Slashdot Mirror


Should SETI Be Looking For Lasers Instead?

colonist writes "Frank Drake, creator of SETI's famous equation, says the detection of extraterrestrial radio signals won't work, because Earth's own radio signal will only be around for 100 years. More and more of Earth's communications use cable and satellites, with no radio-frequency leakage to space. Instead, we should be looking for intentional signals in the form of high-powered lasers that could 'outshine the sun by a factor of 10,000'. Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA. In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?"

523 of 694 comments (clear)

  1. Optical SETI by Space+cowboy · · Score: 5, Interesting


    Optical (ie: laser detection) SETI has been up and running for a while now (see Optical SETI overview for example). Drake ought to declare an interest though, since he's one of the investigators on the project.

    It's a reasonable argument, but it's far harder to set up optical "listening" posts than radio ones. It cost me about 1000 uk pounds (WHY is the pound symbol banned from /. ?) to set up a SETI listening post, including all the costs from dish/low-noise-amplifier through receiver and PC. Setting up an optical one is waaay more expensive. Optics in general are far more expensive than radio components, and large-scale ones are extortionate :-(

    The counter argument of course is that to detect laser light, the remote civilisation have to be pointing their laser at us, whereas with radio it doesn't matter since it's not a directed beam. Against that you have to offset the time-period over which transmissions of either kind could be made...

    The chances of getting a radio contact may be a few orders of magnitude lower than getting an optical contact, but since the chances of me setting up an optical SETI station are precisely 0, the chances of getting 'the' signal with radio is infinitely greater than with optics, at least for me :-)

    Simon

    --
    Physicists get Hadrons!
    1. Re:Optical SETI by selderrr · · Score: 4, Interesting

      a very stupid question from a non-engineer : is it not possible to have non-directed optical signals ? Some sort of 'ambiet laser'. I understand that you'd have to go low voltage in order not to burn everything around you, but aren't pulsar stars some sort of ambient light beacon ? ? And how about we set up SETI to search for radioactivity residue slung into space ??

    2. Re:Optical SETI by Anonymous Coward · · Score: 5, Informative

      £

    3. Re:Optical SETI by BarryNorton · · Score: 5, Insightful

      A diffuse source contradicts with LASER, but yes, it's possible. But in order for it to be detected over ambient light it would have to be something huge and noticeable like a pulsar - I'd hate to see their electricity bill, these aliens of yours ;)

    4. Re:Optical SETI by Zarhan · · Score: 4, Informative

      very stupid question from a non-engineer : is it not possible to have non-directed optical signals ? Some sort of 'ambiet laser'

      Um, yes. Just take a look at your closest lightbulb. There's your omnidirectional light source right there. One might actually consider variable stars as messages from outer space...

      In the interests of mentioning something real that actually exists, take a look at 802.11 over IR

      Lasers are used for point-to-point links because there is usually an intended recipient. All of the energy goes to that single, intended direction. However, there shouldn't be anything to stop creating ambient monocromatic light source..

    5. Re:Optical SETI by FinestLittleSpace · · Score: 1

      AFAIK, if it's ambient.. it's not a laser.. a laser is a focused stream of light. Correct me if I'm wrong though, IANAS ;-)

    6. Re:Optical SETI by Amiga+Lover · · Score: 5, Funny

      I'm not really sure I want to be looking to make contact with aliens who are pointing FRICKEN LASERS at us.

    7. Re:Optical SETI by Lussarn · · Score: 1

      is it not possible to have non-directed optical signals
      The obvious thing would be to move the directed optical signal to widen the field.

    8. Re:Optical SETI by Sique · · Score: 5, Informative

      A laser is a L.A.S.E.R., which stands for Light Amplification by Stimulated Emission of Radiation. This means that the laser light is an amplification of a smaller light source. Because of the amplification, the laser light waves are synchronous to each other, because they are the amplification of the same light wave. This type of light is called coherent. And because the light waves are synchronous, they can't be diffuse, which would be a contradiction in itself.

      If laser light travels, it loses this coherency, so the laser light gets more and more diffuse (the coherency gets slowly down, so the diffuse part increases). Optically this means that the light beam diameter gets wider and wider with the distance from the source. If the starting laser beam is very strongly bundled and has a very small diameter (thus a high energy density), this widening effect gets stronger. Less strong bundled lasers with lower energy density don't widen that much, so most long distance laser experiments (like measuring the distance to the Moon by shooting a laser beam there and take the time until the reflection can be measured) use quite large diameters, which you wouldn't call "laser" at all, because they don't spur the needle fine light :)

      --
      .sig: Sique *sigh*
    9. Re:Optical SETI by jez9999 · · Score: 4, Informative

      WHY is the pound symbol banned from /. ?

      I believe the answer would be because Slashdot only supports the lower 128 bits/characters of ASCII because the upper or extended 128 bits/characters are not standardized. Or rather, there are too many standards - hundreds of them - used by different people and countries to represent various different characters. Perhaps Slashdot should support the most common of them, ISO-8859-1 (Latin-1), in which the code for the UK pound symbol is 163... but Unicode will probably be supported before that happens. In short, Slashdot sucks a bit. :-)

      As an AC showed in reply to this thread, you can display the UK pound symbol using its HTML equivalent '£' - producing £.

    10. Re:Optical SETI by thue · · Score: 2, Funny

      A light bulb is a non-directed optical source. By turning the light bulb on and off in morse code you would have a non-directed optical signal. :)

    11. Re:Optical SETI by hashwolf · · Score: 4, Funny

      how about we set up SETI to search for radioactivity residue slung into space ??

      Sure, radioactive sludge thrown in space is a sure sign of intelligence.

      --
      - "They misunderestimated me."
    12. Re:Optical SETI by Anonymous Coward · · Score: 2, Interesting

      The reason a pulsar, well, pulses, is because it is spinning. The radiation IS directional, but because the pulsar is spinning, you see the pulsating signal from a distant location. Try to imagine a lighthouse sending it's beam of light in all directions(in 2D, at least), but not in all directions at once.

      Come to think of it, this may be a very viable option for sending a "hello universe" via optical means.

      Heck, maybe pulsars ARE hello world messages. :)

    13. Re:Optical SETI by Nivag353 · · Score: 2, Interesting

      Probably better to support ISO-8859-15 which includes the Euro
      currency symbol.

      The Euro currency is already officially in use in 12 countries and
      over the next few years more countries in Europe will adopt it as
      their official currency. It is also used unofficially in several
      other countries.

      The Euro is increasingly the preferred currency for
      international travellors. For example coming to Ireland via
      China in 2001 we converted money into US$, but now we are
      advised to carry Euro.



      -Nivag

    14. Re:Optical SETI by Captain_Chaos · · Score: 1

      ... is it not possible to have non-directed optical signals?

      Of course. Light is just electromagnetic radiation, like radio is, so anything you can with radio you can do with light. The simplest example of an omnidirectional light beacon is a lightbulb...

      You can't have an omnidirectional laser though, since the fact that the light is unidirectional is one of the things that makes it a laser...

      Pulsars are a bad example of an omnidirectional beacon by the way, since pulsars send out beams of radiation, although they do spin. They're more like a lighthouse than a lightbulb.

    15. Re:Optical SETI by Captain_Chaos · · Score: 1

      I'm not really sure I want to be looking to make contact with aliens who are pointing FRICKEN LASERS at us.

      Why not? After all, we point lasers at other planets too.

    16. Re:Optical SETI by FireFury03 · · Score: 1

      The counter argument of course is that to detect laser light, the remote civilisation have to be pointing their laser at us, whereas with radio it doesn't matter since it's not a directed beam.

      Why are you assuming that radio signals wouldn't be directional? Assuming ET knows where to direct a LASER, there's nothing stopping them pointing a MASER at us either. Although I would've thought that we're far more likley to pick up distinctive omnidirectional signals since it seems somewhat more likely that ET wouldn't know specifically where to direct the signal.

      I've seen some suggestions that advanced civilisations may use twisted light or graviton waves to communicate too.

    17. Re:Optical SETI by Delirium+Tremens · · Score: 3, Funny
      coming to Ireland via China in 2001 we converted money into US$, but now we are advised to carry Euro.
      Could it be because the Euro is actually Ireland's official currency since 2002?
    18. Re:Optical SETI by moonbender · · Score: 4, Informative
      One might actually consider variable stars as messages from outer space...
      Pulsars are rapidly rotating neutron stars with periods less than ~3.75s. When they were first discovered at the radio telescope at Jodrell Bank, England, their origin was unknown and they were thought to possible be signals from extraterrestrials. As a result, the first pulsar was named LGM-1, with LGM standing for "Little Green Men."
      (source)
      --
      Switch back to Slashdot's D1 system.
    19. Re:Optical SETI by FireFury03 · · Score: 5, Informative

      A diffuse source contradicts with LASER

      Not necessarilly. A LASER does 3 things:

      1. Produces a narrow beam of light
      2. Produces monochromatic light
      3. Produces coherent light

      Monochromatic light is produced by gas-discharge tubes (e.g. sodium lights, etc) - nothing special here.

      You can produce a narrow beam of light using a point lightsource and mirrors/lenses.

      Now, the special bit - your normal light bulbs produce incoherent light - you get lots of photons emitted but their waves aren't synchronised, so they interfere destructively with eachother. By contrast the light you get off a LASER is coherent - all the waves are synchronised, so they interfere constructively, making the light appear brighter.

      So if you want to create a omnidirectional optical light beacon, rather than using a normal light bulb and ending up with the photons randomly interfering with eachother destructively, it makes more sense if you can synchronise the wave fronts so they expand away from your light source in neat coherent spheres.

      (I have no idea if the technology exists to do this ATM - it seems like a rather complex problem)

    20. Re:Optical SETI by beh · · Score: 1

      Hmmm... Doesn't that beg the question on whether an alien culture might be able to control (as in modulate) a pulsars "signal"?

      That would certainly take a lot of energy - but could it be done? (Even if it's only a minor modulation on top of a pulsars signal)?

      (Of course, if you'd find a way to do something like that, I'd think it's imaginable to do something like this to a regular star - but I'd guess that pulsars because of their nature might be more probable targets to attract researchers of different species, and hence might be relatively closer checked than other, "normal", stars)

    21. Re:Optical SETI by kahei · · Score: 2, Funny


      1 -- you mean 'characters', not 'bits/characters'. 128-bit character sets will not be needed until we have to represent the languages of hyperintelligent alien races.

      2 -- ASCII is a SEVEN bit standard, it only deals with 128 possible values. There is no 'non standardized upper half' of ascii. There _are_ many 8-bit character sets whose lower half is defined as 'same as ASCII'.

      3 -- Nobody knows for sure why /. can't just support Unicode, but it's probably because there are so many people here who think unix is a great OS -- ack! Get away from me with those mod points! Nooooo!

      --
      Whence? Hence. Whither? Thither.
    22. Re:Optical SETI by FireFury03 · · Score: 1

      And because the light waves are synchronous, they can't be diffuse

      You could organise the wave fronts to expand away from the source in a spherical pattern - the light would still be coherent (observe it from one point and all the photons that hit you would be synchronised) but it would also be omnidirectional. (No idea how you would generate such a light - I am not a physacist :)

      If laser light travels, it loses this coherency

      Why is that? (you go on to talk about losing collimation, not coherency). I guess in the atmosphere the photons would pass through slightly different density matter, interact with different particles, etc and so would travel at slightly different speeds and also lose slightly different amounts of energy (since the energy of a photon determines it's frequency then your light will stop being monochromatic if the photons lose differing amounts of energy). But in space, ignoring the interstellar medium, the only thing that would cause the photons to lose coherence would be gravity... and unless you're dealing with very large tidal forces is the difference between the wave fronts of the photons collected by the relatively small area of a telescope really going to be significant? (again, IANAP - I'm just going on my limited understanding of physics).

    23. Re:Optical SETI by maxwell+demon · · Score: 1, Funny
      Has anyone tried the trick with a yen symbol?


      ¥€$
      --
      The Tao of math: The numbers you can count are not the real numbers.
    24. Re:Optical SETI by Hal-9001 · · Score: 4, Interesting
      A LASER does 3 things:

      1. Produces a narrow beam of light
      2. Produces monochromatic light
      3. Produces coherent light


      Actually, condition 3 is the only one that is necessarily true of all lasers. There are solid-state lasers with very wide bandwidths, thereby violating condition 2, and it is easy to expand or diffuse a laser beam, thereby violating condition 1.

      To be honest, there is little point in creating an omnidirectional laser source, at least for SETI purposes, because that only degrades the signal-to-noise ratio. However, if you want to do so, it's pretty trivial: shine the laser beam into a high numerical-aperture microscope objective, and the wavefronts that emerge beyond the focal point will be an excellent approximation of ideal spherical waves.
      --
      "It take 9 months to bear a child, no matter how many women you assign to the job."
    25. Re:Optical SETI by MoP030 · · Score: 1
      so they interfere destructively with eachother.

      Actually they should interact both des- and constructively with eachother, and on average not at all, otherwise you would have the opposite of a laser: A light source that is dark because all rays annihilate eachother.
      --
      the most sexp i get is my paren-mode.
    26. Re:Optical SETI by SEWilco · · Score: 1
      Radio tends to not be directed, but as a radio signal gets weak very quickly it also has a shorter range.

      There are advantages to both technologies. With radio it is easier to advertise your presence to nearby stars. With lasers it is harder to broadcast, but listening is easier because signals may be detected from many more stars.

    27. Re:Optical SETI by boicy · · Score: 4, Interesting
      "By contrast the light you get off a LASER is coherent - all the waves are synchronised, so they interfere constructively, making the light appear brighter."

      Hmm, not actually sure if this is correct. This is going back a bit but I think:

      Laser stands for Light Amplification by the Stimulated Emission of Radiation.

      A LASER doesn't produce light because of waves contructively interfering. The light is amplified by the absorbtion and emission of photons at specific wavelengths.

      There are two types of photon emission, spontaneous and stimulated.

      Spontaneous emission occurs when an electron in an atom "jumps" from a higher quantised state to a lower one giving up energy. This energy is emitted as a photon. This is what happens in street lights, electrons fall back to a lower energy level and that corresponds exactly to the wavelength of the orange light we see. The photon can be emitted in any direction.

      Stimulated emission occurs when an atom absorbs a photon causing an electron to move to a "higher" state but in this case the electron can immediately jump back to it's lower state. This causes two photons to be emitted in exactly the same direction as the original photon was travelling.

      Essentially a LASER works by putting mirrors round a cavity and multiplying the photons by bouncing them back off the mirrors and into the emitting atoms thereby causing a "chain reaction" to take place where two become four etc.

      The reason that you get monochromatic light (normally) is that the wavelength of the photons produced is exactly related to the energy levels in the atom producing them. The reason you get coherent light is because the photons are travelling in the same direction.

      IWAPIU (I was a physicist in Uni) and built a Nitrogen LASER for my final year project. That was a good 8 years ago now though.

    28. Re:Optical SETI by drinkypoo · · Score: 1

      There's plenty of ways to make Unix handle unicode. My only question, because I've never looked into it, is how assorted web browsers not designed for unicode handle unicode text, and what you have to do to the server to make it support them gracefully if necessary.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    29. Re:Optical SETI by FireFury03 · · Score: 1

      A LASER doesn't produce light because of waves contructively interfering. The light is amplified by the absorbtion and emission of photons at specific wavelengths.

      A LASER doesn't produce light _because_ the waves are constructively interfering (I was never suggesting that coherency is a cause, only the effect).

      The reason that you get monochromatic light (normally) is that the wavelength of the photons produced is exactly related to the energy levels in the atom producing them.

      Yes, this is exactly the same as normal gas discharge tubes.

      The reason you get coherent light is because the photons are travelling in the same direction.

      Correct me if I'm wrong, but since each photon is produced in response to another their waves are synchronised, so the light is coherent. In contrast, the photons are not at all synchronised in a normal gas discharge tube since they rely on electrons (travelling at less than light speed) to stimulate the emission of a photon, so even if the photons were all being released in the same direction they wouldn't be coherent.

    30. Re:Optical SETI by clintp · · Score: 4, Insightful

      I've always thought that a Dyson Sphere with "holes" in appropriate places might serve a dual purpose. The first is, of course, a place to live, collect the star's energy, etc...

      Secondly, as the sphere rotates around the star the "holes" (notches, spaces, gaps, whatever) would -- from the outside -- appear to be blinking lights. Spaced at prime-number width intervals it'd serve as a nearly eternal beacon for other intelligent life. No maintenance, no machinery, and a broad-spectrum beacon as well.

      --
      Get off my lawn.
    31. Re:Optical SETI by pappin · · Score: 2, Insightful
      I don't think you get the aspects of laser light that make it visible over long distances.

      All photons in laser light have the same wavelength, and do not scatter, so they travel in the same direction over long distance.

      Light such as white light consists of light of different wavelengths that scatter in an omni directional pattern. Only part of the light reaches your eye, and the further away you go from the sources, the more gets scattered before it reaches you.

      So, you can't diffuse laser light and still have it visible over long distances, which means if your looking for it you can expect a point source and you have to be looking directly at it.

      A good SETI tool? I don't think so, but there is no harm in trying, because it definitely a possibility!

    32. Re:Optical SETI by FireFury03 · · Score: 1

      Yeah, I get all this - I was just making the point that if you _were_ going to use a omnidirectional light source for signalling it would make sense for it to be monochromatic and coherent since you then eliminate destructive interference.

      I know that omnidirectional lightsources aren't anywhere near practical for signalling over interstallar distances (unless you're dealing with star-brightness sources :), but I was replying to the original poster who was asking if it is possible to have an "ambient laser", which is essentially describing a coherent monochromatic omnidirectional light amplification device.

    33. Re:Optical SETI by dfj225 · · Score: 1

      "One might actually consider variable stars as messages from outer space..."

      I don't think I would really consider a pulsar to be a message, since they are created through a very simple physical event. When the star collapses on itself, its rotational speed must increase in order to conserve energy, thus it spins quickly with an practically standard period. If you want to think about this in another way, just look at ice skaters (or you can even try this on a swivle chair): when they spin around with their arms out and then quickly bring them in, their angular speed increases, just like when a star collapses on itself.

      --
      SIGFAULT
    34. Re:Optical SETI by Impy+the+Impiuos+Imp · · Score: 1

      Correct me if I'm wrong, but doesn't the Dyson sphere suffer from the same problem as the Ringworld? Because it is a solid, it won't remain in "orbit", but will degenerate, with one edge sliding into the sun, in spite of rotation?

      Of course, on those scales, something with even diamond rigidity would probably be far more gossamer than a puff of smoke, so perhaps the orbiting of the Ringworld might work after all, without the need for stabilizer rockets.

      --
      (-1: Post disagrees with my already-settled worldview) is not a valid mod option.
    35. Re:Optical SETI by TheCarp · · Score: 2, Insightful

      of cours ethen all you need is enough material to produce a dyson sphere.

      Given the relative size of stars to planets... the Boston MOS has a great display where they show the sun and the planets to scale.

      They have a portion of a sphere which, if memory serves is stickin gout of the wall. It is about 1/3rd of a sphere...and looks like it has a solid 2/3 of a meter radius. Thats the sun.

      The earth is around the size of a golf ball at this scale.

      So I am thinking you need to not just mine but just destroy and completely use all of the mass in several thousand planets just to have enough raw material to produce the sphere.

      Other than those purely logistical issues, sure, sounds like a great idea.

      -Steve

      --
      "I opened my eyes, and everything went dark again"
    36. Re:Optical SETI by Ignorant+Aardvark · · Score: 1

      So I am thinking you need to not just mine but just destroy and completely use all of the mass in several thousand planets just to have enough raw material to produce the sphere.

      Not necessarily. Or you could just use some of the material from the Sun to construct a Dyson Sphere. The physics of it are briefly examined in the science fiction novel The Time-Ships by Stephen Baxter.

    37. Re:Optical SETI by Zeinfeld · · Score: 1
      So, you can't diffuse laser light and still have it visible over long distances, which means if your looking for it you can expect a point source and you have to be looking directly at it.

      This whole scheme sounds to me like that scheme some guy had to make the moon turn red by pointing laser pens at it.

      The big problem here is the atmosphere, and that is not a neutral propagation medium. When you go through several miles of it anything other than the brightest light is going to disappear.

      To make the scheme work you probably would want to forget lasers and use a natural light source such as a star and construct some form of blind in space to modulate the light from a pulsar or the like.

      OK its a pretty far out scheme, but no more so than the giant laser scheme. Its like suggesting building a land link from the mainland to Hawaii. Is a bridge more farfetched than a tunnel?

      --
      Looking for an Information Security student project suggestion?
      Try http://dotcrimeManifesto.com/
    38. Re:Optical SETI by Nivag353 · · Score: 1

      To be more precise:

      If we were to go back to New Zealand from Ireland, and
      planned to spend a few days in China, then now
      we should get Euro rather than US$.

      Prior to 2002 the Irish currency was the Irish Pound, often
      referred to as a "Punt".

      Even if we had been living in England, we would still be
      getting Euro, rather than carrying Pound Stirling (aka UK
      Pounds).


      -Nivag

    39. Re:Optical SETI by Nivag353 · · Score: 1

      The UK still uses Pounds.
      Ireland used to use Irish Pounds, but now use Euro.


      -Nivag

    40. Re:Optical SETI by Cecil · · Score: 1

      Because it is a solid, it won't remain in "orbit", but will degenerate, with one edge sliding into the sun, in spite of rotation?

      How do you figure? Assuming it is perfectly spherical and centered around the sun: gravitational force exerted by the sun on the "right" side pulls it to the left. gravitational force exerted by the sun on the "left" side pulls it to the right. Same with top-to-bottom and any other direction you can think of. You can see the same principle at work in those little magnetic "floating" balls they sell at novelty/science stores. It uses a magnet to exactly counteract the force of Earth's gravity, and the ball floats in mid-air. All the different forces on each side cancel each other out.

      Back to the Ringworld "problem": Even if the sun happens to insist upon hurling out CMEs in one particular direction for awhile or if the light emitted by the sun is more than a bit irregular, the solar wind, even a lot of it, contains realistically zero motive force on any object of reasonable mass.

      So, while it might need tiny orbital correction from time to time, as long as you are absorbing all of the sun's energy, I doubt you'll be breaking your back to avoid running a bunch of ion engines now and then.

    41. Re:Optical SETI by Tjp($)pjT · · Score: 1

      ©

      --
      - Tjp

      I am in wallow with my inner money grubbing capitalistic pig. ... Oink!

    42. Re:Optical SETI by JRIsidore · · Score: 2, Informative

      Stimulated emission occurs when an atom absorbs a photon causing an electron to move to a "higher" state but in this case the electron can immediately jump back to it's lower state. This causes two photons to be emitted in exactly the same direction as the original photon was travelling.

      If the incident photon would excite an electron, which by falling back into its lower state will emit another photon, you cannot get out 2 photons identical to the incident one. This violates conservation of energy.
      With stimulated emission an incident photon interacts with an already excited atom, where the excitation energy must be (more or less) equal to energy of the photon. Then this photon can cause the electron to drop into a lower state, producing another photon, which will be identical to the incident one (and travel in the same direction).

      --
      :w!q
    43. Re:Optical SETI by JRIsidore · · Score: 2

      All photons in laser light have the same wavelength, and do not scatter, so they travel in the same direction over long distance.

      Nope. Most lasers emit light at several modes (frequencies) and some do so on a very broad band. A single-mode laser is actually quite demanding to build.
      And laser light scatters excatly the same way other light does, it's nothing different. But it is very directional and can achieve high intensities, that's why it usually travels further than the light of a bulb.

      --
      :w!q
    44. Re:Optical SETI by DysonSphere · · Score: 2, Interesting

      How about parking a "shutter" in between a star (say ours), opening and closing it in a pattern to make our star appear to blink in a mathematical pattern. Much cheaper than building a Dyson Sphere, visible over great distances, and you would get your "quasar" effect. Wouldn't have to be that large either.

      --
      Mommy. What's a karma whore?
    45. Re:Optical SETI by nmg196 · · Score: 1

      In anyone is wondering... you have to use £ to get the £ symbol. If you're not a UK web developer - that may not be obvious :)

    46. Re:Optical SETI by JRIsidore · · Score: 1

      Further nitpick: a laser does amplify more than your lightbulb since it's based on another principle, the stimulated emission, whereas the lightbulb "uses" spontaneous emission. Lasers always have an active medium which amplifies the light. By your definition a lightbulb within a cavity would also be a laser...

      --
      :w!q
    47. Re:Optical SETI by Anonym1ty · · Score: 1
      "(WHY is the pound symbol banned from /. ?)

      It is? ££ ££

    48. Re:Optical SETI by JRIsidore · · Score: 3, Informative

      Well, besides the lightbulb others already mentioned there actually is a kind of ambient laser - the random laser. It differs from others that you don't have a cavity but a little sphere (or a cloud) of the active medium. On their way out of it the photons get scattered, but also amplified by stimulated emission. This type of laser usually radiates in all directions. Here's some more information about them: random lasers. Look under publications, there are 2 papers on the 2nd page.

      --
      :w!q
    49. Re:Optical SETI by r2q2 · · Score: 1

      An ambient Lazer would be the sun.

      --
      My UID is prime is yours?
    50. Re:Optical SETI by multipartmixed · · Score: 1

      > what you have to do to the server to make it
      > support them gracefully if necessary.

      Generate all your output in UTF-8. If the browser can't handle it -- fuck 'em. They'll see a funny little A with a circle and another character instead of the pound sign. Big deal.

      --

      Do daemons dream of electric sleep()?
    51. Re:Optical SETI by Carnildo · · Score: 2, Insightful

      Correct me if I'm wrong, but doesn't the Dyson sphere suffer from the same problem as the Ringworld? Because it is a solid, it won't remain in "orbit", but will degenerate, with one edge sliding into the sun, in spite of rotation?

      Not to the same degree. Ringworld is actively unstable, meaning that if it gets off-center, the star's gravity will pull it further off-center. A Dyson sphere is neutral, meaning that the star's gravity has no net effect on it. If it gets off-center, it can be stabilized in that position -- with an unusual gravity gradient on the surface!

      --
      "They redundantly repeated themselves over and over again incessantly without end ad infinitum" -- ibid.
    52. Re:Optical SETI by erpbridge · · Score: 1
      The Euro currency is already officially in use in 12 countries and over the next few years more countries in Europe will adopt it as their official currency. It is also used unofficially in several other countries.


      So, when are we going to start seeing countries outside of Europe using the Euro? I'd like to hear that the Euro is the default form of currency in the US, or maybe in Brazil...

    53. Re:Optical SETI by Chuck1318 · · Score: 1
      Because it is a solid, it won't remain in "orbit", but will degenerate, with one edge sliding into the sun, in spite of rotation?

      Dyson's original concept for a Dyson Sphere was not a solid sphere, but the idea that there would be sufficient solar collectors in orbit around the star to intercept its light. This is a form of SETI, detecting ET civilizations by seeing their sun's light degrade down to infrared heat radiation.

    54. Re:Optical SETI by pappin · · Score: 1
      According to my research (though not exhaustive) laser light has the same wavelength and phase.
      However I am no expert on this and you may be correct. Do you have some material or other source that I can take a look at?

      sorry for the childish page, but you get my drift.
      http://www.colorado.edu/physics/2000/lasers/
      http://repairfaq.cis.upenn.edu/sam/laserfaq.htm#fa qwil

    55. Re:Optical SETI by susano_otter · · Score: 1

      Which may go a long way towards explaining why we haven't heard back from anybody: we keep poking them in the eye with lasers.

      Reminds me of the old proverb: The reason we know there's intelligent life out there is the fact that none of it has tried to contact us.

      --

      Any sufficiently well-organized community is indistinguishable from Government.

    56. Re:Optical SETI by marcosdumay · · Score: 1

      Stimulated emission occurs when an atom absorbs a photon causing an electron to move to a "higher" state but in this case the electron can immediately jump back to it's lower state. This causes two photons to be emitted in exactly the same direction as the original photon was travelling.

      The reason that you get monochromatic light (normally) is that the wavelength of the photons produced is exactly related to the energy levels in the atom producing them. The reason you get coherent light is because the photons are travelling in the same direction.


      The fotons are emitted with the same phase, that is what causes stimulated emisssion to be coherent.

      The light generaly is highly monochomatic beause the stimulated states generaly have long life times, what is not true for gas lamps (while they often generate light from single excited states).

      Finally, lasers' fotons can travel preciselly on the same direction because they are coherent, and do it often because lasers are normaly obtained fron the mirror apparatus you described, that amplifyes light only on one direction.

    57. Re:Optical SETI by JRIsidore · · Score: 1

      I visited a few lectures about lasers and currently work on my diploma thesis which has to do with lasers. You can believe me, they generally do have more than one wavelength. :)
      I don't have good web references though (only old-fashioned books and such), but a quick googling brought up this site. It explains quite good how multi-mode operation of lasers can be understood (see the "Longitudinal Laser Modes" section). If you have any more questions feel free to ask.

      --
      :w!q
    58. Re:Optical SETI by schon · · Score: 1

      It's a reasonable argument, but it's far harder to set up optical "listening" posts than radio ones.

      Reminds me of the old joke about the guy looking for his keys in the grass by a lamp post. Someone comes over to help him, and they search for almost an hour, when the good samaritan asks - "are you sure you lost your keys around here?"

      "No," the guy replies, "I'm pretty sure I lost them in that field over there."

      "WHAT? Why are you looking here then?"

      "Because the light is over here."

    59. Re:Optical SETI by Rufus88 · · Score: 1

      A LASER doesn't produce light because of waves contructively interfering.

      I don't think he was suggesting that. He didn't say that constructively interefering waves is what causes light to be generated. I think he was merely pointing out that the "Stimulated Emission" process causes the resulting photons to be coherent.

    60. Re:Optical SETI by Rich0 · · Score: 1

      I think you're actually wrong about the ringworld. I believe that a ringworld is stable with respect to its plane containing the star, but neutral with respect to the position of the star within the plane (as long as the star is within the ring).

      Picture the star centered in the ring, but displaced from the plane of the ring. Clearly the ringworld feels mass in the direction of the star, and no mass in the opposite direction, so it is attracted to the star until it is centered in the plane.

      Now, picture the star off-center in the ring. On the one hand, the star is closer to the mass on the one side, but on the other hand there is more mass on the other side. If you work out the math the net force is always zero.

      A ringworld is actually more stable than a Dyson sphere in that sense, although both need correction systems, and as long as you're correcting in one direction you probably can correct in all three. It also probably wastes less mass on less useful space. You could have a combination - a ringworld combined with lots of solar-orbiting satellites which constitute a dyson sphere for purely energy-gathering purposes.

    61. Re:Optical SETI by TCQuad · · Score: 1

      If you allow for enough windows in the surface of the Dyson sphere and can control the degree/timing of their opening, you get a force that could be used to correct your distance or compensate for any other external force.

      One side moving too close? Simply open the other side. Solar winds push the closed area, moving it away.

    62. Re:Optical SETI by ByteSlicer · · Score: 1

      It just occurred to me that if alien civilizations actually manage to make Dyson spheres, then this could account for some of the dark matter in the universe (although the spheres will probably glow in infrared).

    63. Re:Optical SETI by Carnildo · · Score: 2, Insightful

      Yes, a ringworld is stable along the axis of rotation. However, I did the math for stability in the plane of rotation, and it is unstable.

      For a ringworld, mass per angular unit increases linearly with offcenter-ness, but gravity falls off as the inverse square, so the further off-center the star is, the more it pulls the ring offcenter.

      For a Dyson sphere, gravity falls off as the inverse square of distance, but mass per angular unit increases as the square of distance, so the net result is no change in gravitational attraction.

