play lots of video games when i was young? Nope i sucked at them. So i programmed insted. Obviously there are factors well beyond that of a simple video game. The residing though within me screams that this is rediculous. They take a snapshot of a life and try to do a full analysis to discover what is wrong. Every good psychologist knows it is often years before any real healing can be done for those who are actually aflicted with a real problem. Just check there salary if you don't beleve me.

    When did society become so weak. Agression is not a bad thing. Violence against other humans is.

    --
    off and out
  171. Frag 'em all... by Saltine+Cracker · · Score: 1

    I'd like to think I'm your average well adjusted 26 year old professional computer geek.
    Do I play FPS games?...Sure!
    Do I like watching violent movies?...Sure!
    Did I play Dungeons and Dragons?...You bet!

    Do I collect guns?...Hell no (unless you count a splat ball gun)!
    Have I thought about what it would be like to kill someone?...Sure.
    Have I killed someone?...not that I recall.
    Have I ever grabbed a sword and some chain mail and duel'd it out with the DM?...No!

    Bottom line is there are people who can't seperate reality from fantasy, and there are those who can. It doesn't matter what you do, Quake, Magic, D&D, or Karate Magazines...if a person can't seperate fantasy from reality bad things are bound to happen.

  172. I am! by DrSkwid · · Score: 1

    So, are you a violent video gamer that eats Tofu and uses Ecstasy recreationally?

    Shit, I am.
    What with that and the Chronic by the time I'm forty I won't be able to remember anything!

    This memory thing is all bullshit anyway IMHO. What it really is is a shift in focus.

    It's all FUD to keep you going to work and contributing to the GDP.

    Fuck 'em all.
    Do your own thing.

    A bolt to the brain causes cows more memory loss than I'll have until the day I forget to look before I leap.


    .oO0Oo.

    --
    There are places where the networks are not touching,and there are places where they are-Boeing's Lori Gunter
    1. Re:I am! by carlos_benj · · Score: 1
      "What with that and the Chronic by the time I'm forty I won't be able to remember anything!"

      So that's my problem! I'm 44! Who are you?

      carlos

      --

      --

      As a matter of fact, I am a lawyer. But I play an actor on TV.

  173. Re:Off- Topic by DrSkwid · · Score: 1

    There is nothing wrong with responsible hunting. Of course, that's strictly an opinion (backed by scientific fact).

    wtf are you on about!

    Nothing wrong -> er, it's murder
    Responsible hunting -> oxymoron
    scientific fact -> you trippin

    murderous desire to kill things with weapons -> get over them.
    You are sentient.
    You can rise above it.

    Students or deer - what's the difference?

    .oO0Oo.

    --
    There are places where the networks are not touching,and there are places where they are-Boeing's Lori Gunter
  174. Re:Off- Topic by DrSkwid · · Score: 1

    once upon a time killing black people wasn't murder

    want to wind back the clock?
    .oO0Oo.

    --
    There are places where the networks are not touching,and there are places where they are-Boeing's Lori Gunter
  175. Re:Off- Topic by DrSkwid · · Score: 1

    Come one, give one logical argument that isn't based on emotion that shows that plants are better to eat than animals.

    give me one reason why I shouldn't kill you that's based on logic rather than emotion.

    I'm proud of my emotions.

    many plants rely on being eaten to thrive


    .oO0Oo.

    --
    There are places where the networks are not touching,and there are places where they are-Boeing's Lori Gunter
  176. Re:Off- Topic by DrSkwid · · Score: 1

    there's vitually no wild eco-system left in my country.

    the production of dairy cattle is hardly natural

    you might like to learn something too
    .oO0Oo.

    --
    There are places where the networks are not touching,and there are places where they are-Boeing's Lori Gunter
  177. Has anyone thought of this? by Astralmind · · Score: 1

    Maybe the increase in voilence is proportional to the increase in the number of people?

    I would think it would be reasonable to figure that if there is a 10% increase in population, there would a 10% increase crimes, a 10% increase in the number of people effected, and a 10% in the nature of the crime (ie instead of fist, use a knife, instead of a knife use a gun).

  178. Re:A very good point! by Nostafa · · Score: 1
    >Video games emulate all the behavior without the >experience. Ya, you can blow away 20 aliens in >one minute, but do you experience the pain? Do >the aliens cry out? Do you see pictures of their >parents grief-stricken?

    You can blow away that many aliens only when in god mode. Sometimes the dragon wins. In full motion 56 frame per second 3dfx horror. If you arent hearing the aliens cry out maybe you need a new sound card. And yes we there grief stricken parents at the end of the level. We put them out of there misery and listen to the sound of them crying out in pain as the blood is splayed in high speed 3d.

  179. Re:I agree by jallen02 · · Score: 1

    Lmao :)

  180. Misleading story title by yerricde · · Score: 1
    Unless you think that a Tetris®-like game encourages players to drop a ton of bricks on a fella's head, games like freepuzzlearena have no connection with violence, right?
    --
    Will I retire or break 10K?
  181. Re:Well, Duh! by billyt007 · · Score: 1
    The survival of civilization relies on the OTHER neural pathways overriding the violent ones when its time to make a real life decision. Thankfully this happens most often. Unfortunately, it is happening less often that it used to (road rage is an example.)


    Happening less? What are you talking about? Violent crime in the USA (don't know about other countries but I do assume you talking about USA, if not please remove my foot from my mouth) has gone down for the past 7 years! Violent crime in schools have gone down 40%! Yes, violent crime in schools is down 40%! And this is at a time when more violent video games are released then ever! Note, I don't think there is a connection.

    --
    Open Source, Open Standards, Open Minds
  182. Re:Deflecting Blame by AnarchoFreak_00 · · Score: 1
    Well... u seem to be the big know it all. So y don't you tell everyone what the problem is.

    Alot of ppl say the vioent TV/games, casue real life violence, alot say thast a load of BS.

    Like most things in life, This is not a black and white thing.

    Here's what i thibk: Violent TV/games do help casue violence when that person is atill learning about human emotions (5-15-ish?). Ppl who arn't brought up prtenting to kill ppl or whaching them get killed, can halden it when they grow up.

    I play violent games, and i don't have an urge to kill anyone, alot of ppl say i couldn't hurt a fly. ON the other hand. I imagine that if someone was brought up whatching violent tv, and killing ppl in video games, that they would be violent ppl, casue thats what their brain was brought up to think. (humans follow by example)

    - - -

  183. I've said it all along, you know. by Daniel+Rutter · · Score: 1
    See here.

    Or, for that matter, here.

  184. hrm by jbarnett · · Score: 1


    From: apa.org

    "Study 1 found that real-life violent video game play was positively related to aggressive behavior and delinquency. The relation was stronger for individuals who are characteristically aggressive and for men."

    uh? think about this, agressive behavior was stronger as a result of violent video games in people who are characteristically agreesive. Now replace the words "Violent video games" in the above sentance, with any other activity and it still holds true. The statement

    Agressive behavior was stronger as a result of home gardening and baking cakes in people who are characteristically agreesive.

    I think that above paragraph would also turn true if studied...

    So what does this study really prove?

    They aren't putting "normal" people in these tests, but people that are already voilent or agreesive in nature

    "people who score high on measures of aggressive personality have highly accessible knowledge structures for aggression-related information. They think aggressive thoughts more frequently than do those individuals who score low on aggressive personality measures, and have social perception schemas that lead to hostile perception, expectation, and attributional biases "

    Lets give a crack addict a bunch of smack and see if they become addicted to it. Here how do you tell if the smack is addictive or the crack addict is just "replacing" his addiction?

    --

    "`Ford, you're turning into a penguin. Stop it.'" -THHGTTG
  185. Re:Missing the point by jbarnett · · Score: 1


    "Violent video games may be more harmful than violent television and movies because they are interactive, very engrossing and require the player to identify with the aggressor, say the researchers."

    But if you think about it, the graphics in Quake3 SUCK compared to real life, video games suck in general. I am going to go play some football, it it more interactive, more engrossing and requires to identify with agressive behaviour a lot more then these half-assed video games with lousy game play and bad graphics. When I slam into someone at full force I want to FEEL their rip cage crush under the brute force and not some cheese POP sound effect like you get on video games. Plus the blood totaly sucks in video games, sure it splats, but after that it "disappears" for no reason, when I hit someone on the footable field, blood goes everywhere, and it doesn't disappear, it covers my uniform and flows naturally like water, unlike any video game, even if you have a Vodoo3.

    That or hockey, give me sharp blades on my feet, give me a huge wood stick, and a solid disc that flies 100mph at people's croches. If any one pisses me off, I will slam them into the guard rail and beat them in the knee caps with my stick. If they still mess with me after that I will drop my gloves and beat this fool in the face with my bare hands. No matter how good your graphic card is, you can't see a blood tooth fall onto the ice after you beat someone senseless. Plus video games are volient and cause volience, I don't want any part of that, I am a all american kid that plays footable and dates the head chearleader. I also pay my taxes on time, unlike these volient video game freaks.

    I also bet video games cause aids, war, proverty and any other of society's "demons" that we don't have an obvoius answer for. If it is a difficult society issuse that can be resloved quickly, I am sure video games caused it, because if it is that COMPLEX of a problem, then it has a COMPLEX answer, and video games are COMPLEX, with all the new 3d graphics and such.

    --

    "`Ford, you're turning into a penguin. Stop it.'" -THHGTTG
  186. Argh. by T_Wit · · Score: 1

    In my opinion, credibility comes from two places. One, who you are. Two, what you say.

    The paper comes from a credible source. So they they win the who you are. Now, what you say.

    Let's see, intro sounds fine to me. Now, let's move on to the first few lines of the actual paper. Let's see, it's @#$#ing Columbine. Could these dopeheads please use something other than that media baby to start a paper with??? I couldn't even read any more after that! It's like hanging out a big sign that says "If you play computer games, you're from Satan and you're going to go on a violent killing spree!"

    /me takes his railgun and goes to fix the problem by finding the blue key to their lab and killing the evil scientists, and after i kill them i open the panel to get the red key to go on to the next level. Suuuure.

    It's not the games that make me want to kill people, it's the people telling me games make me want to kill

  187. Oh yeah . . . by Sjsop · · Score: 1

    I know that since Railroad Tycoon II came out I've wanted to run over everybody who hacks me off with a train.

    Oh, wait, I've wanted to do that ever since I fell in love with Gomez' train set on The Addams Family in the 60s! TV causes violent behavior! Now I have to run over my TV with a train!

  188. Short note. by Yosho · · Score: 1

    IIRC, the swastika is a symbol for good luck in some Middle Eastern religions. Specific names escape me at the moment, but I've never heard of it being Satanic in any way.. (Unless, of course, you consider Middle Eastern religions to be 'Satanic', but that's a whole other can of beans that doesn't need to be opened)

    --
    Karma: Terrifying (mostly affected by atrocities you've committed)
  189. Re:If violent video games increase violent behavio by SamThePondScum · · Score: 1
    What did you say that he didn't say?

    I mean, other than the part where you imply you're saying something different, and the generalized insults you added to the end.

    Are you trying to give better examples of causation and correlation? Or are you trying to say that the previous examples weren't valid? Or is your point that the examples were "rediculously exagerated"?

    Because being exaggerated, when you're trying to show how something is different than another thing, isn't necessarily a bad thing. He wasn't trying to prove the truth value of the statements, after all, but rather appeared to be demonstrating the difference in form.

    I don't mean to put words in your mouth, lest I be accused of "strawmanning," but I don't see how the examples you gave are any more clear than the previous examples, nor more correct, nor any less exaggerated, form wise.

    Or, maybe you just wanted to rant about "all [us] guys" who are "over-sensitive non-psych educated geeks who think they know everything"?

    Putting such a blatant and obvious over-generalization in a discussion about correlation and causation isn't such a good idea. Besides the fact that most people already know that lots of smart young kids are egotistical, if you were were trying to make a point (and not just an excuse to rant), insulting the audience you apparently think you're talking to doesn't exactly seem like a great use of time.

    But maybe I'm confused.

    --
    -- PondScum, SamThe
  190. Re:Not a surprise. by clvrmonkey · · Score: 1

    Is it possible that more naturally aggressive people gravitate to video games and violent/action movies? Is it possible that these aggressive people use video games and movies as an outlet for their aggression instead of acting on them in the real world? It's not to say that people who engage in violent behavior don't get ideas from video games or movies (or the 10 o'clock news...), but maybe, just maybe, they were predisposed to violence BEFORE they were introduced to the various types of media currently facing blame for the worlds woes...

    --
    All God does is watch us and kill us when we get boring. We must never, ever be boring.
  191. Refuting yourself? by carlos_benj · · Score: 1
    "Violent tendencies are brought on by violent upbringings, not by any single factor. "

    ...And ONLY violent upbringing!

    carlos

    --

    --

    As a matter of fact, I am a lawyer. But I play an actor on TV.

  192. Personal Testimonies by carlos_benj · · Score: 1
    "Hmmm, you're responding to a guy who's just pointed out the futility of using personal testimonials in these kinds of arguments, and your brilliant rebuttal is... a personal testimonial."

    Yeah, and Riddick Bowe thinks he can be a Marine. He's too mentally impaired to know he can't. I know I've lost mental capacity, but maybe that's because I don't do drugs (well, there was that time I was invited to eat some brownies....).

    "Can anyone think of a drug user who admits that their favorite drug might have nasty side effects? Or a drug virgin who admits that the government's stance on drugs could be completely wrong? Hmmm..."

    Depends on what part of the government's stance we're talking about.

    --

    --

    As a matter of fact, I am a lawyer. But I play an actor on TV.

  193. Re:Studies show religion increases violent behavio by carlos_benj · · Score: 1
    I said:

    "While it is true that many instances of religiously motivated atrocities have taken place, they do not match the toll by totally irreligious movements."

    You replied:

    "This is deceptive and inaccurate."

    It was an honest assesment.

    "The Chinese cultural revolution ... was a cult of personality based around chairman Mau. A very religious movement (worshipping a human instead of a god is still worship, and still religion)."

    I would think that such hair-splitting would be found by most people to be far more deceptive. Most people are able to interpret the word religion contextually. For example: Exercising religiously is not in the same category as Islam. A vi zeaolot is not generally viewed as the spiritual equivalent of a devout christian.

    carlos

    --

    --

    As a matter of fact, I am a lawyer. But I play an actor on TV.

  194. Re:Studies show religion increases violent behavio by carlos_benj · · Score: 1
    "Unlike a whopping 30 years worth of video game data, research spanning THOUSANDS of years show that more organized mass killings have resulted from RELIGION than FROM ANY OTHER CAUSE!

    While it is true that many instances of religiously motivated atrocities have taken place, they do not match the toll by totally irreligious movements.

    The Chinese cultural revolution

    Pol Pot

    Russian Revolution

    Just to name a few.

    carlos

    --

    --

    As a matter of fact, I am a lawyer. But I play an actor on TV.

  195. Re:Off- Topic by Holyscapegoat · · Score: 1

    Students or deer - what's the difference?

    Let me begin by saying, in the nicest way possible,

    You're a stupid fuck. You have no idea what the hell you're talking about. Do you have even the slightest understanding of ecology? Students have parents (usually) to feed them. Deer don't.

    Here's a question that your feeble mind might comprehend - would you rather your precious deer die by a gunshot or starve to death? Go ahead, try to get hunting banned. Then, when hordes of hungry deer are eating every farmer's field in sight, don't complain when YOUR food starts getting more expensive or unavailable. Don't cry when millions of deer each year starve because chewing the bark off trees (who knows, maybe the trees in your landscaped yard?) doesn't give them enough to live through the winter.

    Stupid asshole. Try this new thing called LEARNING. You might like it.

  196. Re:TOTAL CRAP!!!!! by aTRaTiCa · · Score: 1
    for the love of god I hope your a troll....

    Anyways... Picture a world where all games were still written in QBasic.. Wonder if that would eliminate violence. :-)

    --
    ------- What exactly is real?
  197. Oh golly gee wilicekrs... by aTRaTiCa · · Score: 1

    Just becasue I wanna see a serial killer simm, psycho simm, and a flasher simm doesn't mean I'm violent. :-) I keep that on the soccer field!

    --
    ------- What exactly is real?
  198. sure by nomadic · · Score: 1

    I always felt more aggressive after a two hours of Doom. Strangely enough, 12 hours of Doom just left me drained (and seeing swirling lights above my head as I tried to sleep).

    To descend into seriousness for a minute, I have two comments:

    Firstly, if violent video games/movies promote real life violence, why is Japan apparently immune from this? Japanese video games are just as, if not more bloody than their American ports/counterparts. I haven't watched too many movies, but I'm pretty sure they're even more violent than ours. Same with Hong Kong. They don't seem to have these school violence issues,though they might just be underreported. And if you compare TV/movies with those from 10 years ago (at least in America), you'll notice that they're substantially less violent now than they used to be.

    Point the second. Violence is a part of the human condition; repressing it totally might not be a good thing. Behavioral scientists have believed for years that emotions are "saved up", to simplify it, and must be periodically released. If they're not, they'll eventually boil over, and I can think of a lot worse ways of expressing violent emotions than plugging people on deathmatch Quake.

