Should SETI Be Looking For Lasers Instead?
colonist writes "Frank Drake, creator of SETI's famous equation, says the detection of extraterrestrial radio signals won't work, because Earth's own radio signal will only be around for 100 years. More and more of Earth's communications use cable and satellites, with no radio-frequency leakage to space. Instead, we should be looking for intentional signals in the form of high-powered lasers that could 'outshine the sun by a factor of 10,000'. Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA. In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?"
Optical (ie: laser detection) SETI has been up and running for a while now (see Optical SETI overview for example). Drake ought to declare an interest though, since he's one of the investigators on the project.
It's a reasonable argument, but it's far harder to set up optical "listening" posts than radio ones. It cost me about 1000 uk pounds (WHY is the pound symbol banned from
The counter argument of course is that to detect laser light, the remote civilisation have to be pointing their laser at us, whereas with radio it doesn't matter since it's not a directed beam. Against that you have to offset the time-period over which transmissions of either kind could be made...
The chances of getting a radio contact may be a few orders of magnitude lower than getting an optical contact, but since the chances of me setting up an optical SETI station are precisely 0, the chances of getting 'the' signal with radio is infinitely greater than with optics, at least for me
Simon
Physicists get Hadrons!
The message only contained two words:
FIRST POST!
Are we the message?
I guess that's akin to leaving a flaming bag of poo on the doorstep.
Give yourself 5 points.
"We apologise for the inconveniance."
Is a message allowed to read itself?
Maybe we should consider the possibility that we are part of a device to perform some calculation to find the answer to a certain big question.
Then we hardly need a whole lot of computers to see them!
Somewhere I read that some flu viruses might be of alien form. Indeed, they seem to be the ideal organisms built for space travel. So why don't we search for alien messages in their DNA too?
Don't try to use the force. Do or do not, there is no try.
yup. And the message is 41,99999999 (ad finitum)
When will I end this grieving ? When will my future begin ?
We dump pretty enormous amounts of energy at RADAR wavelengths, 24/7, across the night sky. That'll stop approximately when we have no fear of hostile aircraft showing up at our borders.
You know, never.
--Dan
And exactly since when do satellite uplink transmissions stop at the satellite? The uplink is a radio wave, albeit a directed one. It might still be possible to pick up an alien uplink signal.
We're not just a message, we're a giant computer. 42!
Paul Davies reads Fark too.
Oh sure, yeah, right. DNA is the frickin' solution to everything, isn't it?
... sheesh.
Next thing you know, all those conspiracy nutters who say we are "Children of the Gods" will be being appointed to national agencies
Look, if someone knows something about space aliens, then OUT WITH IT!! Why the American people have put up with Area 51 for so long without any sort of culpability being required of their government, I do not know. Of the people and for the people, my ass.
Of the Grey Overlords, and For the Grey Overlords. Lets just call it a spade.
; -- the corruption of government starts with its secrets. a truly free people keep no secrets. --
That would be kind of dumb to put a message in living cells. We've been around not nearly as long as other things like "Rocks". Life as we know it is very fragile and in my opinion not a good message carrier.
Nuclear Powered lasers sounds pretty cool. To send out beacons my ass, they want a better missle defense system.
Mark
Considering we're struggling to even send unmanned spacecraft to Saturn, how can we succeed in making sense from random radio signals? Secondly, considering light takes 25 years to reach the Earth from the nearest star, how will the knowledge help us?
If you keep throwing chairs, one day you'll break windows....
Is EM not the most likely medium for wide-beam transmission? Lasers are completely ridiculous... it's a tight beam transmission taken to an extreme. We have no idea how other civilizations could be reaching out... perhaps they're using gravity waves, or perhaps they've discovered some sort of faster-than-light system of communications which they have been signaling other races with but we are too ignorant to perceive. In all likelyhood EM is the best way of reaching out to other civilizations, and while we may not be talking yet to any siginicant degree I can't argue with listening...
seti in dna article : bugmetnot is your friend
Yes, we are the intelligent design of an alien lifeform. Find out more information at http://www.rael.org/.
Albeit, there's a lot of non-coding DNA in Eukaryotic cells, but I wonder how many generations a random mutation would endure in that region unchanged. Those regions probably have a purpose re: the conformation of the DNA, among other things.
While using SETI on our genetic code might be helpful in identifying patterns and so forth, the notion that another creature would talk to us that way seems a little far fetched.
___
It's the end of my comment as I know it and I feel fine.
I for one welcome our DNA-speaking, laser-shooting overlords. :-D
YOU FAIL IT!
messages encode YOU!
Better than finding out that DNA in ascii gives you the Goatse guy... or a GNAA troll.
"When all you have is a hammer, everything starts to look like a nail"
Next thing you know, we will look for SETI in the burn pattern of a tortilla...or maybe in the reflection from a store window...
Is anyone getting my point here?
"For centuries, mankind has searched for evidence of God, in the skies, in the stars, in animals and in himself." Now do a search and replace s/God/aliens/ and ask if this is really any more a sensible statement. Not to mention, if we do find aliens, are we their peers, or are they our gods?
Final thought of the day...from what I can understand, our solar system is rather young compared to other galaxies out there. And apparently there are hundreds of planets capable of supporting life (our life, that's not even counting life that forms in some environment we consider hostile). Well if that's the case, and life/evolution is as easy as the theories make it sound (all it takes is heat and time)...then why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth? Think about it.
- JoeShmoe
.
-- I wonder which will go down in history as the bigger failure: the War on Drugs or the War on Filesharing
No user serviceable DNA inside, please consult your local Genesis Device reseller of warrantee issues.
(Hair Color Gene)
Blond Hair Outside! Can't Divide!
(Appendix Formation Gene)
-- Depreciated Code, ##GOD
(Eye Color Gene)
-- Unchecked Buffer but who cares? ##JOE
Aliens with frickin' laser beams on their heads?
Because that would rock.
Remember, it takes 42 muscles to frown and only 4 to pull the trigger of a sniper rifle.
In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?"
Nice idea. But, IMHO, it is not the 'Magic Encrypted Formula' hardcoded into whatever finally rendering the even more magical 42. What about the hypotheses that the system that the instances based on that DNA create is covering (for sure alternative, because supposedly on the level targeted there is no single 'true' one) messages?
CC.
TaijiQuan (Huang, 5 loosenings)
How is SETI science?
is in our mitochondria.
That is to fool the lameness filter. It counts the capitals or something like this.
All my years of hard work at Seti@home for nothing? Oh, well, back to Doom3, much better use of my spare cycles anyway.
I have always thought that there could be a different mode of life out there. That is, one that flourishes on a different kind of gas other than oxygen or any other gases we know here. It could even be the environment that is different. Yet I see NASA and the SETI people looking for a life similar to ours. This is obviously waste! Remember that according to Godly people, nothing is impossible by him. So this kind of life could be possible too. How can a [small] man like me suggest new strategies to these NASA/SETI guys?
In his Children of the Mind book, they find an alien civilization on a planet that communicated via DNA, and i thought that oidea was wonderfully original. For example, the aliens give their space craft a messege that resembles, very much so, a cocaine molucule. The crew had to work out whether they aliens were trying to say "hey, have some cocaine, join the party!", or whether they were drugging them and boarding the ship.
Sheesh - you'd figure that the SETI guy would have read Contact
so basiclly he is saying all the time, money and the processing power donated to seti at home project are for nothing?
This Sig is removed due to factual inaccuracy
Monk #1: "He speaks out of love for his friend. Perhaps that love in his heart is God."
Monk #2: "Oh, how convenient, a theory about God that doesn't require looking through a telescope. Get back to work!"
Here...