      --
      "They redundantly repeated themselves over and over again incessantly without end ad infinitum" -- ibid.
    64. Re:Optical SETI by inKubus · · Score: 1

      £

      42

      --
      Cool! Amazing Toys.
    65. Re:Optical SETI by inKubus · · Score: 1



      42

      --
      Cool! Amazing Toys.
    66. Re:Optical SETI by CaptainAvatar · · Score: 1

      Yo, people, just bear in mind that Dyson spheres don't have to be solid objects; in fact, Dyson's original concept was of a sufficient number of objects (ie a lot!) in orbit to completely absorb the star's light. A solid Dyson sphere is more of a sf fetish than a real-world possibility.

      --
      The real Captain Avatar is a fictional character, so I suppose he doesn't mind if I impersonate him.
    67. Re:Optical SETI by trewornan · · Score: 1

      When I'm travelling through countries which use different currencies I always use dollars. It's probably the only currency you can be sure will be accepted in nearly any situation. I've spent dollars as if they were local currency in most of the major european countries and several non-european ones. More than anything I think it's just the most recognisable currency internationally. The Euro doesn't even come close. (Incidentally - I'm not American, I'm from the UK so this isn't nationalistic bias)

    68. Re:Optical SETI by Anonymous Coward · · Score: 1, Insightful

      "Sure, radioactive sludge thrown in space is a sure sign of intelligence."

      Becouse we wouldn't want to put radioactive materials in space right?? Ha ha thats funny becouse putting stuff that is radiocative in space would be dumb becouse there isn't anything radioactive in space....its like pure and perfect and entierly free of evil radioactivity which is of course only produced by us evil dumb humans who shouldn't be producing such evil dumb things that are radioactive.

      stendec@gmail.com

  2. Message from aliens in our DNA finally found! by Anonymous Coward · · Score: 5, Funny

    The message only contained two words:

    FIRST POST!

    1. Re:Message from aliens in our DNA finally found! by zeptic · · Score: 4, Funny

      As long as it isn't "Hello World".....

    2. Re:Message from aliens in our DNA finally found! by CFBMoo1 · · Score: 3, Funny

      DECODING...

      1> Leave primordial goo on new planet.
      2> Let simmer for a couple of billion years.
      3> Harvest.
      4> Cook and add A1 Bleeagnarg Sauce and server.

      Health Note: Not all humans are guarenteed to be fat free. Pasty white ones should be tossed for lack of sun light unless your from Olga Snerga Prime, then prep with Oooogla Sauce instead.

      Manufacturers Note: Any resemblance between intelligent life is purely coincidental.

      They always did put the cooking directions on most foods.

      --
      ~~ Behold the flying cow with a rail gun! ~~
    3. Re:Message from aliens in our DNA finally found! by Hektor_Troy · · Score: 1
      4> Cook and add A1 Bleeagnarg Sauce and server.
      Okay, I have the Bleeagnarg Sauce, but what kind of server should I add? A quad Opteron? And should I just add the entire rackmount or should I prepare the server somehow? Grating it?
      --
      We do not live in the 21st century. We live in the 20 second century.
    4. Re:Message from aliens in our DNA finally found! by evocate · · Score: 1

      I'm glad it wasn't a link to goatse.cx!

    5. Re:Message from aliens in our DNA finally found! by Wyllie · · Score: 1

      Message in our DNA?? I bet the answer to the question would be 42.

  3. What a horrible message. by Anonymous Coward · · Score: 5, Insightful

    Are we the message?

    I guess that's akin to leaving a flaming bag of poo on the doorstep.

  4. My guess on the message... by miknight · · Score: 5, Funny

    "We apologise for the inconveniance."

    1. Re:My guess on the message... by R.Caley · · Score: 1, Funny

      "Will you guys shut the hell up!"

      --
      _O_
      .|<
      The named which can be named is not the true named
    2. Re:My guess on the message... by chegosaurus · · Score: 1, Funny

      Closely followed by some pedant pointing out the spelling mistake.

    3. Re:My guess on the message... by miknight · · Score: 1
      "Closely followed by some pedant pointing out the spelling mistake."
      Dang... I'll use aspell to check next time.
    4. Re:My guess on the message... by kalidasa · · Score: 1

      Yes, but be careful, as aspell probably would have wrongly told you that "apologise" is mis-spelled: but DNA was British.

    5. Re:My guess on the message... by mikael · · Score: 1

      "I'm sorry, nobody is available to take your message just now. If you'd would like one of our agents to call you back, please leave your name, address and personal details after the tone."

      --
      Vintage computer adverts: http://www.vintageadbrowser.com/computers-and-software-ads
    6. Re:My guess on the message... by RamboCalrissian · · Score: 1

      I'm pretty sure that the message would be something along the lines of "42" And it would just confuse us and piss us off.

    7. Re:My guess on the message... by miknight · · Score: 1

      Yeah! Although since I'm Australian I spell it that way normally (no excuses for "incoveniance" though :))

    8. Re:My guess on the message... by data64 · · Score: 1

      42 is the first thing I thought when I read "Are we the message?" piece in the post.

      Mods why is the parent at -1 ? This is an obligatory reference to "Hitchhikers Guide To Galaxy", where the earth was created to figure out the question to the answer 42.

    9. Re:My guess on the message... by sharkdba · · Score: 1

      I'm pretty sure that the message would be something along the lines of "42" And it would just confuse us and piss us off.

      Agreed, IF we assume ETs would use decimal system. Unless "42" (or something similar) is just using our characters , but is in fact totally different message in another alphabet/numerical system/symbol table.

      --
      The purpose of life is to find the purpose of life.
    10. Re:My guess on the message... by wkitchen · · Score: 1

      Or "MAKE MONEY FAST!!!!!"

    11. Re:My guess on the message... by bobbozzo · · Score: 1

      When I read it, I thought of:

      The medium is the message.

      --
      Nothing to see here; Move along.
  5. Are we the message? by EachLennyAPenny · · Score: 5, Interesting

    Is a message allowed to read itself?

    1. Re:Are we the message? by Anonymous Coward · · Score: 2, Funny

      no that violates the DMCA

    2. Re:Are we the message? by Anonymous Coward · · Score: 1, Interesting

      Well, winzip allows archive propagation as a self-extracting executable, so why not humzip?

    3. Re:Are we the message? by Young+Master+Ploppy · · Score: 3, Funny

      I guess in Soviet Betelgeuse, messages from advanced alien civilisations read YOU! (wince - sorry, first ever slashism - and hopefully the last)

      --
      http://instantbadger.blogspot.com
    4. Re:Are we the message? by slimyrubber · · Score: 1

      If we are the message... Who is this message directed to?!

      Certainly you dont write on a paper for the sake of the paper.

      --
      [ I can not bring myself to believe that if knowledge presents danger, the solution is ignorance ] -- Isaac Asimov
    5. Re:Are we the message? by 3dr · · Score: 3, Interesting

      Anthropomorphic messages want to read themselves.

      A comment on the intro bit... Searching for an easily controlled and powerful phenomenon, like electromagnetic radiation, is a smart tactic at least for starters. As the tech gets more sophisticated in terms of control and detectability (LASERs), the challenge is greater.

      But who is this Paul Davies guy, and whose ass did he pull the SETI-in-DNA idea from? SETI has always been on the edge of SciFi-fringedom, but the jump from that to finding encoded messages in DNA leaves no shred of credibility. Here's why:

      "The Bible Code". What the Bible Code showed us is that given a sufficiently large text, you can pretty much find anything you want. Your birthday, apocolyptic predictions, SETI-in-DNA ideas, etc. By changing the search algorithm (ignoring punctuation and vowels is the equivalent method used in the Bible Code for searching Hebrew IIRC) you artificially expand the chances of finding a self-confirming data sequence.

      This isn't science -- it's a parlor trick.

    6. Re:Are we the message? by SharkJumper · · Score: 1

      Is a message allowed to read itself?

      Yes. But unfortunately, it has to be fed through a punchcard reader to extract the information. You first.

      SharkJumper

    7. Re:Are we the message? by raygunz · · Score: 1

      "If we are the message, then who's it for?"

      The alien stranded on Titan, of course. The message is "Help is on the way." And if you happen to have a small metal good luck charm that looks like an spaceship spare part, you can look forward to a space voyage soon.

      With grateful acknowledgement to Kurt Vonnegut.

      --
      "Debugging" by Dave Agans - the perfect gift for your favorite imperfect engineer.
    8. Re:Are we the message? by Java+Ape · · Score: 1
      No, the real message is

      "You have been found to be operating your world in violations of intergalatic patents 234,564.1, 569,870.2 and 1,345,264.2. Please cease and desist all techological manufacturing and research until appropriate licenses can be negotiated and secured.

      Failure to comply will result in sterilization of your planet to prevent the theft of intellectual properties rightfully registered our clients.

      Sincerly
      Xanthpus and Ziphydol Licensed Intergalactic Legal Counsel."

    9. Re:Are we the message? by danila · · Score: 1

      Well, seriously speaking, there are ways to encode something in DNA and make the readers confident the message is genuine. You just make sure that a particular message is very stable - that's the only good indicator of specialness. So if anything contained the message, it would be the mitochondrial (sp?) DNA. But, of course, you are correct in saying it's bullshit. There are better ways to communicate - just leave a "monolith" (a powerful AI + nanotech) somewhere and have it activate itself when the humanity is ready.

      --
      Future Wiki -- If you don't think about the future, you cannot have one.
  6. message of means? by Tjebbe · · Score: 5, Funny

    Maybe we should consider the possibility that we are part of a device to perform some calculation to find the answer to a certain big question.

    1. Re:message of means? by The+Clockwork+Troll · · Score: 1, Funny
      Yes, and perhaps the question is,
      "Are we part of a device to perform some calculation to find the answer to a certain big question?"
      --

      There are no karma whores, only moderation johns
    2. Re:message of means? by denpo · · Score: 1

      And 42 is the answer

      --
      //TODO: put sig here
    3. Re:message of means? by goneutt · · Score: 1

      But what is the question. Are you willing to have your brain minced to find the question that the mice are looking for.

      --
      Bacardi + slashdot = negative karma.
    4. Re:message of means? by Psycizo · · Score: 1

      What do you get when you multiply six by nine?

    5. Re:message of means? by oever · · Score: 1

      We'll never find out, unless someone took out the message before they cremated Douglas N. Adams.
      If you'd like to inspect the ashes for hidden meaning, go here.

      --
      DNA is the ultimate spaghetti code.
    6. Re:message of means? by Scarblac · · Score: 5, Informative

      Maybe we should consider the possibility that we are part of a device to perform some calculation to find the answer to a certain big question.

      Actually, in my opinion, Kurt Vonnegut is the real master of "perhaps humanity only exists for a very stupid reason" stories.

      Especially the sub-stories of his sf author character Kilgore Trout often have that theme - humanity exists only to train the hardiest microbes in the universe, because hyperintelligent rays of light want to help organic life travel the universe and only microbes could do that, etc.

      In one of KV's books (spoilers for "Sirens of Titan"!), there is an intelligent alien who brings a message from his side of the universe to the only other intelligent species in the whole universe, millions of light years away. Half way, his ship breaks down, the alien manages to land on the moon we know as Titan. He needs a replacement part to fix his ship. His home planet sends the part, but this of course takes a long time; but the thing they can do faster than light is influence the thoughts of the monkeys that live on a planet nearby.

      As the millennia pass by, the monkeys evolve under the influence of the far-away aliens, eventually building huge pyramids and the like in patterns that meant "almost there now" to the alien who was watching from some moon, eventually producing an extremely complex story line, including many wars, the stock market, the development of space travel, and fashion, that ends in a human going to Titan with a weirdly shaped piece of metal adorning his neck.

      This is of course the replacement part for the alien, who can thus continue his travels. Humanity has served its purpose of producing the spare part, and is left to its own devices.

      Eventually the alien reaches the other side of the universe, to deliver the message to the only other intelligent species in the universe. It said "Hello there".

      I love Kurt Vonnegut. Adams must have read quite a few of his books.

      --
      I believe posters are recognized by their sig. So I made one.
    7. Re:message of means? by bhtooefr · · Score: 1

      Ahh, the data's all wonky. You're not a real native. All you know is that two million years before the destruction of Earth, the computer was on six times nine.

    8. Re:message of means? by mysticwhiskey · · Score: 1

      Agreed. Sirens of Titan was alternately weird, despairing, inspiring, then again weird, despairing and finally poignant. Damn, what a story.

      --

      Stuck down a hole! In the middle of the night! With an owl!

    9. Re:message of means? by ckaminski · · Score: 1

      Do they actually make a card capable of running doom3 in ultra graphics @ 1600x1200 @ 60hz?

      And did anyone else nearly wet their pants when the first hellspawn showed up?

      Oh...

    10. Re:message of means? by Walt+Dismal · · Score: 2

      I'm not playing with myself, I'm conducting research into my DNA to find out if I'm part of a device to perform some calculation. So far, I've calculated that Hustler magazine has 104 pages, plus or minus a 5% margin of error and a few staples.

    11. Re:message of means? by dasmegabyte · · Score: 1

      I'm not familiar with your units. What's that in split beavers per inch?

      --
      Hey freaks: now you're ju
    12. Re:message of means? by Sanga · · Score: 1

      Thanks for spoiling it for all that have not read it. And the message was "Greetings" BTW.

      I too was astounded by the similarity when I read SoT and realised that it was Mr. Vonnegut's earliest works!!!

  7. If they outshine Sol by 10,000x... by toomin · · Score: 3, Funny

    Then we hardly need a whole lot of computers to see them!

    1. Re:If they outshine Sol by 10,000x... by Anonymous Coward · · Score: 2, Informative

      Intensity drops by r^3. When you're talking about r in light years, cube root(1e4 x small) = 21 x cube root(small) = small. You need all the help you can get.

    2. Re:If they outshine Sol by 10,000x... by Anonymous Coward · · Score: 5, Funny

      "Do not look at the alien civilization with your remaining eye."

    3. Re:If they outshine Sol by 10,000x... by philbert26 · · Score: 1
      Intensity drops by r^3. When you're talking about r in light years, cube root(1e4 x small) = 21 x cube root(small) = small. You need all the help you can get.

      Forgive me if I am talking nonsense (I've had no coffee this morning) but doesn't it drop by r^2 (the surface of a sphere being proportional to r^2)?

      Either way, your point still stands, because r is very large.

    4. Re:If they outshine Sol by 10,000x... by fgb · · Score: 1

      No. He's right. The circumference of a circle is proportional to r^2. The surface of a sphere is proportional to r^3. Now, go get some coffee.

    5. Re:If they outshine Sol by 10,000x... by DAQ42 · · Score: 1

      The question is, what wavelength do we look for? Blue? Red? Violet? Ultra-violet? Maybe Infra-red? Or another sub-visual spectrum?

      --
      Don't Ask Questions. I don't know the answers and even if I did I wouldn't tell you.
  8. We should decode viruses too by Scorillo47 · · Score: 1, Interesting

    Somewhere I read that some flu viruses might be of alien form. Indeed, they seem to be the ideal organisms built for space travel. So why don't we search for alien messages in their DNA too?

    --
    Don't try to use the force. Do or do not, there is no try.
    1. Re:We should decode viruses too by PsiPsiStar · · Score: 2, Insightful

      viruses and non-eukaryotes have to be too efficient with their DNA. Anything not needed will get discarded

      --

      ___
      It's the end of my comment as I know it and I feel fine.
    2. Re:We should decode viruses too by Scorillo47 · · Score: 1

      Well, probably there is still some room for some message, like "Alien XXX please fix your software" or something like this :-)

      Some advanced viruses such as bacteriophages of the family Leviviridae, can reach almost 300 Kbp (kilobase pairs) which should be enough to store some additional data.

      --
      Don't try to use the force. Do or do not, there is no try.
    3. Re:We should decode viruses too by BarryNorton · · Score: 1

      I KNEW it! Maybe we should send them back a little virus of our own... b***ards!

    4. Re:We should decode viruses too by jayminer · · Score: 1

      Some viruses (retroviruses/retrovirii) even don't have DNAs, they have have single strand RNA (ssRNA). These viruses inject the enzyme reverse transcriptase along with the RNA.

      Virus DNA is transcribed and translated to make capsid proteins and reverse transcriptase later.

      Maybe this is the alien code we're looking for, just something different of a genetic code, emulating human DNA behavior, strange.

    5. Re:We should decode viruses too by zoefff · · Score: 2, Interesting
      Pay attention: irony ahead.


      We don't need to search there.

      Quoted from the article: The cargo would be designed to infect, without harm, any DNA-based life it encountered.


      There, they KNOW that we are a DNA-based life form, universally sprung from a watery solution, the salty sea. Like we all know, that harmless DNA can be engineered quite easily. That's why I don't understand that all the rocks from the moon (and mars) are in quarantine

    6. Re:We should decode viruses too by Lord+Kano · · Score: 2, Informative

      viruses and non-eukaryotes have to be too efficient with their DNA. Anything not needed will get discarded

      I disagree.

      To quote the above linked source

      "In reassortment, two separate viral strains, sometimes from different host species, infect the same cell and swap whole segments of one or two genes. This is how the 1957 and 1968 strains may have originated. The 1957 strain, which killed 70,000 in the United States, carries three gene segments from ducks and five from humans. The later version, which took a U.S. toll of 34,000, mixes two duck segments with six human ones."

      Human and Duck DNA in one strain of the Flu virus doesn't sound very efficient to me.

      LK

      --
      "Hi. This is my friend, Jack Shit, and you don't know him." - Lord Kano
    7. Re:We should decode viruses too by peculiarmethod · · Score: 1

      "Human and Duck DNA in one strain of the Flu virus doesn't sound very efficient to me."

      unless you want to figure out how to kill off all life evolving on earth.. then its a pretty good start, two different species on the same planet, one strike. how many weapons did we have until recently that could take out multiple coordinated targets?

      pm

      --
      ** "It's not my job to stand between the people talking to me, and the ones listening to me." -- Pego the Jerk
    8. Re:We should decode viruses too by Anonymous Coward · · Score: 1, Insightful

      Uh...the flu virus is one of the most successful life-forms on the planet. It works by switching back and forth from infecting humans and infecting poultry. I don't think you can criticise its efficiency.

    9. Re:We should decode viruses too by Lord+Kano · · Score: 1

      It's not very efficient, it's very effective.

      LK

      --
      "Hi. This is my friend, Jack Shit, and you don't know him." - Lord Kano
    10. Re:We should decode viruses too by PsiPsiStar · · Score: 1

      True, but how long will that data persist if the phage is replicating? You could fit a message inside a capsid but even if the thing is still fit for replication, the message will be lost.

      A viral particle is fit for transmitting a message, or replicating itself. I doubt it could be used for both.

      --

      ___
      It's the end of my comment as I know it and I feel fine.
    11. Re:We should decode viruses too by PsiPsiStar · · Score: 1

      1. These are genes that your article discusses are come from the flu virus in duck hosts and the flu virus in human hosts. The article is not talking about human and duck DNA.

      2. The original article was proposing sending a message via genetic code. Think of it this way. An organism, if it is still going to be capable of replication, will need to have two types of DNA. One type will allow it to replicate, make proteins, etc. We'll call this "Coding DNA". The other type of DNA is the 'message' that the aliens want to transmit and will get replicated along with the rest of the DNA, but will not make proteins. Degradations of the message DNA will not impact the vitality of the organism and the message will be easily changed. Coding DNA is preserved because it has a purpose. Non coding DNA (message DNA) is subject to random genetic drift, which will not be corrected by evolutionary processes. (note: message DNA is a term I made up here to describe the alien message. It has nothing to do with mRNA, etc. )

      Some viruses (like Lambda phage)do pick up bits of DNA from their hosts. But this DNA is not constant from generation to generation and could not transmit a message after thousands of generations, let alone ten.

      --

      ___
      It's the end of my comment as I know it and I feel fine.
    12. Re:We should decode viruses too by PsiPsiStar · · Score: 1

      But with a virus, you'd still have a strong push to make the gene more efficient and to edit out defects, because the gene is so small.

      --

      ___
      It's the end of my comment as I know it and I feel fine.
  9. are we the message ? by selderrr · · Score: 4, Funny

    yup. And the message is 41,99999999 (ad finitum)

    1. Re:are we the message ? by Seahawk · · Score: 1

      Does that mean Intel is an alien coorporation?

    2. Re:are we the message ? by Inzite · · Score: 1

      yup. And the message is 41,99999999 (ad finitum)

      Damn!!! FDIV Bug strikes again. I suppose Intel processors could explain a lot of Marvin though.

    3. Re:are we the message ? by irrelative83 · · Score: 1

      Hope you really mean ad infinitum

  10. Regarding RF Leakage to Space by Effugas · · Score: 5, Insightful

    We dump pretty enormous amounts of energy at RADAR wavelengths, 24/7, across the night sky. That'll stop approximately when we have no fear of hostile aircraft showing up at our borders.

    You know, never.

    --Dan

    1. Re:Regarding RF Leakage to Space by earthman · · Score: 1

      Even if there would be no fear of hostile aircraft, radar would be used to track civilian aircraft, birds, etc.

    2. Re:Regarding RF Leakage to Space by torpor · · Score: 1


      No, that'll stop when laser-based detection systems, capable of tracking gnats across your grandma's ass, are fielded, globally.

      In other words, around 2015.

      --
      ; -- the corruption of government starts with its secrets. a truly free people keep no secrets. --
    3. Re:Regarding RF Leakage to Space by Effugas · · Score: 2, Informative

      Then it's just a matter of frequency, not coverage. Remember, at the end of the day, light is just another wavelength of EMF, just like RADAR. And I doubt we'd go to a global laser system, if only because the higher the frequency, the worse the penetration -- the whole thing about seeing clouds is because they block and scatter optical frequencies. (They also scatter radar, but less, and in a correctable fashion -- see SAR, synthetic aperature radar).

      But if we did, we'd really have to pump the power up, and since we're illuminating the sky, we'd have to pump far more energy out into the wild blue yonder than for the equivalent space in low frequency RADAR bands.

      --Dan

    4. Re:Regarding RF Leakage to Space by Inexile2002 · · Score: 5, Insightful

      What a letdown to discover alien RF signals and find out their message was "ping". It would be undeniably cool to discover them, but if all we discovered was RADAR signals there would be no message to decypher.

    5. Re:Regarding RF Leakage to Space by JaredOfEuropa · · Score: 1
      We dump pretty enormous amounts of energy at RADAR wavelengths
      Would this energy still be detectable from far (lightyears) off? Conversely, would we ever be able to detect RF signals from alien planetside radar or satellite uplinks? I don't think so, and that's not what we're looking for. From the article blurb: "...intentional signals in the form of high-powered lasers" (Emphasis mine).

      If you're trying to say "hi" to beings on another planet, lasers are a much better option than radio... you'd need a pretty big transmitter to get through to the other side. Lasers are directional and thus more effient. (The downside is that you'll have to poke it at different stars in turn, if you don't know which star your pals' planet is orbiting). So it stands to reason that aliens would also use lasers rather than radio to try and contact us.
      --
      If construction was anything like programming, an incorrectly fitted lock would bring down the entire building...
    6. Re:Regarding RF Leakage to Space by Shanes · · Score: 1


      We dump pretty enormous amounts of energy at RADAR wavelengths, 24/7, across the night sky. That'll stop approximately when we have no fear of hostile aircraft showing up at our borders.


      And when it does, this tiny pre-programmed thingy left by ET far out in the solar system will register it, trigger, and start to transmit a message. And the message will read:

      "Good, you've finally learned to shut up! Your civilization is then ready. Here's what to do: ..."

    7. Re:Regarding RF Leakage to Space by Lumpy · · Score: 1

      Not only that but Gobs of radio transmissions are directed at sattelites and spill past them like MAD.

      More and more of Earth's communications use cable and satellites, with no radio-frequency leakage to space.

      This makes me realize that Mister, Drake knows absolutely nothing about RF and sattelite communications. there is a HUGE amount of spill past a bird when the uplink is used, plus uplink facilities for sattelites use insane-mad power to get a nice clear signal up there for the sattelite to relay.

      we spill an absolute crapload of RF out into space from almost every single communication system we have. and today's sattelite TV and Audio is at a much higher power than the first TV and radio transmissions because of simply that they are being broadcast UP with a massively high gain antenna.

      --
      Do not look at laser with remaining good eye.
    8. Re:Regarding RF Leakage to Space by CrazyGringo · · Score: 1

      You will not mock the Machine that goes PING!

    9. Re:Regarding RF Leakage to Space by Ancient_Hacker · · Score: 1

      Um, the uplink signal to satellites isnt a good candidate to get picked up by SETI'ing aliens. It's usually in the 10's to 100's of watts, and directed in a narrow angle to the geosynchronous orbit. And the signal is mighty spread-out over dozens to hundreds of MHz. Not exactly something easy to intercept, or pick out of the background noise. OTOH your basic radio and TV and radar transmitters are using omni-directional antennas, on much narrower bandwidths, at 100's of times more power, all helping in the reception issue.

    10. Re:Regarding RF Leakage to Space by nusuth · · Score: 1

      The original SETI never searched for accidental leakage from random wavelengths in the first place. The idea was once you were advanced enough, you would put a "We are here." bacon at a wavelength that makes cosmic sense. I don't see how Dyson could have misrepresented his (even if only partially his) brainchild.

      --

      Gentlemen, you can't fight in here, this is the War Room!

    11. Re:Regarding RF Leakage to Space by mdrn28 · · Score: 1
      discover alien RF signals and find out their message was "ping"


      I guess the best response would be "ack"?

    12. Re:Regarding RF Leakage to Space by JDevers · · Score: 1

      Well, the problem is that they aren't really "insane-mad power" so much as insane mad high gain antenna like you say later in your post. The problem is though that those antenna are highly directional and focused. They produce a very high gain at a given point in space and then get worse and worse as you travel away from that point. Since that focus point in only a few tens of thousand miles or so from the surface, at a few light minutes out they would be nearly indistiguishable from a NON-directional source such as a broadcast tower. The thing is though that broadcast towers use MUCH more power than uplink satellites so from a given far away distance, the broadcast tower would be much easier to "see".

      I agree with Mr Drake in the long run, it won't be too much longer before all of our comms are by laser light which is so much more directional and non-focused (read: coherent) that we will be spilling only small fractions of our broadcast spectrum out into space. Eventually it is probable that we won't use comm sats at all, if the world is completely linked by fiber. All RF will be extremely local transmission for mobile objects and we will be near undetectable from a few lightyears distant unless we WANT to be noticed.

      Basically, right now we are at the peak of transmission, but are rapidly approaching the downhill phase.

    13. Re:Regarding RF Leakage to Space by dasmegabyte · · Score: 1

      You're not excited by the prospect of decoding random alien broadcast?

      God, I am. Somehow, watching a 3d tank image of an alien reality series seems so much more voyeuristic and interesting than just watching a human one. Because even though the contestants will be just as vapid and vanilla culturally as our human contestants, they'll be vapid and vanilla about a completely different culture.

      Kinda like the first time you see Anime, before you realize it's all giant angular robots, blushing big eyed sailor girls and effeminate men with swords.

      --
      Hey freaks: now you're ju
    14. Re:Regarding RF Leakage to Space by Lumpy · · Score: 1

      The problem is though that those antenna are highly directional and focused.

      HUH? when did they get magical antennas??

      last I knew that parabolic dish antenna theory certianly did no focusing except pointed at the feedpoint. HBO's uplink facility is on the magnitude of over 1000 watts into the dish and they have at LEAST 68 DBi gain on their dish = well over 50Kw output in a directed transmission that still spreads out like physics told us. (Unless it's that new coherent, "laser" radio waves all the sci-fi books talk about.)

      everything you said goes way against Antenna and Electromagnetic Transmission theories.

      I suggest you go to ARRL.com and read up on how microwaves and parabolic gain dish antennas really work.

      I'm betting the "beam" from the uplink facility is almost 100 miles wide when it hit's the sattelite, probably more like 1000 miles wide. I'd calculate it, but it's late and I hate calculus.

      seriously, look it up, learn about RF transmissions and how they work and propagate, it will open your eyes.

      Hell when they talked to the men orbiting the moon, or to the mars rover, they aim at that planet/moon's center and the spill will easily get the target craft in range..

      --
      Do not look at laser with remaining good eye.
  11. Satellites? by earthman · · Score: 5, Insightful

    And exactly since when do satellite uplink transmissions stop at the satellite? The uplink is a radio wave, albeit a directed one. It might still be possible to pick up an alien uplink signal.

    1. Re:Satellites? by prockcore · · Score: 4, Funny

      And exactly since when do satellite uplink transmissions stop at the satellite? The uplink is a radio wave, albeit a directed one. It might still be possible to pick up an alien uplink signal.

      Fuck... if aliens are anything like us, the signal is going to have DRM all over it.. you know, to ward off space pirates.

    2. Re:Satellites? by BCW2 · · Score: 1

      And all radio signals have bleed off. I'm glad I'm not the only one to catch this discrepancy.

      --
      Professional Politicians are not the solution, they ARE the problem.
    3. Re:Satellites? by maxwell+demon · · Score: 1

      Then can the aliens sue SETI for violation of the DMCA?

      --
      The Tao of math: The numbers you can count are not the real numbers.
    4. Re:Satellites? by dasmegabyte · · Score: 1

      What's the jurisdiction of the Digital Alien Copyright Act -- should we worry about the Green Lanterns coming here to kick our ass if we decrypt episodes of "Upsilon Centauri Survivor?"

      --
      Hey freaks: now you're ju
  12. We are the message. by torpor · · Score: 2, Funny

    Oh sure, yeah, right. DNA is the frickin' solution to everything, isn't it?

    Next thing you know, all those conspiracy nutters who say we are "Children of the Gods" will be being appointed to national agencies ... sheesh.

    Look, if someone knows something about space aliens, then OUT WITH IT!! Why the American people have put up with Area 51 for so long without any sort of culpability being required of their government, I do not know. Of the people and for the people, my ass.

    Of the Grey Overlords, and For the Grey Overlords. Lets just call it a spade.

    --
    ; -- the corruption of government starts with its secrets. a truly free people keep no secrets. --
    1. Re:We are the message. by Lord+Kano · · Score: 2, Interesting

      Why the American people have put up with Area 51 for so long without any sort of culpability being required of their government, I do not know.

      Simple, regardless of whatever else has gone on there; they have developed some really cool technology that has kept our country safe and free.

      The U2, SR-71, F-117A and B2 were all flown at Area 51 during tests. Who knows what other cool shit is out there. Guess we'll find out in 40 years.

      LK

      --
      "Hi. This is my friend, Jack Shit, and you don't know him." - Lord Kano
    2. Re:We are the message. by Zocalo · · Score: 2, Insightful
      Is it just me, or does that "Aurora" on the web page at abovetopsecret you linked to look suspiciously like the Scramjet NASA has been very publically testing recently? The one they have a photo of a few planes down (Hyper-X)... I think they are probably one and the same somehow.

      That's not to say there isn't some other cool shit at A51 we won't be seeing at airshows for a few decades of course. :)

      --
      UNIX? They're not even circumcised! Savages!
    3. Re:We are the message. by torpor · · Score: 1

      Rubbish. Government Secrecy is the most unsafe form of governance of all...

      Its a fallacy that your country is safe because of its secrets. The fact is, cold and hard, your governments secrets are a liability to its populace ...

      --
      ; -- the corruption of government starts with its secrets. a truly free people keep no secrets. --
    4. Re:We are the message. by Lord+Kano · · Score: 1

      Rubbish. Government Secrecy is the most unsafe form of governance of all...

      Secrets are necessary. No goverment will ever be perfect, but for the good imperfect ones to survive they must keep secrets.

      I'm sure that most of us agree that the Axis vs Allies fight was a case of good versus evil. The secrets that the allies kept helped to win the day.

      Its a fallacy that your country is safe because of its secrets.

      Our greatest dangers come from secrets that were not properly kept.

      The fact is, cold and hard, your governments secrets are a liability to its populace ...

      My parents and grandparents lived long enough for me to be born because of the secrets my government kept. Neither German nor Japanese are the national languages of my country because of those secrets.

      LK

      --
      "Hi. This is my friend, Jack Shit, and you don't know him." - Lord Kano
    5. Re:We are the message. by torpor · · Score: 1

      My parents and grandparents lived long enough for me to be born because of the secrets my government kept. Neither German nor Japanese are the national languages of my country because of those secrets.