  199. Re:violence against women rise 40% during Super Bo by sswanson · · Score: 1

    80% of statistics are made up on the spot.

  200. What Did the Experiment Part of the Study Measure by Prof_Dagoski · · Score: 1

    The experiment in which participants bombarded one and other with white noise is suggestive, but may not be measuring agression. Instead it may be measuring acquired reflexes. In 3-D shooters like Wolfenstein, you learn to react quickly to ambush situations, and you learn that it takes more than one hit to put a bad guy down. Therefore, it stands to reason that anyone who's been playing a 3-D shooter will be quicker on any test involving reaction and reflex. It also stands to reason that by virtue of having learned to shoot an opponent several times by keeping the fire key pressed down, the particpant will tend to hold the 'punishment' button down longer. This is a tricky thing to measure. This test may measure agressiveness in most instances, but in dealing with 3d shooter games, especially those that use the keyboard as a controller, the test may simply be measuring a profeciency in game playing which may not indicate agressive tendancies. The rest of the study is very interesting, and merits more research into the connection especially into the behaviors exhbited by different age groups.

  201. damn the media... by headcase+fargone · · Score: 1

    this whole thing more than likely wouldn't be any sort of issue if the media hadn't twisted it into something it's not.

    let's speak from the teenage demographic everyone seems so concerned about. I'm 15, home-schooled, and have had a computer of my own since I was 8. Once a month I go out to shoot guns and set up targets with my big brother, and, yes, I play violent video games, and even plan to make a career in game development.

    I also daily listen to heavy metal.

    in addition to this, my parents are ultraconservative Christians and can be, at times, overbearing or excessively hard on me. some of their beliefs and perceptions are utterly absurd and have ended up hurting me mentally or physically, though completely unintentionally.

    all of my friends honestly expect me to go crazy and kill a bunch of people in a murderous rage, just because of that combination of factors. bullsh*t.

    despite the fact that my parents have not offered me the best childhood I could have had, they raised me with a strong sense of reality (no Santa, no Easter Bunny, no Tooth Fairy, no monsters, no ghosts ("except the Holy Spirit!"), nothing like that of any kind) and my personality and life are built on a strong moral foundation. I can tell the difference between what's real and what's not and frankly that seems like the biggest problem to me in these school shootings, if we're looking to blame something. honestly, these kids may have been perfectly sane and WANTED to kill people and terrorize their school. who knows?

    when I play a game it's usually to relieve pent-up aggression. soldier of fortune is a good, recent example. the damage system in the game registers head shots, neck shots, chest shots, stomach shots, groin shots, arm shots and leg shots, and all the parts change dynamically (shoot in head, head is gone and gushes blood, shoot in neck, grasps neck and tries to hold in throat, shoot stomach, intestines spill out, shoot arm\leg, arm\leg falls off and sprays blood). that's a great game for me because instead of actually physically killing someone (or myself) I release my anger on these tiny little computer-generated things, and I feel better. it's my choice whether or not I should take that into the real world or not, and I'm fully aware of that.

    it's all about personal responsibility.

  202. Bad research! No biscuit! by Chillas · · Score: 1

    Ignoring the science for the moment, the writeup is clearly biased. Opening with mention of the Columbine shooters' affection for Doom implies (to me at least) the researchers were going in with a particular bias. Also...

    Entertainment media affects our lives.

    I wouldn't disagee with it in principle, but this quote strongly implies that a causal relationship was being looked for. Again, ultimately only a correlational relationship can be found, but this show a strong bias.

    when video games first appeared, popular games were simple and apparently harmless.

    ...

    As the name of the game implies, the goal of the player in Mortal Kombat is to kill any opponent he faces. Unfortunately, such violent games now dominate the market.

    Saying earlier games were "harmless" and that "unfortunately" violent games are popular show a strong anti-game violence predisposition. The writeup also shows a lack of understanding of the games themselves, and an inability to take discussion of the games in context:

    ...Doom, a game licensed by the U.S. military to train soldiers to effectively kill.

    Huh? What?

    An investigator ...r said Harris and Klebold were "playing out their game in God mode"

    This investigator was looking at Doom mods on Harris' web site. All of us here know what playing in God mode means, but clearly the researchers think this is somewhat ominous.

    I think it is fairly clear that this work was done with a strong anti-violent game predisposition, as well as a lack of understanding (or even concern) for the game culture, making the results, in my opinion, questionable at least, garbage more likely.

    --
    --- Math illiteracy affects 8 out of every 5 people.
  203. Yes, they have evidence for causation by NathanBos · · Score: 1

    Correlation vs causality. Actually this study has a pretty strong claim for causation, because the second study is experimental. As all stats 101 students know, you can't assume causation from a correlation in survey-type study. A survey (study 1) leaves you vulnerable to the argument "maybe its the violent people who choose to play video games", or "maybe a 3rd variable, like mental illness, causes both." However, when you do a controlled experimental study (as they did) you know what order events happen in time. FIRST, they brought in a group of students and controlled for various attributes. THEN they had them play two diff games. THEN they observed the ones who played the violent game to behave more aggresively. Doesn't PROVE causation but it's pretty strong evidence for it. SECOND, they never claim that video games turn a non-violent person into an aggressive one. They claim that it is one factor among several that primes aggressive behavior. So, take a frustrated and confused teen, add years of mimicking violent behavior on the screen, and you're more likely to get real violence. Is that important? Hell, yes it is! As someone with children nearing school age, I'm in favor of controlling every variable that it is possible to control to minimize violence.

    --
    Democracy is the worst form of government ever devised, except for all the others. -Winston Churchill
  204. According to the APA... by BitwizeGHC · · Score: 1

    ...adults having sex with children is OK, but sitting down to a Q3 or UT fragfest is a Bad Thing that will surely corrupt your mind!

    This is the same group that a few months ago, released a study saying that child molestation doesn't necessarily harm the child, and that we should really start calling it adult/child sex to avoid implicating our own, closed-minded moral system.

    I'm sorry, but the shrink community doesn't carry a whole lot of credibility, to me.

    --
    N4st0r, trixx0r h0bb1tz0rz! Th3y st0l3 0ur pr3c10uzz!
  205. Big Bird could Kick their A**!!! by SupahVee · · Score: 1
    Thats it, my kids arent playing those Sesame Street games anymore, I might catch them at the zoo trying to be best friends with a furry elephant.

    And Oscar? Oh man, he's outta here, talk about aggressive behavior....

    --
    "See, we plan ahead! That way, we never have to do anything now."
  206. Those Bastards! by Lizard_King · · Score: 1

    If only I had my RPM cannon on me {pant}, I would blast those editors a new ass. {heavy breathing}

    --
    "My mother never saw the irony in calling me a son-of-a-bitch." - Jack Nicholson
  207. Re:Janet Reno Play These Games? by cyborg_monkey · · Score: 1

    That has to be one of the most ignorant posts yet.

  208. Posting this story is a troll..... by cyborg_monkey · · Score: 1

    All the comments are predictable.... Let me sum it up: 1) Good computer 2) Good games 3) Bad government 4) Bad parents You can stop posting now.

  209. Monkey See Monkey Do... by Seb+Rabit · · Score: 1

    Oh Come on. How do they know that violent people dont choose to play violent games. Coralation does not show causality.

    --
    If God created us in his own immage, how do you explain Vanessa Feltz?
  210. mutherfsckers by djrogers · · Score: 1

    If I ever run into one of these @$$holes on the street I'm gonna stick my boot so far up his ass he'll be digesting it. The nerve of these knuckle heads, implying that I'm aggressive just because I play a few friggin games! This makes me so mad I could scream.

    DAMN!!! Now I've gone and broken my monitor. Soory if there ar any typos, I can't see what I'm typng anymore...

    --
    Think outside the... Hey, where'd the friggin' box go?
  211. Re:Video Games ain't the only thing then... by T'Kethry · · Score: 1

    (anyone know _any_ karate student without _any_ ego or tendency to violence? - personal experience here)
    Well, there's me, my daughter, my son, and several of their friends. Presuming you're using "ego" as synonymous with "arrogant", of course. Karate, or any martial art, properly taught, teaches discipline and *avoiding* violence if at all possible.

    --
    Death is but a doorway.
    Here, let me hold that for you.
  212. Re:I am passive by Ig0r · · Score: 1

    But actually taking the time to investigate the big picture, and go deeper than a few blurbs and catchy headlines in a magazine or newspaper would take time and effort, which is something that most Americans seem to refuse to do.

    --

    --
    Soma: because a gramme is better than a damn.
  213. Don't blame violent games... by Ig0r · · Score: 1

    Blame Canada!

    --

    --
    Soma: because a gramme is better than a damn.
  214. I want to write a violent video game now by LordM0rdor · · Score: 1

    Ok, enough is enough. Any rational human being will know the difference between the real world and video games...those who falter are the disturbed, and would eventually go postal any way, so why worry? Sure playing MK makes little kids play fight, but what the hell is wrong with that? When I was a kid I play fought to a G.I. Joe theme....the difference is?

    I think these people aught to get their thumbs out their asses and study something important.....Like 3d hardware (muhahaha). I am not much of one for writing video games....hell the last one I wrote was pacman for my palm pilot... but now I think I will go write a game where the whole point of the game is to walk through a school and shoot random students.... and ya get extra points for hitting teachers/administrators/staff ;>

  215. Noone's placing the blame. by theghost · · Score: 1

    Noone is trying to place the blame on anything in particular here. They are looking at one of the factors involved in the increasing violence present in our society at all levels, and trying to understand if it really does pose a threat.
    To pull a quote from the article:

    "In sum, Study 1 indicates that concern about the deleterious effects of violent video games on delinquent behavior, aggressive and nonaggressive, is legitimate. Playing violent video games often may well cause increases in delinquent behaviors, both aggressive and nonaggressive. However, the correlational nature of Study 1 means that causal statements are risky at best. It could be that the obtained video game violence links to aggressive and nonaggressive delinquency are wholly due to the fact that highly aggressive individuals are especially attracted to violent video games. ""

    I believe in non-violence. I believe that exposing oneself to violent images, games, discussion (eg role-playing games), and thought (eg I'd like to plant roundhouse kick upside Fred Phelps' head!) are inherently harmful to the human spirit/psyche/whatever. I still love the Matrix, i still like games, and i'd still like to lay the smack down on Phelps.
    Just because we acknowledge that something is bad for us doesn't mean we have to give it up. Understanding the effect these things have onn us allows us to consciously counteract them. I choose non-violence though i am predisposed to violence.
    Don't get defensive and lash out at things like these without trying to understand, or you risk becoming more like the mainstream - don't lash out at everything that is different from your view. This is the sort of behavior that fuels the rage of the would-be killers.

    --
    The only thing necessary for the triumph of evil is that good men do nothing.
  216. Did you read any of the study? by DavittJPotter · · Score: 1

    I personally thought the most sad sentence of the study was on the first page, regarding a video that the two Colorado killers: "In the video, Harris and Klebold dress in trench coats, carry guns, and kill school athletes. They acted out their videotaped performance in real life less than a year later..." And the media is blaming VIDEO GAMES and EASILY AVAILABLE GUNS?!!?!??! None of the teachers immediately had these two boys examined/locked up/helped? Apparently not -- because we've seen the terrible aftermath. Perhaps someone should actually start *helping* these kids. And guys/girls - the "I'll kill you if you think my games are bad" comments *aren't* going to make a positive impression...they'll just reinforce the media's and most of society's view of /.'ers and other computer geeks/nerds/whatever you want to be called. My $.02. DJP

    --
    "If there's hope, it lies in the proles..."
  217. Re:Missing the point by redragon · · Score: 1
    "One study reveals that young men who are habitually aggressive may be especially vulnerable to the aggression-enhancing effects of repeated exposure to violent games," said psychologists Craig A. Anderson, Ph.D., and Karen E. Dill, Ph.D. "The other study reveals that even a brief exposure to violent video games can temporarily increase aggressive behavior in all types of participants."

    I've got a better idea! Let's expose "young men" to Sunday Football (Fake Wrestling, whatever...), and I bet that it's even worse. They choose to go after video games because it's a freaking fad to blame things on.

    Anyone notice that CNN, NBC, ABC and CBS are often times the first to jump on this bandwagon? Wonder why? Cause they show more f-ing violence than I'll ever get in a four hour Q3:Arena session.

    I think they should find something new to blame.

    Like EVERYONE.

    Cheers,
    Casey

    --
    - Sighuh?
  218. Re:Yet Another Study.. by Pinball+Wizard · · Score: 1
    If you ever want a good laugh, dig up an old health textbook from pre-1930. The prevailing wisdom was that masturbation caused innumerable evils in adolescents, including poor health, antisocial behavior, and insanity.

    Parents were made to believe that it was imperative to prevent their children from ever masturbating. Even once would ruin the child forever.

    Its was what the experts all said, so it must have been true.

    --

    No, Thursday's out. How about never - is never good for you?

  219. Of course aggressive people like to play Doom... by MasteroftheVoxel · · Score: 1

    Its seems funny to me that people point to the fact that Eric Harris (of Columbine) liked to play Doom as one of the reasons he committed the act he did.

    I would find it unusual if he _didn't_ like to play Doom.
    Doom is violent. So are war movies. So is hunting. The fact that a person with a violent personality likes to do violent things is not a surprise to me.
    It also says nothing about whether these violent activities _cause_ violent behavior in youth. I love to play Doom and Quake too, but I am probably the least violent person you could meet. For me, these games provide an outlet to relieve some frustration and aggression that we _all_ experience from time to time. The games don't make me more violent.

    Now Doom is probably not for the small child. But as for the teenager who likes to play Doom and then kills a dozen of his classmates. I think there is something else wrong with him. Its due to something more than Doom.

  220. Re:A very good point! by Xiombarg · · Score: 1
    do me a favor, will ya? explain to me how "practical" your hunting rifles and shotguns and handguns will be when pitted against the artillery and armor and aircraft of a modern army, which is who you would be facing in any "war of independence."

    It took only a handful of men and a few miscellaneous handguns and rifles (about a dozen total) to hold of the S.S. in the Warsaw ghettos during WWII - for over two weeks.

    Ever heard of Afghanistan? Seems that the mighty Soviet army had a hell of time there, fighting against an unskilled population with bolt action rifles. As I recall, the Soviets did not win, and they had tanks, helicopter gunships and jets.

    It seems unlikely by your comments, that you have ever read anything related to military combat procedures, nor do you have any personal experience with such. The infantry soldier is the primary weapon of the military: period. Aircraft are easy targets. Tanks don't last long without infantry support. Artillery won't function when the men around it are dead.

    And every bit of equipment disabled or abandoned, for any reason, is open to capture by your opponent.

    Assume for the moment that you are the President of the United States. The government you sit upon has collapsed under your tyranny and licks your boots. But, you are facing an armed population, half of the United States to be precise: which outnumbers your standing military 200 to 1. Assuming only 10 percent of this actually fights, you're still outnumbered 20 to 1. Are you going to shell your own cities to get this guerrilla force? Nuke New York? If you do so, do you think that the people who were standing on the fence are going to suddenly side with you - a government murdering its own people?

    Weapons of mass destruction are simply out of the question. You can't just shell Chicago to get the "rebels" because a goodly portion of the population is either neutral or on your side. You are fighting a guerilla war, where the enemy might be one of your own cabinet members, or the chef down in the White House kitchen, or the talking head on CNN describing the last failed attempt at quelling the descention.

    c'mon, gun nuts - i'm serious. who out there really thinks that they and their hunting buddies could hold out against the U.S. Army for more than, say, 24 hours?

    Some of us "gun nuts" are ex-military. Some of us are active military, for that matter, who will not side with a despotic government. Could we hold out against the US Army for more than 24 hours? In a properly run guerrilla war, we could hold out for far longer than 24 years. Remember Viet Nam? We don't need tanks and planes, we have the most powerful weapon available, the foot soldier and his rifle.

    - Xiombarg

    --
    Hypocrisy is the Vaseline of social intercourse. -- R. Heinlein
  221. Next Study... by lbrlove · · Score: 1

    Okay, here's the next study to perform:

    Does being in the military lead to more violent behavior?

    I suspect that this has to be more causative of violence than video games. Consider that video games are a virtual experience, often involving the destruction of enemies that are understood to be unreal. The military teaches the destruction of real people and objects, and makes the ways and means of doing so mundane.

    If my hypothesis is correct (feel free to flame if you know better), then why do we consider veterans good people to hire, know, and work among?

    The reason is because nobody has pronounced the military to be loner/geek/outcast behavior, so it cannot be duly attacked with presumptive logic and judgmental studies. Food for thought.

    -L

    1. Re:Next Study... by lbrlove · · Score: 1

      I actually agree with you, but was more striving for some introspection by people who commit stupid studies based on unsure correlations. Good point though.

      -L

  222. Re:Well, Duh! - Remedy? by lbrlove · · Score: 1

    Okay, so two hours of HGTV for every hour of frags. I really like how we know everything about how the brain works, and that everyone's neural networks work identically, or even average out to working similarly.

    So now, instead of being left-brained or right-brained, you are either "gun-brained" or "plowshare-brained". I come away from this discussion feeling that someone should be just plain brained! Uh-oh, those damned video games talking through my fingers again!