Bot Assisted Blogging
Where they didn't want to see us until we had warp engines. I'm no trekie but perhaps if the message exists it's in something that we can't do yet / don't even know about.
I think we would probably be able to program organisms from scratch by that point, so what kind of organisms would you send to establish life on a distant planet? It would probably start off small, or virus like, but would need to be preprogrammed to evolve into something more complex. Since the evolution would be random, you really couldn't determine the outcome after billions of years.
Then it occurred to me that if we were going to go through all this trouble for a slight chance that these packets of life might just thrive and grow some brains, we would probably put some kind message in there. Then it occurred to me that we could possibly be the product of such a plan.
It is possible that the structure of the genetic code itself is an artificial creation of an advanced race. Maybe we should examine the fossil record to look for patterns in the earliest life on the planet. Maybe humans got an evolutionary speed pass to intelligence. Who knows? At any rate understanding the underlying structure of genetic programming would be necessary for understanding the rational behind choosing one structure over another. Just like programmers develop an understanding of the language they program in, perhaps we'll see some calculated order to it all.
Therefore it is important that we, even in the future when we do not need radio, have gigant radio transmitters on moon or in orbit around the sun, that sends out an omnidirectional radio signal. This because other civilizations will probably pass through some kind of "radio" based state if they survive long enough, and then be able to know that there exist life on other planets (even if we are dead by the time the signal reaches them). It is important that we help other civilizations that might exist notice us - since it can do a great deal of positive things - like uniting their civilization, etc. It is also important that we, in this radio signal, transmit all our knowledge and information about our technologies - so that other worlds that is just about to enter "radio-age" can quickly benefit from our knowledge and even if we are dead - they can "start where we left".
If we would use this radio signaling "lighthouse", other civilizations might also do that. The big positive thing with omnidirectional radio contra a laser - is that the radio signal will reach every star eventually. To ensure that the radio transmissions continue as long as possible (billions of years, or more), it should be made as an self-serving "space robot" circling our sun.
We should invest some of our energy and resources to make it possible for other civilizations to learn from us!
We should look for waste heat in the infrared spectrum. Primarily because it is highly unlikely that ET's, who are more than likely thousands to millions of years more advanced than us, are using such primitive technology as radios and light signals to communicate with each other. More than likely they are using FTL methods which are by their very nature unknown to us at this point and time given our primitive technological methods.
I say faster than light because it is probable that there are many civilizations in this Galaxy and if we assume that, then it is also probable that these beings will use the most efficient means of communication available and that means FTL communication if it is possible, and there are indications that is, even without violating causality. So from our perspective the Galaxy will look "silent" but from theirs it'll look like Coruscant x100.
Therefore, if we take Dyson's advice and have an Infrared SETI program we may find countless civilizations via their waste heat or at the very least we will have a far more efficient means of locating them.
If one such laser beam would hit the earth, I don't think it would be a message like 'hi there, we are cute nice aliens from outher space and we are going to give you world peace!'. NO this alien death ray would mean something like 'Sheez, what a bunch of morons you puny earth dwellers are. Die die die!!1'. I would not bother building a giant listening post for that message. :/
You know it makes sense, a little reminder from jointm1k.
What would this message contain, and how would we confirm its validity? Let's see, maybe it would contain scientific truths about our world we could confirm. Perhaps stuff like the water cycle (evaporation, condensation, precipitation, etc.), the shape of our planet, how our world was formed, etc. Then the real message would be a simple one. It would have instructions on how to live for a better, more harmonious, society. For the purposes of contact, the message would of course mention that these extraterrestials are out there, and willing to open the doors of communcation with all those that contact them, and that they will directly aid in benefiting our species.
Oh wait... What was that Bible thing about again?
Except the message we get is "Please destroy slashdot.orh, it is destroSDFying the astro-productivity of our employIUZXCees" And we're left here wondering "slashdot.orh, wtf is that?"
I found the message! Encoded in my own DNA! It says you should each send $50 to:
PO Box 1922
Anchron, OH
30544
Swear to god. Obey the aliens.
Beware blue cats moving at
In ST:TNG, of course! This episode
I think we're really looking in all the wrong places. We're putting human assumptions on alien life.
We assume they would be using radio communication, or that they'd bother with a high-power laser. What if their communication is completely different. Like, something we haven't even considered to be a possibility yet, even in SciFi.. In a transmission media we don't even realize, we may be receiving communications from them, but we simply don't have the equipment to hear it.. We can't even decipher what any other creature on this planet is trying to communicate, why should we even be so egotistical to thing that not only would we know how to receive their communication, but have the vaugest idea of what they're saying.
I thought the idea of SETI was that we'd pick up an omni-directional broadcast, with some alien saying "here we are, can anyone hear me" A laser would be directional. It would have to be intended for Earth, and would need to be tracking many years ahead of where we are. We aren't broadcasting the same signal, why would they? There could be many planets near by with the same idea of listening, but if no one's talking, there's no communcation.
Maybe pulsars aren't just some celestial event, maybe they're beacons, and when we're ready to go to them, we'll find more information. But for now (and the next hundred+ years), we won't be going anywhere near them. Like, we haven't even managed to get a person to the next planet yet. There isn't enough "push" to develop to the next level. Imagine if every country spent their military budget on developing space travel. we'd alerady have a flag on Pluto, along with a bunch of empty beer cans from tourists.
But no, we waste our resources blowing each other up, or making sure we're on the virge of it every day. Remember the cold war? Ya, 40 years of "I'm going to kill you all", just for it to fall apart, and both sides realize that those people we were so scared of for so long aren't really that bad.
I grew up knowing the Soviet Union was the evil Red Army, who had so many weapons pointed at us because they hate us so much. Now, thanks to the fall of the Soviet Union, and the rise of the Internet, I now frequently talk to a Russian, and really, he's a nice guy. I've seen some beautiful pictures around where he lives, where not too long ago I would have believed was a frozen wasteland.
If only all of our governments would give up on this nonsense and cooperate in things, or better yet, ditch the whole "This is ours, you can't play with it" mentality, we'd make a lot more progress.
[rant mode off]
Serious? Seriousness is well above my pay grade.
the medium is the message.
The divergence of a laser beam is, assuming ideal optical components, mostly dependent on the diameter of the beam where it starts. You can take a big telescope and let the light pass through in the opposite direction, so let's say, a diameter of 4 meters. For visible light, that will generate a beam with a divergence of 1e-14 sr. So, to get to 2e29 W/sr, you need a laser with a power of no less than 2e15 watts. (Compare this to a mid-size electrical power plant at 1e9 watt...)
Yes, there exist lasers that can generate ultrashort pulses in the near-infrared, with such a high peak energy, say 100 femtoseconds (100 fs=1e-13 s) and 100 joules per pulse, so there you have our desired fluence.
Unfortunately, such lasers can only fire something like one shot per second. If you really want to appreciate the high peak power, you need a camera with a shutter time of 100 fs. Imagine looking at the sky with such an ultrafast camera. The chance that you actually manage to catch a flash from this laser is virtually zero, unless you have a way to know when the flash is going to come. Someone who is looking at a nearby star and expecting flashes is more likely to have an aperture time of 0,1 seconds or so in order to capture any photons at all. At 0,1 seconds aperture time, the laser is no longer 10,000 times more bright than the nearby star (that is, our sun), but rather 1e8 times weaker.
So, it is unlikely that this is going to word, assuming that someone is looking at us anyway.
Avantslash: low-bandwidth mobile slashdot.
A satellite signal has a footprint on the surface of the Earth, but some of that footprint may miss the Earth entirely, thus leaking signal into space.
Donte Alistair Anderson Roberts - hi son!
Karma: Chameleon
this genetic sequence is licensed under GLP...