      Never mind language. To whom is the U.S. National Debt owed?

      --
      ; -- the corruption of government starts with its secrets. a truly free people keep no secrets. --
    6. Re:We are the message. by tmortn · · Score: 1

      The history of aviation design has seen a curious convergence where the function of the airplane tends to dictate its form the higher the expected speed is.

      If you look at prop planes you will notice through history more configurations than in even subsonic jets. However if you look at the pinnacle of Piston fighter designs which occured in WWII you will find that most look very similar. The only real unique designs in monoplanes where radial vrs inline/opposed engines and very subtle visual differences.

      That has carried over into supersonic jet designs to an ever greater degree. There were two supersonic jet transports created and they look very similar. While some contribute this to spy efforts ( Russia and the creators of the Concorde stealing from each other ) since the end of the cold war it has become fairly apparent that the designs were driven far more by their requirments than anything else.

      Hypersonic designs have few possible configurations. If the USAF has a black program that cracked the Ramjet problem then in all likely hood it looks a great deal like HyperX. If you go look the Australian project also looks very similar.

      The interesting thing to me would be to see if there was any quiet effort by the airforce in opposition to the hyperX program... IE possibly eliminating a wastefull research program covering ground that has already be covered while at the same time killing the advance of known engineering so they could maintain their edge/secrecy longer. In otherwords once everyone gets this technology the advantage of it is reduced. Also the possibility of creating deffense missles capable of intercepting such a plane hit the table... IE a ramjet missle.

      There was a similar life cycle to the use of the SR-71. Early in its life it flew over borders with impunity becasue it couldn't be shot down and its existence was not commonly known. Once its existence was well established then the technology to defend against its incursions came into existence or once technology to defend it became a reality its existence became known. Take your pick. In otherwords it was not publicly known until its advantage had ceased benifiting from its secrecy.

      --
      I don't ask you to be me. I only ask you not expect me to be you.
  13. DNA, no way! by WhatsAProGingrass · · Score: 1

    That would be kind of dumb to put a message in living cells. We've been around not nearly as long as other things like "Rocks". Life as we know it is very fragile and in my opinion not a good message carrier.

    Nuclear Powered lasers sounds pretty cool. To send out beacons my ass, they want a better missle defense system.

    --
    Mark
    1. Re:DNA, no way! by Errtu76 · · Score: 1

      That would be kind of dumb to put a message in living cells. We've been around not nearly as long as other things like "Rocks". Life as we know it is very fragile and in my opinion not a good message carrier

      Oh, but it is! Because if the message was simply to have different kinds of races, then nothing we have done so far has changed that.

      I'm no DNA specialist, but i imagine there are certain dna strings in a human body that is equal for all humans (like all humans have 2 arms, 2 legs and a head). That string never changed, so the 'message' stays intact over the centuries. Very good carrier if you ask me.

    2. Re:DNA, no way! by 12x12 · · Score: 1

      There are "strings" of DNA which are considered to be "junk" by geneticists. These strings may represent "old code" not used by modern organisms because conditions since the appearance of the first primitive single-celled organisms has changed so radically.
      This DNA would be an excellent place to store files, messages or even your favourite pr0n stash as the data capacity represented is fairly large [1].

      BTW you have about 70% of your DNA in common with a cucumber.


      Ian

      [1] For relative and various values of large.

  14. Duh? by ikewillis · · Score: 1

    Is EM not the most likely medium for wide-beam transmission? Lasers are completely ridiculous... it's a tight beam transmission taken to an extreme. We have no idea how other civilizations could be reaching out... perhaps they're using gravity waves, or perhaps they've discovered some sort of faster-than-light system of communications which they have been signaling other races with but we are too ignorant to perceive. In all likelyhood EM is the best way of reaching out to other civilizations, and while we may not be talking yet to any siginicant degree I can't argue with listening...

    1. Re:Duh? by kalidasa · · Score: 1

      Last time I checked, light (as in lasers) is a form of electromagnetic radiation (or EM); it is not, however, a form of RF (radio frequency) transmision. So perhaps you should s/em/rf/ .

      It is precisely because lasers are tight beams that they would be more likely to be used for interstellar communications; however, I do not think it likely that a laser would be used as a "hailing beacon," an attention-getting signal to attract new nodes (like Earth) to the network - because, of course, they are too tight. RF Seti (like Seti@Home) assumes that there are transmission stations which are broadcasting just such an attention-getting signal in an effort to contact new species; it is assumed that signals intended for other stations more local to the broadcasters would be too weak to be intercepted, and that nobody out there knows about us yet.

  15. user reg bypass by Krafty+Koder · · Score: 4, Informative

    seti in dna article : bugmetnot is your friend

    1. Re:user reg bypass by sploo22 · · Score: 1

      Did you read the page? There's a link that says "Register later", no need to go through all that.

      --
      Karma: Segmentation fault (tried to dereference a null post)
  16. An experiment by PsiPsiStar · · Score: 1

    Albeit, there's a lot of non-coding DNA in Eukaryotic cells, but I wonder how many generations a random mutation would endure in that region unchanged. Those regions probably have a purpose re: the conformation of the DNA, among other things.

    While using SETI on our genetic code might be helpful in identifying patterns and so forth, the notion that another creature would talk to us that way seems a little far fetched.

    --

    ___
    It's the end of my comment as I know it and I feel fine.
  17. I for one... by MisterLawyer · · Score: 5, Funny

    I for one welcome our DNA-speaking, laser-shooting overlords. :-D

  18. Re:Light takes 25 years from nearest star.. by zoefff · · Score: 1

    purely philofosically: We are not ALONE.
    I mean the diversion from the earth being the centre of the universe had some impact. People got killed for the idea alone.
    Better to have a good neighbour than a friend that's far away. ;)

  19. This reminds me of a saying... by JoeShmoe · · Score: 4, Insightful

    "When all you have is a hammer, everything starts to look like a nail"

    Next thing you know, we will look for SETI in the burn pattern of a tortilla...or maybe in the reflection from a store window...

    Is anyone getting my point here?

    "For centuries, mankind has searched for evidence of God, in the skies, in the stars, in animals and in himself." Now do a search and replace s/God/aliens/ and ask if this is really any more a sensible statement. Not to mention, if we do find aliens, are we their peers, or are they our gods?

    Final thought of the day...from what I can understand, our solar system is rather young compared to other galaxies out there. And apparently there are hundreds of planets capable of supporting life (our life, that's not even counting life that forms in some environment we consider hostile). Well if that's the case, and life/evolution is as easy as the theories make it sound (all it takes is heat and time)...then why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth? Think about it.

    - JoeShmoe
    .

    --
    -- I wonder which will go down in history as the bigger failure: the War on Drugs or the War on Filesharing
    1. Re:This reminds me of a saying... by BarryNorton · · Score: 1
      Next thing you know, we will look for SETI in the burn pattern of a tortilla...or maybe in the reflection from a store window...
      The Roman Catholic Church is waaaaay ahead of you there...
    2. Re:This reminds me of a saying... by Slinky+Saves+the+Wor · · Score: 1

      Well if that's the case, and life/evolution is as easy as the theories make it sound (all it takes is heat and time)...then why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth? Think about it.

      There's only one logical conclusion: we are the first ones, the first race to appear.

      Do we live up to that idea?

      --
      I do not moderate.
    3. Re:This reminds me of a saying... by JaredOfEuropa · · Score: 1
      why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth?
      Perhaps because faster-than-light travel (for the nitpickers: by that I also mean things like hyperspace, wormholes and teleportation) is impossible or not practical, and that most sentient races prefer to stay in their own solar system for that reason.
      --
      If construction was anything like programming, an incorrectly fitted lock would bring down the entire building...
    4. Re:This reminds me of a saying... by Anonymous Coward · · Score: 5, Informative

      Regarding your final question: this question has been asked and pondered before by Enrico Fermi in 1950. See this Nature article for an extensive discussion on the subject: www.nidsci.org/pdf/nature_v409.pdf. I particularly like the list of canonical answers:

      There are no aliens, and there never have been. Humanity is unique in the Universe.

      There have been plenty of aliens, but civilizations only moderately more advanced than ours always blow themselves up in nuclear wars.

      The lifespan of an alien civilization is only a few million years. They visited us ten million years ago, and will turn up again in ten million years time, but there is nobody around at the moment.

      Aliens exist, but interstellar travel is impossible because of relativistic limits on the speed of light, or because living creatures cannot survive it.

      Aliens exist, but are not interested in interstellar travel.

      Aliens exist and have interstellar travel, but they are not interested in contacting us.

      Aliens exist, but galactic law forbids any contact with us because we are too primitive, or violent.

      Some aliens see it as their duty to eliminate all other forms of life that come to their attention.
      Any technological civilization will develop radio and TV, attract their attention, and be eliminated11. They are on their way now.

      They are here already (the preferred answer on the Internet s UFO pages).

    5. Re:This reminds me of a saying... by daveinthesky · · Score: 1, Interesting

      Final thought of the day...from what I can understand, our solar system is rather young compared to other galaxies out there. And apparently there are hundreds of planets capable of supporting life (our life, that's not even counting life that forms in some environment we consider hostile)....Think about it.

      Perhaps.. but I think the point you were trying to get at is that there most probably is e.t. life out there..

      If you take the size of the universe into consideration, then the probability of life outside earth becomes much higher. It's the religious types that believe that we are some sort of special-case that only happened because of god. A more scientific treatment would lead one to realize that there's nothing particularly special about our existence or our home planet.

      Just another ordinary planet in the middle of an ordinary galaxy. Since we can only measure time as a function of light-space since the last big-boom, then we can't really know if there's been several or an infinite number of big booms/implosions before us. We just don't have the capacity. Yes, the thought of aliens is pretty silly if you think of little green men. But if you think of it as the probability of life existing, then it should not be surprising to find that it is so.

      Mod me -1 nutcase, but I have a photo of a UFO that was taken @ machu picchu, peru, a location which is known for its UFO sightings. Thing is, I would have been a total skeptic if this photo was never taken. The photo was actually supposed to be just a normal run-of-the-mill portrait of my uncle and his wife (this was back in the 70s). Once they developed the photo, though, low and behold there was a UFO hanging out between the mountains.

      Since you might want to see this picture, here it is. I'll take the link offline if it gets tremendously slashdotted, but here it goes: ufo picture

    6. Re:This reminds me of a saying... by boicy · · Score: 4, Informative
      "then why isn't the universe like something out of Star TRek"(sic)

      The author Iain M. Banks has discussed this issue throughout his "Culture" series of books. He suggests that perhaps there are galazy spanning civilisations out there, but that they are evolved enough to leave us alone until we reach a level as a species where we can be considered for inclusion in the galactic community.

      Why would they need to do anything as unsubtle as establishing moonbases when they could have invisible ships 30 kms long able to control every single tv screen on this planet from outside the orbit of Jupitor? :)

      In fact, one of his short stories from the collection The State of the Art is about what happens when the Culture use Earth as part of a control group. An excellent read.

      Of course this is sci-fi but you get the drift. If anyone is interested I would go as far as saying that for thought provoking Sci-Fi, Iain M. Banks is the man to beat at the moment.

      Here he is in an interview at scifi.com talking about his writing. And here is the man with a few introductory notes on the Culture for the unitiated - I just picked this site from the top of google so I hope they don't mind me posting here :P

    7. Re:This reminds me of a saying... by brett42 · · Score: 1

      The culture series, plus a bunch of Kim Stanley Robinson's books, have some pretty interesting ideas about what a somewhat believable utopia might look like.

      I would like to add though, that Star Trek's prime directive explicitly requires noninterference with primitive civilizations, and I believe it was mentioned in the parent post.

      I do like the idea of the agency, I think it was called Special Circumstances, that is designed to handle the exceptions to the rule. It makes more sense than all the whining about the Prime Directive that happened every couple of episodes in Trek.

    8. Re:This reminds me of a saying... by The+Cornishman · · Score: 1

      > s/God/aliens/ Why is it that this confusion exists in so many minds? I happen to have watched Contact again last night, and I'm with Jodie Foster: I don't understand the relevance of the question. Aliens are not gods. Period. Aliens will not substitute for Gods. Meeting aliens will not settle the question of whether God exists. It will be interesting to see if they have Gods of their own, of course, but we already coexist with cultures who have different Gods.

    9. Re:This reminds me of a saying... by Minna+Kirai · · Score: 1

      There's only one logical conclusion: we are the first ones, the first race to appear.

      Haha! Hubris.

      More logically, radio transmitters and atomic bombs are invented within 50 years of each other, leaving only a short timeframe wherein a species is capable of being heard before it self-eradicates.

    10. Re:This reminds me of a saying... by Whispers_in_the_dark · · Score: 1
      There's only one logical conclusion: we are the first ones, the first race to appear.

      Do we live up to that idea?

      Where's my immortality then? I don't know about you, but I'm not going to be stuck at the bottom of the pit of Z'ha'dum for a couple million years waiting for some dude, being possessed into thinking he is the "One" by an enigmatic energy-based, jukebox-wearing alien, to come dropping in.

      In short, nope.
    11. Re:This reminds me of a saying... by nine-times · · Score: 1

      You forgot one: The universe is really big. I mean really big. However big you think it is, it's bigger than that. Even if we assume there are aliens who go travelling around the universe at faster-than-light speeds all the time, on a whim- maybe asking "why haven't they come to our planet?" is like me asking you "Why haven't you been to my house?"

    12. Re:This reminds me of a saying... by xRelisH · · Score: 1

      Well, just because we currently no direct evidence of something doesn't mean it doesn't exist.

      And really, who knows, if there are so many hospitable planets out there, maybe there are more "interesting" life forms out there. And on top of that, I'd expect that if these Aliens were advanced enough to develop space travel, they would probably have means of monitoring us without us knowing.

      Like you said, how would we view them if we did make contact? They probably know better than to enter our lives until our society is "ready" for them. Assuming we've been visited before already, I'm sure they may reveal themselves to us once our society is ready to accept the presence of aliens.

    13. Re:This reminds me of a saying... by jc42 · · Score: 2, Interesting

      Star Trek and a lot of SF is based on faster-than-light travel. One of the real possibilities is that the universe just doesn't permit this, and travel to the stars will always be prohibitively slow.

      From an SF writer's viewpoint, this doesn't led to very interesting stories, so most of them have assumed some solution to the FTL problem. A few, such as Ursula LeGuin, have written stories in an "Einsteinian" universe, but have added the gimmick that FLT communication turns out to be possible. This does lead to more interesting universes than the one that we appear to live in, but even she does eventually give in and have someone discover FTL travel.

      But it's quite likely that FTL travel or communication will never be possible in our universe. This does rather limit the possible contacts that we will have with any aliens. Some of the closest stars might just be possible, but with ping times measured in decades, travel isn't really practical, unless you accept the idea that when you get back home, everyone you ever knew will be long dead.

      It would be interesting if we found that FTL communication but not travel is possible. Then we could have a galactic "network" and share ideas, but we couldn't go out conquering (and they couldn't conquer us). I think that if I were a cosmic engineer, that's the sort of universe that I'd build. Then a marginally intelligent but aggressive species couldn't wipe out all the other promising species in their neighborhood. How would you behave toward someone if you could exchange messages with them, but neither could ever reach the other physically?

      --
      Those who do study history are doomed to stand helplessly by while everyone else repeats it.
    14. Re:This reminds me of a saying... by Al+Al+Cool+J · · Score: 1
      why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth?

      Because violating the prime directive may make for good TV, but any real galactic civilisation that's been around for hundreds of millions of years is going to have its act together sufficiently that they would not let a screwball like Captain Kirk boldy go anywhere near an underdeveloped planet.

    15. Re:This reminds me of a saying... by Al+Al+Cool+J · · Score: 1
      For cavemen, struggling every day for survival, travelling by foot from Africa to South America would have been prohibitively slow. Yet mankind did make that journey. It wasn't made by one person in one go, but by countless generations, a little bit at a time.

      Once a civilisation abandons its dependence on planets and stars through improved technoloy (just as we abandoned our dependence on caves and open flame), and becomes a spacefaring civilisation, then exploring the entire galaxy is simply a matter of time. At 0.1c it could be done in 30 million years. And given the age of the galaxy, intelligent civilisations could have arisen up to a billion years ago.

      Time and replication are the most powerful forces in the universe. With time, the action of wind and rain can level a mountain. Through replication, a single microscopic virus can infect and kill a blue whale. Put them together and you can go from a single cell billions of years ago, to the astonishing range of life that now spans the entire planet.

      Spanning the galaxy is just another step in the process. Unless somebody else beats you to it :-)

    16. Re:This reminds me of a saying... by juhaz · · Score: 1

      Universe being big might make life more likely, but it also makes it much LESS likely that any possibly intelligent life happens to be poking around in these parts of this ordinary galaxy.

      And making assumption that Earth is "an ordinary planet" is probably quite wrong, if you stop to think about it. Take a look at http://en.wikipedia.org/wiki/Rare_Earth_hypothesis . Even if you think Earth is ordinary, there ought to be no need to remind you about the timescales, it took a billion years for life to start, and three more to get us. That's long time for something to go seriously wrong, or just differently enough that intelligent life does not arise.

      Maybe not a total nutcase, but perhaps we should say "easily influenced" or something...

      You wouldn't have made much of a skeptic anyway if pic that blurry makes you into a believer, it looks same as all the other UFO shots do, and shares a common feature too: it's so fuzzy that the grainy blotch that's supposed to be a flying saucer might be anything at all. Unfortunately, when you've got whole spectrum of "anything" at your disposal, alien spacecraft tend to be in the part with lowest probability. Occam's Razor, and all that.

      Why doesn't anyone have a crystal clear picture showing a craft that's at least identifiable as artificial, if not extraterrestrial? If _they_ would be here, and don't want to be seen, why would they be buzzing around in immediately alien looking vessels instead of constructing plane or helicopter look-a-likes?

    17. Re:This reminds me of a saying... by Jahf · · Score: 1

      Or we're playing a cosmic game of catch-up.

      Posit that in a few years/decades we may have discovered yet another communication method that is better than radio/laser/etc. And another few decades or centuries later something else comes along.

      If other technological cultures (note: we're assuming alot in assuming that another culture would embrace tech in the same manner as we have) follow a similar pattern, we have a very very tiny window to catch the signal. Compound that with need to have the signal's origination coincide perfectly with the time it needs to travel to us during a time when we have the right technology level to understand that it is a signal.

      I love the idea of SETI, but overall I find it extremely unlikely it will be successful while we are so relatively primitive. I believe that technological evolution will progress to the point where there is a "best" method of communication and if other cultures progress technologically that we will all end up at the same point and possibly be able to discover each other, but I doubt we are anywhere near that level and perhaps no one else is either.

      --
      It is more productive to voice thoughtful opinions (reply) than to judge (moderate) others.
    18. Re:This reminds me of a saying... by JoeShmoe · · Score: 1

      To us, maybe. But given the accelerating rate of discovery (it's exponential) in 100 years or so we might consider faster-than-light travel as trivial as heavier-than-air travel (planes) today.

      Not to mention, light's pretty fast and so the scientist raises a good point that if aliens wanted to contact another world and faster-than-light travel wasn't possible, fast-as-light communication is possible.

      -JoeShmoe
      .

      --
      -- I wonder which will go down in history as the bigger failure: the War on Drugs or the War on Filesharing
    19. Re:This reminds me of a saying... by JoeShmoe · · Score: 1

      None of those cover the case that the scientist from the article is mentioning, aliens exist and even though travel is impossible, shining lasers around the galaxy and seeing who lasers back seems like a pretty reasonable possibility.

      The first answer would not fit with current scientific models of the universe. To science, Earth/Sol is not unique in any way, it's average at best. So for Earth to be the only place where life could exist must meant there is something specifically unique about Earth that we haven't discovered yet.

      If we assume aliens of sufficient intelligence to create weapons of mass destruction (doesn't have to be nuclear, plague and influenza took at serious hit on the population) then we must also assume aliens of suggicient intelligence to want to avoid destruction and work to curtail/eliminate them or their use. Not to mention, there would always be survivors, and so restoring the planet to its previous considition would be relatively quick (compared to it evolving from scratch again).

      There is only one alien civilization? Even if it is true that the timespan is millions of years, surely there is at least one alien civilization whose timespan overlaps our own? If we assume aliens can visit us, then we asumme distance isn't an issue so any alien culture in existence right now should be able to visit us.

      Even if travel isn't possible, commuication is. We are already sending out probes and beacons...give it another 100 years and I bet we are lighting up this section of the universe like it's Las Vegas.

      Given that it does not take a concentrated world-wide effort to have space travel or space communication, it seems impossible that a planet would exist where every member had absolutely no desire to explore beyond their world. In fact, I would say that it's inevitable. As soon as the people on a planet run out of land to claim as their own, they would start looking for more land. That looking is going to have to be up.

      This seems reasonable, since Earth is not unique, what reason would aliens have to visit? It would be like us going out of our way to visit a particular anthill in Kenya. But at the same time, if the ants in Kenya had our level of intelligence, they would no doubt notice some signs of intellegence life other than their own. The first ant to hit a road or railway or see a plane fly overhead would have to wonder about it unless they deliberately hide it from us.

      Hiding such things from us assume a unity of purpose and organization that seems impossible. Earth/Sol has resources. Someone would probably be looking for them. We are reasonably remote, but if we assume that there is an "intergalatic federation" passing laws, we must assume that distance isn't an issue.

      The last two are pretty much just movie plotlines, and well explored.

      This isn't to say that none of these are possible, but I think they reflect a definite ignorance of the exponential rate of discovery/technology and the reality of statistics/odds.

      -JoeShmoe
      .

      --
      -- I wonder which will go down in history as the bigger failure: the War on Drugs or the War on Filesharing
    20. Re:This reminds me of a saying... by Firethorn · · Score: 1

      However, there are a number of religions that will have to re-examine some their base premises, as their specific beliefs are that earth is the only planet with life, humans are the only intelligent life, etc etc etc. I have actually talked to some of these people, so I know they exist. I asked one what they'd do if probes found prevailing evidence of life on mars. He was fairly reasonable about it, saying that he'd have to pray, think and read more. But there are some who refuse to acknowledge anything that contradicts their beliefs, until they're basicly hit across the face with it.

      Kinda like how people were killed over the idea that the earth might be round!

      --
      I don't read AC A human right
    21. Re:This reminds me of a saying... by multisync · · Score: 1
      "why haven't they come to our planet?" is like me asking you "Why haven't you been to my house?"


      I'm reading this on your computer right now. By the way, you're out of scotch.


      --
      I don't care why you're posting AC
    22. Re:This reminds me of a saying... by jafuser · · Score: 1

      One possibility not mentioned is that we do live in a universe capable of evolving multiple instances of intelligent beings, but we are the first to survive to the technological level capable of transcieving signals.

      It's kind of an egocentric view, but *someone* has to be first, and whoever they are must have wondered where the hell everyone else is, given that all indications are there should be others out there somewhere =)

      --
      Please consider making an automatic monthly recurring donation to the EFF
    23. Re:This reminds me of a saying... by nine-times · · Score: 1
      I'm reading this on your computer right now. By the way, you're out of scotch.

      you're obviously not at my house

    24. Re:This reminds me of a saying... by schon · · Score: 1

      asking "why haven't they come to our planet?" is like me asking you "Why haven't you been to my house?"

      Well, you've never invited me before. :o)

    25. Re:This reminds me of a saying... by nine-times · · Score: 1
      Well, you've never invited me before. :o)

      eh? must have gotten lost in the mail. I'll keep sending it to random addresses- you keep looking.

    26. Re:This reminds me of a saying... by ltbarcly · · Score: 1

      The first answer would not fit with current scientific models of the...

      Your right! Of course, this discounts the possibility that our model of the universe isn't exactly right. Also, the situation where life is plentiful is considered further along on the list.

      If we assume aliens of sufficient intelligence to create weapons of mass destruction

      Maybe we can assume that, but it only considers a very narrow view of the universe. It may well be possible that some scientific discovery which is universally found in itself destroys, say, the entire solar system in which it is found instantly. For example, some heavy subatomic particle that degrades all matter within 1 zillion miles. Let your imagination run wild. But this sort of thing would 1. destroy the civilization which created it. 2. Leave no trace nor chance that a warning could be sent.

      There is only one alien civilization? Even if it is true that the timespan is millions

      Maybe there are millions of alien civilizations, and some's lifespan overlaps ours. However, who is to say that they would be near us at all? Or that although their lifespan overlaps ours, it doesn't overlap ours so that signals are recieved now? (maybe the signals were coming in like mad until 40,000 BC, and they won't start up again with the next nearby intelligent civilization which overlaps ours until 20000 AD? That gap is only a blip in time)

      Given that it does not take a concentrated world-wide effort

      This comment is entirely earth-centric and anthropomorphic. Perhaps it is a planet of super intelligent prey-animals. Prey animals don't go adventuring, they prefer well worn paths and cosistancy. These super-guinea pigs might also have functional population control, so that they always have plenty of land and resources. However, they have no wish to draw attention to themselves, due to millions of years of prey-animal evolution effecting their cognition. Of course these animals would think of space exploration as totally insane and rediculous and wouldn't even have to discuss it. ...

      What if every anthill in Africa had intelligent life? Then how likely would it be for any given one to be visited? What if Africa had 100 Trillion anthills, how likely then?

      Earth has what resources? Metal? Solar Power? Heavy elements? Everything the earth has is everywhere else, in this case even intelligent life is everywhere. This turns into the 100 trillion anthills example.

      So, FACT: We haven't made contact with aliens despite trying with a reasonable amount of effort for a somewhat decent amount of time.

      Where are they? There may be more reasons than are given on the list, but all the reasons given are decent.

  20. So now we are looking for... by hool5400 · · Score: 4, Funny

    Aliens with frickin' laser beams on their heads?

    Because that would rock.

    --

    Remember, it takes 42 muscles to frown and only 4 to pull the trigger of a sniper rifle.
  21. Are We the Message ... by foobsr · · Score: 1

    In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?"

    Nice idea. But, IMHO, it is not the 'Magic Encrypted Formula' hardcoded into whatever finally rendering the even more magical 42. What about the hypotheses that the system that the instances based on that DNA create is covering (for sure alternative, because supposedly on the level targeted there is no single 'true' one) messages?

    CC.

    --
    TaijiQuan (Huang, 5 loosenings)
  22. Question by chadpnet · · Score: 1

    How is SETI science?

    1. Re:Question by BarryNorton · · Score: 1
      How is SETI science?

      Actually, it has a stronger component of empiricism than most 'scientific' research!

    2. Re:Question by Anonymous Coward · · Score: 3, Insightful

      The question "Are we alone?" is one of the most important philosophical questions; keep in mind that what we call "science" today was once called "pysical science". Philosophy was the profession of scientists centuries ago, and should be part of the toolkit of scientists today.

      From a observational standpoint, you have the (yet unproven) theory: There is life outside Earth. In order to try to prove this theory (disproving it is much harder =), you gather data and analyze it. That's generally considered part of science. If for example, Mars missions finds self-replicating life, that can provide an answer to the simpler proposition. The harder one -- intelligent life -- would still need to be shown in some other manner. (Unless we found self-replicating intelligent life on Mars, of course.)

      As for the "who cares, I'll be dead by then!" narrow-focused people, keep in mind that the tools and networks being developed for SETI -- massively parallel data set computations -- have usages for other areas of "science" that you would probably consider to be science -- protein folding, for example.

  23. The real alien DNA by mikeophile · · Score: 4, Interesting

    is in our mitochondria.

    1. Re:The real alien DNA by drmike0099 · · Score: 2, Interesting

      This may actually be more logical than that article. How would aliens know that we even had DNA, as opposed to what might be a variety of other possible arrangements? How did they know that we primarily use ATGC instead of the other, much less common, nucleotides, so that it would have gone unnoticed? Did they just get really really lucky?

      Or, could it be that they thought some sort of DNA-based lifeform was out there somewhere, whatever nucleotides it was using. They could then send out their own self-replicating, very friendly, single-cell organism, which happens to have the incredible ability to create its own energy (given certain chemicals) all across the galaxy, knowing that a very simple DNA-based organism, if placed next to their designer bug, would eventually wind up incorporating it into its lifecycle such that it's permanent. We call them mitochondria. They made us a deal we couldn't refuse.

      It kind of all fits (in a very sci-fi way) because mitochondria are not DNA-based, and their genome is incredibly well-preserved from generation to generation, with a very very slow mutation rate (we use it to date the spread of mankind from various ancestors). Perhaps their message isn't really a message like "Hi, we are your alien neighbors, look us up when you can read this" but is instead simply that they wanted to assist the development of life in the universe. Knowing that random nucleotides bumping into each other could eventually form life, but knowing that if they had a little mitochondria there it increased the chances and rate by 1000%, they seeded the galaxy with it as some way to put money in the bank. Maybe they eat brains of sentient beings, so they're "gardening". Maybe they just want some friends, or are very scientific and this is a grand experiment.

    2. Re:The real alien DNA by SmlFreshwaterBuffalo · · Score: 1

      I remember my 7th grade biology teacher mentioned this as a theory that some people had. I was hoping someone would bring it up in regards to this article.

    3. Re:The real alien DNA by praedor · · Score: 1

      What are you talking about? Mitochondria ARE DNA-based. They have their own DNA (just like chloroplasts in plants have their own DNA) that is replicated by its very own DNA polymerase (DNA Pol gamma). Some of its genes, over millenia, have been lost to the host cell nucleus, incorporated into host cell chromosomes where they are more stable but still...mitochondria are very much DNA-based, once-autonomous organisms (just like choloroplasts).

      --
      In Bushworld, they struggle to keep church and state separate in Iraq as they increasingly merge the two in America.
    4. Re:The real alien DNA by Leperflesh · · Score: 1

      > ... mitochondria are not DNA-based

      Your analysis is quite interesting and generally I'd support it, but it should be noted that mitochondria do indeed have DNA. Mitochondrial DNA drift is the 'mutation rate' to which you referred.

      So it is still required that the aliens create mitochondrial organisms that 'just happen' to use the terran model of DNA helix molecules.

      -Lep

      --
      I am allowed to criticize you: you are not allowed to criticize me. Sorry, that's just how things are.
    5. Re:The real alien DNA by rmayes100 · · Score: 1

      Actually Mitochondria have DNA, it's right there in your parent poster's link. Otherwise an interesting thought...

    6. Re:The real alien DNA by drmike0099 · · Score: 1
      Oops, my bad. For some reason I was thinking it was all RNA, which (a few hours later) doesn't make any sense to me.

      I did find a cool article on it, though, which discusses mitochondria, chloroplasts, and the theory of engulfment...

  24. SETI on DNA by trifakir · · Score: 2, Funny
    CCAA MADE INCH INAA AAGT CAGT TCCT CGCT

    That is to fool the lameness filter. It counts the capitals or something like this.

  25. A different mode of life. by bogaboga · · Score: 1

    I have always thought that there could be a different mode of life out there. That is, one that flourishes on a different kind of gas other than oxygen or any other gases we know here. It could even be the environment that is different. Yet I see NASA and the SETI people looking for a life similar to ours. This is obviously waste! Remember that according to Godly people, nothing is impossible by him. So this kind of life could be possible too. How can a [small] man like me suggest new strategies to these NASA/SETI guys?

    1. Re:A different mode of life. by doshell · · Score: 1

      In order to look for an "alternative" form of life, you must first define it. Is it based on sylicium instead of carbon? Does it breathe nitrogen instead of oxygen? Does it need methane instead of water?

      You must answer questions like these (don't mind my stupid examples) before you can actually look for said life forms. Otherwise you simply don't know what to look for. :)

      Obviously, there is a big problem in deciding which alternative seems the most plausible.