    -L

  223. GODDAMN LIARS by TheSims · · Score: 1

    THOSE BASTARDS! VIDEO GAMES DO NOT MAKE PEOPLE MORE VIOLENT. WHO ARE THESE PEOPLE? I'LL SHOVE A HAND GRENADE UP THEIR ASSESS, I WILL. SOME NERVE, TELLING ME I'M MORE VIOLENT JUST BECAUSE I PLAY QUAKE III 6 HOURS A DAY. WHERE'S MY MACHINE GUN?

    --
    -- I've never seen electricity, that's why I don't pay for it.
  224. video games linked to gulf war victory? by -DeeT · · Score: 1

    So long as we're postulating side-effects of playing video games, how about preparing those skillful pilots to kick saddam's booty in 1991? People who were young adults in the early 1990s constitute the first generation to grow up with video games.

    --
    fghit entyrop
  225. Remembering Jazz Jackrabbit... by Evernight · · Score: 1
    I was walking through the mall the other day. Saw about twenty guys standing around quietly waiting their turn to play Unreal Tournament in the Mall's new isolation booth kiosks.

    Not two hundred feet away I saw about twenty women of various ages pushing, shoving, and cursing while standing in line with their kids (who were more behaved than the mothers) to get their pictures taken with the Easter Bunny.

    On a side note: After spending the last six months playing Quake II, Unreal, Half-Life, etc., I'd probably get pretty annoyed too if forced to endure a couple hours of Wolfenstien 3D.

    Neu

  226. Re:I agree by jargoone · · Score: 1
    Yellow fur? That's nothing. It took me months to my arms and legs as long as Dhalsim's. I can kick people at the drinking fountain while I'm sitting at my desk punching people. Try that with your yellow fur.

    :P

  227. The Real Evil Game. by Slashdolt · · Score: 1

    It is a two player game. It is one of the most insideous games ever invented. Small children should not be taught this game and should never be allowed to play this game. Although the objective of this game is to kill only one of the opponents players, in order to do this, the player will willingly sacrifice some of his own players! Also, each player will routinely kill the other's players to accomplish their end goal. I have seen people get extremely upset and violent after playing this game. It is a terrible game. Yes, please do all you can to ban CHESS!

  228. Errrr... by /dev/urandom · · Score: 1

    Definitely right on! I mean, every time I finish a round of Q3 I go out and shoot everything in sight.

    Seriously though, somebody should look into the violence increase in people who play Windoze games. I mean, having a crashy OS is bad enough, but not being able to run stable games to vent your frustration...

    Oh and let's not forget modems, the most irritating of all technology! Now THOSE make me angry... well back to my 4000ms pings in UT. :-P


    -----
    "It is not enough that I should succeed. Others must fail."

  229. Re:Look at this study for what it is... by The+Presence · · Score: 1
    This article (the one /. linked to, not the actual APA article) is a classical example of bad journalism. Obviously whoever wrote it doesn't know squat about either social psychology or logic and deduction in general.

    The APA articles cites two very distinct studies. One shows are "positive relation" between violent video games and delinquency and violent behavior. Not exactly a shocking find that violent people are attracted to violent activities. Not a word here about people being MADE violent by video games.

    The second part of the study's conclusion is consistent with the GAAM, much in the way chocolate chip cookies are consistent with a heliocentric solar system. The GAAM is a theory thats been around for a while that merely states that frequent participation in aggressive activities increases accessibility to aggressive behavior scripts. Scripts are basically preset patterns of behavior frequently accessed and used mindlessly (for example a grocery shopping script or a going to the bathroom script).

    Is there anything wrong with this? Take someone who studies martial arts. A big part of that is to increase your own scripts for self defense. To be able to defend and counterattack with learned techniques without thinking. This is the entire point and there's nothing wrong with it.

    These studies have to be taken as saying a lot less than journalists and lay readers think they do. Usually its quite right to think that it proves the obvious. Aggressive behavior leads to arousal and to aggressive thoughts..well duh...its not going to lead to thoughts of teddy bears and fluffy kittens. This study is a long long way from asserting anything like a causal relation between violent video games and violent behavior.

  230. Re:I'm not violent by Dries · · Score: 1

    SERIOUSLY violent games.... you know what I'm talkin about: Carmageddon, Kingpin etc.
    I hope they'll never play Soldier of Fortune. For those guys is Pac-Man a violent game.

  231. Re:Studies show religion increases violent behavio by Dries · · Score: 1

    There is no "proof" and yet believing in gravity is not considered a matter of faith.
    May I point out that there IS a proof that gravity exists, just jump out of a high building and you'll notice that soon enough.

  232. Time to ban the Football team... by Goon+Number+1 · · Score: 1

    I mean, c'mon, if people who already ahve a predisposition for violence are more aggresive after playing a violent video game, then surely they will be even more aroused after playing an actual game where all their senses and their bodies are used.

    So, therefore, the football, wrestling, lacrosse, field hockey, basketball, etc teams should all be banned from our high schools. Medicate the kids, lots of valium and prozac for everyone, and nothing but scenes of pastoral splendor on the television for all to enjoy.

    We should all be passive drones, with no passiosn, no individuality, and no opinion other than what we are given by the News. Don't blink too often, act depressed, or get too excited, or you will be medicated down with the rest of us.

    --
    http://radio.weblogs.com/0103443/
    1. Re:Time to ban the Football team... by YoSPo42 · · Score: 1

      Ever read "Fahrenheit 451"?...if not, read it. The parrellels are AMAZING. like a prophecy fortelling the future.... We should all be passive drones, with no passiosn, no individuality, and no opinion other than what we are given by the News. Don't blink too often, act depressed, or get too excited, or you will be medicated down with the rest of us.

      --
      ////
    2. Re:Time to ban the Football team... by anonymous+cowerd · · Score: 2

      > surely they will be even more aroused after
      > playing an actual game where all their senses
      > and their bodies are used.

      First, a disclaimer. I loathe sports. Mencken once suggested that all golfers should be prohibited from public office; I go one step further and propose that all admitted sports fans should be disallowed from voting altogether. In addition they should pay double taxes and be forced to wear dunce caps when in public. Now that I've made my personal prejudices clear, I'd like to play Devil's advocate here.

      I spent about a decade doing outdoor construction work for a living. Admittedly, while it was physical labor, in contrast with competitive sports, it was not particularly antagonistic in nature; the closest it came to being aggressive was when I had to attack and chop out a survey line with my machete. But it was my experience that after a few hours of hard physical labor, I always felt a pleasant and relaxed sensation, and I was not the slightest bit inclined toward violence, quite the contrary.

      It's possible that the problem with video games is not just the aggressive mental tension they induce, but that psychical aggressiveness combined with the complete physical torpor induced by sitting still in a chair for hours on end, with even the movement of your head and eyes damped down to stasis, as you focus on the computer screen. You get all the mental tension of combat, together with none of the release of strenuous physical activity.

      I'm 45 years old. Probably most slashdot readers are younger, and thus healthier and more supple than I am. Last year I bought Quake II for my eight-year-old son (who loves it, and who is, by the way, the happiest and most good-natured little boy I ever met). I played it a few times. Every time I got deep into fragging, when I finally gave up, I would discover that it was three or four in the morning, I was soaked in sweat like some dope fiend coming off a binge, and my body ached all over like I had been beaten from the strain of holding myself rigidly in position before the monitor. I had to give it up! By comparison the after-effect of a ten-mile hike under the Florida sun is a gentle caress.

      Yours WDK - WKiernan@concentric.net

  233. Re:It's a symptom of America's society by B-B · · Score: 1

    How in the FUCK is that flamebait? Who is s/he flaming?

    That was a well thought out comment.

    OK, education time.

    Moderators are not doing their job.
    (Not flamebait)

    Who is the crackwhore fuckhead with the cranial-rectal inversion who modded this?
    (flamebait)

    Get it?

    Sheesh.

    --
    Reality does not happen until you analyze the dots. -Don DeLillo (Underworld)
  234. Re:I'm not violent by doboji · · Score: 1

    My thoughts exactly.... I've played far more violent video games than anyone I've ever met... and I mean SERIOUSLY violent games.... you know what I'm talkin about: Carmageddon, Kingpin etc. Not light weight crap like doom... And I'm as peaceful as can be... when I murder people I'm extremely humane about it. Seriously though... it's a big fat joke... there are so many factors involved in violent behavior... you can't pin the whole phenomenon on any one activity. -Max

  235. Maybe... by maddurbation · · Score: 1

    now that i think of it, after i had played quake III for about 4 hours, i did go outside and kill every one eyed monster with my plasma gun that i could find, they must be right

    --

    "spare the lachrymosity when the fulminations have inveighed"

    -madd
  236. Re:The experts have an opinion, or three by sqlrob · · Score: 1
    Still offtopic, but at least on this one.

    Excess Vitamin C (currently anyway. Wait awhile, it may change) is harmful, for more than one reason.

    Vitamin C may clog arteries

    Vitamin C may worsen cancer

    I believe high amount can also cause kidney stones (brief blurb here )

  237. Re:The experts have an opinion, or three by sqlrob · · Score: 1
    It's not useless. It's downright dangerous. But then again, so is water.

    The right quantity of C will prevent scurvy. Too much supposedly helps in hardening of the arteries.

  238. For those of you who... by Rhesus+Troll · · Score: 1

    Don't want to read all the posts, here's what we have so far: 1. Video games don't make me violent, and if you say otherwise, I'LL KILL YOU! See? I'm using irony! Ha ha ha! It's fun to have fun! 2. This study is stupid. I play violent games all the time and I've never hurt anyone. Therefore, everything that applies to me must apply to the other 6 billion people on this planet! 3. Doom? Wolfenstein? No wonder they turned violent! Because they're old games! Get it? I'm clever! 4. Well, of COURSE violent games will make people violent for a short period of time. How OBSERVANT of the psychologists to figure that out. And LOOK, they figured out that video games make your grades slip. WOW! Look, I'm being sarcastic! Everyone loves sarcasm! 5. 195th post! 6. Look at me! I did a "summary of all the other posts" post! Aren't I novel?

  239. Re:Studies show religion increases violent behavio by alphasigmaphi · · Score: 1

    Religion has to be more violent than video gaming...when clans go to war, no one gets hurt (other than some bruised egos)...but when the religions go to war...well, there's always the Crusades for an example...

  240. Ok here... by genki · · Score: 1
    Playing video games increases destructive, not violent behavior. Violent is what you call playing football - when you actually are pounding on another living, breathing human being. Destructive is playing a video game, killing simulated aliens. Got it? Good.

    BTW, Oog, if you're reading this, please comment on this!

    ---------------------------------

    --

    ---------------------------------
    Visit
  241. Nice choice. by binarytoaster · · Score: 1
    Let's see. Who's going to be more violent, someone who shoots Nazis for a while, or someone who sat around playing a game where you wander around an island doing nothing but solving pointless puzzles? :)

    Yes, I think we know very well that a violent video game could possibly cause violence in a child. (Watch me get flamed for this.) I know, it's not nearly to the degree the media would like to have us believe. But, as they do say, if you do something long enough, eventually IT becomes habit. That means if you're a small child and can't distinguish reality from fiction...

    However, I must also rant about the fact that parents may complain, but they really don't give a crap. I recall a time when Wal-Mart instituted a ratings enforcement system; if you were not the recommended age for a game, the store clerk WOULD NOT sell it to you. Now, this is particularly interesting due to the fact that parents are the ones that continually yell and make general noise about violent video games being "bad" for our children.

    When a store clerk would not sell a M-rated game (I think it was Parasite Eve) to a child of about 11, he walked out - only to return with his mother, who flew into a rage at the fact that her little boy couldn't buy this rather violent game. She eventually bought the game for him.

    What's funny is that parents have no problem doing this, but if that same 11 year old boy had asked his mother if he could have an R-rated movie with pretty much the same contents (only slightly less effective in terms of violence due to the fact that it's non-interactive) you know what the answer would have been.

    It seems parents may rant all they like about videogames causing violence, but do they DO anything? Nyeh...

    -=-

    My Karma just ran over your Dogma.

  242. Take that back, or I'll kick yer ass! by croot · · Score: 1

    Hey, remember when Dungeons & Dragons was making our children violent? How about heavy metal? Funny that nobody ever condemns the more popular expressions of antisocial behavior, like foo'ball. This is a classic example of chicken/egg logic. Which came first, video games or violent behavior?

  243. Several worrying aspects in the Paper by tagishsimon · · Score: 1
    Other posters have noted two aspects of this study that most concern me:
    • What looks like gratuitous topping & tailing of the paper with references to Columbine ... quite apart from the publication date dovetailing in with the anniversary of that event. This gives rise, in me, to the suspicion that the researchers are seeking publicity more widely than that afforded by peer-reviewed litarature.
    • The absence of any caution as to the difference between causation and correlation. Obviously, in the Journal of the sort in which this paper is found, readers are expected to undertsand this difference. In the wider world, one is oft times mistaken for the other. (Which is why the sun comes out when I take off my sweater).
    I was concerned about a couple of other things I spotted in my first read-through:
    • The increase in Aggressive Behaviour of the users of 'violent' games over users of 'non-violent' games seems to me to be very slight indeed, and lower than the increased aggressiveness (as measured in this experiment) between Women and Men' and in any event lower than the measured aggresiveness of Women. Scary. (and also probably an ignorant misreading by your's truly ... still, thats what it loks like.
    • More interestingly, the researchers having dissed other research early in the paper "our literature review revealed that the few published studies to date have not adequately tested the video game hypothesis", are content later in the paper to make statements such as "this particula pair [of studies] adds considerable support to prior work".
    The Summary and Conclusions paragraphs seem way overblown, considering what seem to me to be the relatively slight findings of the paper; certainly I came away with the impression of researchers who are anxious about the supposed risks of violent video games, anxious for some fame in this reseach field (hey, you gotta eat) and anxious for further funds for more research.

    And none of this says much at all about the Hellmouth and the 1,001 other reasons that people reach for the cudgel, chain or carbine. Not that that is a criticism of this paper, although like other posters, I fear the Daily Mail (and your US reactionary equivilant media) will seize on this to drub games & gameplayers, whilst siting inadaquacies of schools, teachers and systems in their blind-spots.

  244. Re:Studies show religion increases violent behavio by OzymandiasCJS · · Score: 1

    Perhaps we should all re-examine this chain of thinking...
    the greatest crimes ever committed against humanity were done by ATHIESTS (such as Hitler, Stalin, Mao, ect.)
    these atrocities merely seem to be the greatest beacuse of their temporal proximity... but really lets look at some recent but not nearly so publicized (recently) atrocities: Slobodan Milosevic (that guy in Croatia... the patron saint of ethnic cleansing) or just glance at the relations between northern Ireland and the UK... whats with these people... it seems then that if you even examine the earlier examples of Hitler, Mao... they were also killing in the name of 'god' or perhaps themselves as they saw it. But I must say that the number of atrocities commited every day, and I don't just mean killings I speak of social ostacization and other mean and nasties, in the name of 'our friend' the christian god makes those 'atheist' killers seem like children. Now I don't mean to just launch into an all day anti-christian rant, we all know i can do that forever... This can indeed be brought back to the topic at hand. While it would be true that if more people belived in the christian religion as it is WRITTEN the world would be a better place, problem: it only takes one disaffector to bring the whole thing down. That and it could probably be shown that many 'christians' are exactly those responsible for the feelings of ostrasization and isolation that fellows like Klebold and Harris felt. You see religions themselves and their believers are not at fault its the pretenders... those who want to believe but don't want to go to the trouble of actually finding out what it is that they need to do to be better human beings... they want a 10 or so item 'code of conduct' to pay lip service to that will make them feel superior to the next guy, and possibly speed him on his way to whatever post-mortem fate may be his due. -- My two cents nothing more, nothing less. I speak for no-one but myself, and not even that most of the time.

  245. Exactly! by The+Evil+Beaver · · Score: 1

    I find that playing vioent games like Half-Life or Quake are good for relieving stress, except when Windows crashes while I am playing...
    After playing something like Half-Life for a while, the chances of me getting into fights and the like at school are drastically reduced. All this report is is more of our backwards society's pop psychology.

    ----------
    Is this sig off topic?

    --
    Chris 'coldacid' Charabaruk Meldstar Entertainment
  246. the real reason for Columbine by kz45 · · Score: 1

    I think they forgot to mention the fact that the kids that shot up the school at Columbine were taking anti-depressants. Although video-games nowadays are violent(and I love every one of them, especially old school Q1 TF), they are not the direct cause of the acting out of violence. Here are some theories I have on the causes:
    1) The parents: They should actually spend time with their kids, instead of having the TV babysit.
    2) the kids were mentally unstable anyway, and the assholes at school who were bullying them every day of their lives didn't help much either. They were going to crack: anyone would under such circumstances(For some it would have been a fight, for the mentally unstable....). No-one deserved to die, It kind of pisses me off, though, when they interviewed the alleged bullies, and they still say that they didn't even know that they were getting bullied. If Anyone has ever been in highschool...they know...those kids probably got humiliated by the athletes for months.
    3) government testing: Here is my government conspiracy theory. Isn't it kind of funny how we have had so many school kid shootings in the last 10 years. The governement could be testing some kind of drug or device that makes anyone into the perfect soldier...willing and able to do any kind of killing, without even thinking about themselves or their family. And what perfect way to convince the American Public that Gun Control is the Answer.