Wow, what a great idea, we send them chocolate, they send us their passwords. Brilliant!
A house divided against itself cannot stand.
With the promise of quantum communication, it is conceivable that (if Quantum communication is indeed feasible) we should be focussing our optical light search on specific photons of light.
Anyone know about beam splitting entangled pairs etc. Many moons ago, Einstein, Podolski, and Rosen carried out there unusual experiment whereby the they observed what is now known as quantun weirdness. A photon in an entangled state could be split using a sophisticated 50:50 beam splitter. Each split photon could travel off in opposite directions and appear to be twins, in the sense that any change in behaviour of one would instantly (exactly synchronized regardless of distance!!!) be felt by the other, its twin.
Evidence that this was no fluke is gathering thanks to continuing experiments, yet it is still not in stone.
My reasoning is that if this phenomenan is genuine, it could be one way extraterrestrials would chose to contact us. Why not. They send a conventional optical signal, only this time encased in a surrounding cylindar of light, thus allowing for the entangled photons charateristic properties to be influenced only by this cylinder of light. Allot can till go wrong so conceivably, the 'ET's' would send a large stream of such light cylinders- the centre of which is a stream of entangled photons. That way any measurement of the entangled photon would cause an immediate change to its twin (The twin photon - of entangled pair)would presumably be archived on the alien world bouncing back and forth in a cavity (not unlike the cavities we use today - only presumably far more advanced.) So, once change is observed, an immeditae alarm bell is triggered. The ET's can know instantly someone/something has comeinto contact with their signal. Just like Earth SETI, the ET SETI would categorise all their findings and have mant false positives. They would probably already have chartered the area of space to which they send a signal. They may know the only objects (meteorites, stars, planets, commets...) that are likely influences over the transmitted light signal. Hence, if we Earthlings intercept the light in a very manufactured manner (i.e fire a encoded light signal of our own into theres, they are likely to get some unusual data back at there end - instantly.
Anyway, lets face you can't have an interest in SETI without being imaginative.
All Im tring to say is.
1) If I were a highly advanced ET, I would use Quantum entaglement (if it is indeed feasible) to transmit photons of light.
2)I believe we should start sending entangled photons of light, encased in our own manufactured cylinders of background light, out into space.
3)I hope SETI read this.
Maybe someone can enlighten me, because I never understood why SETI got much effort at all. Any random signal we could eavesdrop on seems like it would likely becoming from a planet like ours, transmitter on a surface that is moving around an axis that is moving around a sun that is moving around a galaxy. Radio waves might cut a fair (if increasingly faint) arc into the Universe under such conditions, but a laser? Wouldn't that make it a pressing assumption that aliens knew we were here? And I don't mean just "here here" but "there here": contact in a manner that accounted for our movements over the time scales it would take for a directed signal to reach the planet. I mean, pick any random star of billions in the night sky and assume a planet around it had intelligent life on it. Now where exactly would you point your beacon so that it actually hit that target? And why is it we think we're on the receiving end of such improbable attention?
Well, as a biologist, I always wondered why my peers called the non coding DNA "junk DNA". I think it's non sense. They believe that 98% is junk DNA, that it just cost energy to replicate? I better think of it as something we not yet understand. DNA has a highly repeating structure that can be fearly compared to a crystal. Exited, it shines, DNA emits photons. And it has been proven that some drugs higher the numbers of photons emitted.
Some indians from Amazonia used drugs to "understand" the way the world works. In their deliria, they saw two intimately linked ladder. Indeed, they were the first people to see DNA, hundreds of years ago. This vision is common. In Australia, arborigenous people have drawn DNA long ago.
Could this be one of the message that ET wants us to hear? Personnaly, I think that it's just a message from the nature, to remind us that we are still living things, in a small world...
Would it not be easier in that case for the government to dissolve the people and elect another? - Bertold Brecht
Are we the message?
m
m
That's exactly the idea from The Outer Limits : Double Helix, and sequel, The Origin Of Species.
http://theouterlimits.com/episodes/season3/307.ht
http://theouterlimits.com/episodes/season4/418.ht
If alien civilizations sent messages via live virii, presumably the spammers did so, too. So, we should be chock full of millions of alien messages like, "Buy V1agra!", "Hot Grits PRON", and "INTERGALLACTIC RING T0NEZ".
That should be easy enough to find -- just look for a sixty-something man getting pleasure from his cell phone.
Try with £ to display £...
To find more check here.
-- search the web
Let's see, you are comparing our solar system to other galaxies? You must realize that the scale of a solar system in relation to the scale of a galaxy is unbelieveably small, right? Ie., there are a (suitably big number) of solar systems in our galaxy alone.
Think of it this way, when you look at a picture of a galaxy, and you see the fuzzy white haze, that haze is (to quote Dr. Sagan) billions and billions of stars.
Now step back, and look at a Hubble Deep Field photo. What do you see? A (suitably large number) of galaxies each of which contains a (suitably large number) of stars/solar systems.
If you really consider the scale of the universe and the scale of time that the universe has been around, it seems pretty obvious that there is a lot of life out there.
The reason we don't have the Star Trek thing going on is that wonderful little thing called "c". That, and I guess they are all trying to learn English...
A house divided against itself cannot stand.
I saw this here.
Looked like a laser to me. (Or is it Star Wars?)
SCIREV.NET - fanfics,reviews & more
Gotta give Adams his due!
Now if we could just decode the ultimate QUESTION!
This mind intentionally left blank.
The KKK a bunch of sheetheads? You decide!
Yes, aliens are running cables for a long time. All we need is to send "subscribe 1 year" message.
839*929
Alient Information stored in cells?
It might sound far fetched at first, but when you look at some cell parts like Mitochondria it might be possible. (For those too lazy to click the link: Mitochondria are basically the powerplants of our cells, and posses their own DNA - which indicates that they might have been seperate entities at the beginning)
Another examples is as far as know Chlorophyll. So it could be possible to insert an DNS encoded message in cells.
+++ MELON MELON MELON +++ Out of Cheese Error +++ redo from start +++
if DNA is the message: good luck decoding it given that it mutated over a couple of billion years. Doubt you'd find anything useful.
as /. users rush to see who can excel the other at sophistry. The rules are simple.
Now, let the games begin!There are NO aliens, besides those from Mexico, anywhere near Area 51. How do I know, because if creatures are smart enough to travel outside of their light cone, they are smart enough to be able to watch our tv. This has two effects, 1) you can learn a lot about humans by watching tv, and I'm not just talking about Magnum PI, but how about the neurosurgery or opthomology grand rounds you can probably watch if you live near a university. 2) We've made it abundantly clear, that if you're an alien and you set foot on our world, we will try to kill you, we might be sad about it, have a moderately atractive woman in her thrities fuck you, or we might just pre-emptively break out the big firecrackers in the effort to change our entry to "mostly harmless."
It just so happens that part of maintaining a credible threat is to make it difficult for the ones enemies to precisely ascertain one's capabilities. This is why places like area 51 are necessary. That people watch Independance Day (OF ALL THE FUCKING STEAMING LOADS!) and think that "Hey, if Randy Quade plays a character who says he was ass-raped by aliens who are we to say it didn't happen..." is proof that a program of euthenasia tied to intelligence testing isn't entirely without merit. Why the hell you people can't satisfied with rubbing quartz on your chakras and keeping your retardation to yourselves I'll never understand.
And the moderators. What the hell. "Yeah, maybe there are aliens who traveled a million trillion miles to scare farmers shitless and turn cows inside out. Who's to say...?" GOD DAMMIT!
Man, this is way too deep for first thing in the A.M.! Better flip back to foxnews.
I think we put too much emphasis on detection rather than transmission. Earth sends dribble out into space every day. Whay dont we start sending meaningfull signals out in all directions.