      --
      Score: i, Imaginary
    2. Re:A different mode of life. by Inexile2002 · · Score: 2, Interesting
      How can a [small] man like me suggest new strategies to these NASA/SETI guys?
      Easy. Study science for 4 years undergrad, then 3 years grad, distinguish yourself in the field and then call them and arrange a meeting. People who can't be bothered to do that are usually dillitants who think they're smarter than they really are. There are some brillant people out there who get great ideas outside of their field, but there are also hundreds of crackpots, weirdos and just misinformed people who seem to think that they've figured it out. The 7 years of school weeds out most of those. General tips. Never mention god. Don't tell them: "This is obviously a waste! since a) they obviously don't think so, and b) it isn't. Also, and this is a guess, but age a couple of years.

      As for the other gasses we don't know here - we know all the elements that exist and many that don't exist (ones that we created in labs but don't exist in nature) so we have a pretty solid idea of what possible gasses there are out there. Oxygen breathing, carbon based, water dependent life is possible since we've seen it (us). Carbon and water have special and unique properties that make them ideal for creating life as we know it. If we start looking for "whatever" how will we know we've found it?
    3. Re:A different mode of life. by foobsr · · Score: 1

      Remember that according to Godly people, nothing is impossible by him.

      Not only according to those.

      3.02 A thought contains the possibility of the situation of which it is the thought. What is thinkable is possible too.

      Loc. cit.: The Project Gutenberg EBook of Tractatus Logico-Philosophicus by Ludwig Wittgenstein

      CC.

      --
      TaijiQuan (Huang, 5 loosenings)
  26. Orson Scott Card by toomin · · Score: 1

    In his Children of the Mind book, they find an alien civilization on a planet that communicated via DNA, and i thought that oidea was wonderfully original. For example, the aliens give their space craft a messege that resembles, very much so, a cocaine molucule. The crew had to work out whether they aliens were trying to say "hey, have some cocaine, join the party!", or whether they were drugging them and boarding the ship.

  27. Re:Light takes 25 years from nearest star.. by Anonymous Coward · · Score: 1, Informative

    What planet are you on?

    The nearest star to ours, Alpha Centauri, is only 4 light years away.

    Where did you pull 25 from ?

  28. Why the hell didn't he say that eariler? by hdd · · Score: 1

    so basiclly he is saying all the time, money and the processing power donated to seti at home project are for nothing?

    --
    This Sig is removed due to factual inaccuracy
  29. I remember star trek by fozzmeister · · Score: 1

    Where they didn't want to see us until we had warp engines. I'm no trekie but perhaps if the message exists it's in something that we can't do yet / don't even know about.

    1. Re:I remember star trek by AndroidCat · · Score: 1

      It's a lot more basic than that. They don't want to talk to us until we are a sufficiently evolved consumer market. Other than a latent craving for Slurm, they've left us alone.

      --
      One line blog. I hear that they're called Twitters now.
  30. I had an idea like this a while back. by Mr.Cookieface · · Score: 3, Interesting
    One day when I was reading about some possible candidates of stars that were likely to develop earth like planets, I thought it would be cool to send the spark of life their way so that it could possibly spread throughout the universe. I was thinking about what kind of genetic capabilities we would have in 1000 years if we keep up the pace we're at right now.

    I think we would probably be able to program organisms from scratch by that point, so what kind of organisms would you send to establish life on a distant planet? It would probably start off small, or virus like, but would need to be preprogrammed to evolve into something more complex. Since the evolution would be random, you really couldn't determine the outcome after billions of years.

    Then it occurred to me that if we were going to go through all this trouble for a slight chance that these packets of life might just thrive and grow some brains, we would probably put some kind message in there. Then it occurred to me that we could possibly be the product of such a plan.

    It is possible that the structure of the genetic code itself is an artificial creation of an advanced race. Maybe we should examine the fossil record to look for patterns in the earliest life on the planet. Maybe humans got an evolutionary speed pass to intelligence. Who knows? At any rate understanding the underlying structure of genetic programming would be necessary for understanding the rational behind choosing one structure over another. Just like programmers develop an understanding of the language they program in, perhaps we'll see some calculated order to it all.

    1. Re:I had an idea like this a while back. by doshell · · Score: 1

      It is possible that the structure of the genetic code itself is an artificial creation of an advanced race.

      It's an interesting theory indeed, but it leads to the question "How did alien life forms appear, then? Are they the product of the evolution of simple cells spread over the universe by a meta-alien intelligence?"

      I guess you can see the recursive pattern. :)

      --
      Score: i, Imaginary
    2. Re:I had an idea like this a while back. by wolverine1999 · · Score: 1

      Evolution isn't that type of "blind" random machine you think it is. Emergence theory suggests it's "directed" (for lack of a better word). Read Stuart Kauffman's at home in the universe, for instance.

  31. Re:Light takes 25 years from nearest star.. by jkrise · · Score: 1

    How are we in danger from creatures light years away from us? What kind of weapons can help us defend ourselves? Even if we had a laser gun pointing to these aliens, it'd take years to reach the target!

    -

    --
    If you keep throwing chairs, one day you'll break windows....
  32. That is a big laser by jointm1k · · Score: 2, Funny
    Instead, we should be looking for intentional signals in the form of high-powered lasers that could 'outshine the sun by a factor of 10,000'.

    If one such laser beam would hit the earth, I don't think it would be a message like 'hi there, we are cute nice aliens from outher space and we are going to give you world peace!'. NO this alien death ray would mean something like 'Sheez, what a bunch of morons you puny earth dwellers are. Die die die!!1'. I would not bother building a giant listening post for that message. :/

    --
    You know it makes sense, a little reminder from jointm1k.
    1. Re:That is a big laser by carnivore302 · · Score: 1

      I for one welcome our techno... AAAARRRRGGGGHHH!!!

      --- Proud never to post as an AC
      (Friendly request to visit this site on Elliott Waves)

      --
      Please login to access my lawn
  33. Re:Light takes 25 years from nearest star.. by Inexile2002 · · Score: 4, Insightful

    Sorry buddy. There are a couple of dozen, possibly even hundreds of stars within 25 light years. Alpha Centuari is something like 4.1 lightyears away. So, sun excepted, it takes a hair over 4 years for light from the nearest star to reach us.

    Second. What does the difficulty of getting to Saturn have to do with making sense of radio signals?

  34. Re:Light takes 25 years from nearest star.. by ColdGrits · · Score: 5, Informative
    "considering light takes 25 years to reach the Earth from the nearest star"

    Erm, are you SURE about that?

    Ignoring the real nearest star, Sol, the next nearest star is Proxima Centauri which is 4.22 light-years away... i.e. its light only takes 4.22 years to get here, not the 25 you claim.

    There are 25 known stars within 13 lightyears. Their light won't take 25 years to get to us either.

    Seriously. You wanna check your random information before presenting it as a fact!

    --
    People should not be afraid of their governments - Governments should be afraid of their people.
  35. Re:Light takes 25 years from nearest star.. by jkrise · · Score: 1

    I pulled it from my mistaken memory, perhaps. Still doesn't make a huge difference to my point. Which is, we are not in danger from enemies who are light years away. And there's very little we could do in defence, even if we were. A pointless exercise, in my opinion.

    -

    --
    If you keep throwing chairs, one day you'll break windows....
  36. damn mutation! by darweidu · · Score: 1

    Except the message we get is "Please destroy slashdot.orh, it is destroSDFying the astro-productivity of our employIUZXCees" And we're left here wondering "slashdot.orh, wtf is that?"

  37. Re:Light takes 25 years from nearest star.. by jkrise · · Score: 1

    Assuming we found life existed in a planet 4 light years away - how long would it take to send a chocolate over there? A few thousands of years I guess - does it matter really?

    -

    --
    If you keep throwing chairs, one day you'll break windows....
  38. I found the message! by RALE007 · · Score: 2, Funny
    In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?"

    I found the message! Encoded in my own DNA! It says you should each send $50 to:

    PO Box 1922
    Anchron, OH
    30544

    Swear to god. Obey the aliens.

    --
    Beware blue cats moving at .99c
  39. DNA messages? Where have I seen this before? by hcdejong · · Score: 2, Informative

    In ST:TNG, of course! This episode

    1. Re:DNA messages? Where have I seen this before? by dheltzel · · Score: 1

      Nice post. I thought of exactly the same episode when I read the /. article. I just didn't know there was a site that wrote up the plot. That must have been painful for the webmaster.

    2. Re:DNA messages? Where have I seen this before? by Lomby · · Score: 1

      It goes even better!

      In Carl Sagan's novel "Contact", the message was encoded in the digits of Pi.
      Sadly they produced an horrible movie out of an excellent book, and they left out this idea, which was the ray of hope at the end of the story.

  40. Looking in the wrong places. by JWSmythe · · Score: 5, Insightful

    I think we're really looking in all the wrong places. We're putting human assumptions on alien life.

    We assume they would be using radio communication, or that they'd bother with a high-power laser. What if their communication is completely different. Like, something we haven't even considered to be a possibility yet, even in SciFi.. In a transmission media we don't even realize, we may be receiving communications from them, but we simply don't have the equipment to hear it.. We can't even decipher what any other creature on this planet is trying to communicate, why should we even be so egotistical to thing that not only would we know how to receive their communication, but have the vaugest idea of what they're saying.

    I thought the idea of SETI was that we'd pick up an omni-directional broadcast, with some alien saying "here we are, can anyone hear me" A laser would be directional. It would have to be intended for Earth, and would need to be tracking many years ahead of where we are. We aren't broadcasting the same signal, why would they? There could be many planets near by with the same idea of listening, but if no one's talking, there's no communcation.

    Maybe pulsars aren't just some celestial event, maybe they're beacons, and when we're ready to go to them, we'll find more information. But for now (and the next hundred+ years), we won't be going anywhere near them. Like, we haven't even managed to get a person to the next planet yet. There isn't enough "push" to develop to the next level. Imagine if every country spent their military budget on developing space travel. we'd alerady have a flag on Pluto, along with a bunch of empty beer cans from tourists.

    But no, we waste our resources blowing each other up, or making sure we're on the virge of it every day. Remember the cold war? Ya, 40 years of "I'm going to kill you all", just for it to fall apart, and both sides realize that those people we were so scared of for so long aren't really that bad.

    I grew up knowing the Soviet Union was the evil Red Army, who had so many weapons pointed at us because they hate us so much. Now, thanks to the fall of the Soviet Union, and the rise of the Internet, I now frequently talk to a Russian, and really, he's a nice guy. I've seen some beautiful pictures around where he lives, where not too long ago I would have believed was a frozen wasteland.

    If only all of our governments would give up on this nonsense and cooperate in things, or better yet, ditch the whole "This is ours, you can't play with it" mentality, we'd make a lot more progress.

    [rant mode off]

    --
    Serious? Seriousness is well above my pay grade.
    1. Re:Looking in the wrong places. by StrawberryFrog · · Score: 1

      We assume they would be using radio communication, or that they'd bother with a high-power laser. What if their communication is completely different. Like, something we haven't even considered to be a possibility yet, even in SciFi

      I think you're wrong, mainly because I consider the posibility of a new discovery of the order of magnitude of say, electromagnetic radiation, to be very remote.

      In other words, what you see is all there is.

      --

      My Karma: ran over your Dogma
      StrawberryFrog

    2. Re:Looking in the wrong places. by doshell · · Score: 1

      We assume they would be using radio communication, or that they'd bother with a high-power laser. What if their communication is completely different. Like, something we haven't even considered to be a possibility yet, even in SciFi.. In a transmission media we don't even realize, we may be receiving communications from them, but we simply don't have the equipment to hear it.

      According to current scientific knowledge, in order to transmit information across space, any life form has to forcibly make use of one of the four forces (gravitational, electromagnetic, and strong/weak nuclear forces). This simple assumption simplifies the problem a whole lot:

      The nuclear forces are not suitable for communication because they have an extremely small radius of action. That alone leaves us with gravity and electromagnetism (light is associated with the latter) as the only two options.

      Although the concept of gravitational forces used as a communication channel looks promising, it presents a small problem: transmissions would imply moving big masses to the right spots in space so as to produce a gravitational field corresponding to the desired message (and I'm not even thinking how such messages could be decoded by us). Unless the aliens have discovered a way to change the curvature of space-time without moving masses around, this does not seem too practical.

      Also take into account that, even though the gravitational force does propagate to great distances, it is the weakest of the four, so it doesn't look like a good candidate for the job. We can't even make a map of the universe around us just by going out into space and "sensing" the gravitational field (in fact the way we do this is by observing the relative positions of stars in the sky).

      That leaves us with the electromagnetic force, which is both relatively strong and has a large range of action. In terms of electromagnetism, the difficulty is guessing what range of the spectrum the aliens use as their comms channel. There really is no way to guess -- all we can do is scanning as much of the spectrum we can for the longest possible span of time. I don't know if current efforts are the best we can do, but we definitely seem to be going in the right direction.

      Any comments on this? This is the first time I've thought about the subject.

      --
      Score: i, Imaginary
    3. Re:Looking in the wrong places. by JWSmythe · · Score: 1

      There's so much we haven't learned yet, you can't say that the manipulation of electromagnetic radiation is the end-all of our technology. There's plenty more to come. Imagine going back 100 years, and telling people about microwave and satellite communication. They'd be like "Oh no, that can't happen"

      In my words, what you see is just the beginning.

      --
      Serious? Seriousness is well above my pay grade.
    4. Re:Looking in the wrong places. by JWSmythe · · Score: 1


      You said everything with your first words.. "According to current scientific knowledge". In future years, we'll realize how primitive we are now. Our elders see it. Ask someone who's 90 about life in their childhood.

      --
      Serious? Seriousness is well above my pay grade.
    5. Re:Looking in the wrong places. by StrawberryFrog · · Score: 1

      Actually Nikola Tesla hypothesized that there was another component of EM radiation, Longitudinally Propagating EM Radiation ... He stated that this radiation would not be limited to the speed of light

      Well, Nikola Tesla was good on some occasions and quite a nutter on others. Like this one.

      --

      My Karma: ran over your Dogma
      StrawberryFrog

    6. Re:Looking in the wrong places. by finkployd · · Score: 1

      In other words, what you see is all there is.

      That vast majority of people at every stage of humanity's scientific progress believed this.

      Finkployd

    7. Re:Looking in the wrong places. by MtViewGuy · · Score: 1

      What if their communication is completely different. Like, something we haven't even considered to be a possibility yet, even in SciFi.. In a transmission media we don't even realize, we may be receiving communications from them, but we simply don't have the equipment to hear it.. We can't even decipher what any other creature on this planet is trying to communicate, why should we even be so egotistical to thing that not only would we know how to receive their communication, but have the vaugest idea of what they're saying.

      Remember Star Trek: The Motion Picture and Star Trek IV: The Voyage Home? Outside of the obvious Hollywood licenses :-), both movies do point out the very issues you mentioned--how do you communicate with an alien civilization when their idea about communcations and our idea of communications may not be the same?

    8. Re:Looking in the wrong places. by d474 · · Score: 1

      Another example of looking for the wrong thing:

      Even if SETI is looking at optical or radio waves, what if the message is hidden in the Spectral Lines? That way, you have a continuous light source in which to write a message in a sort of barcode or variant system. A simple primer is all you need to act as a beacon.
      Maybe some day an astronomer performing a spectral analysis will one day come across a pattern that has a distinctly intelligent look to it....

      --
      Authority questions you. Return the favor.
    9. Re:Looking in the wrong places. by bwanaaa · · Score: 1

      it's not the frequency stupid, it's the method. aliens are likely to be using the most efficient form of communication. A bandwidth starved society would use packet based digital transmission. Why dont we use hubble hooked up to air snort?

    10. Re:Looking in the wrong places. by Grishnakh · · Score: 1

      Or how about tachyons? They travel faster than light. Why would a highly advanced alien civilization use a communications channel that's limited to lightspeed?

      Only a little over a hundred years ago, no one had any idea that radio would be invented. The idea that we now know all possible means of communication seems ridiculous to me.

    11. Re:Looking in the wrong places. by sharkdba · · Score: 1

      In other words, what you see is all there is.

      Could be. But what if there are signals/technologies outside our observable spectrum? We are currently trying to detect signals based on our own sensors: eyes and ears. In other words we're looking for what we can see and/or hear. But there might be technologies undetectable by our conventional observation methods. Somehow I think, we're still in for a major breakthrough here.

      --
      The purpose of life is to find the purpose of life.
    12. Re:Looking in the wrong places. by cfuse · · Score: 1
      Imagine if every country spent their military budget on developing space travel. we'd already have a flag on Pluto, along with a bunch of empty beer cans from tourists.

      The fungi that live there might have something to say about that ...

    13. Re:Looking in the wrong places. by JWSmythe · · Score: 1


      Shhhh, there's no life on other planets. To believe there is undermines all human religions.

      --
      Serious? Seriousness is well above my pay grade.
    14. Re:Looking in the wrong places. by cfuse · · Score: 1
      Shhhh, there's no life on other planets. To believe there is undermines all human religions.

      Unfortunatley, this isn't the case. Religion is adaptive, first the world was flat, then when it wasn't flat it was at the centre of the universe, etc.

      It just goes to show that stupid people resist all attempts to correct their stupidity.

      Besides, you've seen the damaging efforts of missionaries on earth - imagine how excited they would be at the prospect of whole new forms of life to corrupt and poison.

      Can't wait for the jihad from space ...

      Oh, and for those who didn't get the original reference: Mi-go

    15. Re:Looking in the wrong places. by thavig · · Score: 1

      I wonder if it is feasible to use neutrinos for broadcasting. I mean I know it is not now, since we don't currently have a way to reliably capture neutrinos. But could such a technology develop? And maybe a sufficiently advanced civilization would switch to that. Or is there enough ambient flow of neutrinos from sources like the sun that any signal would wash out?

    16. Re:Looking in the wrong places. by JWSmythe · · Score: 1

      Probably. Anything's possible. At least that's what I tell my boss. He figured me out a while ago. I'll always say something can't be done, then 1/2 hour later, I'll go back into his office and tell him that it can be done and tell him how easy or hard it would be. :)

      It shouldn't be all that hard (but a bit expensive) to do something silly like take a mirror (a really big freakin' mirror), and reflect the sun's light, and modulate the output at a 90 degree angle from the sun. Oh, that would look like a binary star (of sorts).

      Or to have a satellite (moon size?), half black, half reflective or white, so it would appear to pulse as it rotated. That should be a clear indication that there's something here, when there's a regular pattern to the light. Oh wait, that's what a pulsar looks like. And back to the previous message, a pulsar may be a message saying "Hey, we're here, come look"

      --
      Serious? Seriousness is well above my pay grade.
  41. 10,000 times outshine the sun? Yeah right. by hankwang · · Score: 5, Informative
    The sun radiates with about 2e25 watts per steradian. That's of course an incredible amount of light, so the idea is to use fewer watts within a very narrow angle. The claim is that one can achieve 2e29 W/sr that way.

    The divergence of a laser beam is, assuming ideal optical components, mostly dependent on the diameter of the beam where it starts. You can take a big telescope and let the light pass through in the opposite direction, so let's say, a diameter of 4 meters. For visible light, that will generate a beam with a divergence of 1e-14 sr. So, to get to 2e29 W/sr, you need a laser with a power of no less than 2e15 watts. (Compare this to a mid-size electrical power plant at 1e9 watt...)

    Yes, there exist lasers that can generate ultrashort pulses in the near-infrared, with such a high peak energy, say 100 femtoseconds (100 fs=1e-13 s) and 100 joules per pulse, so there you have our desired fluence.

    Unfortunately, such lasers can only fire something like one shot per second. If you really want to appreciate the high peak power, you need a camera with a shutter time of 100 fs. Imagine looking at the sky with such an ultrafast camera. The chance that you actually manage to catch a flash from this laser is virtually zero, unless you have a way to know when the flash is going to come. Someone who is looking at a nearby star and expecting flashes is more likely to have an aperture time of 0,1 seconds or so in order to capture any photons at all. At 0,1 seconds aperture time, the laser is no longer 10,000 times more bright than the nearby star (that is, our sun), but rather 1e8 times weaker.

    So, it is unlikely that this is going to word, assuming that someone is looking at us anyway.

    1. Re:10,000 times outshine the sun? Yeah right. by wolverine1999 · · Score: 1

      I don't know how realsightings.com found that laser like streakt then. Perhaps going frame by frame in video footage?

    2. Re:10,000 times outshine the sun? Yeah right. by Natchswing · · Score: 1
      We wouldn't be using cameras, we'd be using photomultiplier tubes. Not only are they quite capable of detecting single photons but they're pretty cheap and been around for many years.

      The only trick is isolating the wavelength so we don't cook them.

    3. Re:10,000 times outshine the sun? Yeah right. by Tjp($)pjT · · Score: 1

      Use a set of cameras so one always has an open aperature.

      --
      - Tjp

      I am in wallow with my inner money grubbing capitalistic pig. ... Oink!

    4. Re:10,000 times outshine the sun? Yeah right. by tsm_sf · · Score: 1

      The sun radiates with about 2e25 watts per steradian. That's of course an incredible amount of light...

      Actually, it's pretty believable for those of us who get outside every now and then.

      --
      Literalism isn't a form of humor, it's you being irritating.
    5. Re:10,000 times outshine the sun? Yeah right. by shadowbearer · · Score: 1


      Thirty years ago we couldn't generate those pulses at all, much less detect them.

      One can't assume that the civilization trying to communicate is at our level of tech, nor that we will remain at this level - we advance by trying to, not by saying "it can't be done."

      Cheers,
      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
  42. Cable and Satellites by maroberts · · Score: 1

    A satellite signal has a footprint on the surface of the Earth, but some of that footprint may miss the Earth entirely, thus leaking signal into space.

    --

    Donte Alistair Anderson Roberts - hi son!
    Karma: Chameleon

  43. first message? by saint_uv · · Score: 2, Funny

    this genetic sequence is licensed under GLP...

    1. Re:first message? by Tenebrious1 · · Score: 1

      this genetic sequence is licensed under GLP...

      Ah, so you believe the aliens are benevolent. Me, I think the message encoded in our DNA will turn out to be a shrink-wrap EULA...

      --
      -- If god wanted me to have a sig, he'd have given me a sense of humor.
  44. Mmmm, chocolate.. by pedestrian+crossing · · Score: 1

    Wow, what a great idea, we send them chocolate, they send us their passwords. Brilliant!

    --
    A house divided against itself cannot stand.
  45. Re:Light takes 25 years from nearest star.. by Lord+Kano · · Score: 1

    Which is, we are not in danger from enemies who are light years away. And there's very little we could do in defence, even if we were. A pointless exercise, in my opinion.

    I'm guessing that you don't understand the point of research that is done for the sake of research.

    It's not about finding enemies, it's not about finding someone to go to an intergalactic barbecue with, it's about finding someone else in all of the vastness of space. Just to see if we're alone.

    LK

    --
    "Hi. This is my friend, Jack Shit, and you don't know him." - Lord Kano
  46. Re:Duh... by peculiarmethod · · Score: 1

    oh come on, moderators! thats funny.. the hitchhikers guide.. to the entire friggin galaxy! doesn't anyone on slashdot read anymore?!

    pm

    --
    ** "It's not my job to stand between the people talking to me, and the ones listening to me." -- Pego the Jerk
  47. Quantum SETI by essreenim · · Score: 5, Interesting

    With the promise of quantum communication, it is conceivable that (if Quantum communication is indeed feasible) we should be focussing our optical light search on specific photons of light.

    Anyone know about beam splitting entangled pairs etc. Many moons ago, Einstein, Podolski, and Rosen carried out there unusual experiment whereby the they observed what is now known as quantun weirdness. A photon in an entangled state could be split using a sophisticated 50:50 beam splitter. Each split photon could travel off in opposite directions and appear to be twins, in the sense that any change in behaviour of one would instantly (exactly synchronized regardless of distance!!!) be felt by the other, its twin.
    Evidence that this was no fluke is gathering thanks to continuing experiments, yet it is still not in stone.

    My reasoning is that if this phenomenan is genuine, it could be one way extraterrestrials would chose to contact us. Why not. They send a conventional optical signal, only this time encased in a surrounding cylindar of light, thus allowing for the entangled photons charateristic properties to be influenced only by this cylinder of light. Allot can till go wrong so conceivably, the 'ET's' would send a large stream of such light cylinders- the centre of which is a stream of entangled photons. That way any measurement of the entangled photon would cause an immediate change to its twin (The twin photon - of entangled pair)would presumably be archived on the alien world bouncing back and forth in a cavity (not unlike the cavities we use today - only presumably far more advanced.) So, once change is observed, an immeditae alarm bell is triggered. The ET's can know instantly someone/something has comeinto contact with their signal. Just like Earth SETI, the ET SETI would categorise all their findings and have mant false positives. They would probably already have chartered the area of space to which they send a signal. They may know the only objects (meteorites, stars, planets, commets...) that are likely influences over the transmitted light signal. Hence, if we Earthlings intercept the light in a very manufactured manner (i.e fire a encoded light signal of our own into theres, they are likely to get some unusual data back at there end - instantly.

    Anyway, lets face you can't have an interest in SETI without being imaginative.

    All Im tring to say is.

    1) If I were a highly advanced ET, I would use Quantum entaglement (if it is indeed feasible) to transmit photons of light.

    2)I believe we should start sending entangled photons of light, encased in our own manufactured cylinders of background light, out into space.

    3)I hope SETI read this.

    1. Re:Quantum SETI by frakir · · Score: 1

      Once referenced photon twin is limited in some space (eg "bouncing back and forth in some cavity ") our 'signal' photon loses its entangled characteristic.

      Besides how would you tell if photon hit a detector or just some rock?

    2. Re:Quantum SETI by Anonymous Coward · · Score: 3, Informative

      That's an interesting idea, but what the Einstein, Podolski, and Rosen's experiment showed was "spooky action at a distance", not instant data transmission at a distance. It is true that reading the state of one of the entangled photons coming out of their device uniquely determines some qualities of the other photon (that is, WE now know something about the other photon), but the other observer doesn't get any information from us this way.

      EPR were just freaked because it seemed to them that a signal that carried information about the system seemed to travel fater than light. (Not an informative signal that we originated, however)

      What it all boils down to is, we don't know of a way (yet) to send information faster than light, even though it seems that some phenomona in the universe are governed by a connection that links/correlates points in space faster than it is possible for light to travel between each.

      http://en.wikipedia.org/wiki/EPR_paradox

      (insulanus)

    3. Re:Quantum SETI by essreenim · · Score: 1

      Experiment by ENS in Paris showed that it is possible to measure the phase shift of certain materials that can be fired through the photon without absrbing light. It is this phase shift that could take measurements.

      Ope up google and search for Quantim ENS paris etc. etc.

      Of course its all experimental stuff.

    4. Re:Quantum SETI by essreenim · · Score: 1

      Yes, but their experiment was/is the foundation. Further QE experiments have progressed since then. Its probably a matter of _when_ the technology is available so that we can measure and accuately remeasure (without destroying - the hard part) what you are measuring. Expreiments by ENS in Paris are the most interesting I've seen regarding this.

      It seems as though the basic components are there. Its just we are not advnced enough to use it yet. Bu, the "ET's" might be. If we can even conceive/imagine how it could work in the future, then maybe we can start looking now.

      Suppoe beings out there have this technology and can already use it for communication. It is not that far fetched that they would. No more far fetched than SETI itself. Why not look for entangled pairs of photons flying through space?
      if (we dont find them) { Try something else }
      else if (we do find them) {develop technology to understand them! }

      --

    5. Re:Quantum SETI by GamerGeek · · Score: 1

      If I were a highly advanced ET

      Then your neck would be twice as long, you could light up your entire arm, levitate a mack truck, and wipe the floor with ALF.

      Screw those light bulbed fingered bicycle flying wussies.

    6. Re:Quantum SETI by roydeboer · · Score: 1
      That way any measurement of the entangled photon would cause an immediate change to its twin (The twin photon - of entangled pair)would presumably be archived on the alien world bouncing back and forth in a cavity (not unlike the cavities we use today - only presumably far more advanced.) So, once change is observed, an immeditae alarm bell is triggered.
      I believe the first measurement (in order to observe change) of the archived photon will destroy the entanglement. So the photons are no longer twins...
    7. Re:Quantum SETI by Captain_Chaos · · Score: 1

      If this mechanism worked it would allow you to transport information faster than the speed of light, which as far as I know is still thought to be fundamentally impossible, so I think it's extremely unlikely that it could work. One reason probably being that you wouldn't be able to measure the state of the particle in the cavity without altering said state, so that you would never know what the state was before you tried to measure it. Good old Heisenberg's uncertainty principle. Any physicists care to comment?

    8. Re:Quantum SETI by maxwell+demon · · Score: 2, Informative

      As long as you only measure one of the particles, you just get random noise. It's only in the correlation between the measurements on both particles that you can see that they were entangled. But to see (or exploit) them, you have to transmit the measurement results (classical information!), and as long as you don't find a way to do that FTL, you can't do FTL communication with entangled pairs (and if you find a way to transmit classical information FTL, you obviously don't need the entangled pairs to transmit classical information FTL - however, it would enable you transmitting quantum information FTL using the classical FTL link and an entangled pair).

      --
      The Tao of math: The numbers you can count are not the real numbers.
    9. Re:Quantum SETI by FireFury03 · · Score: 1

      Anyone know about beam splitting entangled pairs etc.

      I think the idea of quantum communication is that you take 2 entangled particles, leave one at the source and take the other to the destination. You could then (in theory) use the entanglement to communicate instantaneously. This obviously requires first physically transporting one of the particles to the destination whilest storing the other particle at the source. Although this would seem to lead to some problems:

      Lets say ET is only 10 light years away and your entangled particles are going to be photons. ET entangles a pair and stores one of them at their end. the other one gets sent our way in the hope that we will capture it and then use the entanglement to facilitate instantaneous communication.
      1. it's going to take 10 years for the light to get to us - how does ET store a photon for 10 years? (I guess bouncing it between perfect mirrors, slowing down the light or refracting it in a circular path)
      2. AFAIK the entanglement decays after a fraction of a second so you're going to need to find some way of sustaining the entanglement.

    10. Re:Quantum SETI by Progman3K · · Score: 1

      OK, I am not a licensed physicist, but here's what I *think* I understand.

      The entanglement DOESN'T end simply by measuring it; from what I understand, the particle's spin can be changed, and the entangled twin's spin will instantly change its spin to complement.

      I'm not sure if this precludes changing the spin of one of the particles AGAIN... Never mind that for now though.

      What if you directed a stream of particles who are all spinning in the same way towards Neptune, let's say. Could you then modulate the stream here (like encoding binary bits) by changing the spin of some of the twins so that someone on Neptune would also see the particles spin changing?

      Wouldn't that be a way to send "subspace communications" ?

      Trek away. Even if I'm wrong, I'm sure that we can do something with this.

      --
      I don't know the meaning of the word 'don't' - J
    11. Re:Quantum SETI by Jim+Starx · · Score: 1
      I really doubt this will ever work. It would be a violation of relativity for signals to travel faster then light.

      Its probably a matter of _when_ the technology is available so that we can measure and accuately remeasure (without destroying - the hard part)

      At the core of quantum mechanics is the simple fact that you cannot measure without disturbing. This is a theoretical limitation, not a technological limitation.

      --
      The darkness... controls the music. The music... controls the soul.
    12. Re:Quantum SETI by Jim+Starx · · Score: 1

      That isn't a way of sending information. For starters I'm pretty sure that the entanglments does not survive for a second measurement. The thing is, we can't change the spin, we can only measure it, once measured the probability wave collapses and the particle chooses a particular spin. On our end, we can measure the particles spin, but we have no way of knowing whether or not these particles are entangled unless someone calls us up and says for such and such particles you should have gotten these answers. If the measurements correlate, then we know they were entangled. But we can't use that correlation to control the measurement or to indicate to anyone else that there actually is a correlation.

      --
      The darkness... controls the music. The music... controls the soul.
    13. Re:Quantum SETI by Progman3K · · Score: 1

      But Jim, they wouldn't even HAVE to be measured twice:

      The stream is sent with its polarization KNOWN, for examples, ALL the particles are spinning left.

      So when you are measuring them on Neptune, you already know they should all be like that, any particles received spinning the other way were sent as a bit of information.