  247. Re:What about Dungeons and Dragons???? by Goat+Slammer · · Score: 1

    I play a role playing game loosely based on the intricate art of slamming goats. this is fantabulous. role the 20 sided...slam a goat...role the 12 sided.....slam your friends goat....role the 10 sided......slam 2 goats at the same time.....role the 8 sided....slam the first goat you slammed......role the 6 sided....slam the closest baby goat....role the 4 sided....slam a billy goat.....flip a coin....slam a choice ripe goat....i usually forget the RPG at this point and just start a giant goat orgy. WOOOOOOIIIIEEEE slamming here slamming there BBAAAAAAHHHHH. they are all screaming for it they cant get enough.OH OH i forgot video games taught me how to slam goats. there was this game and it was.....BBAAAAAAAHHHHHHH, and and and it could be a 3 player game and....BAAAAAAAHHHH... hold on ill go get it right now....BBBAAAAHHHHH... im untouchable....they cant touch you...BBBAAAAHHHH...WWWOOOOOOOOOIIIIEEEE. D&D..WOOOOOOOOIE... D&G....Dungeons and Goats.... BAAAAAAHHH.

    --
    Candy is Dandy but Liquor is Quicker Goats for me in 2's and 3's WOOOOOOOOOOOOOIE
  248. Deflecting Blame by cibrPLUR · · Score: 1
    Reunion of Colombine and Oklahoma, lets blame something for all the violence we're hearing about. Oh, we haven't used video games in a while, let's use that. Good idea.

    --

    -cibrPLUR

    1. Re:Deflecting Blame by cibrPLUR · · Score: 1

      Ok, then we should pass a law that only lets people who are semi-intelligent or greater play violent video games.

      --

      -cibrPLUR

    2. Re:Deflecting Blame by [aSe] · · Score: 1

      I'd have to agree with you.. Sadly, the media has no real answers to why we have school shootings.. So they look for something to take the blame... We know the difference between Doom (or whatever shoot 'em up) and real life.. tis sad..

      --
      .o0o. Just Another Lamer .o0o. [ I have no life, feel free to e-mail me ;) ]
  249. Re:Studies show religion increases violent behavio by eean · · Score: 1

    Would the "Cultural revolution" really be counted as unreligious? I'm mean there athiest, so they have blinded faith in it just like other religions (I'm anogistic myself)
    Suppose I can't argue with the killings by Stalin (which I assume goes under the "Russian Revolution" term) sense most of them were for polictically reasons.
    However, I think that a religion (I define religion in the faith of something relating to the otherwise unexplainable) of some kind is just part of human nature so it is true that
    religions have led to more violence for the same reason that humans have led to more violence.

    Ian

  250. violence eternal...the human condition by Kanon42 · · Score: 1

    maybe instead of blaming every media source under the sun we should look at our fucked up civilization for the cause of violence. Parents beat their children who beat their children who beat... maybe its not tv/videogames/internet/thinking maybe its just our whole mindset as human beings i look on video games as a way of getting rid of excess violence in my life look what just happened in florida! its not our entertainment its the goddamn human condition

    --
    -Kanon-
  251. Re:I'm not violent by 72beetle · · Score: 1

    >... there are so many factors involved in
    >violent behavior... you can't pin the whole
    >phenomenon on any one activity.

    Sure you can. That activitiy is POOR PARENTING. It's not necessarily a character flaw in today's parents that cause kids to lash out in the most primal of ways when dealing with a tense situation, but today's both-parents-work-and-see-the-family-maybe-an-hour -a-day society takes family focus away from the parent(s). Studies have proven that animals without parental guidance have grown up to be more violent and anti-social, and people are just animals with better taste in clothing.

    --
    -Those who dance are considered insane by those who can't hear the music.
  252. Re:Doom? Wolfinstien?? Mortal Kombat??? by zombieking · · Score: 1

    But, either way you look at it, It isn't real. It's just entertainment. In Saving Private Ryan, that guys head popped like a zit, but it was just entertainment. If they attack video games, I think you have to attack ALL forms of media as well.

    --

    -----
    "The only difference between me and a madman is that I'm not mad." - Salvador Dali (1904-1989)
  253. Is this science? by Wolfgang+Anonymous · · Score: 1
    It seems that a study like this is not undertaken to discover something. It is undertaken to prove something, or more likely, to prove anything. The world (such as it is) awards scientist-type folks not so much by what they discover as much as how many times they're published in the elite trade journals. I find this fact far more disturbing than any of the findings. But it's an expensive world, and the journals have bills to pay, too. Is someone, PhD or not, more likely to read a topical article on violence and video games, or some tired old article on nutrition and childhood development?

    Of course video games have some effect on behavior. I no longer drive immediately after playing Gran Turismo. I would find myself swerving in and out of traffic, and taking risks I never would take otherwise. But after about 30 minutes or so of rest, I can drive normally, with no desire to daredevil. And after marathon sessions of Sim City 3000, I would find myself walking around condemning poor city planning, and mentally calculating the cost of rerouting freeways, eliminating polluting industries, etc. So it is not surprising to me that airhorn aggressiveness is more intense immediately after playing Wolfenstein. I suggest this effect is temporary: contine to measure subject's agressiveness throughout the day, and let me know of the results. I doubt you would find any correlation to the type of game played. In fact, I would not be surprised if the opposite is true. Wolfenstein player may have experienced catharsis (releasing real emotions in response to artificial stimuli), lessening any aggressive thoughts. You've experienced catharsis if you have ever laughed (or cried, felt tense, etc.) in response to a situation in a movie or television show. But even a longer term stidy would not be science without a big enough sample, as video games are not the only effect in any person's life.

    --
    I'll call a fig newton a cookie if I want to
  254. lan parties by miss_america · · Score: 1

    this past weekend the university of kentucky lug had lan party. no one has went out and killed anyone. of course we are all sane/normal/educated indivduals.

    parents and kids need to learn that these things are only a game.

    Like the saying goes: Guns don't kill people, people kill people.

    --
    -If at first you don't succeed, call it version 1.0.
  255. Re:TOTAL CRAP!!!!! by fl�me�ator · · Score: 1

    for the love of god I hope your a troll....

    Good guess.

    --


    HI!!!!!!!!
  256. Re:False Statements and other sources by onegligen · · Score: 1

    There is stong evidence from the battlefields of world war I and II, that majority of solders had it very hard to start shooting their "enemies" because they were too shocked about the idea of killing someone. This sort of "incompetence" does not exist any more, thanks to violent video games that among other methods are used in military training to teach solders teamwork in killing people.

  257. Out of the closet now by dannk · · Score: 1

    Ive been reading /. for some time now and have never posted but w/ this topic im coming out of the closet. LEt me start off by saying ive been playing video games for an unhealthy amount of the day, everyday, since i was in the single digits (atari 2600 days). Heck, playing games even got me my first job. ANd the worst thing i think i may have gotten from it is some chalky skin in the summer from being inside more then i should (but hell, im sure some girls like chalky, pasty skin and im sure if the sun gives you cancer ill be alright... but if monitors give you cancer...) anyhow. I ask myself. Does/do video games tend to make me more violent? I think not. Does Jerry Springer make me want to dress up like a woman and date my sisters, uncle, cousins father? No. After playing a game of Counter- STrike, do i want to run down to the local army surpluss store and get me one of those dandy MP5's and take out the VIP? i think not. Does it desesencitize me to viloence? Sure it does. Does T.V. do the same? Sure it does. What came first? How do i know i wasn't pretty much already desencitized to the whole thing before the graphics got far along enough for people to complain about it. Or for the children today, im sure theve watched alot more T.V. before there gaming days begin. Lets face it, "Battle Tank" for the 2600 isnt going to make people violent (except maybe for that bored w/ the invisible tanks + bullets, i can see getiing pissed at that). So is it possible that the 14 or so years before that the Rape, and murders, and the evening NEWS would make me more violent? How can you do a study like this and single out one thing and say, study shows that..... There is alot more to life then playing video games. But maybe if they can clone a few kids, and not let themn have any interaction w/ anything excpet for video games they could prove a point, the scientists are wack! (poor cloned kids). But really. Why is everone (um...everyone: Everyone but us) always looking for the blame? Could it be parenting issue? Hell NO! There is nobody on the face of this plaent who has not done a perfect job in raising a little angle, you all know this is true. Every kid had the values and morals infused into them by there parents when they get home from work at the end of the day, after dinner, before the game or the movie, right before johnny goes to bed, that makes them perfect children. Ofcourse the deeper issue here is "the kid from across the street", they are always evil........ Is it possible that some of us have inherit traits, violence being one of them? Its o.k. if our dog gets out of the house a starts "rounding" up the neighbors cats as well as the neighbor. We can just say "well, thats what he was bred for, hes a hearding dog". And poeple will agree w/ that. Isn't it possible, after thousands of years of hunting and killing, each of us has a natural hunter instinct in us? Wether we respond to this in any form is dependent on the person, but its just as possible for Quake making me joing the neighborhood clan w/ the kid from across the street as long as i can bring my hatchet along. Are they gonna do a test to see if video games make you stupid also? They should get a whole bunch of kids, make them play UT or Q3 and then have them stand on the roof of a 4 story building and ask them whats the health/armour ratio loss if you were to jump? Then ask them to demostrate (ovcourse it would help if you put a carboard medipack at the bottom so they could get that +20 health at impact). Shoot, when i was young i made carboard wings and thought i could fly (thank god i didnt have access to the roof, or maybe too bad?). ok, ive rambled long enough and my MP5 is really starting to dig into my hip. My boss is like 10 cubicles down so im thinking of I duck and strafe inbetween cubicles, and providing there are no "secrets" on the way, i should be able to finish off the whole complex w/ 5 minutes. If not, its no big deal, i know the console command for god mode... but first it think im just going to walk around and test my FPS.

  258. Another bogus "science" article by kenhuie · · Score: 1

    Their own words: "However, there is presently no empirical evidence on whether playing a violent video game increases accessibility of aggressive thoughts." So the article is nothing but smoke & ramblings.

  259. Video Games by Raystlyn · · Score: 1

    The report PROBABLY meant that aggressive and delinquent people often play violent videos games. See what the prior sentance says...? These people are aggressive and delinquent to begin with, video games have nothing to do with it. "Always look on the media with a critical eye... yes, even Slashdot."

  260. Re:I agree by nyboi · · Score: 1

    What do you mean that video games are VIOLENT!. I will beat the crap out of whoever came out with that comment! You better watch out!!!!!!!!!!! violence, yeah! whatever.

  261. Game Violence - as seen from the inside by thenoog · · Score: 1
    From a fellow gaming-industry worker:

    If it were absolutely 100% unquestionable that some aspect of your game was causing 0.01% of players to commit homicide, would you still add that feature?

    Game violence as observed from INSIDE the industry:

    Violence Rationalizations

    Enjoy!

    --
    - In a knowledge based industry your main asset will always be people -
  262. Can't believe people let this one slide... by Qalat · · Score: 1

    >In the 1980s, arcade games like Pac-Man became >dominant. In Pac-Man, a yellow orb with a mouth >raced around the screen chomping up ghosts and >goblins. I'm sorry, but how can you do two detailed studies on video games and NOT KNOW A DAMNED THING ABOUT PAC-MAN??!! At this point in the report, I was pretty well convinced that their findings were irrelevant.

  263. Seems something is missing in this study by ollymgs · · Score: 1

    Hmmm I read the study, If you play voilent video games you become agressive according to the research. Only they forgot the the following: Agressive people looking to express themselves are more atracted to voilent video games. IMHO playing these kind of video games is more a way of some agressive people to express themselves and absolutly not the cause of deliquent behavior.

  264. Quick Calvin and Hobbes Quote.. by Pezonikz · · Score: 1
    This reminds me of a comic strip done by the respectable Bill Watterson. It shows Calvin sitting on the couch, watching TV.

    Calvin:
    Graphic violence in the media.
    Does it glamorize violence? Sure. Does it desensitize us to violence? Of course. Does it help us tolerate violence? You bet. Does it stunt our empathy for our fellow beings? Heck yes.
    Does it cause violence?... Well, that's hard to prove.
    The trick is to ask the right question.

    You don't have to agree with it, it's just something I like. Peace.

    --
    -"Connect like dots, flow like hardened concrete."
  265. Re:Man! they are reaching... by drwiii · · Score: 2

    Super Mario Bros. is violent. In real life, you wouldn't believe how many turtles I stomped on and kicked. I finally learned my lesson when one bounced back at me off that sewer pipe in the back yard, though.

  266. Re:Statistics abuse (correllation) by hawk · · Score: 2

    I don't know if I'd go as far as calling it a claim; it seems to me to be a smaller step than that.

    I'm just saying that someone who is already likely to blow real people away probably has yet one more reason to play games where he pretends to do so . . .

    Nothing in there suggests a causal relation *from* the game to a real shooting.

    However, diverting them in this way makes esnese (but so does handing out 9mm ammunition to street gangs, figuring that by killing more of them this way, you save more lives than you lose in innocent bystanders during the fihte . . .)

  267. That's amazing. by the_doctor · · Score: 2

    Academic achievement was negatively related to overall amount of time spent playing video games.

    Holy cow! These guys really are smart. I think they must have been talking to my mom.

  268. Most People Eat At McDonalds. by Seumas · · Score: 2
    Well, you stole my thunder -- but well put!

    The first thing that crept into my mind when I saw the article on Slashdot was that this article would either be a completely unfounded urban-legend (like the rise in domestic violence on Superbowl-Sunday which, only in the last year or two, has the media actually started to act responsibly for and even admit that it is a completely unfounded and made-up statistic) or that it would basically have the following point:

    People who are violent tend to play violent video games.

    Well, duh.

    This is along the same line of "Most rapists view pornography, but most viewers of pornography are not rapists"

    In other words, so what if there is a correlation between violent people and video-games? What does that have to do with the rest of us? Because some kid down the street goes berserk every time he watches Teenage Mutant Ninja Turtles or feels violent after playing ten-zillion hours of Quake3, the rest of the world should give it up or require that every other normal kid do without the videogame?

    I mean, come on here -- most murderers have eaten at McDonald's, but most people who eat at McDonald's don't commit murder.

    And that's about as strong as this article's argument is.
    ---
    icq:2057699
    seumas.com

  269. Video Games ain't the only thing then... by MikeV · · Score: 2

    Let's see, you have driving to work (a particularly barbaric experience of yelling at all the other 'fools' on the street since no one but you have any sense at all), being married (_never_ leave an empty jelly jar in the fridge), being in school (my ears are _not_ big!), the bus ride to and from school (survival of the fittest when it comes to getting a seat), football (gasp - really?), competitive sports in general (except hockey - those guys are _so_ nice and under control), paintball warfare(kill em! kill em!). These guys _really_ need to put this all into perspective. I view karate lessons as more inflamitory and promoting of actual violence than a video game (anyone know _any_ karate student without _any_ ego or tendency to violence? - personal experience here).

    Solution then? Ban driving, marriage, school (and school busses), football, sports in general, paintball warfare, etc... sit at home and watch the Partridge Family (but then _that_ could drive some to violence).

    Or - perhaps rather than pointing fingers at others, we could point them back at ourselves. It's easy to think your kids are perfect. Heck, mine are. They'll never get into trouble or get into a fight. (NOT!). There will be cases when you will be totally taken by surprise, but in many instances of violence, there are signs and clues - parents should be educated on these clues and taught how to handle them in a loving and nurturing maner (rather than - "you're grounded!"). Instead of spending all this money to fund research on why video games are so bad and responsible for violence (something that will be used in a very biased way to the exclusion of all other possible causes in court), how about a little funding to workshops for parents and kids?

  270. violence against women rise 40% during Super Bowl by ch-chuck · · Score: 2

    There was a recent StraightDope column about perverted statistical anomalies used to bolster a media spin political position, Does violence against women rise 40% during the Super Bowl?

    --
    try { do() || do_not(); } catch (JediException err) { yoda(err); }
  271. Another study shows... by ch-chuck · · Score: 2

    that habitual users of Msft products show a definite increase in agressive marketing behavior, with a marked tendancy toward intrusive advertising, spam, telemarketing and development of a pathological ability to overhype the capabilities of their software while obscuring and concealing bugs, blaming others and evading responsibility for it's defects.

    --
    try { do() || do_not(); } catch (JediException err) { yoda(err); }
  272. Re:A very good point! by orabidoo · · Score: 2
    if kids in the past had used these guns for hunting, and killed all kinds of animals yet they were not raving lunatics, then why are the kids today turning into these evil beasts because of video games?
    if people stopped trying to put *blame* around for a second, and turned to teh much more interesting tasks of looking at the actual chains of causes and effects that reinforce each other in society... and if we (the /.-ians) stopped being so defensive about these games just because most of us play them, we might even begin to accept that there *is* something of a relationship between games that train you in a simulation to kill humans indiscriminately, and violence in society. that doesn't mean that games produce violent kids; rather, that in a relatively violent society there's nothing surprising in the fact that violence is featured prominently in movies, tv, games, songs, and everywhere in popular culture. and that if a society were to become less violent, the representation of violence for entertainment would probably go down too.

    as for hunting and guns, yes, I totally agree that teaching a kid to hunt will give him responsability. the point is that hunting is controlled violence within rigid bounds of acceptability, and has (somewhat of) a redeeming reason too (namely, collecting food). it may be violent, but it is not mindlessly violent. I don't think it's even comparable to the kind of violence that's featured in movies and video games.