I think there should be a collaborative effort to generated our own highly amplified lazer signals etc into space. If quantum mechanics can deliver, whats to stop us from using entangled pairs to deliver laser signals. If we incorporated one of each of these pairs to our emitted laser beam and fire it off into space, by the time it is detected, we may instantly be able to know what exactly has detected it. If you are confused when reading this, then look up the famous Einstein, Podolsky, Rosen experiments on Quantum weirdnes.....
I guess when they thought up that gigantic computer called Earth, they surely put some kind of message in. It probably is a question like: "What is the question to the answer to the life, the universe and everything, the answer being 42 ?"
Does CCAA CCAAAAGTCAGTTCCTCGCTATGTAACA fit the question, or do we just all carry a piece of Perl script with us ?
Slashdot: stuff for news, nerds that matter, matter for news, stuff that nerd
Detecting a simple content-free transmission would be a great start as you at least have somewhere to focus your investigation.
After that it's probably just a matter of looking hard enough.
Boffoonery - downloadable Comedy Benefit for Bletchley Park
Comment removed based on user account deletion
The entire message was
FIRST POST
- GOD
but as a human has the ability to self-reflect, the answer is most likely "yes":
We can and thus we are, per definition, allowed.
Slashdot: stuff for news, nerds that matter, matter for news, stuff that nerd
Nope they should look for persons with pointy ears wich are keep repeating 'It's illogical...It's illogical...'
That's almost exactly what the movie suggests: that we are a message and we can pass the same message onward. Won't say too much lest I ruin the movie for yall though, as much as I realize it has but a small chance of ever making it to the states. (wonders about the prospects of Cutie Honey in the same vein.)
My life in the land of the rising sun.
What if the aliens just don't give a damn, and aren't looking for life? Then what?
In 19th century, there were projects to contact the Martians by means of huge fires set up in deserts. After invention of radiocommunications, Earthlings are searchings for traces of similar radiocommunications from other civilizations. Now, when the communications are becoming optical, of course, it is "reasonable" to look for traces of optical communications. Of course "they" must be using it just because we are using it. I wonder, what SETI-like projects will try to detect several decades later? And centuries later?
It's bizarre. The universe could be teeming with life, or it could be utterly, completely barren save for us, and both alternatives would look pretty much the same to us.
Communication modes: Our communications are getting more focused, more noiselike (anyone remember what 300 bps sounded like compared to 56K compressed?), less tangible. Maybe the signal came 500 years ago. We couldn't have heard it. Couldn't have. At least the Professor on Gilligan's Island had a radio - coconuts wouldn't have worked. You can't hear radio without a radio (or finely-tuned braces). Who knows what the next physics breakthrough in modes of communication will be? Something quantum? Gravity-related? When it arrives, and if it's better, we'll switch over to it wholesale, and guaranteed we don't have receivers for it at present. Who knows what aliens would be sending their messages with?
Lucky in the life lottery: Perhaps it's easy for life to take hold on a planet, but maybe we're lucky to have had relatively complex creatures survive the multiple catastrophes. Folks sometimes theorize that Jupiter has protected us from some major calamities just by being big and in a further orbit, acting as dustbuster. Maybe life was seeded here from elsewhere. Wouldn't even have to be an organism - just a decayed crappy chunk of RNA-esque material would do for initial seeding purposes, and it would only have to happen once - one intact chunk out of millions of rocks. It took a heck of a long time to evolve multicellular organisms - the number just boggles the mind. Perhaps it's just that hard to evolve anything past single-cell organisms.
Planets: There seem to be a significant number of planets around. The program Celestia keeps a semi-current list of the detected planets and systems (so you can have fun visiting). Some of them, though, seem like there are gas giants way too big, or way too close to the sun, or are in a funny configuration. That's likely not conducive to life.
Age of the universe: I'm guessing, according to an increasing number of observations of late (mostly from the Hubble), that the universe is a lot older than we've been theorizing over the past few decades. The older it is, the more likely extraterrestrial life becomes.
The Ultimate Find: If we found someone, something out there, it would be the greatest discovery... well, practically ever. At least, "are we alone?" is something we've been asking for so long, and actually having a definitive answer would be amazing.
I think the voyages to Mars and (soon) Titan will inspire a new generation. Gads, if we can be that surprised in our own solitary back-yard...
I don't know if we'll find anything out there. I remain hopeful, but I certainly don't have "faith" in anything being out there.
-- Ritchie
Binary geeks can count to 1,023 on their fingers
Great, so we will waste our computer cycles on trying to find some combination of something in our DNA that happens to have the word "Alien" (or "beam me up" or something) in it, if you re-arrange and skip enough stuff and substitute enough letters.
Bollocks.
In case you missed it, Michael Crichton gave a great lecture about SETI and consensus science.
The DNA msg reminds me of this novel, worth a read... enjoy!
Could someone explain me how, from a few ligth years distance, someone could point a laser straight on our receivers? I mean the odds of this being sucessful are very low, no?
Btw, right now there's an "emitter" pointing a laser on a "receiver" in a tv-show here, this last one lost an arm and is dancing around like "AAAAAH!"... we perhaps might not want so much they point a laser at us?
-- search the web
The entire question of alien life is wether it exists or not. This is pure speculation as proof one way or the other simply does not exist.
Some people claim that life can only begin under very optimal circumstances pointing at the planet earth. Forgetting neatly that 1. this planet wasn't exactly like today when life started and 2. that even today life exists in places that can only be described as lethal.
Others claim that life can originate pretty much anywhere and that there is no need for it to be based on the same principles as us. They got a tiny point in that on earth a tiny ecology has been found that doesn't rely on the sun for its energy but lives instead in a cycle relying on the earths own heat from its core. They got a huge gaping hole in that everything on earth seems to have the same origin, if life truly was easy we would have more then 1 ancestor to all life on earth. You would also expect to see some proof of life on other planets.
The most annoying bit about alien life is that if it exists why haven't they found us? Surely any halfway curious species would have long since mapped the galaxy and if they are anything like us landed ships to sell beads and mirrors to the natives?
Of course their may be a very depressing answer to explain the lack of contact. That there is no way to travel between the stars. That no-one is trying to contact us because everyone out there is just like us stuck in their solar system.
I don't know wich is more depressing, that we are truly alone or that we are not but doomed to stay in our tiny little bubble of space.
At least we can try can't we?
MMO Quests are like orgasms:
You may solo them, I prefer them in a group.
I was in Norway the other day and I was talking a look at a rather interesting shaped fjord, when i noticed something written on the fjord wall. It was in English and it was reading "Slutty Barfast". I thought it was rather peculiar and wanted to share my experience with the slashdot crowd...
----
The idea here seems to be that at some point we'll just decide to abandon the whole RF spectrum because we have better mechanisms of comminucating. This is implausible to the point of silliness. We *will* have better mechanisms, but the RF specrum is still there, and still as usable as it ever was, and if no one is using it, why, it will be very cheap. So people *will* use it, of course.
Imagine, for instance, that UHF TV goes away, and non one wants the spectrum any more. Now you can build a local TV system for the cost of a transmitter (which you can get as cheap surplus). So lots of people will do that, so there will be lots of use of the UHF spectrum. It will just be by people doing more interesting thigns than it was before.
0, no, that was to their corepirate nazi captors. they just went ahead & tried to STEAL the .com (froogles) from the disabled guy. no 'shares' for him.
it's either yuk, phewww, either, or both. lookout bullow. the daze of the felonious payper liesense stock markup FraUD softwar gangster execrable is WANing into (searchable) coolapps at the speed of right.
as for robbIE's fauxking PostBlock censorship devise, it also, remains infactdead.
consult with/trust in yOUR creators.... where seti will eventually 'look'. see you there?