      Maybe I am missing something here. Please shed light.

      --
      I don't know the meaning of the word 'don't' - J
    14. Re:Quantum SETI by galen · · Score: 3, Interesting

      Faster than light communication may violate relativity, but remember that relativity is a theory. It is a proposed description of the way the universe behaves. Granted, so far it has proven to be a highly accurate description. Also keep in mind that relativity operates on the scale of the very large and has never been incorporated with quantum theories.

      So, having said that, history is filled with theories that are very accurate within their intended scope, but fail when applied to a different or expanded problem space. For example, when masses, distances, and speeds get astronomically large, Newton's mechanical theories need correcting.

      As a quirky aside, IIRC relativity does not rule out faster than light travel. It does forbid acceleration to and beyond the speed of light, but that all hinges around mass. What about the possibility of massless phenomena? If photon entanglement doesn't involve the transmission of mass for communication, there's nothing in relativity that would prevent the communication from happening faster than light. The fact that we currently base all of our physics on mass movement may be limiting our imaginations here. (Or I may be full of it. I'm not a phycisist after all.)

      ~~Galen~~

    15. Re:Quantum SETI by sexylicious · · Score: 1

      So what you're saying is that you take a pair of entangled photons, have one get sent to the moon and hooked up to a detector and transmitter, and take the other and stick it in a cold room until the one on the moon is ready.
      Then, at a prearranged time, read both photons. The one on the moon sends it's results to earth as soon as the detector reads it. The one on earth stores the info with a timestamp.

      The incoming data from the moon should lag a bit, easily measurable with today's equipment. Put a time stamp on said data as soon as it comes to your lab, account for transmission delays (should only add a couple of seconds at most).

      When you compare the times, your moon detector should say that the photon had such and such state on the moon, and since you read both photons at the same time, the one on earth should give you information a couple of seconds before the info arrives from the moon about the photon on the moon.


      Would be a good experiment.

    16. Re:Quantum SETI by aardvarkjoe · · Score: 1

      It doesn't work that way, unfortunately. You don't know the properties of the photon you send, until you measure the properties of the entangled photon. Your scheme involves measuring them twice: once to determine their state before sending them, and once on the recieving end.

      --

      How can we continue to believe in a just universe and freedom to eat crackers if we have no ale?
    17. Re:Quantum SETI by CrowScape · · Score: 1
      --
      common sense: noun
      What those who are ignorant of the subject matter think; usually wrong.
    18. Re:Quantum SETI by Jim+Starx · · Score: 1

      You can't create a particle with certain properties. You create a particle and then measure it to find out those properties.

      --
      The darkness... controls the music. The music... controls the soul.
    19. Re:Quantum SETI by Progman3K · · Score: 1

      Are you sure?
      I thought I read about an experiment where light particles were sent through something that split them apart and left each stream polarized in a certain direction, but that the stream was subject to entanglement, meaning if you changed the polarization on a twin particle, the other twin would also spontaneously change polarization...

      Maybe I'm just not getting it though... *sigh*

      --
      I don't know the meaning of the word 'don't' - J
    20. Re:Quantum SETI by Jim+Starx · · Score: 1

      That's correct, but the orientation of the pair is still random. If we're talking about spin up and spin dow for instance. You can use a splitter to create two particles, one going left and one going right. Each particle will randomly be spinning either up or down, but they will allways be opposites of each other. You may find that the left particle spins up and that the right particle spins down, or you may find that the right particle spins up and the left spins down. But you'll never find them both up or both down.

      --
      The darkness... controls the music. The music... controls the soul.
    21. Re:Quantum SETI by smurf975 · · Score: 1

      What if you used some device that works like an ideal transistor?

      What I mean and it is actually far of, of how a transistor actually works. Is that you don't measure the entangled particle but mimic it and read that mimicked data. Sort of a pseudo entanglement.

      So if an entangled photon changes its state a pseudo-entangled particle will also change its value. As if a particle changes its energy state it should have an effect on its surroundings (at least those sensitive to it) not? However by just mimicking not measuring (interacting) you will not touch it.

      Lets say you have a group of particles of which some are entangled with another group of particles within a non-entangled group. Wouldn't the non-entangled particles react to the changes of the entangled particles within it?

      --
      -- I don't buy it, I grow it.
    22. Re:Quantum SETI by adaknight · · Score: 1

      What about the possibility of massless phenomena?

      Photons have no mass.

      --
      hrm. then again. maybe not.
    23. Re:Quantum SETI by trewornan · · Score: 1
      in the sense that any change in behaviour of one would instantly (exactly synchronized regardless of distance!!!) be felt by the other, its twin.

      The results are random. So the entangled photons 'match' but if you can only see one end of the experiment all you get is random photons and no way of knowing what happens at the other end.

      And anyway, this assumes that the 'hidden variable' model is wrong.

      Bell's Theorem is the most interesting result of this effect.

    24. Re:Quantum SETI by trewornan · · Score: 1
      Faster than light communication may violate relativity, but remember that relativity is a theory

      But if stuff can travel faster than light then you have to explain what meaning to give to distances proportional to the square root of minus one. And don't give me any Star Trek nonsense about hyperspace - that's just bullshit . . . like stuff travelling at superluminal speeds.

    25. Re:Quantum SETI by essreenim · · Score: 1

      He is not full of it you *#@£

  48. Should SETI Be Shut Down Instead? by droleary · · Score: 2, Interesting

    Maybe someone can enlighten me, because I never understood why SETI got much effort at all. Any random signal we could eavesdrop on seems like it would likely becoming from a planet like ours, transmitter on a surface that is moving around an axis that is moving around a sun that is moving around a galaxy. Radio waves might cut a fair (if increasingly faint) arc into the Universe under such conditions, but a laser? Wouldn't that make it a pressing assumption that aliens knew we were here? And I don't mean just "here here" but "there here": contact in a manner that accounted for our movements over the time scales it would take for a directed signal to reach the planet. I mean, pick any random star of billions in the night sky and assume a planet around it had intelligent life on it. Now where exactly would you point your beacon so that it actually hit that target? And why is it we think we're on the receiving end of such improbable attention?

    1. Re:Should SETI Be Shut Down Instead? by awhoward · · Score: 1
      Optical SETI looks for targeted signals, not leakage radiation. Radio SETI can look for leakage, but only for closest few stars among 100 billion. For a Obviously that's why OSETI experiments use photodetectors with nanosecond speed (eg. photomultiplier tubes). Nanosecond pulses are perfectly resolvable on these detectors. For a detailed analysis of these scenarios out a recent paper.

      --Andrew

  49. Junk DNA... by fib2004 · · Score: 1

    Well, as a biologist, I always wondered why my peers called the non coding DNA "junk DNA". I think it's non sense. They believe that 98% is junk DNA, that it just cost energy to replicate? I better think of it as something we not yet understand. DNA has a highly repeating structure that can be fearly compared to a crystal. Exited, it shines, DNA emits photons. And it has been proven that some drugs higher the numbers of photons emitted.

    Some indians from Amazonia used drugs to "understand" the way the world works. In their deliria, they saw two intimately linked ladder. Indeed, they were the first people to see DNA, hundreds of years ago. This vision is common. In Australia, arborigenous people have drawn DNA long ago.

    Could this be one of the message that ET wants us to hear? Personnaly, I think that it's just a message from the nature, to remind us that we are still living things, in a small world...

    --
    Would it not be easier in that case for the government to dissolve the people and elect another? - Bertold Brecht
  50. The Outer Limits by InfiniteZero · · Score: 2, Informative

    Are we the message?

    That's exactly the idea from The Outer Limits : Double Helix, and sequel, The Origin Of Species.

    http://theouterlimits.com/episodes/season3/307.htm
    http://theouterlimits.com/episodes/season4/418.htm

  51. Alien Virii = Spam Marketing Wars? by Anonymous Coward · · Score: 1, Funny

    If alien civilizations sent messages via live virii, presumably the spammers did so, too. So, we should be chock full of millions of alien messages like, "Buy V1agra!", "Hot Grits PRON", and "INTERGALLACTIC RING T0NEZ".

    That should be easy enough to find -- just look for a sixty-something man getting pleasure from his cell phone.

  52. It's a matter of scale by pedestrian+crossing · · Score: 3, Insightful

    Let's see, you are comparing our solar system to other galaxies? You must realize that the scale of a solar system in relation to the scale of a galaxy is unbelieveably small, right? Ie., there are a (suitably big number) of solar systems in our galaxy alone.

    Think of it this way, when you look at a picture of a galaxy, and you see the fuzzy white haze, that haze is (to quote Dr. Sagan) billions and billions of stars.

    Now step back, and look at a Hubble Deep Field photo. What do you see? A (suitably large number) of galaxies each of which contains a (suitably large number) of stars/solar systems.

    If you really consider the scale of the universe and the scale of time that the universe has been around, it seems pretty obvious that there is a lot of life out there.

    The reason we don't have the Star Trek thing going on is that wonderful little thing called "c". That, and I guess they are all trying to learn English...

    --
    A house divided against itself cannot stand.
    1. Re:It's a matter of scale by Progman3K · · Score: 1

      >(to quote Dr. Sagan) billions and billions of stars.

      He never said that.

      --
      I don't know the meaning of the word 'don't' - J
    2. Re:It's a matter of scale by pedestrian+crossing · · Score: 1

      I watched Cosmos avidly. He may not have written the line, but he certainly said it!

      --
      A house divided against itself cannot stand.
    3. Re:It's a matter of scale by Progman3K · · Score: 1

      Nope.

      I own the Cosmos series on DVD, and he does say "Millions of Billions" or something like THAT, but he never say "Billions of Billions"

      As a matter of fact, if you read his book Broca's Brain, he even states that he NEVER said that.

      Note: I just read 3 of his books in the last month, it might have been in Cosmos, Demon-Haunted World or Broca's Brain that he denied saying the phrase, I'm not certain. One thing that IS certain is that Sagan himself never said "Billions of Billions"

      --
      I don't know the meaning of the word 'don't' - J
    4. Re:It's a matter of scale by pedestrian+crossing · · Score: 1

      Whatever, you're totally OT now. My point was that it is "a matter of scale". Geez, you're as bad as the grammar nazis!

      --
      A house divided against itself cannot stand.
    5. Re:It's a matter of scale by Progman3K · · Score: 1

      >Whatever, you're totally OT now. My point was that it is "a matter of scale". Geez, you're as bad as the grammar nazis!

      You're right. Sorry.

      Feel free to point out my copious spelling errors!
      I know I made a couple of doozies in the last post.

      Anyhow, I REALLY like Sagan. If you liked Cosmos (so incredible, words fail me), I encourage you to read Demon-Haunted World.

      --
      I don't know the meaning of the word 'don't' - J
  53. Is this a laser signal, or something else? by wolverine1999 · · Score: 1

    I saw this here.
    Looked like a laser to me. (Or is it Star Wars?)

  54. In Cells? Hmm... like Mitochondria? by CharonX · · Score: 1

    Alient Information stored in cells?
    It might sound far fetched at first, but when you look at some cell parts like Mitochondria it might be possible. (For those too lazy to click the link: Mitochondria are basically the powerplants of our cells, and posses their own DNA - which indicates that they might have been seperate entities at the beginning)
    Another examples is as far as know Chlorophyll. So it could be possible to insert an DNS encoded message in cells.

    --
    +++ MELON MELON MELON +++ Out of Cheese Error +++ redo from start +++
  55. static noise by now by fuck_this_shit · · Score: 1

    if DNA is the message: good luck decoding it given that it mutated over a couple of billion years. Doubt you'd find anything useful.

  56. And the race is on... by Anonymous Coward · · Score: 3, Funny

    as /. users rush to see who can excel the other at sophistry. The rules are simple.

    Comment on the physics and applicability of technology that has never been seen and wrangle and argue about how to build machines for which there is no conceivable power source.
    Players must say as little in as many words as possible. It must also sound scientific and advanced. For lessons on how to do this, watch Star Trek.
    Lastly, players must never admit that they don't know what they are talking about. By admitting such a thing, one is actively admitting to sophistry. Confession is the last thing a sophist must engage in.
    Now, let the games begin!
  57. YOU FUCKING RETARD!! by Anonymous Coward · · Score: 2, Interesting

    There are NO aliens, besides those from Mexico, anywhere near Area 51. How do I know, because if creatures are smart enough to travel outside of their light cone, they are smart enough to be able to watch our tv. This has two effects, 1) you can learn a lot about humans by watching tv, and I'm not just talking about Magnum PI, but how about the neurosurgery or opthomology grand rounds you can probably watch if you live near a university. 2) We've made it abundantly clear, that if you're an alien and you set foot on our world, we will try to kill you, we might be sad about it, have a moderately atractive woman in her thrities fuck you, or we might just pre-emptively break out the big firecrackers in the effort to change our entry to "mostly harmless."

    It just so happens that part of maintaining a credible threat is to make it difficult for the ones enemies to precisely ascertain one's capabilities. This is why places like area 51 are necessary. That people watch Independance Day (OF ALL THE FUCKING STEAMING LOADS!) and think that "Hey, if Randy Quade plays a character who says he was ass-raped by aliens who are we to say it didn't happen..." is proof that a program of euthenasia tied to intelligence testing isn't entirely without merit. Why the hell you people can't satisfied with rubbing quartz on your chakras and keeping your retardation to yourselves I'll never understand.

    And the moderators. What the hell. "Yeah, maybe there are aliens who traveled a million trillion miles to scare farmers shitless and turn cows inside out. Who's to say...?" GOD DAMMIT!

    1. Re:YOU FUCKING RETARD!! by Zareste · · Score: 1, Informative

      because if creatures are smart enough to travel outside of their light cone, they are smart enough to be able to watch our tv

      This is based solely the 'linear intelligence' model, which thinks that all civilizations follow the same tree of technology, and if a civilization has a technology that we don't, then it means they've 'passed us up' on this imaginary tree and know everything that we do.

      It's basically meaningless. The ability to get from one system to another could simply mean that the civilization, at one point or another, needed a means of space-travel to survive and now happens to be way ahead in transportation. Or they may be a bunch of dunces who stumbled on a way to bend space into wormholes.

      And there are a billion ways to exist here unknown to human perception and inventions. Or at least quite a few. Just one look: Many of us are still bent on denying spirits and anything else we're told to believe is 'paranormal' (a funny little scarecrow-word that's kept us away from anything we're not told to acknowledge or figure out). Do you think the government could get funding to detect something they can't see at all? They wouldn't have much success getting funds for something that a politician can just call a ghost chase.

      If we can't even detect something as frequent as a spirit, then moving around under our radar would be a snap for someone with the right skills or technology.

      But kudos for not sacrificing your credibility and using the fearful old 'tinfoil hat' scarecrow, anyone else would have chickened out and gone 'Eek! Anyone who doesn't believe me has a tinfoil hat!!'

      --
      I am NOT a number! I am a - oh wait, I'm number 761710. Look! 761710!
    2. Re:YOU FUCKING RETARD!! by Zareste · · Score: 1

      This is the problem with you fucks

      Anyone else smell a mindless troll? I take it the big attention-whoring flame was supposed to to cover up the fact that you clearly don't have any deduction skills? There are plenty of subjects at which you can let off the steam after a fight with your mom or dad, but science certainly isn't one of them, and you've given a flagrant demonstration at how dumb a person can make himself look when he charges into subjects he doesn't understand.

      Fine then, I'll put this in terms people your age can understand: Different planets have different materials, different possibilities, and in this supposed situation, different forms of life. Now, on our planet, the most we have is natural fuels, of which we need a lot in order to get into space. On another planet they could easily have materials that'll do the same with little technology required. Following? Probably not but anyway, intelligent life on a planet with these materials has a gigantic boost in that direction. They could have space travel while giving no attention at all to these completely unrelated subjects you're coming up with.

      You wondering how someone on another planet could travel without knowledge of the atom is the same as another uneducated dunce wondering how the Egyptians built the pyramids without knowledge of glaciers. It only means that you can't put two and two together and have this naive idea that everyone who knows this therefore knows everything about some subject that has absolutely nothing to do with it. The linear intelligent model: Only idiots follow it so it's no wonder you've tried so zealously to back it up. Just what I'd expect from a mindless anonymous coward.

      --
      I am NOT a number! I am a - oh wait, I'm number 761710. Look! 761710!
    3. Re:YOU FUCKING RETARD!! by Zareste · · Score: 1

      Everything's simple when you're a mindless anonymous coward who couldn't identify his own hand before his face. Here we have an excellent example of the sort of neanderthals who try to reinforce the 'spirit r not exist' ideas mom and dad told them to believe. No logic, no proof, nothing to back their little fantasies but capital letters and the usual 'u r suxors and stoopid becuz I think spirits r not exist'

      People with small minds are always in over their heads when it comes to these matters. Leave your shack for once and go get a sense of reason.

      --
      I am NOT a number! I am a - oh wait, I'm number 761710. Look! 761710!
  58. 'We're Here' may be better than 'Where are you' by essreenim · · Score: 1

    I think we put too much emphasis on detection rather than transmission. Earth sends dribble out into space every day. Whay dont we start sending meaningfull signals out in all directions.

    I think there should be a collaborative effort to generated our own highly amplified lazer signals etc into space. If quantum mechanics can deliver, whats to stop us from using entangled pairs to deliver laser signals. If we incorporated one of each of these pairs to our emitted laser beam and fire it off into space, by the time it is detected, we may instantly be able to know what exactly has detected it. If you are confused when reading this, then look up the famous Einstein, Podolsky, Rosen experiments on Quantum weirdnes.....

  59. Re:Light takes 25 years from nearest star.. by myowntrueself · · Score: 1

    "Ignoring the real nearest star, Sol, the next nearest star is Proxima Centauri"

    How about the nearest *real* star, proxima is tiny, just a little pink puffball.

    (oh crap I hope this doesn't start an interstellar war).

    --
    In the free world the media isn't government run; the government is media run.
  60. Let the mice decide... by thrill12 · · Score: 1

    I guess when they thought up that gigantic computer called Earth, they surely put some kind of message in. It probably is a question like: "What is the question to the answer to the life, the universe and everything, the answer being 42 ?"
    Does CCAA CCAAAAGTCAGTTCCTCGCTATGTAACA fit the question, or do we just all carry a piece of Perl script with us ?

    --
    Slashdot: stuff for news, nerds that matter, matter for news, stuff that nerd
  61. A pretty good start really by Chuck+Chunder · · Score: 2, Insightful

    Detecting a simple content-free transmission would be a great start as you at least have somewhere to focus your investigation.
    After that it's probably just a matter of looking hard enough.

    --
    Boffoonery - downloadable Comedy Benefit for Bletchley Park
    1. Re:A pretty good start really by dheltzel · · Score: 1
      Detecting a simple content-free transmission

      If it's content-free, how would you know it was a message?
      I know modern journalism is content-free also, and we assume there is some sort of message there, but I don't think we can make the next leap just with that.

    2. Re:A pretty good start really by JDevers · · Score: 1

      You wouldn't know it was a message, but you would know it was most likely an artificial transmission. Like the parent said, this would allow us to focus on that region a lot more closely looking for real messages.

      Imagine if you and I are in a large dark room filled with other people and we want to locate each other. The best way to do that isn't to talk it is to be very loud for short stretches of time (shreak in other words), then when we get close to start talking. This is a massively flawed analogy, but shows how a non-message can convey information (in this instance, location).

    3. Re:A pretty good start really by dheltzel · · Score: 1
      but you would know it was most likely an artificial transmission

      I still don't understand how you could know this. If SETI has been searching with many computers for many years and hasn't found anything yet, if they do find something that looks artificial, how can they be certain it's not just random noise that happens to look artificial to the program (or the humans writing the program).

      I'm beginning to suspect the whole SETI thing is bogus, just an excuse to conjure up grant money and donations for cool computers. Not that thats so bad, I'm just mad I didn't think of it first.

      I won't comment much on your analogy, except to say that the shriek does carry content, in this case the message is "I'm human", that allows it to be filtered out of the background noise. If you started with the assumption that the subjects don't understand that the shrieks are human, then finding each other would be mostly just chance and the shrieking would become part of the background noise because the subjects couldn't read teh message, right?

    4. Re:A pretty good start really by dheltzel · · Score: 1
      Still, it seems like our sense of what is ordered (i.e. not random) might be different than that on another world. Perhaps where we see a pattern, the alien race might see randomness and vice versa. What if we are seeing a continual stream of intelligent broadcasts from a civilization that is trying to send a message, but that message appears to us as random noise. We would have even come up with scientific explanations about where it's coming from if it has been going on long enough. It seems like we are awfully close minded about how we are willing to believe other life might try to communicate with us.

      I'm not trying to disparage your remarks, that's more of a general observation about mankind.

  62. Comment removed by account_deleted · · Score: 2, Insightful

    Comment removed based on user account deletion

  63. Interesting... by thrill12 · · Score: 1

    but as a human has the ability to self-reflect, the answer is most likely "yes":
    We can and thus we are, per definition, allowed.

    --
    Slashdot: stuff for news, nerds that matter, matter for news, stuff that nerd
  64. Nope by noerej · · Score: 1

    Nope they should look for persons with pointy ears wich are keep repeating 'It's illogical...It's illogical...'

  65. Ever seen Casshern? by lingqi · · Score: 2, Interesting
    Erm, granted probably not (btw Casshern is a movie released recently in Japan. See here (bottom of page) for a PA rant on it.)

    That's almost exactly what the movie suggests: that we are a message and we can pass the same message onward. Won't say too much lest I ruin the movie for yall though, as much as I realize it has but a small chance of ever making it to the states. (wonders about the prospects of Cutie Honey in the same vein.)

    --

    My life in the land of the rising sun.

  66. Um by Rie+Beam · · Score: 1

    What if the aliens just don't give a damn, and aren't looking for life? Then what?

  67. What else? by S8ngsu3 · · Score: 1

    In 19th century, there were projects to contact the Martians by means of huge fires set up in deserts. After invention of radiocommunications, Earthlings are searchings for traces of similar radiocommunications from other civilizations. Now, when the communications are becoming optical, of course, it is "reasonable" to look for traces of optical communications. Of course "they" must be using it just because we are using it. I wonder, what SETI-like projects will try to detect several decades later? And centuries later?

  68. Life. Don't talk to me about life. by nimblebrain · · Score: 2, Insightful

    It's bizarre. The universe could be teeming with life, or it could be utterly, completely barren save for us, and both alternatives would look pretty much the same to us.

    Communication modes: Our communications are getting more focused, more noiselike (anyone remember what 300 bps sounded like compared to 56K compressed?), less tangible. Maybe the signal came 500 years ago. We couldn't have heard it. Couldn't have. At least the Professor on Gilligan's Island had a radio - coconuts wouldn't have worked. You can't hear radio without a radio (or finely-tuned braces). Who knows what the next physics breakthrough in modes of communication will be? Something quantum? Gravity-related? When it arrives, and if it's better, we'll switch over to it wholesale, and guaranteed we don't have receivers for it at present. Who knows what aliens would be sending their messages with?

    Lucky in the life lottery: Perhaps it's easy for life to take hold on a planet, but maybe we're lucky to have had relatively complex creatures survive the multiple catastrophes. Folks sometimes theorize that Jupiter has protected us from some major calamities just by being big and in a further orbit, acting as dustbuster. Maybe life was seeded here from elsewhere. Wouldn't even have to be an organism - just a decayed crappy chunk of RNA-esque material would do for initial seeding purposes, and it would only have to happen once - one intact chunk out of millions of rocks. It took a heck of a long time to evolve multicellular organisms - the number just boggles the mind. Perhaps it's just that hard to evolve anything past single-cell organisms.

    Planets: There seem to be a significant number of planets around. The program Celestia keeps a semi-current list of the detected planets and systems (so you can have fun visiting). Some of them, though, seem like there are gas giants way too big, or way too close to the sun, or are in a funny configuration. That's likely not conducive to life.

    Age of the universe: I'm guessing, according to an increasing number of observations of late (mostly from the Hubble), that the universe is a lot older than we've been theorizing over the past few decades. The older it is, the more likely extraterrestrial life becomes.

    The Ultimate Find: If we found someone, something out there, it would be the greatest discovery... well, practically ever. At least, "are we alone?" is something we've been asking for so long, and actually having a definitive answer would be amazing.

    I think the voyages to Mars and (soon) Titan will inspire a new generation. Gads, if we can be that surprised in our own solitary back-yard...

    I don't know if we'll find anything out there. I remain hopeful, but I certainly don't have "faith" in anything being out there.

    -- Ritchie

    --
    Binary geeks can count to 1,023 on their fingers :)
    1. Re:Life. Don't talk to me about life. by sharkdba · · Score: 1

      The Ultimate Find: If we found someone, something out there, it would be the greatest discovery... well, practically ever. At least, "are we alone?" is something we've been asking for so long, and actually having a definitive answer would be amazing.

      Agreed. The only problem is we really need to find something to have a definitive answer. Not finding doesn't prove there is nothing.

      --
      The purpose of life is to find the purpose of life.
  69. SETI by digitaltraveller · · Score: 1

    In case you missed it, Michael Crichton gave a great lecture about SETI and consensus science.

    1. Re:SETI by sparkchaser · · Score: 1

      I'm sure the same speech given by John Crichton would have been more interesting...

  70. The tree song by sICE · · Score: 1

    The DNA msg reminds me of this novel, worth a read... enjoy!

    Could someone explain me how, from a few ligth years distance, someone could point a laser straight on our receivers? I mean the odds of this being sucessful are very low, no?

    Btw, right now there's an "emitter" pointing a laser on a "receiver" in a tv-show here, this last one lost an arm and is dancing around like "AAAAAH!"... we perhaps might not want so much they point a laser at us?

  71. SETI was never going to work by SmallFurryCreature · · Score: 1
    It is a dream but humanity needs to dream.

    The entire question of alien life is wether it exists or not. This is pure speculation as proof one way or the other simply does not exist.

    Some people claim that life can only begin under very optimal circumstances pointing at the planet earth. Forgetting neatly that 1. this planet wasn't exactly like today when life started and 2. that even today life exists in places that can only be described as lethal.

    Others claim that life can originate pretty much anywhere and that there is no need for it to be based on the same principles as us. They got a tiny point in that on earth a tiny ecology has been found that doesn't rely on the sun for its energy but lives instead in a cycle relying on the earths own heat from its core. They got a huge gaping hole in that everything on earth seems to have the same origin, if life truly was easy we would have more then 1 ancestor to all life on earth. You would also expect to see some proof of life on other planets.

    The most annoying bit about alien life is that if it exists why haven't they found us? Surely any halfway curious species would have long since mapped the galaxy and if they are anything like us landed ships to sell beads and mirrors to the natives?

    Of course their may be a very depressing answer to explain the lack of contact. That there is no way to travel between the stars. That no-one is trying to contact us because everyone out there is just like us stuck in their solar system.

    I don't know wich is more depressing, that we are truly alone or that we are not but doomed to stay in our tiny little bubble of space.

    At least we can try can't we?

    --

    MMO Quests are like orgasms:

    You may solo them, I prefer them in a group.

    1. Re:SETI was never going to work by cranos · · Score: 1

      But there are ways to travel between the stars, whether it be through colony ships or some other means. Just because its going to take a while doesn't mean it is impossible.

      Also the lack of contact with alien life does not automatically lead to the conclusion that there is no alien life. There could be hundreds of civilisations out there with a tech level of maybe the industrial revolution or lower. It's thinking like this that lead our ancestors to believe that the earth was flat and if you sailed too far you fell off the edge of the world.

  72. On other news... by Project2501a · · Score: 1

    I was in Norway the other day and I was talking a look at a rather interesting shaped fjord, when i noticed something written on the fjord wall. It was in English and it was reading "Slutty Barfast". I thought it was rather peculiar and wanted to share my experience with the slashdot crowd...

    --
    ----
  73. We won't stop using RF by tfb · · Score: 3, Insightful

    The idea here seems to be that at some point we'll just decide to abandon the whole RF spectrum because we have better mechanisms of comminucating. This is implausible to the point of silliness. We *will* have better mechanisms, but the RF specrum is still there, and still as usable as it ever was, and if no one is using it, why, it will be very cheap. So people *will* use it, of course.

    Imagine, for instance, that UHF TV goes away, and non one wants the spectrum any more. Now you can build a local TV system for the cost of a transmitter (which you can get as cheap surplus). So lots of people will do that, so there will be lots of use of the UHF spectrum. It will just be by people doing more interesting thigns than it was before.

    1. Re:We won't stop using RF by CyBlue · · Score: 1

      ... Just like we haven't abandoned footed messengers, carrier pigeons and smoke signals. Everyone knows they'll never go away because they will always be cheaper than an RF setup.

    2. Re:We won't stop using RF by CyBlue · · Score: 2, Insightful

      ... adding to my last comment; A more recent example is distance communication by electricity over wires. 60 years ago who could have imagined that it would ever go away? Today we are moving away from copper telephone lines and TV to optical. We're even exploring optical pathways in next generations of computers. In 50 years, why would some kid want to communicate in voice/video over pair of wires when he can do full holographic display over a discarded trunk of fiber that's obsolete? Before saying that something will never go away, look back on history. Eventually technology will progress to the point that RF is substandard for any kind of communication purposes beyond Highschool science projects.

    3. Re:We won't stop using RF by faedle · · Score: 2, Insightful

      The exact point isn't that we won't use RF at all, but that we won't use RF high power brodcasting. It takes a lot of power for signals to leave our magnetosphere, and currently there is nothing stronger than a conventional UHF TV signal: it's broadband, and the AM video carrier often is a blistering million+ watts.

      The odds of a million watt AM carrier surviving a trip light-years across space is pretty good.

      Compare that to a signal from most personal communications devices, the likely long-lasting legacy from what will undoubtedly be referred to as the "radio era." FRS radios are tyipcally under a watt, and are a narrow FM signal.

      The odds of a 1 watt FM signal surviving a trip light-years across space is iffy.

      Compare that to a signal from a digital device like an 802.11 system or a digital communicator (cell phone, cordless phone, whatever). Make it a little more complicated.. give it an OFDM (or some other near-noise-floor FHSS system) modulation method, and a 200mW signal level.

      The odds of a 200mW spread spectrum signal surviving a trip light-years across space is nanoscopic, and that's given the assumption that you know where to look.

      I don't think the assertion that RF will go away entirely is the point. The point is, high power radio flatulence that can be easily seen across space and time will. Even today, the direction most RF engineering is going is lower power and better modulation methods.. partially because of regulatory requirements (OSHA's RF exposure guidelines alone has had an effect), but also because all that power costs money. If you can service the same number of viewers with 1/3rd the power, it saves a lot of money to the electric company.

      Not to mention, the amount of unintentional radiation has gone down somewhat as well. RF emissions from devices that don't use RF (like generators.. or even the alternator in your car) are a sign of inefficiency, so the are slowly being engineered out of existance.

      That dosen't mean we should probably stop looking: somebody who wants to be found will likely be intentionally broadcasting a beacon. But, it's a lot more plausable that such a beacon will be laser or even visible light than radio.

    4. Re:We won't stop using RF by jefp · · Score: 3, Insightful

      Yeah, it's silly. In fact our civilization will keep on radiating more and more RF until we have fully saturated the airwaves with encrypted spread-spectrum signals from trillions of separate low-power sources. To an outside observer this would basically look like thermal noise peaking at microwave frequencies.

      SETI@Home and other SETI searches skip right past sources like this, but guess what: ten years ago an astronomer named Walter Sullivan wrote up his observations of intense thermal microwave emissions from four nearby start that are otherwise similar to our sun. He attributed it to natural stellar masers, which do exist in other types of stars. I say he made the first observation of another civilization.

    5. Re:We won't stop using RF by jefp · · Score: 2, Informative

      Oops, sorry, the astronomer's name was not Walter Sullivan. That of course is the name of a science reporter - he wrote an article about the supposed maser observations. I forget the name of the actual astronomer.

    6. Re:We won't stop using RF by bulletman · · Score: 2, Insightful

      As we switch to broadbrand RF, equal power is being spread out over more MHz, so overall our signals look more and more like background noise.