  273. Re:how the study was conducted by bughunter · · Score: 2
    Also, it's silly to compare a subject's propensity to sound an air horn with "aggressiveness" or "violence." That's not aggressive, just annoying. If they had given the subjects 9mm semiautomatics instead of air horns, they would not have seen any differences... These players know that an air horn is not a gun, just like they know a joystick is not a gun, and a pig-cop is not a real person... come ON - these aren't lab rats, people. They're college freshmen, which from a lofty doctoral candidate perspective must appear to be a lower form of life or something, given the logic being applied.

    Just because people who have just played "Deathorgy 2000" for an hour are statistically more likely to be annoying does not mean they are statistically more likely to be violent. Once again, this seems like a study where the conclusion was designed before the procedure.

    --
    I can see the fnords!
  274. Re:Look at this study for what it is... by alhaz · · Score: 2

    I read their little speil, and i think it's bad science.

    The thing about scientists is, whenever they set out to prove something they want to prove, they invariably find a way of proving it.

    They do show a short-term correlation between agressive behavior in a lab, and agressive behavior in a video game.

    What they did not address, however, is the massive ammount of collected evidence already available on the subject. Namely, the fact that while violent video games have become more and more popular over the last several years, all state and federal statistics show that violent crime committed by monors has gone down every year for the last several years.

    So, there's this controlled environment where, under short-term evaluation, a certian correlation is shown.

    And then there's this big, uncontrolled situation we call reality, where for the last several years a different correlation has been shown. And they failed to address it.

    --
    This is just like television, only you can see much further.
  275. Paraphrasing Dr. Marvin Monroe... by Col.+Klink+(retired) · · Score: 2

    I did a little research. I found this little thing in history called the Crusades. Tremendous violence. And y'know what? They didn't even have video games!

    --

    -- Don't Tase me, bro!

  276. Re:No Slashdot, NO! by Bad+Mojo · · Score: 2

    This statement has never ceased to provide humor for me. Anyone who thinks that a video game (console, PC, or arcade) is a training simulator has either never played one, or never been on an actual killing spree.


    Bad Mojo

    --
    Bad Mojo
    "If you can't win by reason, go for volume." -- Calvin
  277. Re:Look at this study for what it is... by zCyl · · Score: 2

    Everything you said is precisely correct except for this statement:

    > and in this case, the researchers were clearly trying to find the truth.

    They were not. These two psychologists failed to apply the scientific method properly. They conducted two studies, and then wrote a comprehensive summary describing results they would have hoped to obtain, and dismissing the results they did obtain. They went into the study believing that video game violence (or VGV as they so cutely call it) caused aggressive behavior, and they discovered no evidence that it does. Then they summarized that it must cause aggressive behavior because "it is obvious" (slight paraphrase), despite the results they obtained.

    This is not the scientific method, this is the political method. It is effective for achieving political ends, but not for finding truth.

  278. Re:No Slashdot, NO! by zCyl · · Score: 2

    > Ok, but wouldn't it be better if violent people didn't have the benefit of simulator
    > training before they went on actual killing sprees?

    As part of martial arts, I have trained in defending myself against an armed aggressor when I am unarmed. If I am ever in such a situation, I will pray that the aggressor has learned everything he knows from video games or from watching violent TV/movies. Video games and movies teach people very ineffective habits. It turns out that the things that look the coolest are not the most effective.

    So no, I wouldn't consider video games top rate training at all. Playing video games teaches you how to play video games, or in the case of the marine doom training, how to work in a team. If anything, they will develop logical skills, not assassination skills.

  279. Studies on Video games.... by Master+Switch · · Score: 2

    Cause violent behaviour (On Slashdot anyway :)

    --
    -Master Switch, one more element in the machine
  280. Ummm.. Sports? by SnatMandu · · Score: 2

    What about non-video games? I'm sure many of us have encountered over-aggressive jock types. Interesting idea: Maybe it's all that football and hockey they're playing. Of course, nobody dares show any connection between agressive sports and violent behavior. I don't think it's not talked about because it's obvious either. It's just that Football is so Apple-Pie that nobody dares touch it with a ten foot pole.



  281. s/Aggressive/delequent/; by Felinoid · · Score: 2

    They define "aggresive behavure" as being delequent. Skipping class is violent behavure?
    They also point out that people get lower grades.
    I do not understand the "nose blast" example however my guess is this is a test of aggresive beahvure based on how long a person holds down a button.
    A technical trate of many nonviolent video games is the need to let go of the button QUICKLY on violent video games to mash down and hold on.
    As such this may end up learnning to hold buttons longer.
    Also the nose blast is "psudo violenet" realistic video games force the player to make a greater seperation between reality and fantacy unlike other games who allow you to be comfortable with the reality that lines and bright colors are fictional.

    In the real world.. rather than the lab or in a video game.. violenent acts are done every day by kids and adults who are underprivilaged [have no computer or video game access].
    While kids playing violent video games are pumping money into more and more powerful computers. They are not doing anything violent short of playing the stupid game and maybe ranting on-line.

    Yes it's true... if you play ANY addictive game (like violent video games) you will tend to skip classes (in favor of the games) and drop grades.

    This has more to do with how good violent video games really are.
    And then there are people who don't have a very good seperation of reality and fantacy (that violent video games premote) and they do not understand the attraction of such games short of learing to be violent. They imagin it as a tool for violence trainning and having imagined it that thought becomes fact to them. In the mean time we make skins of such people and blow them away in violent video games knowing full well no such death occured.

    It's just annother case of "I think it therefor it's true".

    --
    I don't actually exist.
  282. Re:Statistics abuse (correllation) by Black+Parrot · · Score: 2

    > And when one thinks about it, we really do expect those who are violent and prone to such behavior to be more interested in such games

    Thus leading unerringly to the conclusion that schools and libraries should make lots of violent games available, because people blasting their way through Wolfenstein won't be blasting their way through Columbine.

    ps - The above neither is nor isn't sarcasm; it's just the logical outcome of your claim. I honestly don't know how I feel about it.
    --
    "Damn! And just when Piranha was starting to turn the tide of negative PR!"

    --
    Sheesh, evil *and* a jerk. -- Jade
  283. Re:Janet Reno Play These Games? by mindstrm · · Score: 2

    One article said that 2 nights before the raid, the father said 'Look. I'll go and get him myself if I have to. I don't understand the problem. I have custody. I have the highest ranking law enforcement officer in the US on my side, I have president Clinton on my side, and I have the courts on my side. All are saying that my boy is supposed to be with me. What more does the US government need to act on this? I want my boy back.

    Well.. if you put it that way, it makes sense.
    What were the feds supposed to do.. go in unarmed? with a mob of irrational protesters outside, who could very easily turn very violent? (heck.. they DID turn violent).
    Not a shot was fired and nobody got hurt, not until the protesters started RIOTING.

    In my country, when you have someone elses child against's the court's permission, we call it KIDNAPPING, and people go to PRISON for it.

  284. The mistake you make.. by mindstrm · · Score: 2

    is thinking that the neural network equates what happens in a video game with real life. They are TOTALLY DIFFERNET stimuli, at least, for ME they are.

    None of the sensations of actual violent behavior are present when playing a video game. Yes, it can be exciting, and even get your heart going.. but more due to anticipation of winning the contest than of committing acts of violence.

    In half-life, when I shoot soldiers, do I equate this to holding a gun and killing someone? No.. not in the slightest. It's a GAME, and my brain makes a very clear distinction.

    The brain learns based on all it's stimuli at a given time, and the result. (yes, bad english, I know). It's not simply 'oh, my score went up because I shot someone'. That's logic. What the brain learns is that a particular twitch of your hands and visual on the screen caused you a pleasant feeling (winning). This is extremely different than the sensations you would get actually killing somone. '

  285. Re:Well, Duh! by Kaa · · Score: 2

    Hello? Anybody home? Our brains are neural networks, which learn by patterning and repetition.

    Yep, somebody's home, though probably not one you expected :-)

    Saying that our brains are neural nets (NNs) which learn by repetition is a GROSS oversimplification of human neural activity. It's like saying that aircraft fly by sending electical signals down the wire. Sure, some of it is taking place, but that's not a useful starting point.

    Do the "violent behavior is normal/acceptable/etc" neural pathways get reinforced by playing violent games or by watching cinema/TV violence? Of course they do.

    Err... can you be more specific about what you mean by saying "neural pathways"? Especially about the 'violent behavior is acceptable' neural pathways? I mean, man, you are making a breakthrough in neural physiology and the study of human brain -- there could be a Nobel prize in this! After all, if after all the years of research it turns out that the brain is such a simple device as you're describing... why, then we'll have most of the world's problem fixed! [/heavy sarcasm mode]

    To summarize, you don't have the first clue about the brain physiology or how human behavior is formed. Try training your "thinking" pathways more.

    Kaa

    --

    Kaa
    Kaa's Law: In any sufficiently large group of people most are idiots.
  286. NEWSFLASH by LLatson · · Score: 2

    This just in!

    Watching "A Baby Story" can make you weepy and want to have children!

    Watching sports can raise your heart rate!

    Watching Burger King commercials can make you hungry!

    Playing video games can make you more aggressive!

    The 'scientists' who publish such nonsensical 'scientific' studies need to be more careful about stuff like this. This is obviously media-pandering and a means to get attention. Give me a break...

    LL

    --
    "If you are falling, dive." -Joseph Campbell
  287. a general rule of statistics.... by sporty · · Score: 2
    a general rule of statistics is that it is just that. a statistic. what you make of it is your own accord. what they have found is that of the 227 people surveyed, they all went/go to college and have played many video games. thus they are violent?

    the part on myst and wolfenstein is pure bull. all that showed was a temporary or exhibition of aggressiveness. The time span of that study was too short imho. Are they also to say pep talks also make people violent? They need to broaden their topic or just say what they found is a statistic. Is it video games that make them aggressive or contact (and simulated) games.



    ---

    --

    -
    ping -f 255.255.255.255 # if only

  288. Wow, what incredible insight! by Wah · · Score: 2

    "We found that students who reported playing more violent video games in junior and high school engaged in more aggressive behavior," said lead author Anderson, of Iowa State University. "We also found that amount of time spent playing video games in the past was associated with lower academic grades in college."

    Amazing, people who like to pursue violent images tend to be more agressive. Who'da thunk it. You mean if I (was a student and decided to) play Madden instead of study, my grades might go down? Me no understand...

    In the second study, 210 college students played either a violent (Wolfenstein 3D) or nonviolent video game (Myst). A short time later, the students who played the violent video game punished an opponent (received a noise blast with varying intensity) for a longer period of time
    than did students who had played the nonviolent video game.


    Duh, it makes sense to me that the people who were asleep (i.e. playing Myst) would want to avoid loud noises, and the people who had been shooting virtual guns wouldn't mind them as much. This is more a study on adaptive behaviour (if that's the right term for how we adapt to our current environment) than violent video games.

    Or maybe all this stuff is just so obvious as to be useless??

    --

    --
    +&x
  289. Re:Well, Duh! by Score+Whore · · Score: 2

    Fine go back 15. People are looking to see if there is a causation between video games and violence. What's the point of looking back and seeing a big spike in violent crime when there were no video games. Unless you want to show what seems obvious to some: video games are not a cause. At most they are a symptom, but not an indicator.

  290. The problem with this study by hey! · · Score: 2

    or at least the second study, is that it doesn't really control for the affects of physiological arousal.

    It's long been established that states like aggression and sexual attraction can be affected by preexisting levels of physical arousal. For example, if you climb to the top of several flights of stairs and encounter a good looking woman, you are more likely to rate her as attractive than if you met her going down the stairs. The effect doesn't have to be huge to be statistically significant.

    It may be that Myst is just as exciting as Wolfenstein 3D; heck lot's of people find chess more exciting than video games; but they aren't really exciting in the same way,are they?

    It would be better to compare something like a driving game than a puzzle oriented game. In fact, ideally you would have custom games written with interfaces to the subjects galvanic skin response, heart rate and respiration to bring them to the exactly the same level of physical arousal. (Hey, you might be able to sell something like that!)

    --
    Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
  291. Re:A very good point! by Zurk · · Score: 2

    guns teach kids responsibility. if you blow your head off because you mishandled that .375 hollow point +P magnum loaded rifle, its *your* fault..and no one elses. simply having a real gun and living with one (i was 13 when my parent got me a .22 and it "lived" in my cupboard ever since..no accidents in 2 decades..and its still sitting there) teaches you a sense of real responsibility. unfortunately more an more people have biased attitudes because they themseleves have never handled any decent level of firepower. ive handled dozens of weapons (and still do - everything from .22 to .44 magnums) and im always cautious when handling them.

  292. Re:A very good point! by infodragon · · Score: 2

    Personally, I am not a huge fan of guns because they are becoming less and less practical in today's urban society.

    What is the practical use of a gun? To kill. The original writers of the constitution specifically put in the right to keep and bear arms into the 2nd amendment of the constitution for 1 reason... To make it impossible for our government to do whatever they want to us. The original intent was that if the legislators started to do what the British government was doing then the citizens of the country could rise up and overthrow the repressive government. Yes you read that right the founding fathers encouraged the use of a violent overthrow if the American government became repressive. Thomas Jefferson in his biography stated that a violent overthrow of the government should happen every 12 years or so. Basically eliminating corruption.

    To continue with "original intent" it was the intent of the original writers of the constitution that the citizens would have access to the same firepower as the government. Today that is impractical with the development of weapons of mass destruction, but there are many weapons that are impossible for a citizen of the United States to legally own which are not weapons of mass destruction.

    If guns are taken from the citizens hands who is going to stop the government if it decides to repeat the past of the British. If you don't think the government is going to do this then explain why many of our freedoms been striped from us.

    The United States may be needing another war of independence in which guns would be very practical. Of course this is just MHO.

    --
    If at first you don't succeed, skydiving is not for you.
  293. Re:A very good point! by infodragon · · Score: 2

    c'mon, gun nuts - i'm serious. who out there really thinks that they and their hunting buddies could hold out against the U.S. Army for more than, say, 24 hours?

    It is called Guerilla Warfare which is extremely effective. A small band of lightly armed men are extremely mobile. The heavily armed US army is extremely immobile. As you slowly pick off small parts of the US army you capture extremely valuable resources which reinforce your lethality. Making you stronger and them weaker.

    I could go on and on. There are quite a few good books on Guerilla Warfare. The US government and every other government out there studies it and is very worried about it.

    And by the way... If I wanted to I could buy military grade X on the black market, i.e. plastic explosives with remote and timed detonators, very effective in guerilla warfare. Which by the way "fell" off the back of a transport. I can buy an AR-15, which is the civilian version of the M-16, and use a common file to modify the firing pin to convert it to a fully automatic machine gun. IMO this is much more than "hunting buddies."

    Also sorry about the 12 years typo it is 120 years.

    --
    If at first you don't succeed, skydiving is not for you.
  294. Re:A very good point! by Kool+Moe · · Score: 2

    Thing is, those kids so many years ago did exactly as you say- they went out- hunted, killed, and cleanded. I have many friends from western PA who do the same things today.

    The difference is they EXPERIENCE death. They KNOW the power of the weapon. They see the blood, they see the light go out in the animals' eyes. They understand what pulling the trigger means.

    Video games emulate all the behavior without the experience. Ya, you can blow away 20 aliens in one minute, but do you experience the pain? Do the aliens cry out? Do you see pictures of their parents grief-stricken?

    That's the issue. Not that guns are any different today than they were years ago, but that the experience is different. Without respect for life- without understanding the pain and sorrow killing can cause- that is the tragedy.

    Violent video games can perpetuate the violence- and kids can grow up thinking violence is no big deal. Ah, so someone gets shot-they'll be ok....right?

    That is where the parent/peer guidance needs to come in. I watched violent movies sometimes as a kid, but my parents were always there with the sorrowful look on their face when a death occurred- or they made me watch MASH to see the other side.

    Yeah, that's it- every hour my kid plays a violent video game, it'll be balanced with an episode of MASH. ;)

    --
    Kinda like Moe, but just a little more Kool
  295. Comment removed by account_deleted · · Score: 2

    Comment removed based on user account deletion

  296. Computer games by Hard_Code · · Score: 2

    I /know/. Computer games get me so mad. Sometimes I'm playing the Sims, and my character gets hungry, and there is NO FOOD in the pantry, so I have to go to the store but I don't have any money because I blew it on a car. That pisses me off SO MUCH. And also sometimes when I'm playing Dune 2000, I select a unit and tell him to go somewhere, but he is dumb and goes on some little trip through the enemy's base! I get SO MAD! I feel, like, I want to break stuff! Man, these computer games make me so violent!

    --

    It's 10 PM. Do you know if you're un-American?
  297. Re:Thoughtless posts are more damning than good by QuantumG · · Score: 2

    many of us couldn't be damned repeating the same old same old so we fall back on humour. If you cant see that then maybe I should just kick your f*ckin' head in!@!#!!