...just don't shoot the messenger.
Kjella
Live today, because you never know what tomorrow brings
I think we should search the digits of pi for messages left to us by the Creators of the universe.
Praise Sagan!
The beauty of this scheme is that ET wouldn't have to visit Earth to implant the message. A lot of junk DNA consists of genomic fragments inserted by viruses over the course of evolution. An alien civilisation could, for negligible cost, dispatch tiny packages across the galaxy, loaded with customised viral DNA. The cargo would be designed to infect, without harm, any DNA-based life it encountered.
It's patently foolish to believe an intelligent species would try to write a message in the genes of a developing species remotely from another star in the blind hopes that the virus doesn't wipe out the entire population instead. It's just silly. And who's to say which species the super intelligent shades of blue wrote the message in? Perhaps they thought another species altogether was bound to become dominant on this planet instead of man.
Wait! Could THIS be the real reason the dinosaurs went extinct! (^_-)
Fun with Inkwell | www.coo
...Advanced alien races recklessly shoot lasers into space randomly.
--fetch daddy's blue fright wig, i must be handsome when i release my rage
"All your base are belong to us"
Are you sure this isn't an X-Files script?
Come the revolution, the Bourgeois, Capitalistic, "A PARKING STICKER HOLDERS", will be first against the wall!
It seems clear to me that neither radio waves nor lasers would be used by aliens. These data-transmission methods are strangled by the speed of light. This would make the response time to their initial "hello" transmission MUCH more than the half-hour attention span typical of both humans and aliens alike.
The key is to transmit/receive messages in "subspace". Messages in subspace can be heard across the galaxy instntaneously! (according to Star Trek at least)
Suppose we picked up a signal from some ET and that there was no doubt, scientifically speaking, that it came from ETI. At least half the world doesn't believe in science, so if you're hoping that some of the more narrow-minded religions in the world are going to suddenly snap out of their narrow mindedness, I wouldn't count on it. Just look at the amount of scientific evidence they already manage to ignore or discount. Probably several new and conflicting religions would be founded by people claiming to have found some "divine" interpretation of the ET's message.
Maybe you're hoping the ETs could tell us something that would advance our technology. Given how many of us subscribe to irrational world views, it seems to me that would be damned irresponsible of them. Sort of like throwing gasoline on a fire.
My bet is the first communication detected from an ETI will be a question, something they want to know, or something they want to make sure we know before they say anything else. If our world was enlightened enough to support broadcasting to the stars, rather than just listening, I think we'd ask a question. Asking a question implies you've developed the patience to wait for a reply, which, for light-speed communication at least, is a lot of patience!
Traveling to the nearest star will take ages at sub-light speeds. Then there's all the costs, risks and lack of benefit in the foreseeable future. Mankind went to the moon 35 years ago. Where are we today? Even a simple interplanetary Mars mission is way off. Now try getting funding for an interstellar or intergalactic mission. The world isn't like Star Trek. We're not interested in spending trillions to send some few colonists to make a little pet colony on some remote rock.
Kjella
Live today, because you never know what tomorrow brings
In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?
What, like in the Star Trek episode The Chase?
...like me that just thinks SETI is a waste of time and money? Anyone else who believes that there are no aliens?
We'll Return, after this Message by John Walker of Fourmilab (and Speak Freely and Autocad) did a very computer-geek compatible story on the suggestion in the Slashdot blurb. It'd be worth a read if you weren't already spoiled on the ending...
In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?
I recall a 2-parter of The Next Generation where they discovered an ancient alien message encoded in the DNA across dozens of worlds, which reprogrammed the tricorder to emit a holographic message of peace.
So if Star Trek is to be believed, we won't discover this message for another 400 years, but we'll have to race the Klingon and Romulan empires for the discovery (psst, Captain Piccard, here's your chance for a head start!). At the end of the ordeal, everyone will share a few moments of sage unity before returning to their obtuse ways.
Slay a dragon... over lunch!
probably grimacing in pity/disgust as they do what they must.
The purpose I see in SETI is to find a radio source, possibly unintentional. As another poster suggested, maybe we'll receive their version of the NORAD system or some high-intensity pulses from an intergalactic war. Whatever the signal we receive is, if we can associate it with probable intelligent life, then we could send them something they would be unlikely to miss. I wonder what an ultra-high-powered laser directed at their planet would appear like to them? Of course, this assumes that they can see in our visible spectrum. Perhaps it would appear as a dim star blinking in their sky, visible to some advanced observation system. Meanwhile, some random alien orbiting our planet would be sliced in half by our communication attempt.
Play the DNA backwards and discover the hidden message!
Surely, of it is proven that our DNA is designed by someone else, it should be more that sufficient prior art to ban all and any patents based on human DNA?
Are we the message?
:)
Wow - Marshall McLuhan was right - the medium is the message!
It's been staring us in the face the whole time - every reproductive act is spreading the word(s).
I left my body to science, but I'm afraid they've turned it down...
This was a Star Trek: The Next Generation episode? It was pretty good until it got kind of lame at the end....
Please consider modding the parent up. Thank you.
as opposed to all those real things that don't exist like bigfoot or an honest politician.
The concept that just because our use of radio is supposedly going to decline over the next 100 or so years any possible alien civilisation is already beyond radio, is pretty weak.
...sharks.
Got time? Spend some of it coding or testing
I think the duck-billed platypus is all the proof we need that aliens have messed with Earth.
That would explain Michael Jackson.
In this case, fiction is stranger than truth.
Got time? Spend some of it coding or testing
http://slashdot.org/comments.pl?sid=115490&cid=978 2852
My html no is good.
I boycott signatures
They are looking for Radio Waves generated by the use of electricity (or something comparable). Just as everything electrical we create lets off some kind of electromagnetic force unless shielded the idea is so do the things an advanced alien civilization use. The purpose of SETI is to search for radio waves associated with the use of electrical objects not Radio shows by Aliens.
set it up like this. The car is 1 light minute from an observer. It's travelling away from the observer at .5C. It flashes its rear lights.
from the observer's point of view, it will see the headlights flash 1 minute later. It communicates this instantly to the car, so the car finds out about this at T+1 minute.
Now from the car's perspective, the light is moving away from it at C, but it's moving forward at .5C, so the light is only getting closer to the observer at .5C. Hence it takes two minutes to reach the observer. At T+1 minute, the light has not reached the observer. So the guy in the car is surprised by the announcement that it has, and sends back an instant communique for confirmation.
"Confirmation?" asks the observer, "I haven't sent you anything yet!" After all the light has not yet reached the observer, so how could he have sent the communication?
This is the theoretical problem with instant communication. It breaks the principle of causality. This principle has never been observed to have been broken, and is basic to our understanding of the universe.
This is why it is unlikely that an instantaneous communication device will ever be invented. Quantum entanglement has been shown not to allow such a device - the entanglement does not transmit any information.
"More and more of Earth's communications use cable and satellites, with no radio-frequency leakage to space"
What , you mean like GSM, 3G , Wi-Fi, Bluetooth etc etc. Ok , these are relatively low power but I think if anything MORE data is going over radio that ever before albeit perhaps the *percentage* of total data over air is going down.
What a way to store old backups.
Okay, sure, I hear you say, Rael is really a failed French racing driver called Claude Vorilhon, who had the Elohim (read: aliens) meet him on top of a Clermont Ferrand mountain in December 1973, who told him how they created humans through cloning...
Great, just great, now SETI has been linked to the Raelians and Clonaid... That's a sure way to guarantee to be taken seriously *sigh*
I heard that your library burnt down and destroyed your only two books - and one was not even coloured in yet.