      Stephen

    7. Re:We won't stop using RF by adamdeprince · · Score: 1

      Just like we haven't abandoned footed messengers, carrier pigeons and smoke signals. Everyone knows they'll never go away because they will always be cheaper than an RF setup.

      Footed messengers and carrier pigeons are specific implementations of physical delivery. The messengers now wear brown shirts and drive UPS, Fedex or DHL vans and the carrier pigeion has been replaced with 707's, but the basic communication medium has remained the same.

      It is only a slightly larger streach to equate smoke signals with light houses or sirens, and those are in common use today.

    8. Re:We won't stop using RF by CyBlue · · Score: 1

      Footed messengers and carrier pigeons are specific implementations of physical delivery.

      In the same way you could say that copper wire, fiber optics and RF are all specific implementations of digital delivery. Transporting a physical package by foot, horse, truck or plane are just as much evolutionary advances in transportation as the previously mentioned digital media are. The same basic method of 1's and 0's has remained.

    9. Re:We won't stop using RF by tfb · · Score: 1

      These aren't the same thing at all. It actually costs rather a lot of money to keep, say, a communications network based on horses going - you need horses, food for them, roads, staging posts (I used to live in a fairly small village 20-30 miles out of london which once had 30 or so pubs, since it was about a day's journey by horse out of London, so *lots* of people needed to stop there).

      It also costs money to broadcast RF, of course, but hugely less than it costs to run a horse-based system. But RF spectrum is *very* expensive at the moment - look at how much the 3G licenses which were auctioned in 2000 in the UK went for! If RF spectrum were free, how much would it actually cost to set up the transmitting part of a radio station? My guess is from a few hundred to perhaps some tens of thousands of dollars. I don't know about the US, but people in the UK run pirate radio stations from tall buildings which can be heard across most of London by pretty mundane equipment. These things don't cost much money to set up, clearly.

      So RF isn't going away on cost grounds.

      A much better argument is made by some of the other followups to my message - RF won't go away, but it will become increasingly indistinguishable from noise as we make better and better use of the spectrum in an information-theory sense. That would indicate (to me) that we ought to be doing some analysis of what a civilisation which uses RF efficiently would `sound' like to someone listening. If it really does end up as noise (and I can't see why it shouldn't) then there's a problem, I guess, although there's probably hope because it wouldn't look like the sort of noise that is generated by purely natural processes.

  74. Yes by Kjella · · Score: 2, Funny

    ...just don't shoot the messenger.

    Kjella

    --
    Live today, because you never know what tomorrow brings
    1. Re:Yes by spincycle1953 · · Score: 1

      "...just don't shoot the messenger."

      Oh, great. Now it's "Go ahead and shoot me, I'm the message."

      --
      My other machine is a lever.
  75. Pi Seti by kmeson · · Score: 1

    I think we should search the digits of pi for messages left to us by the Creators of the universe.

    Praise Sagan!

  76. Absolutely absurd! by darkstream · · Score: 2, Interesting
    My favorite quote:
    The beauty of this scheme is that ET wouldn't have to visit Earth to implant the message. A lot of junk DNA consists of genomic fragments inserted by viruses over the course of evolution. An alien civilisation could, for negligible cost, dispatch tiny packages across the galaxy, loaded with customised viral DNA. The cargo would be designed to infect, without harm, any DNA-based life it encountered.

    It's patently foolish to believe an intelligent species would try to write a message in the genes of a developing species remotely from another star in the blind hopes that the virus doesn't wipe out the entire population instead. It's just silly. And who's to say which species the super intelligent shades of blue wrote the message in? Perhaps they thought another species altogether was bound to become dominant on this planet instead of man.

    Wait! Could THIS be the real reason the dinosaurs went extinct! (^_-)

    --
    Fun with Inkwell | www.coo
  77. Becase by Jacer · · Score: 1

    ...Advanced alien races recklessly shoot lasers into space randomly.

    --
    --fetch daddy's blue fright wig, i must be handsome when i release my rage
  78. no radio, no laser by goobie123 · · Score: 1

    It seems clear to me that neither radio waves nor lasers would be used by aliens. These data-transmission methods are strangled by the speed of light. This would make the response time to their initial "hello" transmission MUCH more than the half-hour attention span typical of both humans and aliens alike.

    The key is to transmit/receive messages in "subspace". Messages in subspace can be heard across the galaxy instntaneously! (according to Star Trek at least)

  79. What are we really hoping for? by trenobus · · Score: 2, Insightful

    Suppose we picked up a signal from some ET and that there was no doubt, scientifically speaking, that it came from ETI. At least half the world doesn't believe in science, so if you're hoping that some of the more narrow-minded religions in the world are going to suddenly snap out of their narrow mindedness, I wouldn't count on it. Just look at the amount of scientific evidence they already manage to ignore or discount. Probably several new and conflicting religions would be founded by people claiming to have found some "divine" interpretation of the ET's message.

    Maybe you're hoping the ETs could tell us something that would advance our technology. Given how many of us subscribe to irrational world views, it seems to me that would be damned irresponsible of them. Sort of like throwing gasoline on a fire.

    My bet is the first communication detected from an ETI will be a question, something they want to know, or something they want to make sure we know before they say anything else. If our world was enlightened enough to support broadcasting to the stars, rather than just listening, I think we'd ask a question. Asking a question implies you've developed the patience to wait for a reply, which, for light-speed communication at least, is a lot of patience!

    1. Re:What are we really hoping for? by sharkdba · · Score: 3, Interesting

      ... light-speed communication at least, is a lot of patience!

      Unless the first ETs we encounter live in a different time dimension. What we consider couple of thousand years, might be a few minutes for them, who knows?

      --
      The purpose of life is to find the purpose of life.
  80. Two words: Warp engine... by Kjella · · Score: 1

    Traveling to the nearest star will take ages at sub-light speeds. Then there's all the costs, risks and lack of benefit in the foreseeable future. Mankind went to the moon 35 years ago. Where are we today? Even a simple interplanetary Mars mission is way off. Now try getting funding for an interstellar or intergalactic mission. The world isn't like Star Trek. We're not interested in spending trillions to send some few colonists to make a little pet colony on some remote rock.

    Kjella

    --
    Live today, because you never know what tomorrow brings
  81. Re:Light takes 25 years from nearest star.. by isorox · · Score: 1

    Erm, are you SURE about that?

    Yeah, there's roadworks, and with everyone going on holiday at this time of year, the average speed drops.

  82. Too much TV by zoeblade · · Score: 1

    In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?

    What, like in the Star Trek episode The Chase?

  83. Is there anyone else... by splatbang · · Score: 1


    ...like me that just thinks SETI is a waste of time and money? Anyone else who believes that there are no aliens?

    1. Re:Is there anyone else... by cranos · · Score: 2

      Prove it. Seriously, if you believe that Seti is a waste of money, prove that there are no aliens and hence no need for Seti.

      Seti is an experiment. A massive experiment that may prove to be fruitless, but if the big payoff does come about I think that the money will be well spent.

  84. Isn't this an episode of ST:TNG? by nahdude812 · · Score: 1

    In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?

    I recall a 2-parter of The Next Generation where they discovered an ancient alien message encoded in the DNA across dozens of worlds, which reprogrammed the tricorder to emit a holographic message of peace.

    So if Star Trek is to be believed, we won't discover this message for another 400 years, but we'll have to race the Klingon and Romulan empires for the discovery (psst, Captain Piccard, here's your chance for a head start!). At the end of the ordeal, everyone will share a few moments of sage unity before returning to their obtuse ways.

  85. Find omnidirectional source, send directional by CyBlue · · Score: 2, Interesting

    The purpose I see in SETI is to find a radio source, possibly unintentional. As another poster suggested, maybe we'll receive their version of the NORAD system or some high-intensity pulses from an intergalactic war. Whatever the signal we receive is, if we can associate it with probable intelligent life, then we could send them something they would be unlikely to miss. I wonder what an ultra-high-powered laser directed at their planet would appear like to them? Of course, this assumes that they can see in our visible spectrum. Perhaps it would appear as a dim star blinking in their sky, visible to some advanced observation system. Meanwhile, some random alien orbiting our planet would be sliced in half by our communication attempt.

  86. Marshall McLuhan Was Right! by grantdh · · Score: 1

    Are we the message?

    Wow - Marshall McLuhan was right - the medium is the message!

    It's been staring us in the face the whole time - every reproductive act is spreading the word(s).

    :)

    --

    I left my body to science, but I'm afraid they've turned it down...
  87. Radio Hanging around by cranos · · Score: 2, Insightful

    The concept that just because our use of radio is supposedly going to decline over the next 100 or so years any possible alien civilisation is already beyond radio, is pretty weak.

  88. Re:Light takes 25 years from nearest star.. by Ost99 · · Score: 1

    Thousands of years to travel 4 lightyears?
    I think not. From ca. 1975 and onward we've had the technology to cross that distance in a matter of decades (Orion, nuclearbomb powered propulsion).

    We lack the will to fund such a trip, and the stomake to accept the potensial loss of human life from nuclear fallout.

    - Ost

    --
    ---- Sig. gone.
  89. At least we know that the aliens are... by leonbrooks · · Score: 1

    ...sharks.

    --
    Got time? Spend some of it coding or testing
  90. Living proof of Aliens by DJ-Dodger · · Score: 2, Funny

    I think the duck-billed platypus is all the proof we need that aliens have messed with Earth.

  91. In radix 13, that works. by leonbrooks · · Score: 1

    In this case, fiction is stranger than truth.

    --
    Got time? Spend some of it coding or testing
  92. I said this weeks ago.... by funkdid · · Score: 1

    http://slashdot.org/comments.pl?sid=115490&cid=978 2852 My html no is good.

    --

    I boycott signatures

  93. SETI is not searching for Radio Communication! by Sophrosyne · · Score: 1

    They are looking for Radio Waves generated by the use of electricity (or something comparable). Just as everything electrical we create lets off some kind of electromagnetic force unless shielded the idea is so do the things an advanced alien civilization use. The purpose of SETI is to search for radio waves associated with the use of electrical objects not Radio shows by Aliens.

  94. Less radio being used on earth? Umm ..... by Viol8 · · Score: 1

    "More and more of Earth's communications use cable and satellites, with no radio-frequency leakage to space"

    What , you mean like GSM, 3G , Wi-Fi, Bluetooth etc etc. Ok , these are relatively low power but I think if anything MORE data is going over radio that ever before albeit perhaps the *percentage* of total data over air is going down.

  95. Why is this a surprise.... by CaptainPotato · · Score: 1
    ...when the Raelians have been saying something like this for years?

    Okay, sure, I hear you say, Rael is really a failed French racing driver called Claude Vorilhon, who had the Elohim (read: aliens) meet him on top of a Clermont Ferrand mountain in December 1973, who told him how they created humans through cloning...

    Great, just great, now SETI has been linked to the Raelians and Clonaid... That's a sure way to guarantee to be taken seriously *sigh*

    --
    I heard that your library burnt down and destroyed your only two books - and one was not even coloured in yet.
  96. to the moon alice! by Anonymous Coward · · Score: 1, Insightful

    I have a few points to make. Firstly, it is not unwise to scan for other forms of communication. However, by the time the laser reaches us, their ancient radio technology would have reached us first. That is depending on their stage of development relative to our own of course.

    Secondly, while it is true we have been moving away from radio signals by using more wired and directed technologies, we have since rekindled radio communications with the popularity of cell phones and wifi.

    Also, having said this, I'd like to thank all the unsecure routers for making the echoes of the internet available to our alien friends. Now, our filth, knowledge, politics, and confusion will be available for anyone who can decipher our layers of protocols. ;-D

    Lastly, I'd like to point out that we have no motivation to operate an expensive high powered resource eating laser for hundreds of years. Especially one pointed at random stardust with the hopes that someone will notice it millions of years from now. They're more likely to notice the past two hundred years of radio than we are likely to attempt to communicate via a laser. As a result, its safe the to assume the same about other civilizations out there, if there are any.

  97. Maybe our DNA is part of the answer to a question by tb()ne · · Score: 1

    Rather than having an encoded message, our DNA may be part of an attempt to solve a problem or answer a question. Genetic algorithms are currently used to solve complex problems by evolving random solutions in a way that mimics natural selection. While the problem solving technique is named for its similarity to the evolution of biological species, it's possible that the converse could also occur: a biological species is created for the purpose of carrying out an evolutionary problem solving task.

    Once we fully understand our DNA and have sufficient computing resources, we might be able to simulate our own evolution to answer the question without having to wait for the solution to evolve biologically. Considering the amount of time it takes to evolve biologically, I hope it turns out to be true that there's no such thing as a dumb question!

  98. "It all goes back to nothing..." by Malic · · Score: 1

    Hmmmm, "Are we the message?" Humanity is the messenger, Angels=Messengers, Humans are the 18th Angel - sounds like a Neon Genesis Evangelion reference to me...

    --
    I swear by MacOS X. Although I use to swear *at* MacOS 9...
  99. In our DNA, my ass by Oligonicella · · Score: 2, Insightful

    Yet another bogus attempt to inject some credence to that hoary ghost of ID. No, there is no "message" in our DNA other than the message of how to make and use cell parts.

    This is the last friggin' retreat the ID'ers can have. The last bastion of that stupid concept of "irreducible complexity". Couldn't have your way with the eye? Couldn't make the flagellum work for you? Now, trying to encode some decipherable message in the DNA? Yeesh.

    Been watching that Star Trek movie too many times.

    1. Re:In our DNA, my ass by sharkdba · · Score: 2, Insightful

      Yet another bogus attempt to inject some credence to that hoary ghost of ID. No, there is no "message" in our DNA other than the message of how to make and use cell parts.

      And what makes you so sure of this? I'm not suggesting there is a message coded in our DNA, but if there is a possibility, it should be explored. After all there are many parts of DNA which scientists have NO IDEA what they are for.

      Your type of flat denial is what held science back for many years throughout human development.

      --
      The purpose of life is to find the purpose of life.
  100. this reply is quite offtopic by Sepper · · Score: 1

    (wonders about the prospects of Cutie Honey in the same vein.)

    You mean like This movie?

    You just missed it :)

    --
    I live in Soviet Canuckistan you insensitive clod!
  101. Optical SETI technical issues by awhoward · · Score: 2, Informative
    There's a lot of technical speculation in these posts, and little in the way of calculation. For a sober analysis of the technical issues, check out the Harvard Optical SETI page (disclaimer: I'm a graduate student in that research group). Of particular interest are a recent paper describing the search methodology and 5 years worth of targeted observational data, and an older technical paper that calculated everything you need to verify that optical SETI is a reasonable idea.

    --Andrew Howard

  102. Bible Codes by Black+Parrot · · Score: 2, Funny


    > Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA.

    Let's see, we're looking for an unspecified message in an unknown language spelled out in an unknown coding... Yeah, I bet you can 'find' any kind of message you want in there, just like the silly Bible Codes thing. The only surprise is that k00ks haven't already been making their claims.

    --
    Sheesh, evil *and* a jerk. -- Jade
  103. Re:Quantum entanglement does not allow FTL comms by NorthDude · · Score: 1

    from the car's perspective, the light is moving away from it at C, but it's moving forward at .5C, so the light is only getting closer to the observer at .5C

    I always had problem figuring out this... I mean, it's logical and all, like if I would be throwing a ball instead of photon, but isn't the speed of light a constant? If it is, how come it would go at .5C from the observer point of view?

    I understand the maths, it is kind of ... simple (1 - 1/2 = 1/2 :-P) but it is the concept that light, if its speed is a constant, should always travel at the same speed that baffles me in this. Would care to explain it to me?

    --


    I'd rather be sailing...
  104. DNA? Maybe few billion years ago. by juhaz · · Score: 1

    Yeah, sure, cells are self-multiplying and self-repairing, the problem lies within that "capable of adapting" part, because it means they're also self-modifying over long timescales.

    Even if hypothetical aliens planted first primitive lifeforms on Earth three or four billion years ago, and included a message of some kind in them, you can bet your ass off that any remains of whatever was encoded in there has long, long, long, long ago been lost to random evolutionary processes.

  105. pathetic humans by east+coast · · Score: 3, Funny

    You bullheaded humans think you have it all down pat, don't you?

    The sad truth is that my planet found your planet from the leaked signal of an '802.11b' device owned by Dave Stewart in Provo, Utah as he was attempting to download a copy of Blue Oyster Cult's Don't Fear The Reaper song. But soon no other intelligence will be able to find your planet due to the decline in the P2P that was a beacon in the long dark night of space. You see, it's the legal dickering of the RIAA that is more a threat to your society than high powered lasers... so sad.

    --
    Dedicated Cthulhu Cultist since 4523 BC.
    1. Re:pathetic humans by bitrott · · Score: 1

      Are you saying that you aliens have a fevah, and the only cure is more cowbell?!

      Cause that would be funny.

    2. Re:pathetic humans by east+coast · · Score: 1

      Are you saying that you aliens have a fevah, and the only cure is more cowbell?!

      We must admit that we would have liked the song better if there was more cowbell.

      --
      Dedicated Cthulhu Cultist since 4523 BC.
  106. Re:Quantum entanglement does not allow FTL comms by AKAImBatman · · Score: 1

    Now from the car's perspective, the light is moving away from it at C, but it's moving forward at .5C, so the light is only getting closer to the observer at .5C.

    That's not right. Space-time should dilate for a travel at .5 C, thus causing him to see light travel at the velocity c. In fact, the guy in the car has no way of knowing if he's moving or if the other guy is moving toward him.

    To get your mental juices flowing, consider this: Is our star currently flying through space a near light speed? If it is, then we'd may need to decelerate to reach another star. But how does a space ship know if it's accelerating or decelerating? Maybe it really is accelerating toward the planet. Or maybe the ship is slowing down and allowing the planet to approach.

    According to relativity, both these perspectives are equally valid. The only thing that distinguishes them is the observer's point of view.

  107. Re:Philosophical issue by moonbender · · Score: 1

    Repeating Decimal on MathWorld. 1/2 = 0.5 = 0.49999... - I'm not sure what's philosophical about it, it's perhabs a bit counter-intuitive, but many things in Maths can be so, and as far as I know the equality is a proven fact and not really open for philosophical discussion...?

    --
    Switch back to Slashdot's D1 system.
  108. Maybe SETI should by silence535 · · Score: 1

    secretly crack PGP-keys.... oh, wait.

    --
    Dyslectics of the world, untie!
  109. Actually the message said this: by commodoresloat · · Score: 1, Funny

    Hi! How are you?

    I send you this file in order to have your advice.

    See you later. Thanks

  110. Cute calculation -- completely wrong. by awhoward · · Score: 1

    Obviously that's why OSETI experiments use photodetectors with nanosecond speed (eg. photomultiplier tubes). Nanosecond pulses are perfectly resolvable on these detectors. Check out a recent paper to see how this really works and for edification on other technical issues. --Andrew

    1. Re:Cute calculation -- completely wrong. by hankwang · · Score: 1
      It's good to see what the people behind this project have been thinking of - when stuff ends up in press releases it is sometimes inflated beyond recognition, which I was suspecting in this case.

      The essential numbers in the paper are: 1500 photons captured per pulse in a big telescope from 1000 light years distance, which is a factor 1e4 above the sun background within a 3 ns time window. According to the paper, the detector actually often registers such flashes due to various causes which are not likely to be extraterrestial civilizations.

      Now suppose that you find a flashing star. What kind of messages would a civilization encode in these flashes? The transfer rate is limited to a couple of bytes per second at most.

  111. I don't get it by nnnneedles · · Score: 1

    If someone would construct a laser signal that outshines the sun by x10,000, it probably must be to send a very intentional message. I don't really see any other benefits of such a huge communicational device.

    If the message is intentional, why couldn't they just use the more primitive and much cheaper radio?

    According to Drake, radio would be unfashionable in alien land, because their TV's no longer use it.

    Well, I suggest they could still use radio when they wanted to communicate <i>intentional</i> messages across outer space.

    --
    Will code a sig generator for food
  112. Re:Quantum entanglement does not allow FTL comms by slubberdegullion · · Score: 1
    It always does travel the same speed. From the observer's point of view, it is travelling toward him at C, in a very easy-to-understand manner.

    the car, on the other hand, is moving away from the observer at .5C. So if it saw the light as moving toward the observer at C, then the light would be moving away from the car at 1.5C - an impossibility. The car sees the light receding from it at C, which means that from the car's point of view the light is covering the original distance to the observer at a rate of only .5C.

    according to relativity, the car moving away from the observer is equivalent to the observer moving away from the car. So it might be easier to think of it as the observer moving away from the car. From his perspective, even though he's moving away from it, the light travels toward him at C. From the car's perspective, the observer is moving away from the light and hence the light, traveling at C, is only travelling at .5C relative to the observer.

  113. Re:Quantum entanglement does not allow FTL comms by slubberdegullion · · Score: 1

    The car does see the light travel at the velocity C relative to the car. However, because he and the observer are moving apart at .5C, the car sees the light move at only .5C relative to the observer.

  114. Zindell's Neverness & Requiem for Homo Sapiens by ynotds · · Score: 2, Interesting
    Yet another case of SciFi blazing the trail for (suspect) science. In War in Heaven (1998), the final book of the follow up trilogy to his still largely overlooked classic Neverness, David Zindell writes:
    "Because this secret is part of the Elder Eddas," Danlo said. "And the Eddas are believed to be encoded only in human DNA."
    In truth, no one knew what the Elder Eddas really were. Supposedly, some fifty thousand years ago on Old Earth, the mythical Ieldra had written all their godly wisdom into the human genome.

    Rather than humans being "Children of the Gods", Zindell has a few of us becoming "gods" and makes an almost convincing case that it would be an inescapable development in a universe with FTL travel.

    Paul Davies usually does a pretty good job of representing the perspective of mainstream physics, even adding a few details from his own work, but this time he really seems to have gone out on a limb. While it's a great idea for a SciFi plot, it isn't going to take too many more species' genome maps to make the null hypothesis look very safe.

    --
    -- Our systemic servants do not good masters make.
  115. you can't 'detect' entanglement changes by glyph42 · · Score: 2, Informative

    As soon as the alien measures anything about his photon to determine if it's still entangled, Boom! Entanglement is lost. Besides, you cannot determine whether it's entangled without knowing our results on Earth, which he would have to get using some kind of conventional communication signal, and then do some statistical analysis comparing our results to his.

    --
    Music speeds up when you yawn, but does not change pitch.
  116. No radio-frequency leakage? by Captain_Chaos · · Score: 3, Insightful

    More and more of Earth's communications use cable and satellites, with no radio-frequency leakage to space.

    Why would there be no radio-frequency leakage to space using satellites? Some of the signal sent down to earth probably bounces back to space. More importantly, most of the radiation beamed up to satellites goes right into space! There's no way those beams are so narrow that they only hit the satellite's receiving antenna...

    1. Re:No radio-frequency leakage? by faedle · · Score: 1

      No, but the uplink frequencies are often in the high UHF and microwave ranges that tend to not leave the magnetosphere of this planet, and would be likely non-detectable much past Mars.

  117. Re:Quantum entanglement does not allow FTL comms by maxwell+demon · · Score: 1
    I always had problem figuring out this... I mean, it's logical and all, like if I would be throwing a ball instead of photon, but isn't the speed of light a constant? If it is, how come it would go at .5C from the observer point of view?


    The light certainly goes at c from the outside-car observer's point of view. But the car itself goes at 0.5c from the same observer's point of view, so from this observer's point of view the distance between car and light grows only as 0.5c (assuming the light is moving into the same direction as the car, of course).

    But as seen from the car's point of view (or from the point of view of some observer driving the car), the speed of light also travels with c, while the car doesn't move at all (it's always just around himself). Therefore from his point of view, the distance between car and light grows with c.
    --
    The Tao of math: The numbers you can count are not the real numbers.
  118. who goes first? by zogger · · Score: 2, Interesting

    SETI is a neat concept and it's logical. That means any alien species would have figured it out as well, and would first be listening for signals directed to *them* before they actively pick a target to transmit to, no matter the technique. Picking a target at random to direct some sort of advanced transmission -> to is pretty expensive and silly, you would want to know that the civilization is advanced enough to understand and to reply to your transmission. Seems like it anyway. It's a catch 22, who goes first?

    It could be we have a host of semi advanced civilisations like ours, all sitting around in passive reception mode, waiting for someone to contact them.

    1. Re:who goes first? by shadowbearer · · Score: 1


      It could be we have a host of semi advanced civilisations like ours, all sitting around in passive reception mode, waiting for someone to contact them.

      Or hoping nobody figures out where they are ;-) I put the odds of hostile aliens vs. benevolent ones at 50/50. Of course, where else would I put it *grin*

      Cheers,
      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
    2. Re:who goes first? by zogger · · Score: 2, Interesting

      --and how much do our scientists care about actually communicating with... I dunno, pick some little critter at random, I'm in the south, we'll say possums. If joe scientist wanted to study possums, he would try to stay as hidden as possible and just watch/observe/ take notes, etc. Some alien species could feel the same way if they are even marginally more advanced than we are. We might just be dumb critters to them. They might be fully aware of us, but really not give a care other than watching, and use a totally different way to communicate than what we use, along the lines of the article suggestions.

      With that said, I think they already are here,as in *here*, to me the point is moot, and one of the main reasons I know the government is a big fat liar in public. In private,I have had too many guys who would be in a position to actually know what they are talking about, off the record of course, clue me in. If it was just one, I'd say "eh, no way, war stories like fish stories", but several now,quite startling really, and besides what I saw when I was a teenager. One of the main reasons I am so much an "honesty with government please" ranter. Not the only reason, but a main reason.

      Now I know I'll get ranked by the trolls, but oh well, it's real.

    3. Re:who goes first? by shadowbearer · · Score: 1

      Well, actually I was thinking about the other civilizations hunkering down and not wanting to communicate because they're paranoid :) Kinda like we'd be, if anyone cared enough about SETI to link the public gestalt with the science. Not sure whether it's better either way, lol!

      -and how much do our scientists care about actually communicating with... I dunno, pick some little critter at random, I'm in the south, we'll say possums. If joe scientist wanted to study possums, he would try to stay as hidden as possible and just watch/observe/ take notes, etc. Some alien species could feel the same way if they are even marginally more advanced than we are. We might just be dumb critters to them. They might be fully aware of us, but really not give a care other than watching, and use a totally different way to communicate than what we use, along the lines of the article suggestions.

      Which is another possibility(ies), but not what I was hinting at. I still think it's possible some "grad student" might break the rules, and that might explain some of the not-so-easily explainable sightings. But - to address your last bit - evidence, man, evidence. I've seen some weird things too, things I couldn't explain, but nothing that convinced me that it was ET. Having been an amateur astronomer for nearly 30 years, I know that one will see things one can't explain right away, and VERY occasionally not at all.

      I also know that one doesn't always know how to explain them in light of one's current knowledge, but later is another matter: one of the most convincing UFOs I saw as a teenager I saw later at an AF airshow; same strange objects and maneuvers that were all too familiar. It was a major D'oh moment :)

      (I WILL NOT discuss alien surgical procedures or abductions; because they are all too totally absurd and Occams Razor puts them in the paranoid homo sapiens genre :)

      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
    4. Re:who goes first? by zogger · · Score: 1

      the one myself and three friends saw wasn't really "far away" astronomy, it was two houses away floating over a roof. Scared and awed the snot out of us. I will never forget it. Literally had the sensation where all the hairs on your neck go up, only time that ever happened to me. I have yet to see anything we claim as a society to own or operate look or act like it did. I can't tell you what it was, but I know what it wasn't, namely all the normal explanations. It appeared as an often described thing, a rough glowing oval, approximately 30 or so feet wide, judging by it's size relative to the normal house roof, it was slightly smaller, about 1/4 that thick or a little more. It came down the block, hovered over this house for a minute,perhpas less than a minute, not very long, slowly went back down the block, then went up and *really* accelerated away, faster than any fighter jet I ever saw. It didn't poof out, just accelerated so fast it was gone in a second or so, but you could still see it briefly. No noise of note, not a sound, just a light similar to like when someone is welding, but not quite as bright, but bright enough. Right up there in the eerie category, but still awesome. Scared and at complete amazement and wonderment at the same time. Tell ya whut, it shut four teenagers up for quite awhile, we just stared at each other, then looked at the sky, then back to staring at each other. We didn't say much to each other until the next day really. There was nothing to say, one of those things you just experience. Best I can describe it, like getting stunned.

      All I got to say is, if we had stuff like that in the early 60's, I want my skycar now, heh.

  119. (OT) This is the first time I have ever seen... by CausticPuppy · · Score: 5, Funny

    ...a post consisting only of a single non-alphabetic character, getting modded to +5.

    Truly we live in amazing times.

    --
    -CausticPuppy "Of all the people I know, you're certainly one of them." -Somebody I don't know
  120. Uh... by jav1231 · · Score: 1

    If they would outshine the sun, we wouldn't need SETI to find them! :)

  121. Ugh by dcollins · · Score: 1

    Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA. In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?

    I'm suddenly reminded of the SNL sketch where Nick Lachey's eyeballs pop up out because he had to roll them too hard, too many times.

    --
    We know where leadership by an anti-intellectual "strongman" who scapegoats minorities and likes boisterous rallies goes
  122. Star Trek TNG Episode by gooru · · Score: 2, Insightful

    Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA. In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?

    This was a Star Trek: TNG episode. I distinctly remember Romulans, Klingons, the Federation (and perhaps a couple other species) all fighting over some secret weapon they had discovered in human DNA when it turned out to be a holographic image of a common ancestral species that had seeded the planets. It was probably the second season.

    1. Re:Star Trek TNG Episode by benzapp · · Score: 1

      It was probably the second season.

      It was actually the season finale of the the sixth season.

      --
      I don't read or respond to AC posts
    2. Re:Star Trek TNG Episode by guntherweber · · Score: 1

      It was a sixth season episode, but not the season finale.

    3. Re:Star Trek TNG Episode by benzapp · · Score: 1

      Ahh yes, my bad

      --
      I don't read or respond to AC posts
  123. If you're looking for a message from god/aliens by bernfast · · Score: 1

    ... why not look for it in quantum theory. If you're part of the universe quantum events are your primary source of randomness. Why shouldn't it be possible to tune quantum events to cause whatever effect you desire if you're not a part of this universe? The bible (and the qur'an, too) tell us that god is omniscient, omnipotent and omnipresent. According to physics that's impossible inside this universe anyway.

    Outside the universe on the other hand and with some spare dimensions it might even be possible to 'calculate ' future states of the chaotic system universe, or future states of a four dimensional cone around the desired area of effect and induce the required quantum randomness to make this happend the way you intend them to be.

    This is just my personal theory how to explain an omnipotent god together with a scientific view of the world.

  124. Re:Light takes 25 years from nearest star.. by cheekyboy · · Score: 1

    This is a message to Mr Kr98FtG5 of earth in 2098.

    When you read this in google archieves, please send back in time an email to me to pick the best stocks for me to be rich!!

    Thanks, all the best, oh and say hi to Jerry.

    --
    Liberty freedom are no1, not dicks in suits.
  125. Re:Quantum entanglement does not allow FTL comms by AKAImBatman · · Score: 1

    You're right. I'm sorry, I misread your post as "the car sees the light travel at 0.5c". Carry on. :-)

  126. If we are the message then ... by Thanatiel · · Score: 1

    It is most probably a Threat of War

    --
    Irrelevant news and morons using moderation to mod down what they disagree on. 2018 resolution: so long.
  127. Re:Quantum entanglement does not allow FTL comms by drinkypoo · · Score: 1

    There's no such thing as deceleration, it's just acceleration in another direction :P

    --
    "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
  128. SF Tachyons ? by hot420 · · Score: 1

    Now What about Tachyons ? (just finnished SF Book: Timescape) Altho I belive still theorical phisichs and undetected in nature They are supposed to be faster than light and possibaly able to travel backward in time. This would seem to be an ideal communication method over very long distances (D=rt) http://en.wikipedia.org/wiki/Tachyon

    1. Re:SF Tachyons ? by Jim+Starx · · Score: 1

      Generally the physics community is in agreement that Tachyons don't exist. We can't prove they don't exist, but their existance was postulated based on a mathematical peculiarity in the theory of relativity, and the effect of their existance would violate many of the core principles of physics.