    --
    How we know is more important than what we know.
  298. Yer whatever... by QuantumG · · Score: 2

    Just try to take my video games away from me you pussys.. I'll kick ya f**kin' heads in@!#!!

    --
    How we know is more important than what we know.
  299. Re:False Statements and other sources by ronfar · · Score: 2
    What in the Hell are you talking about?

    Haven't you ever heard of Gallipoli, where the Turks machine gunned unarmed British soldiers?

    The whole of France was turned into a charnel pit!

    Have you ever done any serious study of the Great War?

    Did you know that German snipers would shoot through the eye slits on the British side of the lines?

    Sigh... the American school system, kids think that WWI started when the Lusitania sank. Perhaps when you've grown up and gone through college you'll get some historical education? Of course, I'm not sure what that will be like at Bob Jones University...

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  300. Re:False Statements and other sources by ronfar · · Score: 2
    Haven't you ever heard of Gallipoli, where the Turks machine gunned unarmed British soldiers?
    Pardon, I of course meant unarmed Australian soldiers fighting on the British side. Replying to ignorant idiots can addle my mind that way ^_^
    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  301. Re:Damn Straight! by ronfar · · Score: 2
    Don't read On Killing, it's a poorly researched, poorly written book by a quack pop-psychologist. The people who did this study may be ignorant, but they are far less idiotic than Lt. Col. Grossman, who is basically a fascist leaning politico trying to make money from the death and suffering of children. He's hardly an unbiased bystander, he was an advisor to the failed lawsuit against id and others.

    Oh, and KahunaBurger, this isn't Amazon, so quit trying to peddle books. If you have something useful to contribute to the conversation, contribute it, don't just say read On Killing over and over again to get money into the pocket of your fascist hero. I happen to know that his testimony before Congress is available to everyone online, so why don't you do a little Web search.

    Or could it be that you don't give a damn about people and just want to see profits for Grossman at the expense of American freedom?

    Oh, and no, a person doesn't have to read On Killing to conclude Grossman was a fascist any more than he or she has to read Mein Kampf to conclude Hitler was a Nazi.

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  302. Re:Ever heard of a confounding variable? by ronfar · · Score: 2
    KahunaBurger's definition of science:

    "If I like it, no matter how obviously flawed and biased the research is, then it is good science and everyone should just bow down before the authoritarian new laws we will have to enact to protect people from themselves."

    "If I don't like it, as in this post by KahunaBurger about the fact that the American Scientific Establishment might deny homeopathic medicine a top level .med domain name then it's bad science and suppressing people's rights and should not be listened too."

    I mean, I'm sure it never occured to you (and I say this as someone who has no real opinions on homeopathic medicine, but who has close friends who swear by it) that the reason why the body that was supposed to enforce a .med domain name would deny it to homeopathic medicine is because they believe homeopathic medicine is bad science and have studies to back that up.

    Of course, knowing the US medical establishment the way I do, I know that .com is the correct designation for such sites, money comes first and people second.

    But then, it has always been the position of authoritarian fanatics, from Hitler to the present day, that they have unimpeachable scientific authority for their insane, repressive political beliefs. These people have to corrupt the scientific community because their claims do not stand up on their own merits. If you can't convince people they have to give up their right to free speech because it is good for the state, use some pseudo science to push your claim, eh?

    Of course, the elitist and condescending attitudes of such fanatics always gives them away, "How dare you try to disagree with these people!! They're priests^H^H^H^H^H^Hpsychologists, you should be burned for heresy for even trying to debate them!!"

    I've read this reoprt, it is bad science, and you know it is bad science. Anything for the cause though, right? The big lie technique, keep repeating obviously false statements until the public swallows them, eh?

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  303. Patrick Henry said it best.... by ronfar · · Score: 2
    Listen KahunaBurger and understand, you people just don't get it. The United States is not going to turn into the "worker's paradise"/fascist state/"aryan utopia"/"kingdom of god" or whatever flavor of the same old tired totalitarian dictatorship that you and people like you have been trying to push ever since the peasants got uppity and decided to overthrow the king. It just isn't going to happen, Americans always resist those who would set themselves above other men as kings or gods, and you and your hero Grossman are no different. You should give it up, you'll find that you can live a happy life in a free country if you give it half a chance.

    However, people like you can inflict a lot of suffering on a lot of people in the short term before people see through you and see what you are about. You are talking about jailing people for downloading Doom or buying their kids Mortal Kombat, yet another reason for jack booted government thugs to knock down the doors of law abiding peaceful American citizens and put guns to their heads. That's the use of force your ilk never object to, a use of force you and your ilk seem to relish with unholy glee. Otherwise, how would you enforce your censorship, someone is going to have to go to jail and there must be uncounted millions of copies of the game Doom out there. They aren't just going to evaporate because you say they're bad.

    I will resist people like you until I die, as Patrick Henry said, "I know not what course others may take; but as for me, give me liberty or give me death!"

    Why don't you try Iran, I think they have just the kind of government you want already.

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  304. Parenting by The+Queen · · Score: 2

    I am simply fuming. I've said it a zillion times, parents who let the TV/computer babysit, entertain, educate and raise their children for them are BAD parents. Kids need discipline, they need guidance. I played Quake feverishly when it came out, I played Mortal Kombat, etc., but my parents had taught me right from wrong and I knew how to seperate fantasty from reality.

    Your quote is right on. Parents who don't pay attention to what their kids are doing have only themselves to blame. Not video games, not gun manufacturers, not society, not drugs, ad freaking nauseum...

    The Divine Creatrix in a Mortal Shell that stays Crunchy in Milk

    --

    The House Between - Original Sci-Fi Series
  305. This brings something else to mind... by Bedemus · · Score: 2

    Excellent post, got me to thinking about my high-school days. I played video games from the time I was 5 years old, starting with one of those all-in-one pong setups you could pick up at Sears or Radio Shack, moving on to Atari, Nintendo, etc, etc.

    Yet, for all the supposedly violent video game content I processed as a youngster, my gaming friends and I were always the TARGET of agression... We weren't particularly interested in sports, for instance, nor were we impressed by physical muscle... I got into the gifted program (quit it when I went to Jr. High -- Now THAT stuff can mess with your mind) and generally became branded a geek at an early age.... I had a lot of pent-up rage at the jocks and whatnot, but I never attacked anyone, I saved it for my time spent gaming, when I "decompressed," as I like to put it.... I was subject to threats and the like all the time however, from the "normal" kids. This continued all the way through high-school. The ones who were leading the healthy lives, body-building, playing football, etc.... these are the violent ones.... Ever see a high-school football player who's really juiced up after a game? They take that stuff off the field with them, into their social life, use that energy to beat down the little guy, a lot of times. Used to make me sick.

    My story isn't uncommon, as was evidenced by the strong backlash on /. when the Columbine story hit the wire. Perhaps people should start looking at the way many computer geeks/gamers get treated by their peers as a possible catalyst for these acts, and perhaps at the way parents are raising their kids nowadays, as opposed to taking the easy way out and blaming the "different" kids for society's ills. The media is just feeding a witch hunt, I think.

    I apologize for the rambling, but this post just struck a chord with me I guess.

  306. I am passive by cdlu · · Score: 2

    I am a pascifist. Not by choice. By sheer apathy. It doesn't stop me from playing huge numbers of violent video games, and the games don't stop me from being completely passive.

    Violent tendencies are brought on by violent upbringings, not by any single factor. Perhaps people should look at the bigger picture?

  307. Off- Topic by veldrane · · Score: 2

    Sheesh! What vicious thing did soybeans do to you to make you want to murder them and eat their curds?

    There is nothing wrong with responsible hunting. Of course, that's strictly an opinion (backed by scientific fact).

    Join PETV, People for the Ethical Treatment of Vegetables!

    -Veldrane

  308. Games that *do* cause violent behavoir are: by gad_zuki! · · Score: 2

    Crappy games, boring games, dull games, the kind that tempt you to throw the CD or cart against the wall. Please, don't let your children play these games, they could damage the drywall.

  309. US murder rate 3x that of Canada by anonymous+cowerd · · Score: 2

    The U.S. murder rate is three times higher than that of Canada. Same continent, same language, same high level of industrialization, same TV shows and pop songs, and I'm even given to understand they have video games up there. But the U.S. murder rate is 6 per 100,000 per year, while Canada's is 2 per 100,000 per year.

    I know it's trendy to blame all the problems of the world on video games these days, and I can understand how venal pseudo-scientists might be eager to cash in on that fad, but I don't much care. Why don't these psychologists stop wanking off over video games and study those numbers, and try to figure out why it works out that way?

    Yours WDK - WKiernan@concentric.net

    1. Re:US murder rate 3x that of Canada by Animats · · Score: 2
      That's basically because the US has much easier access to handguns. Yes, guns don't kill people, people kill people, but people without guns are far less effective killers.

      On a related note, in the US, the rate of shootings is way up (about 3x) since the 1960s, but the murder rate is down to 1960s levels. This reflects better medical care; most big cities have paramedics and trauma centers now. More shooting victims are surviving, although often with crippling damage.

  310. Re:False Statements and other sources by G-Man · · Score: 2

    You've left some things out, as well as oversimplified quite a bit. What the studies found was that crew-served weapons (e.g., heavy machine guns) were responsible for a disproportionate amount of the killings. Based on their number, firing rate, and lethality, they inflicted even more casaualties than one would have thought.

    The average rifleman on the other hand, has plenty of incentive to just keep his head down during a firefight, and no one is really watching him to make sure he fires his weapon. The crew on the machine gun will quickly notice if one of the crewmembers is not doing their job, and there was little evidence they ever failed to pull the trigger.

    After WWII and Korea, the Army altered rifle training to emphasize firing the weapon in combat situations (instead of just shooting at round targets at the firing range). Their problem was pretty much "solved" by the time Vietnam rolled around, so video games had pretty much zilch to do with it.

  311. Prison causes crime by kevin805 · · Score: 2

    My studies have found that nearly 100% of people who have spent time in state prison are criminals. We need to stop putting people in jail, because it causes crime.

    --Kevin

  312. this is sooo dated... by LocalYokel · · Score: 2

    Who plays "... violent video games like Doom, Wolfenstein 3D or Mortal Combat [sic]" anymore?

    I can see how those games can lead to violent behavior -- they suck! Personally, I would prefer to commit a violent act against myself than have to figure out some obscenely complicated sequence of buttons to finish off a match, or once again get pissed off because my version of the game did not have the naked chicks on the walls...

    --

    --

    --
    E2 IN2 IE?

  313. If violent video games increase violent behavior.. by Paul+Neubauer · · Score: 2

    Do 'dull' games lead to an increased risk of chartered accountancy?

    Do funny, humorus games lead to an increase of comedy in the streets?

    And, more importantly, is this causation or mere correlation?

    Causation: Evil violent game turns harmless person into violent person.

    Correlation: Evil violent person tends to like games that happen to be violent.

    Do stupid games lead to an increase of 'first post' nonsense?

    --
    I don't subscribe to RMS's GNUtopian vision.
  314. Er... by Greyfox · · Score: 2

    Wouldn't that indicate a correlation between drinking water and violent behavior?

    --

    I'm trying to teach myself to set people on fire with my mind... Is it hot in here?

  315. Re:Doom? Wolfinstien?? Mortal Kombat??? by markjrubin · · Score: 2

    I wonder if they evaluated people who played text mode quake?

    --
    Howdy.
  316. Inconclusive Period! by NeverSayNever · · Score: 2

    Like many psycological studies that have come out lately, they don't make a lot of sense. If it isn't child abuse and its relation to smoking, it is some other crazy hypothesis. We must remember that there is very little science in psycology and what science there is is largely ignored. As many people have pointed out that there was a questionaire involved instead of a real study on actual behaviour. That in my opinion botches the whole study but for those people who aren't as skeptical as me, I will continue. There is an effect which is widely discussed in Sociology and Psycology called the Hawthorne effect that states quite simply that if people know they are being studied then they tend to give false results. Case in point, the study was geared toward this result and thus these so-called brilliant PhD's go there expected result. But they ignore their own theory. As other /.er's have pointed out that aggression doesn't lead to violence and to imply that is insane. There are many situations we encounter in the course of our day that raise our aggression level. Why can't we admit that the brain is more complex than we can currently comprehend? Psycology, in my opinion, has done nothing to futher how our brain works. It is widely acknowledged as the easy way to get through University and has had countless theories that have been discounted by biological researchers. Sure Doom, Quake are evil but psycology is too by the same token.

  317. All of them by xant · · Score: 2
    While I agree with you in principle, an alternative definition of mental illness would put them ALL in that category. Isn't it crazy to go on a rampage killing? Whether or not the courts found them to be crazy is merely a legal definition.

    If you accept that then you must ask what caused the insanity? There IS a cause - whether it's in the genome and turned on at birth, or caused by bad parenting, or turned on by video games. This study didn't find any statistically significant evidence that video games were the cause, but simply saying "killers are crazy" doesn't address the question of "why??"

    --
    It's rare that you're presented with a knob whose only two positions are Make History and Flee Your Glorious Destiny.
  318. Re:Look at this study for what it is... by Mike+Micelli · · Score: 2
    The problem is not with the study, per se, it's with peoples' reactions to the study.

    We all know that the unwashed masses and politicians (unwashed as well?) will point to this preliminary study as definitive proof that Johnny shot 12 kids with a .9mm because he played Quake.

    Unfortunately, most peoples' faith in the APA is so great, that if they (the APA) even hint at a link between video games and violence, everyone is going to say "See, I told you. Ban the games, they're dangerous!"

    See my .sig. Even though it's from a fictional character, it speaks volumes of the mentality that most (read majority) people have.

  319. A very good point! by Dman33 · · Score: 2

    My Dad used to carry a rifle to school every day (in the 40's) to go hunting after school. He never shot, or killed anyone. His parents, at home, taught him better.

    This is the point that I have been trying to make! Look at our ancestry, we are hunters. Throughout history, our fathers have gone out and blown the brains out of cattle, deer, sheep, and almost anything else that moves. Our ancestors cut the heads off of chickens, rabbits, and small game. My question is if this behavior did not lead to school massacres etc., then how the hell does a stupid video game?!

    When kids grew up in the late 1800's and early 1900's, they grew up with hunting rifles in thier hands. The were taught how to hunt from a young age and probably got thier first kills before they were 10! The were exposed to cleaning and skinning the kill as well. Has any of these 'experts' that tell us that video games are to blame actaully stuck their hand into a deer's chest to cut the sternum with thier knife? I bet not.

    Personally, I am not a huge fan of guns because they are becoming less and less practicle in today's urban society, but what I am trying to say is that if kids in the past had used these guns for hunting, and killed all kinds of animals yet they were not raving lunatics, then why are the kids today turning into these evil beasts because of video games? The answer is that they are not. Nothing has changed. As long as we are humans with free will, there will always be violence and tragedy. We must accept it and do something about accountability. We must look out for our kids, not by putting metal detectors into their schools, not by subscribing them to WAVE, but by teaching them how to get along with other kids, how to communicate their feelings with others, and that they are not alone in this cold world and that there are people, at home, that love them very much.

    Ah, but what do I know. I am just a 22 yr old programmer that has been playing everything from Wolfenstein to Quake III.

    1. Re:A very good point! by friedo · · Score: 2
      Personally, I am not a huge fan of guns because they are becoming less and less practicle in today's urban society, but what I am trying to say is that if kids in the past had used these guns for hunting, and killed all kinds of animals yet they were not raving lunatics, then why are the kids today turning into these evil beasts because of video games?

      A lot of people say that kids today are raving lunatics. Not true. Kids are the same as they've always been. It's just that now we have slightly different problems that need to be blamed on a common scapegoat. Columbine tradgedy a result of shitty parents who a) failed to raise their children or b) were too absorbed in their own lives to recognize their child's mental illness? No, it was the video games! Bullshit.

  320. Re:Look at this study for what it is... by B'Trey · · Score: 2
    Unfortunately, not everyone understands the basic principles of scientific research or of logic. The six o'clock news won't report that the study shows a correlation, but not a causation, between video games and violent behavior. They won't bother to define "violent behavior". They'll simply scream "Latest studies show a link between violent video games and violence in our schools!!!!"

    Politicians won't bother to read the study and understand what it actually means. They'll use selective quotes and beg that we vote for them because they'll Do Something(tm) about this Horrible Threat to our Schools(tm); after all, we must Save the Children(tm). Activists determined to brand the American Ideal with their own particular visions (duly enforced by law, of course) and misguided crusaders eager to save the American people from themselves will be just as quick to trumpet snippets of the report which seem to support their cause.

    This isn't, however, the fault of the researches. Public opinion and the fear of public response can not and should not be allowed to dictate the course of scientific research. It's hardly over-reacting, however, to view the publication of such studies with some trepidation. Not because of the nature of the studies themselves, but because of the (mis)use to which they'll undoubtedly be put.

    --

    "The legitimate powers of government extend only to such acts as are injurious to others." Thomas Jefferson.

  321. Re:Well, Duh! by Andrew+Cady · · Score: 2
    Unfortunately, it is happening less often that it used to (road rage is an example.)