I have a few points to make. Firstly, it is not unwise to scan for other forms of communication. However, by the time the laser reaches us, their ancient radio technology would have reached us first. That is depending on their stage of development relative to our own of course.
;-D
Secondly, while it is true we have been moving away from radio signals by using more wired and directed technologies, we have since rekindled radio communications with the popularity of cell phones and wifi.
Also, having said this, I'd like to thank all the unsecure routers for making the echoes of the internet available to our alien friends. Now, our filth, knowledge, politics, and confusion will be available for anyone who can decipher our layers of protocols.
Lastly, I'd like to point out that we have no motivation to operate an expensive high powered resource eating laser for hundreds of years. Especially one pointed at random stardust with the hopes that someone will notice it millions of years from now. They're more likely to notice the past two hundred years of radio than we are likely to attempt to communicate via a laser. As a result, its safe the to assume the same about other civilizations out there, if there are any.
Rather than having an encoded message, our DNA may be part of an attempt to solve a problem or answer a question. Genetic algorithms are currently used to solve complex problems by evolving random solutions in a way that mimics natural selection. While the problem solving technique is named for its similarity to the evolution of biological species, it's possible that the converse could also occur: a biological species is created for the purpose of carrying out an evolutionary problem solving task.
Once we fully understand our DNA and have sufficient computing resources, we might be able to simulate our own evolution to answer the question without having to wait for the solution to evolve biologically. Considering the amount of time it takes to evolve biologically, I hope it turns out to be true that there's no such thing as a dumb question!
This is a philosophical issue. The difference between 1/3 and 0.33333.. is infintesimally small.
I was once shown the following proof that 0.999999999... = 1 as follows:
x = 0.999999... => 10x = 9.999999...
10x - x = 9.999999... - 0.999999... = 9
=> 9x = 9
=> x = 1
But if we apply this using any FINITE number of recurring digits, n we see something different. If n=4, denoting 4 recurring digits:
x = 0.9999 => 10x = 9.9990
10x - x = 8.9991
=> x = 8.9991 / 9
=> x = 0.9999 as we would expect!
As we increase n, 9x will be 8.99991 then 8.999991 then as n tends to infinity 9x will tend to 8.9999...91 where the 1 one the end is infinitesimally small, giving x = 0.999999... recurring and not 1 as the solution to our "proof"!
For any value of n, multiplying x by 10 will leave 9-1 9s after the decimal point, so the subtraction 10x - x = 9 is never valid. Whether this suddenly becomes valid because n is infinitely large is a philosophical question, but it seems like an arbitrary assumption to base such a proof on.
Hmmmm, "Are we the message?" Humanity is the messenger, Angels=Messengers, Humans are the 18th Angel - sounds like a Neon Genesis Evangelion reference to me...
I swear by MacOS X. Although I use to swear *at* MacOS 9...
Yet another bogus attempt to inject some credence to that hoary ghost of ID. No, there is no "message" in our DNA other than the message of how to make and use cell parts.
This is the last friggin' retreat the ID'ers can have. The last bastion of that stupid concept of "irreducible complexity". Couldn't have your way with the eye? Couldn't make the flagellum work for you? Now, trying to encode some decipherable message in the DNA? Yeesh.
Been watching that Star Trek movie too many times.
"where the 1 one the end" should be "where the 1 on the end"
"For any value of n, multiplying x by 10 will leave 9-1 9s" should be "For any value of n, multiplying x by 10 will leave n-1 9s after the decimal point"
Apologies - I haven't had my coffee yet! My point still stands.
i'm don't understand why the existance of living ...
matter is so hard to grasp. of course 99% of the
universe is a hostile place for certain chemical
structures. but the univers is a BIG place so 1% is
still a resonable big space.
maybe it's because we are confronted with living
matter 24/7 we can't grasp the idea, that we are
not a freaky accident in the univers but the norm
of complex molecular structures in the given 1% of
friendly space.
also with further space-research count on finding
on exotic complex (selfreplicating) structures in
hostile environments.
i-a bet yah, you can find crystal structures on
many different a planets
and the other day, i was just thinking about
living organisms, that can "override" the law
of "conserving impulse". they can generate random
impulse in any direction, without having to have
counter balance it. kindda like juggeling impulses
vectors and being able to "drop" some of the
counteracting impulse on a more massiv object.
(like what we do when we drive a car). these
"animals" (i think more insects) are already
traveling thru space and even though they have
a tiny brain compared to us humans, they have a
highly evolved nervous system that does the
navigation to and from planets and solarsystems.
naturally to be able to generate impulse at will,
they have
(wonders about the prospects of Cutie Honey in the same vein.)
:)
You mean like This movie?
You just missed it
I live in Soviet Canuckistan you insensitive clod!
--Andrew Howard
> Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA.
Let's see, we're looking for an unspecified message in an unknown language spelled out in an unknown coding... Yeah, I bet you can 'find' any kind of message you want in there, just like the silly Bible Codes thing. The only surprise is that k00ks haven't already been making their claims.
Sheesh, evil *and* a jerk. -- Jade
Yeah, sure, cells are self-multiplying and self-repairing, the problem lies within that "capable of adapting" part, because it means they're also self-modifying over long timescales.
Even if hypothetical aliens planted first primitive lifeforms on Earth three or four billion years ago, and included a message of some kind in them, you can bet your ass off that any remains of whatever was encoded in there has long, long, long, long ago been lost to random evolutionary processes.
You bullheaded humans think you have it all down pat, don't you?
The sad truth is that my planet found your planet from the leaked signal of an '802.11b' device owned by Dave Stewart in Provo, Utah as he was attempting to download a copy of Blue Oyster Cult's Don't Fear The Reaper song. But soon no other intelligence will be able to find your planet due to the decline in the P2P that was a beacon in the long dark night of space. You see, it's the legal dickering of the RIAA that is more a threat to your society than high powered lasers... so sad.
Dedicated Cthulhu Cultist since 4523 BC.
secretly crack PGP-keys.... oh, wait.
Dyslectics of the world, untie!
Hi! How are you?
I send you this file in order to have your advice.
See you later. Thanks
Obviously that's why OSETI experiments use photodetectors with nanosecond speed (eg. photomultiplier tubes). Nanosecond pulses are perfectly resolvable on these detectors. Check out a recent paper to see how this really works and for edification on other technical issues. --Andrew
Does the synthesis of reverse transcriptase now consititute a violation of the DMCA?
If someone would construct a laser signal that outshines the sun by x10,000, it probably must be to send a very intentional message. I don't really see any other benefits of such a huge communicational device.
If the message is intentional, why couldn't they just use the more primitive and much cheaper radio?
According to Drake, radio would be unfashionable in alien land, because their TV's no longer use it.
Well, I suggest they could still use radio when they wanted to communicate <i>intentional</i> messages across outer space.
Will code a sig generator for food
Rather than humans being "Children of the Gods", Zindell has a few of us becoming "gods" and makes an almost convincing case that it would be an inescapable development in a universe with FTL travel.
Paul Davies usually does a pretty good job of representing the perspective of mainstream physics, even adding a few details from his own work, but this time he really seems to have gone out on a limb. While it's a great idea for a SciFi plot, it isn't going to take too many more species' genome maps to make the null hypothesis look very safe.
-- Our systemic servants do not good masters make.
As soon as the alien measures anything about his photon to determine if it's still entangled, Boom! Entanglement is lost. Besides, you cannot determine whether it's entangled without knowing our results on Earth, which he would have to get using some kind of conventional communication signal, and then do some statistical analysis comparing our results to his.
Music speeds up when you yawn, but does not change pitch.
More and more of Earth's communications use cable and satellites, with no radio-frequency leakage to space.