      --
      The darkness... controls the music. The music... controls the soul.
    2. Re:SF Tachyons ? by essreenim · · Score: 1

      Yeah, interesting. How could you look for something if you don't know its possible properties though. Gravity waves have potential too in my opinion -if they even exist. As far as I know the latest interferometry experiment to look for them failed...

  129. Re:Quantum entanglement does not allow FTL comms by AKAImBatman · · Score: 1

    There's no such thing as deceleration, it's just acceleration in another direction :P

    Sure there is. Deceleration is acceleration to cancel out velocity relative to a different point of reference. :-)

  130. Independance Day, the movie by Firethorn · · Score: 1

    Well, my impression was that the guy is still crazy. On the other hand...

    He could have had some contact with the scouting party. Their mental powers could have done something. But why they'd leave him to potentially uncover them...

    The old 'Too wierd to be true' flipped on it's end.

    And Randy's character never claimed to have been sexually molested, others picking on him said that.

    --
    I don't read AC A human right
  131. Replicators by Perl-Pusher · · Score: 2, Interesting
    It turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?"

    If we were the message, it would have long ago mutated as to be undecipherable. The message was destroyed by SG-1 and the those gray aliens in last seasons Stargate. Seriously, DNA wouldn't be my choice, but a self replicating nanobot designed to reproduce with extreme fidelity would be more suitable for a message. Unfortunately, uncontrolled replication could have disastrous results.

  132. HHTtG by malfunct · · Score: 1

    Are we the message?

    Didn't Douglas Adams already answer that question?

    --

    "You can now flame me, I am full of love,"

  133. Re:Light takes 25 years from nearest star.. by ColdGrits · · Score: 1

    Uh, OK. Since you insist, the nearest real star is a few light-minutes away. So light from IT doesn't take 25 years either.

    Well, you did ask!

    If you are going to ignore Proxima Centauri, then there's Alpha Centauri which is also around 4 light-years away. STILL not 25 years away.

    --
    People should not be afraid of their governments - Governments should be afraid of their people.
  134. Dint RTFA, just picking on the title by NanoGator · · Score: 1

    "Should SETI Be Looking For Lasers Instead?"

    Additionally? Sure. Instead? No, jack ass. We haven't met any aliens yet. We should be looking for everything.

    --
    "Derp de derp."
  135. For the record by Durandal64 · · Score: 2, Informative

    Paul Davies is a creationist. Sorry, but I'm not going to take the advice of a guy who honestly thinks the universe is 6,500 years old.

    1. Re:For the record by Durandal64 · · Score: 1

      Oh give me a break. Are you seriously suggesting that there isn't anything in the world we can be reasonably certain of? Gee, I guess you'd better not drive your car today, because you don't know, for sure, whether or not it'll spontaneously explode.

      It's easy to spout this kind of anti-intellectual trash when it has no real implications on your daily life, but when you take this same kind of idiotic attitude and apply it to technology, suddenly we can't trust anything. The evolution of our understanding of how the universe works and the sometimes drastic changes that occur in that understanding mean that we should be open to new ideas, but that does not mean that everyone's dumb-ass pet theory about how things happen holds water. Scientists are interested in theories which fit the facts, and creationism doesn't fit any facts aside from, "Uh, here's the universe." It doesn't explain anything; it just asserts the existence of an entity which created the universe via unknown methods. Yeah, really scientific, there. You can't even demonstrate the existence of this entity, much less show that it's behind the universe's creation.

      Dumbass.

  136. Bright Light! Bright Light! by Ancil · · Score: 1

    ..high-powered lasers that could 'outshine the sun by a factor of 10,000'
    Also known as the "Illudian Q35 Explosive Space Modulator".

    Seriously though. I'm pretty sure that if any light sources appear in the sky with 10,000 times the luminence of the sun, they'll be noticed by scientist and non-scientist alike.

  137. The Mote In God's Eye by bracher · · Score: 1

    Anyone remember The Mote In God's Eye by Larry Niven and Jerry Pournelle? Not that the Moties _intended_ it as a signal, but it was a laser, and it was definitely noticed.

  138. Interesting.... by gillbates · · Score: 2, Interesting

    How would we know if there was a message in our genomes? Presumably ET would make it easy for us to spot. Some sort of in-your-face pattern would be best, something that stood out from the random scatter of genetic letters.

    I would posit that an ET intelligence smart enough to create a pattern in our DNA would also be smart enough to make the evidence of their existence readily apparent to even those without the ability to decode DNA. I mean, if the point of sending a message is to communicate, why would you require such sophisticated techniques to understand it, with the attendant risk of misinterpretation?

    Replace ET with God, and you've got a good paraphrase of the "intelligent design" argument for God's existence.

    I think what irks me the most is the assumption that aliens are trying to contact us. When we think about communication, there are some interesting principles:

    1. The sender of a message fulfills some need in sending the message. Perhaps it is a call for help; perhaps "they" need some more friends.
    2. A message is always sent with a reasonable expectation that the recipient will be able to understand it.
    3. The sender usually wants some sort of response from the recipient, even if it is merely an acknowledgement.
    This leaves us with some fundamental problems regarding ET's contacting us with "sophisticated" techniques:
    • An alien intelligence seeking to make contact with other civilizations would probably choose the most easily recognized form of communication, not one which required sophisticated technology or a considerable degree of intelligence to decode.
    • What purpose would such a message serve? If they are more advanced technologically, why would they contact us - we don't have anything that they need? If less so, then we would be able to decode their messages with ease.
    • If "they" are sending messages, then surely they must already know, or strongly suspect, our existence. If this is the case, then why don't they already know how to communicate with us?
    It would seem to me that if aliens were trying to contact us, we would have known it by know. I suspect that if SETI discovers any "intelligent signals", we'll come to discover that they were not intended for us to decode. Perhaps some alien military communications, or ARIA (Alien Recording Industry Association) encrypted music broadcasts, etc...

    Just a rhetorical exercise here: Would God qualify as the sender of such a message?

    • The fact that mankind is the only animal with free will and moral choice is an in-your-face pattern represented nowhere else in the known universe. Furthermore, this is easily recognized by the message recipient (mankind).
    • The desire for a loving relationship is the reason for communication.
    • Our existence is certain to the one who created us.

    With what we know now, only our Creator would possess the knowledge of our existence, the desire to communicate, and the means to do so. I wonder if this occurs to the SETI team, or if they are trying to find God in outer space...

    --
    The society for a thought-free internet welcomes you.
    1. Re:Interesting.... by maxwell+demon · · Score: 1
      An alien intelligence seeking to make contact with other civilizations would probably choose the most easily recognized form of communication, not one which required sophisticated technology or a considerable degree of intelligence to decode.

      Depends. If they are only interested to communicate with an sufficiently intelligent civilization (you know, talking with a stone-age guy about his newest stone-axe can get boring quite fast), they may choose a form which only those they are interested in can understand.

      What purpose would such a message serve? If they are more advanced technologically, why would they contact us - we don't have anything that they need? If less so, then we would be able to decode their messages with ease.

      What purpose did the plate serve which was sent with one of the Voyager space probes? If they are anything like us, they will from time to time send a message, despite them expecting no answer, and even a good chance that noone will hear it (probably if they expected someone to hear it, they'd rather avoid sending messages for security reasons).

      If "they" are sending messages, then surely they must already know, or strongly suspect, our existence. If this is the case, then why don't they already know how to communicate with us?

      They don't need to know that someone is around to hear them. They can send the message just in case.

      Simple example: If you are in trouble, would you shout "help" immediatly, or would you fist make sure that there's really someone around who can hear you?

      BTW, you are always assuming that the message was directed at us. What if we are not the intended receivers, but are just in the direction of send?

      Now, having said that, I don't really expect us to find an extraterrestrial message. But I don't think your arguments are valid.
      --
      The Tao of math: The numbers you can count are not the real numbers.
    2. Re:Interesting.... by gillbates · · Score: 1

      I think my point was more along the lines of this: if aliens are attempting to contact us, we would know by now. I don't believe it is a case of "we're too stupid to figure it out". They either aren't talking, or they're not talking to us....

      --
      The society for a thought-free internet welcomes you.
  139. And the messaage is... by claytongulick · · Score: 1

    42

    Now if we could only figure out what the question was...

    (obligatory Douglas Adams reference, I apologise)

    --
    Drinking habits can be dangerous. You can choke on the cloth and the nuns will wonder where their clothes are.
  140. Caveat: Matter dispersion in the universe by lysium · · Score: 2, Interesting
    then why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth?

    Maybe the universe isn't old enough. Seriously! Stuff like carbon, iron took multiple generations of stars (birth-to-supernova) to produce. Intelligent life that appeared approximately before the existence of Sol/Earth would have lived and died without the means to forge swords, much less spaceships. I believe our star is a fifth-generation, although my head is fuzzy on that number.

    Human beings may just be the first creatures who have the chance at interstellar civilization. Either that, or we are going to be part of the first wave, developing simultaneously.

    --
    Together, we will drive the rats from the tundra.
  141. Re:Philosophical issue by moonbender · · Score: 1

    For example the proof I showed depends upon the sceptic accepting that 8.999999... = 9 for it to work -

    If that was true, it would not be a proof in any meaningful sense - circular arguments don't prove anything. But I really don't see how this applies to the proof you gave.

    Actually, now that I thought about some more, I do, in a way. The key equality in question is: 0.999... x 10 = 9.999...
    For this to "work" you have to accept that the part after the decimal point of both numbers is equal, ie that the left side doesn't have one more 9 than the right side, as would be the case if there were only a finite number of nines and not an infinite amount. So in order for this proof to make sense you have to understand there is such a thing as an infinite amount of periodic numbers after the decimal point.

    So yeah. I still disagree, this is not a circular argument, and you don't have to accept 0.999... = 1 for the proof to work. (In fact, I didn't know about it and was quite astounded when I first stumbled on this on an Internet forum 4 or 5 years ago, but the proof made sense.) You do have to accept that 0.999... does mean that the series of nines never ends, and of course infinity is a hard concept to really understand. And it still feels weird to me that 1 and 0.999... are effectively just two different notations of absolutely the same number, just like 1/2 and 0.5 are.

    --
    Switch back to Slashdot's D1 system.
  142. Re:Quantum entanglement does not allow FTL comms by Jim+Starx · · Score: 1

    The key to understanding this is to realize that the two observers have a seperate concept of time. Rate = distance / time. So if the rate is always measured exactly the same, and the distance is the same for both observers, then the time interval that they measure has changed. Time slows down as your speed approaches that of light.

    --
    The darkness... controls the music. The music... controls the soul.
  143. Message in DNA == "Bible code" by Nimey · · Score: 1

    Please. Our DNA code could be interpreted as a code from an alien civilization, and you could get damn-near any meaning you wanted out of it, just like the n "decryptions" of the "Bible code".

    --
    Hail Eris, full of mischief...

    E pluribus sanguinem
  144. Apologies to Marshall McLuhan by dohboy · · Score: 1

    Are we the message?

    Are we the medium?

  145. Aaaachooo! Yes, I understand. by sasquatch+zeke · · Score: 1

    "I'm sorry boss, but SETI demands that I be alloted more than .7 days a month to potentially receive alien transmissions."

    Side note: Maybe AIDS was just an inter-office memo that got out of hand.

    Side note #2: Imagine a Beowulf cluster of sick people!...Um. Ok. Maybe not.

    S.Z., dodging pink lasers since 1972

  146. Resend!!! by Marcus+Erroneous · · Score: 1

    If we're the message, tell them to check their parity settings and
    send the message again as it appears to have been garbled the first time. ;)

    --
    You must be the change you wish to see in the world - Ghandi
  147. Are we the show? by evocate · · Score: 1

    Development and installation of carbon-based life forms: 8.698163E11
    Fleet of ships to clandestinely monitor their progress: 1.92323E14
    Watching the hilarity and hijinx as they try to figure out where they came from and "the meaning of it all": priceless

    (all figures in US dollars)

    Someday I get tired of this joke - but not today!

  148. No, no, no by Vinnie_333 · · Score: 3, Funny

    No no no! Aliens communicate through a series of large stone monoliths! Don't you guys pay attention?

    --

    "We shall party like the Greeks of old! You know the ones I mean." - HedonismBot
  149. Re:Quantum entanglement does not allow FTL comms by arevos · · Score: 3, Interesting

    Now from the car's perspective, the light is moving away from it at C, but it's moving forward at .5C, so the light is only getting closer to the observer at .5C. Hence it takes two minutes to reach the observer. At T+1 minute, the light has not reached the observer. So the guy in the car is surprised by the announcement that it has, and sends back an instant communique for confirmation.

    "Confirmation?" asks the observer, "I haven't sent you anything yet!" After all the light has not yet reached the observer, so how could he have sent the communication?


    You're assuming there's such a thing as absolute time, which Special Relatively disproved.

    So there is no such thing as T time. There is O(T) - Observer time. And R(T) - caR time. Let T0 be the time when the car flashes its headlights, and T1 be the time when the light from this flash reaches the observer.

    So the car flashes it's headlights at R(T0). The observer sees the flash at O(T1). The observer then immediately sends an instantaneous message to the car, which is recieved at R(T1).

    To both parties, at the time T1, the light ray from the headlights has reached the observer. The difference is that (R(T1) - R(T0)) > (O(T1) - O(T0)).

    Your thought experiment assumes that there is a "universal time". So that one minute for the car is the same as one minute for the observer. This is incorrect.

  150. Re:Philosophical issue by Phleg · · Score: 1

    Your proof assumes that n is finite. In the case of a repeating decimal, the repeating portion is infinite.

    In fact, your conclusion from n tending towards infinity is incorrect. In that case, the decimal quite clearly converges towards 1.0 as n approaches infinity.

    --
    No comment.
  151. Quasars by johndeerejedi · · Score: 1

    Could what we see as Quasars really be these high powered lasers? Last time I checked, there were a lot of theories about what Quasars are, but no real solutions. Maybe that would explain why they are so incredibly bright--focused light in our direction trying to tell us something.

    Also, anticipating it would take a while to get our attention, they don't shift the light from place to place, they have dedicated beams aiming here to ensure it's there when we are looking.

  152. Re:Philosophical issue by Phleg · · Score: 1

    In fact, I missed an even larger issue. Proving that 0.999... = 0.999... does not in any way imply a negation of a proof that 0.999... = 1.

    As a thought exercise, assume for a moment that I have proven the equality 1 = 2. Demonstrating a proof that 1 = 1 in no way negates my earlier construction, as we can combine the equalities: 1 = 1 = 2.

    --
    No comment.
  153. -5 Flamebait on interstellar slashdot by gd23ka · · Score: 2, Funny

    Or perhaps the only message we'll ever see from them would be a giant laser beam that instantly fries our planet, making everything in this discussion irrelevant.

    Maybe that's how you get modded down on an interstellar slashdot as -5 flamebait :-)

  154. Everyone knows... by drdestructo · · Score: 1

    ...the message encoded in our dna is the question of life, the universe and everything, to which the answer is 42. Or was that in the cave men who died off?

  155. And it looks like ET! by PotatoHead · · Score: 1

    Seriously, I think it't funny as hell, but can somebody explain the informative mod? Please?

    I just know I am missing out on something ...

    1. Re:And it looks like ET! by sharkdba · · Score: 1

      ...but can somebody explain the informative mod?

      Click on the parent link on the pound post. There's an inline question in there...

      --
      The purpose of life is to find the purpose of life.
  156. Are we the message? by jgawera · · Score: 1

    If we are the message, then who's it for?

  157. I get it :( by PotatoHead · · Score: 1

    Just read farther down and saw the whole unicode thing.

    (still, it does look like ET!)

  158. Are we the message? by Angst+Badger · · Score: 1

    Are we the message?

    What sort of message would that be? Monkeys are assholes, and monkeys with large brains are assholes with nuclear weapons?

    The "advanced civilization" that actually has to conduct that experiment would either be idiot-savants with a knack for genetic engineering or else rodeo clowns snatched from the future by alien overlords to act as viceroys over a slave class of biology graduate students.

    --
    Proud member of the Weirdo-American community.
  159. Looking? by hcetSJ · · Score: 1
    we should be looking for intentional signals in the form of high-powered lasers that could 'outshine the sun by a factor of 10,000'
    If we're about to be hit by a laser 10,000 times brighter than the sun, I'd be more worried about surviving it than noticing it.

    "Pass me that suntan lotion."
    "The SPF 30 or 45?"
    "Well, Slashdot said we might get hit by a giant laser..."
    "The 45, then."
    --

    This side up.
  160. Can gravity waves (theoretically) be polarized? by mattr · · Score: 1

    Someone mentioned something simple. It would be very elegant if something really simple like say, the MEMS mirrors on a TI light valve that drives an ordinary projector, could detect a SETI, if we'd only thought of it. As I understand it (please correct if wrong) the hydrogen band is one area of little noise and relatively good conductivity through space.. a natural wavelength to look at. I'm not saying gravity waves are the thing, or that they even exist, but if surveys of patterns in ambient energy are show certain characteristics, it would be interesting to see how simple and inexpensive a device can be made that would record patterns *not* falling into those trends.

    So it might be interesting to look for simple (geometric? time-bound? beautiful?) patterns in phenomena we have been seeing, or start recording physical phenomena with more sensitivity with the expectation of ever faster, internetworked, intelligent and quantum computing. For example what kind of a pattern would you get if you slewed a diffraction grating made of neutronium on an orbit that coasted through the troposphere of a sun? What kinds of patterns in radioactivity or infrared are common? Some things may require higher resolution surveys but some may be well within the realm of a species at our level, if say 0.1% of world GNP was put into it per year. And some modes of communication might even be within the realm of a single underfunded individual with a unique point of view.

    There may be an alien that rewards elegance and be sending funnily polarized or spinning vortices of electromagnetic current, there may be all kinds of ETs and a bunch of them may be mathematicians.

    On a side note, too bad we have to plunge through Saturn instead of gliding through its windy layers. No information-bearing processes in all that mass of chemicals and lightning? I don't think so. Why do you?

    My theory (and the rant that Slashdot/firefox lost last week) is that ET has little patience for whiners like the "no news yet, we must really be alone still!" crowd. I'd like to think there are lots of opportunities for communication, and civilizations at the beginning of space technology might be able to make up for such a handicap with creativity, empathy, intelligence, humor, and philosophy. ET likes origami and tricks of the light! He likes both classical and rock in moderation! He likes creative chefs, he likes hackers! (hope not on rye) It is conceivable that a cloud chamber like the one I built a long time ago for a science fair might be sufficient for someone with a microscope and a quantum computer, or possibly the data we need is already available for free online but we just need a very sweet, smart filter with a sense of beauty or maybe even humor. You could write that filter with free software.

  161. Re:Light takes 25 years from nearest star.. by rmerrill11 · · Score: 1
    Oh, come on now this is /. lets be accurate: It takes about 8.5 minutes for light to reach Earth from the nearest star.

    Think about it. for a refresher

  162. Thought experiments by mattr · · Score: 1

    Thought experiment 1: What experiment is missing on cassini?

    Te2: What is the cheapest, lowest tech experiment that has a nonzero chance at finding ET, that makes the most of the qualities suggested in the above post?

    Te3: Given current technology or that conceivable within 5 years if you worked hard at it, what method of seeking patterns in any natural phenomena would achieve the highest degree of parallelism and potential discernment of a pattern out of a high number of samples?

    I'm interested in your replies, even though my Dad says he doesn't want to meet a Bug. Even if I had that viewpoint I'd rather know they were coming.. and maybe the above thought experiments could help select the ones we want to meet. It just might be that this kind of an attitude could mean a lot to the Earth, sooner than later. We've already been broadcasting for 50 years, ET can sense even a 100 year thin bubble of radiation. Why not search DNA, or look for nanoscale structure in cosmic dust. Or maybe it is just a matter of a new way of looking at things we already see every day..

  163. Our DNA message has been decoded, it says by Bob+Bitchen · · Score: 1

    "Over 7 Billion Served!"

    'nuff said.

    --
    http://tinyurl.com/3t236
  164. Hmm.... by GreyOrange · · Score: 1

    Styrofoam seems to last several million years. Perhaps an alien had a coffee break and left one behind with a message of hope and peace....

    --

    Insert Witty Remark Here ===>____________________________
  165. This is not correct.... by malakai · · Score: 1

    It doesn't work this way. Your aliens can not detect a 'change' in the entangled particle. To determine the particle has changed, and what it's 'changed' into, requires bringing back the information (measurement) of the particle sent to earth to it's counterpart.

    EPR is fascinating and can certainly help us get around Heisenberg, which is usefull in 'teleporting' tricks (or simply in quantom computer terms, data transportation), but in all scenarios, a piece of information must be communicated to the destination via normal (relativity obeying) means.

  166. Star Trek: TNG Writere Knew... by G3ek · · Score: 1

    From article: "an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?" Remember that episode of ST:TNG where the Creators had encoded a message in DNA and then seeded life throughout the galaxy in the hopes that all the species would come together to solve the mystery? And then it backfired and they all (for the most part) were suspicious of each other and the lesson of the message was all but lost on the most of the handful of people that witnessed it. Just thought it was interesting. BTW, ST:TNG was the BEST!

  167. SETI shouldn't be looking for anything... by DesScorp · · Score: 1

    ...because there's nothing there. I used to believe in the possibility of ET life, but not anymore. I've come to realize how unique the Earth probably is. Conditions for life on a planet have to be just right, and while it's probable there are more earth-type planets out there, I don't think there's many with that perfect set of circumstances to support life. Paraphrasing Tom Skerrit's character in Contact, "Either there's nothing out there but dust and noble gasses, or they're so far away we'll never find them". I have to agree with that. I'm all for space exploration, but for man's direct benefit (harnessing of resources in space/other planets). Sorry, but older and wiser (and maybe more cynical) adulthood has dashed those old hopes of little green men. If you want aliens, you're going to have to get them in Star Trek reruns, because they're not "out there".

    --
    Life is hard, and the world is cruel
  168. Re:Crop circles are maser burn marks by Tiny+Elvis · · Score: 1

    wouldn't a MASER burn the crop, instead of making it look like a bunch of people with some boards and ropes flattened it?

  169. Actually, the aliens HAVE done this... by choovanski · · Score: 1

    Only problem?

    We're perfectly in line with the sphere's axis. :(

  170. SETI in our DNA? hmmmm.... by wturky · · Score: 1

    So, let me get this straight....we want to put SETI in our DNA? Does this mean we should turn everyone on the planet into a component in a massive, global computer? Maybe we need a way to include the whole earth? And while we're at it, maybe we can program this computer to come up with a really cool question whose answer would be "42" too???? Sounds like a pretty novel idea to me! ;)

  171. No, we should be using radar... by eclectic4 · · Score: 1

    They are here.

    If "over 400 government, military, and intelligence community witnesses testifying to their direct, personal, first hand experience with UFOs, ETs, ET technology" isn't good enough for you, then start hereto research our gov's own documents, and then go here and dismiss these reports with "swamp gas" or "venus" or "a flock of birds".

    This "we may contact other intelligent creatures someday" is a farce. They are here and have been for millenia. SETI is merely a lightning rod for distraction, nothing more.

    --

    "The greatest obstacle to discovery is not ignorance - it is the illusion of knowledge." - Daniel Boorstin
  172. I don't think do. by Dan9999 · · Score: 1

    The post says that we are not going to have radio communication in a certain amount of time, but what about the prolipheration of wi-fi and cell phones? If I'm not mistaken this ain't just a couple of bugs talking in tin cans with string working for us.
    Yes it's unfortunate, the radio pollution we cause and I do hope that we switch to laser everything but the current trend definitively does show more radio and not less like the blurb states.

  173. Message? by r2q2 · · Score: 1

    Yea I mean I can squirt out at least a kajillion bytes of data multiple times a day.

    --
    My UID is prime is yours?
  174. Trekkie fans rejoice! by JPamplin · · Score: 1

    Well, I guess that TNG Season 6-7 episode where all the races work together to figure out the DNA message was true after all. Too bad we haven't met up with the Klingons yet, since they have a critical piece of the message. Oh well. ;-)

  175. huh? by Rhinobird · · Score: 1

    You want to respond to the interstellar equivelant of "Marco!" with "ack"?

    WTF is wrong with you.

    We should send out a high energy response with the ever decipherable "POLO!" encoded...Then imediately move our entire civilisation to Barnard's star.

    --
    If Mr. Edison had thought smarter he wouldn't sweat as much. --Nikola Tesla
  176. SETI on Protien Unfolding by benow · · Score: 1

    There's a good chance that if we focus SETI on protien unfolding we'll find g0d.

  177. DNA = Evidence of God by privaria · · Score: 1
    Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA. In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?"

    OK, I know this is Slashdot and all, but so far I've seen no one consider the obvious possibility that the incredible entropy of DNA's 6-billion bit quaternary code might actually be an indication that there is some creative intelligence behind life after all.

    Years ago, I once asked a coworker who was an avowed atheist if he would be convinced that SETI had found a "hit" if it encountered an endlessly repeating quaternary code millions of symbols long. He replied, "Oh yeah!" and I pointed out that such a result was already in his own DNA. The length of time he took to stop and think about that was immensely satisfying.

    To me, the idea that man can think he created God and not vice versa is the epitome of arrogance.

    1. Re:DNA = Evidence of God by MikeTwo · · Score: 2, Interesting
      Your argument is fairly decent so long as you ignore 2 things:

      1. The "creative intelligence" you speak of could just as easily be the blind process of natural selection. Just add a couple DNA pairs every 50 million years or so and you've got more than enough time to come up with a 6 billion-bit quaternary code, more or less optimized for the present, with a nice long "history of our evolution" message attached to it. This process requires no supernatural forces.

      2. Depending on how you define God, it would seem exceedingly unfair for him/her to reveal themself through sub-microscopic code. There are millions of people living today who have no clue what DNA is, and BILLIONS of people who lived in ages past before DNA was even discovered. While the argument you post may hold true for some weird alien race or unthinking/uncaring God, it definately cannot be extended to any worshippable, caring, and fair Creator of sorts, having excluded the vast majority of humanity thus far with the choice of how to deliver the message.

      To me, the idea that any kind of supernatural forces are in a dramatic ballet with mankind is the epitome of aristocentrism.

    2. Re:DNA = Evidence of God by privaria · · Score: 1

      Thanks for a thoughtful reply from the other side.

      Regarding your first point, a little bit of crypto experience taught me something about the entropy of large numbers: Time scales linearly, but the entropy of numbers B^N (here B=4) most definitely does not, given N. A 64-bit symmetric key is almost trivial to crack with a cluster of today's CPUs. A 128-bit key is 2^64 times longer than a 64-bit one, not twice as long, and will be well out of reach for a long time. That's why the NSA tried so hard to squash PGP.

      Now, we're talking about the equivalent of 6 billion bits. I don't care how many billions of years you give for things to evolve, you can't get to 2^6,000,000,000. The complexity simply exceeds the abilities of our brains to grasp.

      Note that the assumption that things will just evolve on their own is a charitable one. If my '66 Wagoneer had done any evolving in the 40 years it's been around, it might get better gas mileage and put out less harmful emissions than it does. But only more newly designed vehicles have those features.

      Regarding your second point, perhaps the strongest concept of selflessness in humanity is that of laying down one's life for one's friend. Witness the outpouring of support for Pat Tillman, or the type of emotions stirred by the story of a mother who drowns saving her child, or the soldier who falls on a grenade to save his commander. Though I don't presume to be any judge of God's ways, what better way for the Creator to deliver a message about himself than to offer a part of him as a widely predicted and historically recorded sacrifice for his created humanity?

    3. Re:DNA = Evidence of God by privaria · · Score: 1

      I am using entropy in the information theory sense, not in the physics sense. They are different.

      P.S. If this doesn't make sense to you, please don't assume that terms have no widely accepted meanings other than the one you personally understand.

    4. Re:DNA = Evidence of God by privaria · · Score: 1

      Certainly. And thank you for the gracious reply!

      IMHO we're managing to have a decent little discussion here down in the basement of ./

    5. Re:DNA = Evidence of God by MikeTwo · · Score: 1
      Wow. There were a lot of links in that post! That took me a while to get through. Thank you for the wealth of information.

      Again, I must respectfully disagree. However, because this is somewhat offtopic, I will restrict my disagreement to only your first point (concerning evolution), and if you wish to pick up the discussion, we can do so via email. (Unless the /. community doesn't really mind)

      Ok. You said:

      Now, we're talking about the equivalent of 6 billion bits. I don't care how many billions of years you give for things to evolve, you can't get to 2^6,000,000,000. The complexity simply exceeds the abilities of our brains to grasp.

      Note that the assumption that things will just evolve on their own is a charitable one. If my '66 Wagoneer had done any evolving in the 40 years it's been around, it might get better gas mileage and put out less harmful emissions than it does. But only more newly designed vehicles have those features.

      I agree with you that an organism needs to be designed to their environment to be able to produce the 6 billion bits, but I think you misunderstand evolutionary theory, because that's exactly what it advocates. Evolution is design, not randomness, as it is commonly misunderstood. Mutations and/or adaptations introduce new variants, and the pressures of the environment naturally select (i.e., design) the animal most fit for survival.

      Let me give an example that shows how the mathmatics of cryptography do not apply to evolution. The analogy is admittedly oversimplified, so please don't take it beyond the point which I'm trying to make.

      Ok. Say you've got 20 quarters - they represent the genes of a certain animal we're going to speed-evolve. Heads are good genes, tails are bad genes. According to probability, if you were to flip all the coins at once, you would have B^N (2^20) different possible combinations (about a million). Likewise, your chances of getting all heads (a.k.a., a designed animal), would be (50%)^20, or 1 in a million. It would take a lot of flips to get that gene combination!

      However, that's not the way evolution works! Natural selection takes the "right" genes of a population and passes them on genetically to the next. If we wanted to "evolve" this quarter-gene-species, we would do the following:

      1. Flip them all at once (1st generation).

      2. Find all the heads, those genes are good and get passed on to the next generation, so they get moved aside (nautrally selected).

      3. Re-flip all the remaining coins (next generation), and go back to Step 2.

      You can easily see that it'll only take a few "generations" to get a completely designed gene structure!

      That is a simplified analogy to evolution, but it is easily extendable. If you had 6 billion 4-sided dice (A,C,F,G), and you could roll all of them, and then select and pass on the ones that were "right", it wouldn't take you very long to come up with a perfectly constructed 6-billion-bit gene sequence.

      Though I don't presume to be any judge of God's ways, what better way for the Creator to deliver a message about himself than to offer a part of him as a widely predicted and historically recorded sacrifice for his created humanity?

      As a quick nod to your second point, I believe a better way to reveal oneself would be to not have any contradictions, bad science, absurdities, and cruelty in the same document as the good stuff. And if we were truly designed from the s

  178. man-made elements in the sun by qwasty · · Score: 2, Interesting

    The best idea I've seen for getting the attention of ET's is to dump a few tons of elements into the sun that do not occur naturally, such as technetium. Basically, it's nuclear waste, and when an alien astronomer looks at our star, they'd see spectral lines of elements that could only be produced in a nuclear reactor...A sure sign of intelligent civilization.

    1. Re:man-made elements in the sun by AS400+Hacker · · Score: 1
      such as technetium


      Or Adamantium! *SHNICK*
    2. Re:man-made elements in the sun by gumbi+west · · Score: 1

      Do you know what concentrations would be necessary to make it pratical to see the line? I'm just curious as to if this would take about 1 quadrillion tons or if a modest amount would do. i'm betting the latter, but I could be wrong (since it is just the sun's 'atmosphere' that has to contain the stuff).