    Ugh, please don't repeat the myth that violence is increasing. Violence in the US hasn't increased for ten years (and has actually decreased a bit). And while one has to stretch to corrolate violence with video games, it's plainly obvious and undeniable that violence overall is directly related to the "war on drugs". Crime dropped in half starting the day that alcohol prohibition ended and didn't significantly increase until the modern "war on drugs" began, after which it steadily increased to prohibition levels. Pfft!

  322. Re:If violent video games increase violent behavio by KahunaBurger · · Score: 2
    Causation: Evil violent game turns harmless person into violent person.

    Correlation: Evil violent person tends to like games that happen to be violent.

    Strawmanning: Rediculously exagerated descriptions of real causation.

    Real causation: Exposure to violent video games has a tendency to increase the violent responses in any person with an accelerated effect in people who have other violence indicators.

    To put in in other terms, you might as well have said -

    Causation: puffing on one cigarrette will cause an otherwise completely healthy person to die of cancer within a year.

    Correlation: people who have unhealthy habits and living situations otherwise also smoke cigarrettes.

    The real answer, as above, is accellerated causation : Smoking is bad for you, but not in a individually predicatable way, and the effects will be increased in people with other unhealthy life factors.

    You know, if there was a way to get demographic data on all you guys, we could have a real study going here. Just post a well designed, straightforward study on anything related to computers that has a non-positive outcome. Then post a link to it on /. and watch the responses. We could title it "The effects of negitive news on over-sensitive non-psych educated geeks who think they know everything."

    If you want to get a less personalized veiw of the effect of external stimuli on violence, read On Killing. It starts with the firing rates of soldiers in WWII vs vietnam and how the army brought them up. pretty interesting.

    -Kahuna Burger

    --
    ...will work for Chick tracts...
  323. Damn Straight! by KahunaBurger · · Score: 2
    You know when all the movie making types come out all high and mighty about how movies are just fiction and portayals of smoking, violence, drug use, treatment of women, roles of men, what have you, couldn't possibly effect people's actual behavior? I always want to be at one of those press conferences so I can stand up and ask them how much the makers of "The World Is Not Enough" got paid to show one scene of 007 using a Motorola cellular phone. Then ask them who they're lying to - the businesses who they tell that one shot of a product will make viewers want to identify with the hero and use it? Or us, when they say that the behavior of the hero could never effect the viewers' actions. They're lying to someone, or maybe everyone.

    For a better perspective on the issue of this thread, read On Killing.

    -Kahuna Burger

    --
    ...will work for Chick tracts...
    1. Re:Damn Straight! by KahunaBurger · · Score: 2
      You really need to get a grip. I recomend the book because it is interesting and relitively well written. It also speaks directly to this rediculous myth that human capacity for violence is set in stone and desensitisation and modling cannot change it. You can comfort yourself by calling the author a fascist, but it just makes you sound petty and sad.

      Is freedom to play video games more important to you than freedom of speach? Can I say anything I want except point out the dangers we may be exposed to? Its a pretty piss poor respect for freedom that responds with hysteria and bile to a reading suggestion.

      -Kahuna Burger

      --
      ...will work for Chick tracts...
  324. Ever heard of a confounding variable? by KahunaBurger · · Score: 2
    What they did not address, however, is the massive ammount of collected evidence already available on the subject. Namely, the fact that while violent video games have become more and more popular over the last several years, all state and federal statistics show that violent crime committed by monors has gone down every year for the last several years.

    Oh this is rich. All this talk about correlation vs, causation and then this. they don't need to "address" the data, because there is no useful data there.

    This is pure correlation. "Two different things happened together, so they are related". The probelm is that tons of other things were happening at the same time. Program specifily meant to fight youth crime, other changes that may have had unexpected effects. An interesting study last year suggested that the entire dip in juvenile crime in the last decades is due to increased contrceptive avalibility and legal abortion. Unwanted poor kids are more likely to be delinquints, better family planning cuts down on both.

    To suggest that structured laboratory data can somehow be trumped by highly confounded trends is just silly. Do you guys know anything about science?

    -Kahuna Burger

    --
    ...will work for Chick tracts...
  325. Heh Heh by jallen02 · · Score: 2

    I meant to say, "Please Excuse me".

    What came out of my mouth was, "Move or I will kill you"

    Hey.. my cat would not get out of my seat and I had to piss in a QIII DM.

  326. Man! they are reaching... by mekkab · · Score: 2

    Super Mario Brothers and Mortal Kombat both involve considerable violence in the sense that the player typically spends a considerable amount of time destroying other creatures. ... Of the 911 game classifications made by the participants, 21% were in the fighting category. However, a number of classifications of clearly violent/aggressive games were to one of the other categories. For instance, one person who listed Mortal Kombat as a favorite game classified it as a "sports" game. If these suspect classifications are added to the fighting category, the percentage of violent/aggressive games jumped to almost 33%. If Super Mario Brothers is counted as an aggressive game (even when the participant put it in another category), the percentage jumps to 44%.
    Uhm, WHAT?! And who says TETRIS isn't an aggressive game?! (you should see the way I play SCRABBLE!)

    And of course one must consider the age range we are looking at- Young males at the peak of thier testosterone levels. And I believe there is more than just a causal link between aggression and testosterone. So to say "Hey, look! Young males are aggressive!" is about as revealing as saying "Anyone who thinks Super Mario Brothers is a violent game needs to have their head checked"... it's a no brainer!

    --
    In the future, I would want to not be isolated from my friends in the Space Station.
  327. Whew! by Effendi13 · · Score: 2

    I'm glad we've got this pinned down now! We can finally put all of those psychotic palm-packing geeks behind bars. I remember in middle school, as soon as the 8-bit Nintendo came out, everyone started beating each other up at school. We were all scared to death of the really good Metroid players! It was a good thing we had the drug dealing gangs there to keep up a sense of sanity and control. If they hadn't had their guns there to maintain their turf, it could have been an all-out riot! Okay, enough with the sarchasm. We need to keep in mind that people are inhenently violent, and if there is no artificial outlet for this violence, it will be manifested somewhere else. -Effendi

    --
    -Effendi
  328. I'm not violent by Minter92 · · Score: 2

    I have played violent video games since I was a kid. It hasn't made me more violent and I will rip the head off of anyone who says otherwise.

  329. Re:Missing the point by way2slo · · Score: 2
    I concur. You can turn the television on and see increased violence in other types of "games" as well. How about Ice Hockey? It seems there's at least one fight in every Hockey game. You can even see bench clearing brawls in Baseball. Baseball has no where near the contact levels of Football or Hockey, yet there are brawls from time to time. I play hockey and have been involved in several fights. I know what's it's like. Also, I have played violent video games, like Quake, my entire life and not ONCE did I ever get into a fight over it.

    It's obvious that it depends upon the competitiveness of the individual(s). I have found that the more competitive a game is, the more emotions I have. When you really want to win and your opponent wants to deny you that win, some can't help but get drawn into the emotions like tension, anticipation, desire, joy, ego, and anger. When you play a game against another team or opponent, you're making the statement "I'm better than you at this and I'm going to prove it."

    I play Ice Hockey in my spare time and I can tell you that the frustration of getting blown-out is taxing. Eventually, you deal with it by getting mad, wheither it's at yourself, the refs, your opponents. When the game is over, you still may feel it for a few hours, but those feelings pass. When you win, you feel great, but that passess too. That is the reason we play sports. We want to feel the joy of winning, but to do that we have to risk feeling the agony of defeat [insert vido clip of guy crashing on ski jump]. You win, your happy, you lose, your angry. It's as simple as that, yet they don't get it. I'd love to get these PhD's on the ice and show them what it's like. :)

  330. Pong Anyone by Laserfuzz · · Score: 2

    Maybe we should all start playing pong again...There's a game that causes violence! Waiting the little pixel to bounce back and forth....AHHHHH! I always have to remember that I am a human after playing AVP for a few hours.

  331. Military Training? by TegidTathal · · Score: 2

    Having read the posts explaining that the studies are not saying violent games leads to violent activity, and the posts saying that it is the job of parents to make sure the restraint and peaceful responses to real life are ingrained, it strikes me that a fantastic example of this is the training of the US Military.

    Marines, Seals, Rangers, regular infantry, they all train to be lethal in battle. They train, (using the Marine Doom post example) so that they don't have the think in battle, they can just respond. Much like opponents say "victims" of violent media are reacting.

    In the First World War, the percentage of troops who actually fired their weapons was very low. This was an accepted problem. Normal people don't want to shoot other people, so the US (and I'm sure most contries) changed their programs so that their soldiers WOULD shoot their weapons in combat. By Vietnam, the percent of soldiers who fired their weapons in combat situations was very high, approaching 100%. If you think this wasn't because the training desensitized them to violence and trained them repetativly how to kill, you are deluding yourself. The point is, the programs ALSO taught the soldiers to respect life.

    And the programs continue to do so today. The US Military knows that when they train their soldiers to kill, they also have to train them to know WHEN to kill. Some soldiers HAVE gone on and killed people, but no one questions their training, they were accepted to be not quite right in the head (the same way anyone else who resorts to murder is) The difference here is that violent games are used as replacement parents instead of being a sideshow to family life. And the parents, individuals whom studies have recently identified as major influences in what children decide later in life (hence the "talk to your children about drugs, they'll listen" campaigns) aren't there to balance the violence with explainations about why it isn't the way to solve a real world problem (in general)

    Maybe we should learn a lesson from the military.

  332. Psych student critique by InstantCrisis · · Score: 2
    I noticed a few things while reading the essay:
    The sample type (Intro students at a midwest university) is not remotely representative of the population.
    The questions on attitude were presented immediately after game play, while the participant is still aroused, which decreases evidence for correlation between games and long-term attitudes/behaviors.
    The researchers were making a connection between video game violence and resolution of conflicts, though the violence in the games they used was both self-defencive and patriotic. Maybe if they had used Grand Theft Auto or Postal could they make their claim.
    The researchers clearly had no familiarity with Doom at all.
    The researchers downplayed the possibility that persons make aggressive and desensitized by television (Bandura, 1965; Baron & Kempner, 1970; Liebert & Baron, 1972) are just more likely to play violent video games.

    In a first-person action game, like Doom, the player is not synonymous with the character and does not choose to kill entities, but is forced to kill to stay in the game. If there were ways to sneak around enemies or get out of situations less violently (Thief) the players would have a choice, and it is often much easier (or required) to take the non-murdering path to the goal.
    Also, the references to the Columbine incident are evidence that the whole biased experiment was a grab for attention/funding.

    I could go on, but I've spent enough time on this already and I don't think many people are even going to be reading this far down the topic.

    Instant Crisis

  333. Sigh..Bad Memories by dougman · · Score: 3

    I don't like to talk about this too often, but I will admit that I had a little run-in with the authorities as a youth, as a direct result of too many videogames.

    When I was 8, I was sent to a shrink after spending days running back and forth in front of my apartment building with a bucket of water in my hands screaming "Get out of the way! Get out of the way! I must prevent the Mad Bomber from succeeding in his evil plans!".

    This was followed by the unfortunate episode where I crafted a giant yellow arrow (not like a bow and arrow, but an arrow as in the symbol that points to something) and ran around town screaming out "Foul Rhindle! I will find and defeat you! I must keep moving! The bat wants my arrow!".

    Of course, I hit rock bottom the time I stole several dozen live chickens from the local farm and threw them out into the road at rush hour.

    (sigh)

    Okay, my therapist says sharing all of those painful memories will make me feel better. I do already.

  334. Nice game choices by CaseyB · · Score: 3
    The goal of the pilot study was to select a pair of games that differed primarily in amount of violence. The goal was best achieved by pairing of Myst and Wolfenstein 3D.

    Suddenly the results become clearer. Of course the Wolfenstein 3D group was more violent! The control group was probably asleep by the end of the test.

  335. Statistics abuse (correllation) by hawk · · Score: 3

    You have teh most important point, that correllation != causation.

    And when one thinks about it, we really do expect those who are violent and prone to such behavior to be more interested in such games (and the same goes for rapists and violent pornography).

    However, they do have a scrap, at least, in one of the studies. They found that the link is stronger for those who fit an aggressive profile to start with. I'd have to look *very* closely at their definitions before accepting this--as a Ph.D. statistician, psychologists playing with statistics are the second most suspect group (behind sociologists).

    However, the match does not have to be exact for them to come up with a valid correllation--even a mild correllation (such as between a general agressive profile) and a different result (stronger correllation) *could* be evidence of causation, but I'd really need a closer look before being certain.

    hawk

  336. Yeah right... by wynlyndd · · Score: 3

    ...I cannot believe how much this pisses me off! Where's my BFG; someone's going to pay for thi...oh wait...=)

    --
    "Dogs and cats, living together...it's mass hysteria!"
  337. You know I've always suspected this. by Cooty · · Score: 3

    After a marathon of Tetris-playing, my friends would go outside and lay brick walls. I fear some of them went into construction for a living.

    After playing Sim City I had an uncontrollable compulsion to run for mayor, or at least to lay pipes for the sewer authority.

    I saw some people play too much Populous. They became Gods.

    You don't want to know what happened to the guy that played Leisure Suit Larry.

  338. Re:Well, Duh! by ACK!! · · Score: 3

    Yes, it is obvious but it is also a vast over simplification of a much more complex problem. Examining violent games alone without looking at the society that creates the games is a useless exercise to say the least. Violent games lead to violent behavior. I say yeah so? That is obivous to the point of being banal.

    What nobody is really doing at this point is examining the kind of culture that produces these same games. Change society and the games and other forms of entertainment will become less violent. Less violent cultures simply do not get into the same violent passtimes that our culture goes for (the Japanese are odd in the sense that they love the epic fight/duel games and yet do not have the violence factor).

    The society of the Japanese is not as violent(notice I am not saying that their culture is pacifist by any means and their history is very violent I know this) but the games are. The society and culture not the games the children play make the monsters taking out each other in our schools.

    --
    ACK /ak/ interj. 2. [from the comic strip "Bloom County"] An exclamation of surprised disgust, esp. i
  339. Re:Missing the point by _Sprocket_ · · Score: 3
    But is this limited to computer games, or does it extend to other activities? I would argue that any competitive activity will lead to increased aggression over my normal, fairly passive self.
    Years ago, I knew guy in the Air Force who was a part of the Security Police squadron. It was a complete mismatch for his personality - he was a very quiet, reserved, and non-aggressive type (proof that one shouldn't join the military in "general purpose" - insist that your recruiter sign you up for a specific job that you think you'll like).

    During exercises, he was on the base aggressor team. Personnel in various non-combat roles would be trained to augment base defense (one day you're a clerk, the next you're in a concrete bunker overlooking a field). The aggressor team would attack the augmentee's positions as part of the exercise.

    There was a particularly annoying young lady that my friend was unable to ferret out. Time was ticking. The pressure built and he went after her with everything he had. He tossed a smoke grenade at the bunker and lit up her MILES gear as she staggered away from her position.

    There was some hand-smacking for tossing ordnance at another person. Not the safest thing to do. And probably quite unpleasant. But my friend was much harder on himself. He was quite horrified at his own actions. "I wanted to take her out so bad. I mean... my God... I was salivating!"

    The heat of the moment.

    We all like to think we know ourselves. We have our boundaries that we feel comfortable with. There are logical reasons behind what we will and won't do. But to say we know exactly what we'll do while under the pressure of a dire moment is deluding ourselves. We may crumble. Or we may unleash a force we didn't know our psyche contained. And quite often, the situation may call for the actions that force enables us to do. Our survival may be dependent on it.

    And it may scare us after the fact.

  340. Why Columbine? by Spasemunki · · Score: 3

    This actually seems to be an intelligently written and well done study. Their claims aren't outlandish or too far reaching, and they're obviously building on a significant body of research and theory. What I take issue with is the invocation of Columbine at the beginning of the paper. Why dump this incident at the top of an otherwise scholarly paper? Yes, there has been a great association by members of the media between the two kids who did the killings and violent video games, but placing it in this context makes it sound like they are claiming to have the answer, which is not a claim that they are making. The article itself admits that the games would be only one possible factor. Why not come right out and admit what that means? Video games may increase short term and/or long term aggression. But there is no indication that otherwise healthy people will go on a shooting rampage based on nothing more than a few rounds of Doom. Associating Columbine with the evils of violent video games is a cheap cop out, an attempt to paper over serious societal problems with a scape goat. There was much, much more wrong with those kids than having played Doom, and to focus only on video games as the trigger is both cowardly and dangerous.

  341. Stupidity by Bullschmidt · · Score: 3
    There are several problems with the claims made in this article:
    • "We found that students who reported playing more violent video games in junior and high school engaged in more aggressive behavior," - One of the first things anyone who does studies MUST learn is that a correlation (ie when a increases, so does b) does NOT indicate a cause effect relationship. The fact that these kids play violent video games and are violent does not imply a cause/effect relationship.
    • Statistics themselves can be very deceiving. One can find statistics to back just about anything
    --
    "Of all days, the day on which one has not laughed is the most surely the one wasted." -Sebastian Roch Nicol
  342. Re:Missing the point by scumdamn · · Score: 3

    I'd like to see a study done on the effects of team sports and aggression. My son comes home from Lacrosse games and practices and the usually calm nice 15 year old is a pumped up mass of testosterone. He usually has to take an hour to just hang out alone in his room watching tv until he can deal with anyone else without being too boisterous. I'd say his games have a large effect on his behavior, but that doesn't mean that we don't encourage him with what he's doing. He loves the sport, and he is very good at it. Besides, the game has made him tougher and more physically fit.
    Also, I play Quake 3 with my son. We play capture the flag and are usually on the same team. I run and he blocks. We work together and feel a real sense of accomplishment when we trounce another team. I don't see any problem with this at all.
    What? I was supposed to have a point? Oh. Nevermind.