Why would there be no radio-frequency leakage to space using satellites? Some of the signal sent down to earth probably bounces back to space. More importantly, most of the radiation beamed up to satellites goes right into space! There's no way those beams are so narrow that they only hit the satellite's receiving antenna...
SETI is a neat concept and it's logical. That means any alien species would have figured it out as well, and would first be listening for signals directed to *them* before they actively pick a target to transmit to, no matter the technique. Picking a target at random to direct some sort of advanced transmission -> to is pretty expensive and silly, you would want to know that the civilization is advanced enough to understand and to reply to your transmission. Seems like it anyway. It's a catch 22, who goes first?
It could be we have a host of semi advanced civilisations like ours, all sitting around in passive reception mode, waiting for someone to contact them.
...a post consisting only of a single non-alphabetic character, getting modded to +5.
Truly we live in amazing times.
-CausticPuppy "Of all the people I know, you're certainly one of them." -Somebody I don't know
If they would outshine the sun, we wouldn't need SETI to find them! :)
Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA. In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?
I'm suddenly reminded of the SNL sketch where Nick Lachey's eyeballs pop up out because he had to roll them too hard, too many times.
We know where leadership by an anti-intellectual "strongman" who scapegoats minorities and likes boisterous rallies goes
Meanwhile, Paul Davies writes that we should be conducting SETI in our DNA. In turns out that an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?
This was a Star Trek: TNG episode. I distinctly remember Romulans, Klingons, the Federation (and perhaps a couple other species) all fighting over some secret weapon they had discovered in human DNA when it turned out to be a holographic image of a common ancestral species that had seeded the planets. It was probably the second season.
... why not look for it in quantum theory. If you're part of the universe quantum events are your primary source of randomness. Why shouldn't it be possible to tune quantum events to cause whatever effect you desire if you're not a part of this universe? The bible (and the qur'an, too) tell us that god is omniscient, omnipotent and omnipresent. According to physics that's impossible inside this universe anyway.
Outside the universe on the other hand and with some spare dimensions it might even be possible to 'calculate ' future states of the chaotic system universe, or future states of a four dimensional cone around the desired area of effect and induce the required quantum randomness to make this happend the way you intend them to be.
This is just my personal theory how to explain an omnipotent god together with a scientific view of the world.
It is most probably a Threat of War
Irrelevant news and morons using moderation to mod down what they disagree on. 2018 resolution: so long.
Now What about Tachyons ? (just finnished SF Book: Timescape) Altho I belive still theorical phisichs and undetected in nature They are supposed to be faster than light and possibaly able to travel backward in time. This would seem to be an ideal communication method over very long distances (D=rt) http://en.wikipedia.org/wiki/Tachyon
Well, my impression was that the guy is still crazy. On the other hand...
He could have had some contact with the scouting party. Their mental powers could have done something. But why they'd leave him to potentially uncover them...
The old 'Too wierd to be true' flipped on it's end.
And Randy's character never claimed to have been sexually molested, others picking on him said that.
I don't read AC A human right
I have also doubts about the claim that the earth is going to go quiet re RF signals.
The cynic is me wonders whether the "new" approach means that SETI have given up on RF signals? I would love to SETI results published in a meaningful way. E.g. How much of the galaxy have SETI searched in a way that would have revealed the earth's presence had it been there? (Ignore the fact that any signal may take years to get here. Assume the planet sends out the same amount of radiation as the earth did in, say, 1990.) It always seems to be a bit of cop-out not to do so.
Is it possible that we really are alone? That would be a powerful scientific result but lets face it - not one that SETI would be happy with.
What Davies says about the message (an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells) strongly ressembles the message of the (VERY DANGEROUS) Scientology Church of L. Ron Hubbard.
Is Davies a Scientology fellow?
Anyway, go here for more information about the Scientology Church.
If we were the message, it would have long ago mutated as to be undecipherable. The message was destroyed by SG-1 and the those gray aliens in last seasons Stargate. Seriously, DNA wouldn't be my choice, but a self replicating nanobot designed to reproduce with extreme fidelity would be more suitable for a message. Unfortunately, uncontrolled replication could have disastrous results.
Are we the message?
Didn't Douglas Adams already answer that question?
"You can now flame me, I am full of love,"
"Should SETI Be Looking For Lasers Instead?"
Additionally? Sure. Instead? No, jack ass. We haven't met any aliens yet. We should be looking for everything.
"Derp de derp."
This is £ucking ridiculous! Why can't we just have £ on here?! I say we start a petition to bring the £ to /.!
Paul Davies is a creationist. Sorry, but I'm not going to take the advice of a guy who honestly thinks the universe is 6,500 years old.
Seriously though. I'm pretty sure that if any light sources appear in the sky with 10,000 times the luminence of the sun, they'll be noticed by scientist and non-scientist alike.
Anyone remember The Mote In God's Eye by Larry Niven and Jerry Pournelle? Not that the Moties _intended_ it as a signal, but it was a laser, and it was definitely noticed.
How would we know if there was a message in our genomes? Presumably ET would make it easy for us to spot. Some sort of in-your-face pattern would be best, something that stood out from the random scatter of genetic letters.
I would posit that an ET intelligence smart enough to create a pattern in our DNA would also be smart enough to make the evidence of their existence readily apparent to even those without the ability to decode DNA. I mean, if the point of sending a message is to communicate, why would you require such sophisticated techniques to understand it, with the attendant risk of misinterpretation?
Replace ET with God, and you've got a good paraphrase of the "intelligent design" argument for God's existence.
I think what irks me the most is the assumption that aliens are trying to contact us. When we think about communication, there are some interesting principles:
- The sender of a message fulfills some need in sending the message. Perhaps it is a call for help; perhaps "they" need some more friends.
- A message is always sent with a reasonable expectation that the recipient will be able to understand it.
- The sender usually wants some sort of response from the recipient, even if it is merely an acknowledgement.
This leaves us with some fundamental problems regarding ET's contacting us with "sophisticated" techniques:- An alien intelligence seeking to make contact with other civilizations would probably choose the most easily recognized form of communication, not one which required sophisticated technology or a considerable degree of intelligence to decode.
- What purpose would such a message serve? If they are more advanced technologically, why would they contact us - we don't have anything that they need? If less so, then we would be able to decode their messages with ease.
- If "they" are sending messages, then surely they must already know, or strongly suspect, our existence. If this is the case, then why don't they already know how to communicate with us?
It would seem to me that if aliens were trying to contact us, we would have known it by know. I suspect that if SETI discovers any "intelligent signals", we'll come to discover that they were not intended for us to decode. Perhaps some alien military communications, or ARIA (Alien Recording Industry Association) encrypted music broadcasts, etc...Just a rhetorical exercise here: Would God qualify as the sender of such a message?
With what we know now, only our Creator would possess the knowledge of our existence, the desire to communicate, and the means to do so. I wonder if this occurs to the SETI team, or if they are trying to find God in outer space...
The society for a thought-free internet welcomes you.
42
Now if we could only figure out what the question was...
(obligatory Douglas Adams reference, I apologise)
Drinking habits can be dangerous. You can choke on the cloth and the nuns will wonder where their clothes are.
Maybe the universe isn't old enough. Seriously! Stuff like carbon, iron took multiple generations of stars (birth-to-supernova) to produce. Intelligent life that appeared approximately before the existence of Sol/Earth would have lived and died without the means to forge swords, much less spaceships. I believe our star is a fifth-generation, although my head is fuzzy on that number.
Human beings may just be the first creatures who have the chance at interstellar civilization. Either that, or we are going to be part of the first wave, developing simultaneously.
Together, we will drive the rats from the tundra.
Please. Our DNA code could be interpreted as a code from an alien civilization, and you could get damn-near any meaning you wanted out of it, just like the n "decryptions" of the "Bible code".