    3. Re:man-made elements in the sun by qwasty · · Score: 1

      I just did a google search for "technetium seti sun" and I saw a figure on the order of 10^5 tons of technetium to get ET's attention. That's a lot, but it could be done, especially if we make a habit of dumping nuclear waste into the sun. If we just dumped all of our nuclear waste into the sun, it wouldn't be as ideal as dumping pure technetium, but it would be obvious to anyone looking at our star that someone is dumping nuclear waste into it. I'm sure we could come up with quite a lot of it too, especially after we start using nuclear reactors in space. It's kind of ridiculous to try to lift that much off of the earth, but space based reactors could easily dump their waste into the sun. There's no need to dump into the sun, but if we really wanted to attract attention to ourselves, that would be an easy way to do it.

    4. Re:man-made elements in the sun by gumbi+west · · Score: 1

      okay, now how much is produced per megawatt?

  179. The Star Trek Model by bill_mcgonigle · · Score: 1

    then why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth? Think about it.

    If you're using Star Trek as your model, you should remember there are plenty of pre-warp civilizations that are under observation by the Federation but are not to be tampered with until they achieve Warp.

    The universe is big enough that any race that is smart enough and constructive enough to achieve off-world travel is probably not a hollywood mad-insane-bad-guy race that plunders just for jollies. The Earth's resources probably aren't that special when you consider the billions of other stars available in the galaxy.

    You make a good point though - if they exist and wanted to be here they would be here already.

    So, either they don't exist (odds are against it) or they're leaving us alone (the remaining hypothesis).

    Personally, I think they're waiting for us to speak up. When we get over our paranoid fear-of-monsters stage we'll say, "Hello," and they'll answer.

    Until then, we're probably not worth talking to. I run Seti@Home, just in case, but it's probably not worth the electricity until we start broadcasting.

    --
    My God, it's Full of Source!
    OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
  180. You mean, We're related to Klingons? by Uosdwis · · Score: 1

    Wasn't this already explored in ST:TNG? Don't we need to travel to a bunch of planets to figure this sequence out and need a tricorder to play the .mov?

  181. one day someone will finally believe me... by yulek · · Score: 1

    i've only been saying this for around a decade (proof of at least three years :/)

    --
    in this age of communication i'm just not getting through
  182. Junk, eh? by Fantastic+Lad · · Score: 1

    It's interesting that so many stories of this sort are bubbling to the surface in so many forms. The collective unconscious of the human race is on fire at the moment! --Just in big television and movie media alone, stories regarding genetics, mutations, secret government, our hidden past and the changes which are happening to not just us, but our whole planet. . , it's plentiful and it says something. --SG Atlantis, X-Files, Signs, Taken, X-Men, Spiderman, Day After Tomorrow, all those comet impact movies. Even our world leaders are shoring up resources and locking down controls in anticipation of. . , something.

    Crop circles made by guys with planks and rope? Sure. But anybody who really wants to know rather than look away from taboo ideas will quickly run into certain facts. (Rats. Facts, eh? Those things hurt.) Those who have looked into the circle phenomenon have discovered that many of them contain features which cannot be reproduced with planks and rope. --All the plants forming the circle bending only at the stalk nodules, (the first, second or third one down the stalk depending on the distance from the middle of the formation,) or in those circles created by the 'dark-side' to mislead, stalk nodules exhibiting microwave scar damage. --Among many other little items which so many people would really rather not look at too closely for what it all implies. . .

    Indeed, some believe that Alien life has already contacted us, (there are numerous modes through which this can happen, and none of them involve radio telescope dishes or Jodi Foster.)

    Some also believe that the 90% 'junk' DNA has started in the last few years to re-bundle, and that the finished product will be 12 strands rather than just two. --That as the DNA re-builds itself, humans will properly regain what they have had genetically engineered out of them over the last 300,000 years of alien tinkering.

    Some believe that reality is much more vast than we currently perceive, that time is an illusion, and that all of this is in the process of change. And that the changes started a few 'years' ago and will complete themselves within the next eight or so. That many of the strange new diseases and pains people are experiencing are actually the result of DNA re-activation. That 'psychic' phenomenon will only increase as the cycle continues to gather steam.

    And some also believe that certain, powerful elements of our society find the idea of the populace growing aware and breaking free of their bondage so appalling that great energies have been invested in keeping people unaware. --And that to do this, many different methods are employed, one of the primary ones being the psychological programming of people with that strong internal feeling of guilt/worry/distaste/squeamishness whenever taboo subjects arise in conversation. (Or on message boards.) --That in fact, many of our internal reactions are automatic psychological programs not of our own making but deliberately installed through many vectors during our childhood years; through television, (the strobe effect which acts as a hypnotic opener to the thousands of messages which it bombards the viewer/listener with), such as the instant desire to ridicule and assume a 'rational' swamp-gas explanation for all things 'unnatural' like Crop Circles and UFO's or ideas of our history not being as we have been taught. --Or upon failing that, the simple desire to look away and, 'never think about it again'. A very, very effective system! What better way to maintain control over a population than to create a strong emotional negative reaction to the very idea of exploring the lies which hold the people chained?

    --Deliberately litter the field with lots of genuine kooks, con-artists and gullible idiots, and you've just thrown a ton of reasons to rationalize away the scary possibility that something might really be happening. Interestingly, as the veils grow thinner and the DNA continues to re-bundle, and the instances of weird

  183. Message from Sith Lords by notany · · Score: 1

    In galaxy far, far away.... Death Star fires. You get the idea.

    --
    Dyslexics have more fnu.
  184. Imagine... by Sean+the+Impaler · · Score: 1

    ...a Beowulf cluster of humans!

    --
    Sig? No thanks, I'm trying to quit.
  185. SETI signals, microwave and optical, long discussi by CommonModeNoise · · Score: 1

    A long discussion of many of the points raised in this thread can be found here.

  186. Inverse cubed by theolein · · Score: 1

    I often aks myself a number of questions related to discovering civilisations via radio waves.

    Firstly, the strength of radio signals decreases proportionally to the inverse cube of the distance from the planet. That means that a signal is extremely weak over the many light years where another listening civilisation might be. Normal radio signals, even those shaped via a satellite dish, are not coherent, such as a laser is, and the spread should easily make that signal almost undeciferable over the cosmic background noise at multi-light year distances.

    Secondly, even if the signal is extremely strong and/or coherent, where exactly do you aim it? In oder to reach a possible civilisation, one would probably aim the signal within a star's habitable zone, but which star? Alpha Centauri? Sigma Draconis? And for how long?

    Thirdly, how do we know that a civilisation even uses radio signals. Granted, light signals are obvious in view of the natural light and radio of the sun, but what about a civilsation that discovers and uses charged particles as a communication medium before they use radio waves, or what about a signal technology in a civilisation that is far ahead of us and that we have no way of recognising.

  187. Lasers by hackus · · Score: 1

    are stupid.

    Anyone with half a brain who is in Astronomy and knows the issues realize Lasers won't cut the distances required for practical communication.

    I think the whole thing is quaint.

    If there is a big civilization out there....who can raverse the stars, they will know how to defeat the vast distances required for communication and travel.

    Simply because we have SETI people saying the distances are too big for space traveling ET's...then turn right around and tell us we should look for Lasers as a practical detection system must have recieved there PhD's from a crack jack box.

    -Hack

    --
    Got Geometrodynamics? Awe, too hard to figure out? Too bad.
  188. Amperfy or die! by MegaFur · · Score: 1

    Ah, amper, pound, semi, (£)
    I sing thy praises!

    Furry cows, furry cows all around,
    amper, pound, semi (£)! Amper, pound, semi (£).

    Leave us not forget other importants like
    amper, amper, semi (&)*,
    amper, lt, semi (<), and
    amper, gt, semi (>).

    Escape chars, you make this rockin' world go 'round!

    * (Interestingly, here on slashdot, you have to use a literal `&' to get an ampersand. How nuts is that!?)

    --
    Furry cows moo and decompress.
  189. math fur by MegaFur · · Score: 1

    We can't prove "1=1". It's an axiom. In general, in all math, we have it as an axiom that a given mathematical object is equal to itself. In an environment where it's not, math is probably all broke and we can't use it. (Although note that it's possible for a logical system to be only partly broken, and still be usable. An example is any computer program that's fairly stable but crashes on rare occasions or on certain invalid inputs.) Any proofs that show 1 = 2 are proving there's a contradiction *somewhere* but they *don't* show you where the contradiction *is*. If you want to decide that 1 = 2, that's fine, but I think you'll find it difficult to balance your checkbook that way. Do you work for Enron?

    Now let's prove 1 = 0.9999...

    Please note:
    1/3 is "1 divided by 3".
    "1 divided by 3", expressed as a decimal fraction is: 0.3333...

    Since 1/3 and 0.3333... are merely alternate representations of "1 divided by 3" we are justified in claiming that they're equal, thusly:

    1/3 = 0.3333...

    Now let us multiply both sides by 3. The lhs (left hand side) poses no real problem and we get
    3*(1/3) = 1
    without much fuss.

    The rhs is where you'll probably be crying fowl. I'm no great mathematician, but I'll do my best.

    Let's express 0.333... as an infinite summation. It would look like:
    0.3 + 0.03 + 0.003 + 0.0003 + ...

    The next part depends on how much math you have in your brain. If you've had enough experience, then you'll know the distributive property will work just fine here. In other words:

    3 * (0.3 + 0.03 + 0.003 + 0.0003 + ...)

    is, in fact, valid, and it really does equal

    0.9 + 0.09 + 0.009 + 0.0009 + ...

    which, of course, equals:

    0.9999...

    So, to summmarize, we've got

    3*(1/3) = 3*(0.3333...)
    1 = 0.9999...

    There's also some other, more Calculusish way to show the infinite sum (9/10^n) for n=1 to infinity converges to 1 but I can't even remotely remember what it is right now.

    --
    Furry cows moo and decompress.
  190. Michio Kaku by Master+of+Transhuman · · Score: 1

    has been saying for some time that SETI can't work because the signals will be blocked by interstellar debris and the technology used by another civilization would probably be so advanced as to be indetectible by our level of technology anyway.

    He compares us to an ant colony next to a superhighway built by humans. The ants are oblivious - unless we run over them.

    --
    Richard Steven Hack - This sig is TOO GODDAMN SHORT TO DO ANYTHING USEFUL WITH! MORONS!
  191. "are we the message" hrm... by Shadow+of+Eternity · · Score: 1

    Shadowe suddenly notices that when viewed from space, all of civilization spells out the words "T'ch-Klah was here"

    --
    A bullet may have your name on it but splash damage is addressed "To whom it may concern."
  192. message? by Quixadhal · · Score: 1
    In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?
    Yeah... it says U R 0wn3d & r00t3d, pathetic HUMAN!
  193. Unlikely by Mark+of+THE+CITY · · Score: 1

    Recollections of a former laser jock; YMMV...

    First, we have to be looking at the right point in space, at the right time, in the right narrow wavelength.

    Second, we have to pick the signal off from everything else. It won't be by the beamwidth because of divergence. It won't be by coherence because real lasers have something called 'coherence length,' at which point that quality is largely lost. This happens at well under inter-stellar distances! For the reason of distance and divergence, it won't be by amplitude.

    --
    The clearance system sounds logical. It is not. It is completely arbitrary. -- John Bolton
  194. Just a sign of how presumptuous we are! by minkwe · · Score: 1
    We assume that aliens will have similar body features like us (eyes, a head, hands etc) when we have organisms even on earth without those features. I begin to wonder if we will be able to recognize an alien if we met one.

    We assume that aliens will communicate in a similar fashion to us (radio freq., lasers etc) when we have organisms even on earth, whose language of communication we have no clue of. I begin to wonder if we'll be able to recognize an alien signal if we came across it.

    "In any field, the Establishment is not seeking the truth, because it is composed of those who, having found part of it yesterday, believe that they are in possession of all of it today. Progress requires the introduction, not just of new mathematics which is always tolerated by the Establishment; but new conceptual ideas which are necessarily different from those held by the Establishment (for, if the ideas of the Establishment were sufficient to lead to further progress, that progress would have been made)"
    -- E.T. Jaynes
    --
    "Fighting terrorists with millitary might is like killing a mosquitor on your Dad's forehead with a rifle."
  195. I remember that ST:TNG episode! by anakin513 · · Score: 1
    In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?
    Doesn't any one else remember this Star Trek TNG episode?
  196. Message? by Foo2rama · · Score: 1

    Are we the message?"

    If we are the message I think we are an away message...

    --


    ---In a time of Chimpanzees I was a Monkey.
  197. The answer is..... by Crazen · · Score: 1
    .....

    42

  198. Re:Maybe our DNA is part of the answer to a questi by tb()ne · · Score: 1

    I simply offer it as a possibility. I'm neither claiming that I believe it to be true, nor that if it were true, it could be proven.

    I agree that biological and algorithmic evolution are very different; however, I disagree with respect to goals. In biological evolution, even if the environment changes, the "goal" remains the same: reproduce. Changes in the environment may affect the fitness of particular population members, but the goal of reproducing to propagate the species remains the same.

    Also, genetic algorithms do not require static environments. It's just a matter of how you structure the algorithm. Try a google search with the terms "genetic algorithm" and "nonstationary environment".

    I'm in total agreement that simulating our molecular biology is a difficult task. Mapping particular alleles to physical characteristics and modeling how those characteristics determine our fitness in a dynamic environment is damn near impossible. Fortunately, the hyperintelligent gelatinous aliens that encoded our DNA are far more advanced than us.

  199. If it hasn't already been mentioned... by cr0sh · · Score: 2, Interesting
    Those interested in SETI should read the following:

    The Law of Accelerating Returns by Ray Kurzweil

    It offers a very well reasoned argument as to 1) why the technological singularity must occur, and 2) why SETI is likely a failure. Actually, I would suggest reading Vernor Vinge's writings on the singularity, then read Kurzweil's work above.

    One should then read the story (posted at k5?) called "The Metamorphisis of Prime Intellect".

    Finally, read Albert-Laszlo Barabasi's book "Linked" (network theory), Kevin Kelly's "Out of Control" and Steven Johnson's "Emergence" (emergence theory), and Stephen Wolfram's "A New Kind of Science" (The Principle of Computational Equivalence).

    There are many more references, both fictional and non-fictional (for entertainment purposes only, I also suggest the anime "Serial Experiments: Lain") - but these which I have listed detail a staggering breadth of information which, after you have digested it and left it to simmer in your mind, just might change your opinions and worldview in radical directions.

    Lastly - a plea for help: Does anybody here know of any papers or references from reputable sources which discuss why the singularity can't occur, or is wrong in some manner? I have only read one side of the debate, and I would like to hear the other.

    --
    Reason is the Path to God - Anon
  200. Re:Message from aliens in our DNA by __aaacoe2998 · · Score: 1

    And cancer is the message getting pissed off that we haven't received it yet. Kinda like call waiting. Maybe it's an urgent message?

  201. Are we the message? by qute · · Score: 1

    If we are, I'd like to read natalie portman's message. And she could read mine af well :-)

    --
    -- Make software not war
  202. For interesting discussion of SETI... by praedor · · Score: 1

    and for possible answers as to why we haven't yet picked up any signals, I suggest a read of David Brin's 1982 article called: The 'Great Silence': The Controversy Concerning Extraterrestrial Life (a web-based version is available at: http://skew.ot.com/three/random/silence.html.


    We have exchanged emails about its conclusions and I must say I haven't yet decided where I fall on my own...he suggests that the very fact that there has yet to be a single real signal detected is virtually immaterial. The REAL problem is the fact that we haven't found any evidence at all of alien colonization, directly or via robot proxies, within the solar system or on earth. No sign of unexplained discontinuity in the biological evolutionary history of earth suggesting a flushed alien toilet, no sign of mined asteroids, no sign whatsoever of any terraforming attempts on Mars or Venus.


    The basis for the entire problem of the "silence" as he posits it in his paper, is predicated on the belief that interstellar travel is possible whether by robot or via multigeneration starship, etc. To me, it isn't a matter of if being technically possible in THEORY, the real problem is one of practicality. The one hitch is that all it takes is ONE civilization somewhere in the galaxy to beat all the odds and develop space travel and, perhaps, self-replicating surrogates (robotic craft)...after that, barring anything simply making expansion truly impossible, after a total of 6 billion years, even at no greater than 0.1 c max speed, and this civilization (or its surrogates) would expand to fill the entire galaxy. So the question is...where are they?


    Ultimately, after much discussion of the Drake equation and its weaknesses, as well as discussion of all the various arguments as to why there are no aliens all around us in evidence, his argument zeros in on twoa few catastrophic scenarios: the first is based on self-replicating surrogates. All it takes is one paranoid civilization creating destructive robots (ala Gregory Benford stories) to trump all the rest. In such a case, alien civilizations are crushed/destroyed by some means before they can get very far by robotic berzerkers or some form, perhaps hurling asteroids at the fledgling civilization's planet(s). Another, somewhat related, and one I find likely due to my biology background, is that once you release ANY self-replicating system, be it nannite or macro robot probes, you lose control over them because NO replication system is 100% accurate (I say that again, NO replication system can be 100% accurate) so that once you release it on its own, it WILL evolve and you cannot control what this leads to. Perhaps destructive replicants.


    The main scenario he seems to argue for suggests a series of expansions and collapses of civilizations. A planet evolves a technical civilization, which then expands and colonizes neighboring systems in an expanding sphere once each colonized planet reaches the point where it can send out further colonists. Even being conservative on the timeframe for which this would likely take, it is doable in suprizingly short (relatively) period of time. In any case, all the planets and planetary systems have limited resources. Once a system has consumed them, that's it. It either has to expand outward or collapse. Those at the core of the expanding sphere are screwed and can only make due if they expand out into already colonized space...fights over dwindling resources. Various individuals have made calculations as to how long such an expansion and collapse might take, given a few reasonable assumptions, and all the estimates fall into the 60-70 million year range. Ultimately, Brin suggests that what we may be experiencing at the moment is a recovery from the last collapse. Once such an colonization sphere collapses, with the depleted ecologies it leaves behind, it takes a good long time before evolution can produce the next batch of technically competent animals capable of space travel, etc, which then starts the cycle anew.


    This gives short shrift to actually a very interesting (and entertaining) read. I encourage you all to take a look at the article. I am still mulling over his ideas and deciding what objections I have to the whole thing.

    --
    In Bushworld, they struggle to keep church and state separate in Iraq as they increasingly merge the two in America.
  203. The power of wishful thinking by StrawberryFrog · · Score: 1

    what you see is all there is. ... the vast majority of people at every stage of humanity's scientific progress believed this.

    On the contrary, I think that there is good evidence that most people throughout history, as well as most of the posters here, live in a form of hope that is grounded on thier wishes rather than any evidence.

    I think of people who:
    Pray to God to heal thier ills
    Perform sacrifices in the hope that it will bring them career advancement
    Boil horseshit while meditating, to try to turn lead into gold
    Claim that a wealth of experimental and theoretical evidence that matter never crosses space faster than light does, and in fact the whole idea is nonsensical and paradoxical, is just 'our current understanding of science' and will evaporate when some new theory contradicts it.

    --

    My Karma: ran over your Dogma
    StrawberryFrog

  204. Where Is Everybody? by 602 · · Score: 1

    There's a neat book called "Where Is Everybody?" by Stephen Webb; it discusses 50 reasons why we haven't heard from ETIs yet.

    "The aliens will contact us when they can make money by doing so." -- David Byrne

  205. Mod UP! (excellent analogy) by interactive_civilian · · Score: 1
    nine-times makes an excellent analogy here, IMHO. even if there are ETs out there, and even if we are trying to contact them and/or they are trying to contact us, it may just be like sending a message directed to a single person to billions of random addresses.

    Good post!

    --
    "Empathise with stupidity, and you're halfway to thinking like an idiot." - Iain M. Banks
  206. Screaming by Databass · · Score: 1


    I would be kind of fun to do a reverse-SETI project. Make a satellite or moon surface radio unit that just screams at the top of its lungs out into space. See what, if anything, we can attract in a few hundred years.

  207. DUDE! SWEET! by asscroft · · Score: 1

    what's mine say? DUDE!
    Sweet. Dude, what's mine say?
    Sweet!
    Dude!

    we are the message.

    --
    because I have been enjoined by this Holy Office to abandon the false opinion which maintains that the Sun is the centre
  208. basically an energy issue... by slew · · Score: 2, Informative

    Since radio waves and light are basically the same (electromagnetic waves), the problem is not that of possibility, but basically an energy issue...

    photon energy is proportional to frequency

    So for a given amount of energy you can get either more photons at a lower frequency or fewer photons at a higher frequency.

    Since visible light is in the THz range (10^12) and radio waves are in the say MHz range (10^6), that's a factor a million less photons emitted per unit of energy.

    Since we are essentially detecting a bunch of photons, this is the gist of the problem.

    Of course it follows that the odds of finding one of a million needles in trillions of haystacks is easier than finding 1 needle in a trillion haystacks...

    Of course if you are living on a pulsar, then energy (from gravitational collapse) is not a worry (pulsars tend to emit frequencies all over the spectrum from radio up to x-ray), but I don't think "intellegent" civilizations are going to be tossing around that much energy w/o thinking about it.

    Note that a signal from a pulsar is very different from an omnidirectional phase-coherent electromagnetic "pulse". A pulsar spews pretty much incoherent EM, but from hotspots on a fast spining object (think about a person with a gardenhose spinning around really fast, you'll see how a stationary observer will see "pulses" of water drenching her when in fact the garden hose is just spraying incoherent water).

    However, it is technically possible to generate a reasonably coherent, mostly omnidirectional EM pulse from a process known as superfluorescence.

    I suppose it's feasible that this would be able to be repeatable enough to generate a pulse train (imagine a spherical lasing cavity around a superfluoresenct object). For some basic info on this, check this out...

    http://ist-socrates.berkeley.edu/~lvov/OSF.html

    However, given the "energy" argument above, I doubt any intellegent aliens would have turned on a beacon like that (Did you see the movie independence day? Maybe turning on a beacon isn't such a great idea)...

  209. too much star trek by TheLittleJetson · · Score: 1

    an alien message designed to last millenia

    this guy sounds like he's watching too much sci-fi. any reasonably intelligent being knows we weren't created by anyone.

  210. Disappearing and reappearing Spectrum spikes by finnhh · · Score: 2, Insightful
    Cable isn't the biggest problem for the detection bubble of earth. Radio broadcasts will continue to be used in communications and there will be earth based transmissions for a long time. The biggest problem is modulation.

    The easiest artificial signal to differentiate from natural noise are signals with frequency spikes. FM and AM radio have good frequency spikes. VSB modulation which is used in television broadcasts has a decent spike. These are pretty easy to detect as manmade.

    These days the trend of RF technology is moving from spiked spectrum to spread spectrum modulations that looks more and more like noise.

    For example lets take TV from an alien perspective. There is a move from VSB picture and FM voice to spread spectrum transmissions. With FM and VSB the cells on same frequency must be pretty far away from each other not to interfere with each other. And to get a good picture the transmision must be high over the noise floor. The alien observer would see some strong spikes on his spectrum analyser moving along the frequency as earth turns (dobbler). Now with spread spectrum the signal is spread evenly over the spectrum so no spikes. And because spread spectrum signals don't interfere with each other so easily the cells on same frequency will be closer together. So the alien observer would see more transmitters sending evenly spread transmission over another and another and another,each with a slight changing frequency shift to each other because of dobbler. Impossible to differentiate from noise.

    So new technology is changing earth from spiked hedgehodge to fluffy ball, looking just like a natural noise source.

    In future the detection bubble may thicken because of microwave power transmission. If there will be solarpower spacefarms, there will be new spikes with enough oomph to an alien observer.

  211. SETI in our DNA by swordfishBob · · Score: 2, Funny

    well, we all know what's programmed in there.

    The answer is 42.

    --
    -- All your bass are below two Hz
  212. Old idea - Re:Star Trek TNG Episode by gojomo · · Score: 1
    The Star Trek:TNG episode was in 1993, called The Chase.

    This same idea was advanced by a short story called We'll Return, After This Message, by AutoDesk founder John Walker, written in 1989 and published in 1993.

    I also mentioned the same general idea in my 2002 OReillyNet weblog item, SETI not through telescopes but microscopes, about how rugged microscopic messages might be the only ones to survive millions of years.

  213. Why do you assume that they have advanced tech? by AngstAndGuitar · · Score: 1

    Why is the basic assumption that aliens have technology as or more advanced as our own?
    Maybe we should be the ones broadcasting (But I think we already are a bit...)

    My senario goes like this...

    1) WE eventualy go deap space travelling...

    2) WE find some lowtech aliens, who are hospitible and kind...

    3) AS USUAL we kill/subjugate them.

    --
    Less look fast, more go fast.
  214. I wrote some fiction about this 12 years ago... by wernst · · Score: 1
    Though these days I earn my keep writing for a pair of computer magazines, I did for a spell try my hand at fiction. I wrote a short story entitled "One Person's Junk" in 1992 that covers just this very subject.

    Some Googling turns up not only the original source (http://www.intertext.com/v2n4/junk.html) but many, many mirrors, much to my surprise. Here's one: http://www.maths.ex.ac.uk/~mwatkins/isoc/ernst.htm

    Anyway, should you feel like a little light reading, check these out.

  215. Re:Philosophical issue by ltbarcly · · Score: 1

    You are all making this too complicated.

    We want to show that .99999... = 1 .

    Well, let's assume that .9999... != 1 .

    Then 1 - .9999... != 0 .
    Let's say 1 - .9999... = X .

    What can we say about this number X?
    The real numbers are closed under subtraction, so we know that it is a real number.
    And |X| > 0, since if |X| = 0 then X = 0.
    Finally, for any number Y, |Y| > |X|, becuase if you pick any value for Y (!= 0), and consider enough decimal places for 1 - .9999... then |X| is smaller than |Y| . (EG. if we take Y = .001, then we can just look at (1 - .999999999) and see that it is much less than Y. It is apparent that you can do this for any number you pick)

    But all of this implies that X is greater than 0 but smaller than every other positive number. However the positive real numbers is an open set, and therefore has no smallest element. QED

    This is an example of Proof by Contradiction.

    Here is a more constructive proof.

    If .99999... 1 then there is some number N such that .9999... N 1 . However, for every N 1 you pick, I can use enough digits of .9999 to make N .9999... . Therefore .9999... = 1. Look up what it means for a set to be "dense" in another set on mathworld if you don't believe me.

    Finally, I'll restate this idea in plain english.

    If .99999... is some number besides 1, then there is a number between .99999... and 1. What number can you sqeeze in between .9999... and 1? Well, it should be obvious that you can't pick any number to fit, since for any number you can possibly pick, .999... is closer to 1. If two numbers are different then you can ALWAYS find a number between them, as long as the set is dense in itself. Some examples of sets dense in themselves are the real numbers and the rational numbers. Notice that the Natural (counting) numbers aren't dense in themselves, since there is no counting number between 2 and 3, for example.

  216. Re:This reminds me of a saying... PARIS HILTON! by cfuse · · Score: 1

    Aliens exist and have interstellar travel, but they have seen Paris Hilton's porno tape and they are not interested in contacting us.

    Aliens exist, but galactic law forbids any contact with us because we are too primitive, or violent (and Paris Hilton lives here).

    Some aliens see it as their duty to eliminate all other forms of life that come to their attention. Any technological civilization will develop radio and TV, attract their attention, and be eliminated. They are on their way now, to kill Paris Hilton.

    They are here already (Michael Jackson).

  217. Re:Philosophical issue by moonbender · · Score: 1

    These are nice and I had fun reading them, but to be honest I don't think they're less complicated than the original one some ancestor post mentioned. In fact, the original one was simple enough that I understood it with 9th grade maths, while yours I only understand because I've had (or am having) some maths in college. :)

    --
    Switch back to Slashdot's D1 system.
  218. Quantum entanglement by essreenim · · Score: 1

    Yes, I'll put my post here, why not. You probably won't read anyway.

    In true /. fashion, you all went off on a tangent to discuss causality paradoxes etc.

    You attempted to discredit the very concept of quantum communication by invoking your knowledge of relativity. Eianstein himself, if he were here, would be the first to admit that Relativity is not set in stone and that there are still many 'holes' that are unaccounted for.

    I think you have a bit of physics but no grasp of Quantun Entanglement. It has nothing to do with the type of causality you describe. If it even exists at all!, it is an unusual phenomenon. Have a look at the Math(s) of it. It is not classical mechanics thats for sure!.

    1. Re:Quantum entanglement by AKAImBatman · · Score: 1


      You attempted to discredit the very concept of quantum communication by invoking your knowledge of relativity. Eianstein himself, if he were here, would be the first to admit that Relativity is not set in stone and that there are still many 'holes' that are unaccounted for.


      What the hell? I did no such thing as you acuse me of. I merely attempted to correct a poster on a misunderstanding of relativity, and we got on a tangent about acceleration/deceleration.

      As for relativity, it has not been proven to be "wrong" about the universe. In fact, it holds up in every test we've put it through. As odd as it may sound, so has Quantum Mechanics. What *is* odd is that Quantum Mechanics appears to allow several methods for violating light speed (e.g. Quantum Tunneling), but none of them allow for information to be transferred faster than light (the core of relativity). Not even Quantum Entanglement allows for information to travel faster than light (see: http://en.wikipedia.org/wiki/Quantum_entanglement) .

      Now, if you'd please take your trolling elsewhere.

  219. alien response by spawnofbill · · Score: 1

    I can just picture it now, the alien response to a light source 10,000 times brighter than our own sun...

    "AAAH! Zee Glasses! Zay do NOTHING!!!!"

  220. We already know what the message is... by SoulSkorpion · · Score: 1

    "42", if I recall correctly...

  221. nighttime light by kipsate · · Score: 1

    A planet which harbours intelligent life may produce night time light. A large enough telescope may be able to see it.

    There are already plans for a telescope that can take a spectrum of extrasolar planets: TPF.
    Yes, I know, the article is old and probably no-one reads this comment anymore. Never mind.

    --
    My karma ran over your dogma
  222. Your wrong on both counts by DrMorpheus · · Score: 1
    I really doubt this will ever work. It would be a violation of relativity for signals to travel faster then light.

    Nope, Relativity only says objects with mass cannot be accelerated to C or beyond. Actually what it says is, "If a object with mass were to be traveling at the speed of light then we'd have a non-zero number being divided by zero. And we don't know what that means."

    Similarly with faster than light speeds, but in this case it would be a real number being divided by an imaginary number. And we don't know what that means.

    At the core of quantum mechanics is the simple fact that you cannot measure without disturbing.

    Again, nope. Try reading up on "quantum non-demolition measurement".

    --
    Debunking the "59 Deceits"
  223. You forgot an important one! by DrMorpheus · · Score: 1

    Everybody is listening and nobody's transmitting!

    --
    Debunking the "59 Deceits"
  224. Re:Quantum entanglement does not allow FTL comms by arevos · · Score: 1

    obviously makes no sense

    "Obviously" doesn't cut it in physics, I'm afraid.

    Look at it this way; in your thought experiment, replace your instant communication device for an ordinary laser.

    As in the original thought experiment, the car's headlight flash is detected by the observer, and he checks his watch: T+1 minutes. The car driver checks his watch and it's T+2 minutes by the time the flash arrives at the observer.

    Then the observer sends out a laser pulse in return (assume it is sent as soon as he sees the flash of the car's headlights). Now, the car is 2 light minutes from the observer, travelling at 0.5c, so to the observer it will take 4 minutes for the laser pulse to reach the car. The observer checks his watch when it does, and the time is T+5 minutes.

    But to the driver of the car, he might as well be stationary, and the observer moving away from him at 0.5c. Remember that to the driver, the observer received the headlight flash at T+2 minutes, and at that time the observer is 2 light minutes away. The observer's laser pulse in reply will take 2 minutes to cover that distance, so the driver receives the laser pulse at T+4 minutes.

    So to the observer, the time when the driver recieves the pulse is five minutes after the start of the experiment. Whilst to the driver, only four minutes have passed.

    You see? Time isn't absolute. Even if you don't use an instant communication device, you still have a differing in times. Time differencials don't discount the possibility of instantanious communication.