  343. Of COURSE it increases violent behavior! by DrEldarion · · Score: 3

    ... but usually only while playing the games. I can't tell you how many stories of broken controllers/walls/game systems I've heard because people got so frustrated at the damned games...

    Seriously, though, I find video games as an outlet for my aggression a lot of the time... If I get really pissed off at something, I'll go play games for a while, and I'll be totally calm afterwards.

    -- Dr. Eldarion --
    It's not what it is, it's something else.

  344. Interactive Learning by roman_mir · · Score: 3

    I, for once, will agree that interactivity causes better learning curve. Shouldn't we be applying this simple rule of thumb at schools and universities? If interactivity can alter your behaviour faster and more effectively than passive observations then it is the way to go. I think everything that had to do with learning and that was passive before, should become interactive and involve humans into active learning.

    Corollary: I believe that the worst source of violence ever, in the past 50 years (after WWII) was caused by Windows 95/98 OS. It made me so violent sometimes that even the scary Eradicator or Doom or Wolf3 looked PALE in comparison. When my computer crashed because of those OS's I became enraged and unstoppable, I became a killing machine. Of-course when I booted my GNU/Linux or Solaris partitions I cooled down and relaxed for a while.

  345. Doom? Wolfinstien?? Mortal Kombat??? by zombieking · · Score: 3

    This is a NEW study?! And they are playing THESE games??? Of course there is an increase in violent behaviour. These test subject who participated in this study were probably under the impression that they would be playing Half Life or Soul Caliber and they got old, out of date games.... I might be a little violent too...

    --

    -----
    "The only difference between me and a madman is that I'm not mad." - Salvador Dali (1904-1989)
  346. how the study was conducted by ThwartedEfforts · · Score: 4

    I stopped reading when I found out that the study was conducted on volunteer college students (read: adults) using a questionaire. They didn't let people play games and then give them guns to see if they smiled when they fired the guns or something like that. The people who particpated:

    1) had to in order to receive class credit. This is how people who are doing studies get test subjects, the U requires that the 100/200 level students participate in X number of experiments being done by grad students. Unfortunately, these studies are usually questionaires (although, I did participate in one that tested memory by building things with Legos).

    2) having filled out a questionaire, did self assesment, which means any results collected are not singlely biased, but rather are up to the interpretation of each person who filled out the questionaire.

    Personally, I specificly play Quake3 SO I DON'T GET TOO AGRESSIVE IN REAL LIFE AND KICK SOMEONE'S ASS. A quick 200 frags can be really relaxing.

  347. Yet Another Study.. by JonKatz · · Score: 4


    I'll be eager to go read this new study, but I'm always curious about studies like this: How come if video games spur violence among the young, that violence among the young is dropping to its lowest levels since the depression. Though the study may explain Threads.

  348. Not a surprise. by FPhlyer · · Score: 4

    Of course video games increase violent behavior. So does my 40 minute commute through bumper to bumper trafic just to get to a job that doesn't pay me enough. But what really makes me violent? Silly studies that try to place the blame for societies ills on the latest scapegoat. In Nazi Germany, the cause of all human woes was the Jews (according to Hitler and his posse) Today, John Carmack is the father of all things unholy. Get a grip! It's not the games. The people who are blowing away folks in the real world have just never developed a sense of right and wrong. My Dad used to carry a rifle to school every day (in the 40's) to go hunting after school. He never shot, or killed anyone. His parents, at home, taught him better.

    --
    Brought to you by Frobozz Magic Penguin Fodder.
    1. Re:Not a surprise. by KahunaBurger · · Score: 4
      It's not to say that people who engage in violent behavior don't get ideas from video games or movies (or the 10 o'clock news...), but maybe, just maybe, they were predisposed to violence BEFORE they were introduced to the various types of media currently facing blame for the worlds woes...

      I suggest reading On Killing. In WWII soldiers (like the original poster's father, perhaps) had very low firing rates. They gave them guns, pointed at the enemy and said "shoot", but in general, they didn't do much shooting. Troop leaders talked about walking up and down the lines, kicking soldiers to get them to fire their damn guns. These were men from a more rural nation than today, most of whom had probably handled guns well before being drafted.

      By vietnam, the Army had heard of this psychology thing, and was using it to try to reduce soldier aversion to firing on other human beings. They used desensitisation and script building - the same factors, and in some similar ways, that modern psychologists worry about with violent media. Even though its likely that a smaller percentage of vietnam soldiers had handled weapons previous to the draft than their WWII counterparts, firing rates went way, way up.

      Now, to go back to your earlier question, its possible that the entire draft pool of the vietnam war just happened to be more violent than those called up for WWII. Its also possible that people's behavior can be effected by stimuli and training. The fact that we don't present all of this stimuli and training on purpose, doesn't mean that it can't have an effect. It also doesn't mean that one round of Doom can turn a healthy person into a killer. But then, one cigarrette won't turn a healthy person into a corpse either, and that doesn't mean they're safe.

      -Kahuna Burger

      --
      ...will work for Chick tracts...
  349. NY Times Report by blukens · · Score: 4
    The New York Times recently conducted a study of about 100 rampage killers and found that most killers were not the product of loud music and video games, but in fact over half of them were known to be mentally ill.

    It starts out:
    >They are not drunk or high on drugs. They
    >are not racists or Satanists, or addicted to
    >violent video games, movies or music.

    You can read the series of articles here: http://www.nytimes.com/library/national/040900ramp age-killers.html

  350. Thoughtless posts are more damning than good by Junks+Jerzey · · Score: 4

    Could we calm down a bit before posting on this subject? Like any "study" that shows Linux may be inferior to some other OS in some obscure way, this topic always brings out the raving lunatics who disagree, because, dammit!, it's wrong! This doesn't help the "cause" any.

    Violent video games are in a bad position, because they get kids talking about how much damage different weapons do and how much ammo they hold and how they took down Joe 3/_ee+ with a head shot. Well, duh, this is going to cause people to wonder. Yeah, yeah, yeah, violent movies, blah, blah, blah, but they didn't let the viewer to do the killing. Being smug about this is the wrong angle. It's like going in front of a PTA and saying, "C'mon all you soccer moms! Marijuana isn't bad like everyone says! Look at me!"

  351. The Quote... by ranger93 · · Score: 4

    The quote says it all...

    Gun manufacturers don't make bad products, bad parents do.

  352. The experts have an opinion, or three by The+G · · Score: 5

    Last year, studies said bran was good for you. This year they say it's bad for you.

    Vitamin C used to useless, then it was a miracle drug, now it's useless again.

    And yes, after a year of studies finding little correlation, there will of course be two that find that video games are killing us all. Along with rays from high-tension lines, cellular phones, caffeine, aspartame, and the fumes from using ALex caulk on your house's siding.

    Yawn.

    Somebody let me know when the experts have agreed on something for more than five years in a row. I should be nearly finished with Thief II and System Shock 2 by then. Then you can let me know if I'm a raving psycho or not.
    --G

  353. No Slashdot, NO! by zCyl · · Score: 5

    The article does NOT say that video games increase violent behavior, in fact, it says precisely the opposite. Allow me to show you why it says the opposite, when one understands entry level psychology statistics methods.

    > Playing violent video games often may well cause increases in delinquent behaviors,
    > both aggressive and nonaggressive. However, the correlational nature of Study 1
    > means that causal statements are risky at best. It could be that the obtained video
    > game violence links to aggressive and nonaggressive delinquency are
    > wholly due to the fact that highly aggressive individuals are especially
    > attracted to violent video games.

    This is the single most significant portion of Study #1, it says that people who play violent video games are the same people who are aggressive individuals. This means one of three things, either people play violent video games and become aggressive because of it, people who are aggressive prefer to play violent video games, or a third factor causes both aggressiveness and a tendency to play violent video games.

    In order to resolve which of the three it was, they conducted the second study. In Study #2, the hypothesis was the first of the three things I mentioned, that playing violent video games causes aggression. The results of the pilot study conducted for the hypothesis are reported as follows:

    > The game type effect as well as all two- and three-way interactions between
    > the independent variables were nonsignificant (allps > .05).

    The key word here is "nonsignificant". In other words, this means that when they attempted to find an increase in aggression due to playing violent video games, they completely failed. There was no measureable increase in aggression due to playing violent video games.

    So in conclusion, no, playing violent video games does NOT increase violent behavior, and studies, such as this one, continue to demostrate such. Only the opposite can be shown, that people who are aggressive are inclined to play violent video games.

  354. Well, Duh! by Forrest+J.+Cavalier · · Score: 5
    This is obvious. [But I can imagine the whole range of denials from /. quake-rs: No, not me. Can't happen! Ridiculous. Just look at me, I'm not affected...yada yada yada.]

    Hello? Anybody home? Our brains are neural networks, which learn by patterning and repetition.

    Do the "violent behavior is normal/acceptable/etc" neural pathways get reinforced by playing violent games or by watching cinema/TV violence? Of course they do.

    The survival of civilization relies on the OTHER neural pathways overriding the violent ones when its time to make a real life decision. Thankfully this happens most often. Unfortunately, it is happening less often that it used to (road rage is an example.)

    Argue all you want that playing violent games is not criminal. (I don't think it is either.) The problem is, the "violent is beneficial" pathways (by nature and evolution) respond FASTER than the "peace" pathways.

    Train (a neural network term) those peace pathways as much as you train the ones for immediate attack/flame, and you'll be a fine member of a civilization.

    Obvious to any thinking person.

  355. Video Game/ Violence Correlation by liquid-groove · · Score: 5

    I know this probably weon't make some people happy, but I see this with my own son. When he rents a new shoot 'em up game he seems to be much more aggressive after a few hours of game play.

    Knowing this however, it becomes _my_ responsibility as a parent to monitor his game usage and teach him how to appropriately channel his aggression.

    Using video games as a substitute for family interaction can lead to problems. Socialization is a learned skill and sitting in front of a video console 4 hours a night takes away from the opportunities to learn this skill.

    Does that mean that all of us (myself included) who like to play video games are going to turn into gun crazed lunatics? No, and some groups will try to oversimplify these findings to say that. But there does need to be a balance and it is responisibility of parents to make sure that balance is there.

  356. Look at this study for what it is... by El+Volio · · Score: 5
    There's no statement that this proves anything. The authors are well aware that the first experiment only demonstrated correlation, and as we all know by now, correlation != causation. In fact, it could even be hypothesized that naturally aggressive individuals are more likely to want to play violent games.

    And the second experiment is just that -- an attempt to start to establish firmer ground for the "video game hypothesis". This was a pretty responsible approach, I believe. The scientific method bears out the truth in time, and in this case, the researchers were clearly trying to find the truth.

    Before people overreact, let's remember that there's nothing wrong with having the hypothesis that there is a causal link between real-life and video game violence. For many people, that's actually a "common sense" conclusion. So when someone wants to apply the scientific method to verify the validity of that conclusion, even those who oppose it should applaud the honest and valuable effort.

    --

    "You can never have too many elephants on your team."

  357. I agree by Snoobs · · Score: 5

    I am really really really violent. If someone talks to me when I am at my computer trying to get work done, I will punch them. If I am at the water fountain getting a drink and someone tells me to hurry up, I will kick them.

    I learned this behavior from playing video games. It all started with Shinobi, the ninja game from sega. I started pretending to be a ninja and then when street fighter II came out I started fighting like blanka. You couldn't have imagined it when I would dress up in my yellow fur and beat the crap out of people.

    This is my life style and I have video games to thank for it. I now know 20 different styles of martial arts, learned from playing video games. You would believe how high I can jump!

  358. False Statements and other sources by ronfar · · Score: 5
    Harris and Klebold enjoyed playing the bloody, shoot-'em-up video game Doom, a game licensed by the U.S. military to train soldiers to effectively kill from the APA Journal article
    This is a false statement, if I am to believe that the Wired Article, then Doom is used by the military to teach teamwork:
    Barnett looks like he's explained this one before. "Marine Doom, as you saw, is not just a twitch game. The way you get through a Marine Doom scenario and survive is through teamwork and listening to your fire team leader and doing what you're supposed to...."

    "It's about repetitive decision making," Snyder swiftly interjects. Snyder's habitual deference - even off-duty, he calls his friends sir - doesn't always extend to allowing Barnett to finish his sentences. "We're trying to get these things ingrained by doing them over and over, with variations. A real firefight is not a good time to explore new ideas."

    "You also saw how everyone was absorbed," Barnett adds. "That's another part of it. Kids who join the marines today grew up with TV, videogames, and computers. So we thought, how can we educate them, how can we engage them and make them want to learn? This is perfect."

    Like all the media, starting with Grossman, this report has taken a military experiment in teaching teamwork and turned it into a sinister government program to destroy the morals of young soldiers. Since the researchers involved in the project started with this bias, I think we can safely conclude that they are looking at this from a perspective of "violent video games are evil, how can we prove it?"

    The psychological profession long ago decided that the road to power and political relevance was to reject the Aristotilean idea of catharsis and instead follow the Platonic idea that "the poets should be banned from the Republic because they get the people all stirred up." Otherwise, they won't get invited to testify on Capitol Hill or TV talk shows.

    There are some counter articles out there today that everyone should also read:

    Lawmakers are uneducated about video game industry, panelist says

    Illinois attorney general urges end to sales of violent video games to minors

    And, most importantly: Federal judge dismisses lawsuit against movie, video game makers

    I think the big question that everyone needs to ask themselves is who better serves American interests, jurists, or psychologists? I agree with R. A. Heinlein (who used to get guff from amateur psychologist when he was writing his juvenile novels, Red Planet, and others) that the psychological profession is full of charlatans and quacks. Of course, with the current low regard the First Amendment and the entire Constitution is held in in this country, I don't expect my opinions to hold much weight.

    --
    All the creatures will die, And all the things will be broken. That's the law of samurai. (Jubai, 1605)
  359. Analyse by retep · · Score: 5

    The first study just found a link between violent games and violent behavoir. However a link doesn't mean that violent games cause violent behavoir. It's quite common for people to confuse these two. Just because something is associated with something else doesn't mean that that something caused something else. Floods and rain are linked, but you wouldn't say that floods caused rain!

    The second study looks at very short term effects that lasted a matter of minutes. No-one has done any proper studies to look at this. IE you get a two groups of kids, encourage one group to play violent games, watch violent TV etc. while do nothing with the other group. Then as they grow up watch their behavoir. Unfortunatly these sort of studies cost huge amounts of money and take a very long time to complete. But they are the gold standard.

    Now what would happen if such a study was done and showed a definit cause and effect between violent games and TV and violent behavoir? Well I'll put it this way, good luck keeping Doom legal!

  360. Missing the point by tjwhaynes · · Score: 5

    "One study reveals that young men who are habitually aggressive may be especially vulnerable to the aggression-enhancing effects of repeated exposure to violent games," said psychologists Craig A. Anderson, Ph.D., and Karen E. Dill, Ph.D. "The other study reveals that even a brief exposure to violent video games can temporarily increase aggressive behavior in all types of participants."

    I look at this report and I worry. Not because of the details of the report in particular, but because aggressive behaviour is difficult to pin down and is not necessarily a bad thing. The first report seems to me to say that aggressive people may be stimulated by aggressive situations. That doesn't strike me as being an illogical statement - it is merely stating the obvious. The second study is more interesting. If I play an immersive video game, yes, my heart rate goes up. In a tricky situation when I'm pinned down by sniper fire or there is a helicopter whirring overhead, I'm tense, edgy. If I get into an open fire-fight with half a dozen other human players or computer-controlled players, I may get aggressive and noisy. So yes, video games do have an effect, probably far more effective then TV because the interaction between what you see and can do is so much more complete.

    But is this limited to computer games, or does it extend to other activities? I would argue that any competitive activity will lead to increased aggression over my normal, fairly passive self. If I play rugby, there is no way I'm going to survive on the playing field unless I get going. If I'm not pumped when I get the ball, I'm going to get flattened by someone who wants it more than I do. If I'm being chased by some back row player who is technically faster than me on paper, then that extra adrenaline is going to be needed if I'm going to make it to the line. If I'm going to tackle some 6ft6 tight-head prop forward who weighs 260 lbs, I'd better be aggressive!

    Any involving competitive activity will require an increased level of adrenaline, alertness and aggression. And it's not necessarily a bad thing - these are our survival instincts being used in a modern arena, whether it's rugby, Quake or even some individual sport like badminton. Aggression can help us out when our other resources are low. The only time aggression becomes a problem is when it is taken from the field of play/battle/sport whatever and spills over into our daily lives. And I really don't feel that this report works through this last point.

    Cheers,

    Toby Haynes

    --
    Anything I post is strictly my own thoughts and doesn't necessarily have anything to do with the opinions of IBM.