Hail Eris, full of mischief...
E pluribus sanguinem
Are we the message?
Are we the medium?
Gee, I figured it would be "All your worlds are belong to us."
--
What would Bill Clinton do?
"I'm sorry boss, but SETI demands that I be alloted more than .7 days a month to potentially receive alien transmissions."
Side note: Maybe AIDS was just an inter-office memo that got out of hand.
Side note #2: Imagine a Beowulf cluster of sick people!...Um. Ok. Maybe not.
S.Z., dodging pink lasers since 1972
If we're the message, tell them to check their parity settings and ;)
send the message again as it appears to have been garbled the first time.
You must be the change you wish to see in the world - Ghandi
There's a place that a message has been stored in much-more-readable format than lasers or DNA, and it's been stored there for 4,000 years.
This source proclaimed that Earth was round 2,000 years before Columbus was even born. Over 200 years before the event took place, it foretold the fall of the powerful city of Babylon, even mentioning who would participate in the attack, and how it would take place. At a time when humans had no concept of sanitation, when doctors went from patient to patient without washing their hands or wearing a mask, when the Egyptians were using excrement in medicinal recipies; this source dispensed advice about sanitation that is still used today.
It's a number one best-seller worldwide, and has been for millenia. All of these points considered, doesn't it make sense that the Bible should be investigated scientifically before it is discounted as a source of extraterrestrial communication?
You can run but you can't hide, except, apparently, along the Afghan-Pakistani border.
I've always wondered how the scientific community missed this plausable explanation.
What would happen if an alien pointed a Hubble sized maser at our planet from there planet? Wouldn't it leave a mark, kind of like a crop circle?
Around almost every crop circle, little balls of light are seen. There is even UK military footage of this floating around the 'net. Microwaves are
You can even find step by step instructions on the 'net how to make ball lighting in your microwave oven. (google for 'ball lighting microwave')
Development and installation of carbon-based life forms: 8.698163E11
Fleet of ships to clandestinely monitor their progress: 1.92323E14
Watching the hilarity and hijinx as they try to figure out where they came from and "the meaning of it all": priceless
(all figures in US dollars)
Someday I get tired of this joke - but not today!
No no no! Aliens communicate through a series of large stone monoliths! Don't you guys pay attention?
"We shall party like the Greeks of old! You know the ones I mean." - HedonismBot
Approximately 10 percent of a human's DNA is actually involved in control or production of proteins which compose the rest of us or make us grow, age, reproduce, etc. This is a smaller percentage than in any other creature, AFAIK. The other 90 percent has been referred to by biologists as "junk genes" but really, they, don't know what it's doing there. It may not be junk. One speculation is that it's there to absorb "hits" - damage from cosmic rays or chemicals. And after all, if some of the 90 percent that doesn't do anything gets damaged, so what (its like a dent in your chrome isn't going to harm your car's performance nearly so much as a chip in an engine valve). So maybe some of it is DNA for another, alien species if we only knew how to decode it?
Perhaps some Cosmic Event will turn our DNA inside out and we'll be transformed into something else.
I guess what we would have to look for is where the "junk" DNA is the same in many, many people. A pattern in only one person wouldn't really mean much. It wasn't there in his/her parents, and wouldn't be in any offspring. So it would have to be common in many people. That's a lot of searching and matching. A lot. It could be a different kind of problem than simply looking for a pattern in otherwise random signals.
Could what we see as Quasars really be these high powered lasers? Last time I checked, there were a lot of theories about what Quasars are, but no real solutions. Maybe that would explain why they are so incredibly bright--focused light in our direction trying to tell us something.
Also, anticipating it would take a while to get our attention, they don't shift the light from place to place, they have dedicated beams aiming here to ensure it's there when we are looking.
Mod me up please. - Henny Youngman
Busy aligning my non-linear thoughts.
It has never been SETI's goal to detect leakage
from another civilization, our current technology can't see those signals.
Intentional signals directed towards earth i what
SETI is looking for and always has.
Even if the Aliens haven't transmitted radio signals
among themselves for ages, they could easily transmit radio to us.
Or perhaps the only message we'll ever see from them would be a giant laser beam that instantly fries our planet, making everything in this discussion irrelevant.
:-)
Maybe that's how you get modded down on an interstellar slashdot as -5 flamebait
...the message encoded in our dna is the question of life, the universe and everything, to which the answer is 42. Or was that in the cave men who died off?
Seriously, I think it't funny as hell, but can somebody explain the informative mod? Please?
...
I just know I am missing out on something
Blogging because I can...
If we are the message, then who's it for?
Just read farther down and saw the whole unicode thing.
(still, it does look like ET!)
Blogging because I can...
Are we the message?
What sort of message would that be? Monkeys are assholes, and monkeys with large brains are assholes with nuclear weapons?
The "advanced civilization" that actually has to conduct that experiment would either be idiot-savants with a knack for genetic engineering or else rodeo clowns snatched from the future by alien overlords to act as viceroys over a slave class of biology graduate students.
Proud member of the Weirdo-American community.
"Pass me that suntan lotion."
"The SPF 30 or 45?"
"Well, Slashdot said we might get hit by a giant laser..."
"The 45, then."
This side up.
Someone mentioned something simple. It would be very elegant if something really simple like say, the MEMS mirrors on a TI light valve that drives an ordinary projector, could detect a SETI, if we'd only thought of it. As I understand it (please correct if wrong) the hydrogen band is one area of little noise and relatively good conductivity through space.. a natural wavelength to look at. I'm not saying gravity waves are the thing, or that they even exist, but if surveys of patterns in ambient energy are show certain characteristics, it would be interesting to see how simple and inexpensive a device can be made that would record patterns *not* falling into those trends.
So it might be interesting to look for simple (geometric? time-bound? beautiful?) patterns in phenomena we have been seeing, or start recording physical phenomena with more sensitivity with the expectation of ever faster, internetworked, intelligent and quantum computing. For example what kind of a pattern would you get if you slewed a diffraction grating made of neutronium on an orbit that coasted through the troposphere of a sun? What kinds of patterns in radioactivity or infrared are common? Some things may require higher resolution surveys but some may be well within the realm of a species at our level, if say 0.1% of world GNP was put into it per year. And some modes of communication might even be within the realm of a single underfunded individual with a unique point of view.
There may be an alien that rewards elegance and be sending funnily polarized or spinning vortices of electromagnetic current, there may be all kinds of ETs and a bunch of them may be mathematicians.
On a side note, too bad we have to plunge through Saturn instead of gliding through its windy layers. No information-bearing processes in all that mass of chemicals and lightning? I don't think so. Why do you?
My theory (and the rant that Slashdot/firefox lost last week) is that ET has little patience for whiners like the "no news yet, we must really be alone still!" crowd. I'd like to think there are lots of opportunities for communication, and civilizations at the beginning of space technology might be able to make up for such a handicap with creativity, empathy, intelligence, humor, and philosophy. ET likes origami and tricks of the light! He likes both classical and rock in moderation! He likes creative chefs, he likes hackers! (hope not on rye) It is conceivable that a cloud chamber like the one I built a long time ago for a science fair might be sufficient for someone with a microscope and a quantum computer, or possibly the data we need is already available for free online but we just need a very sweet, smart filter with a sense of beauty or maybe even humor. You could write that filter with free software.
It's US! Buckminsterfuller would be so proud!
Thought experiment 1: What experiment is missing on cassini?
Te2: What is the cheapest, lowest tech experiment that has a nonzero chance at finding ET, that makes the most of the qualities suggested in the above post?
Te3: Given current technology or that conceivable within 5 years if you worked hard at it, what method of seeking patterns in any natural phenomena would achieve the highest degree of parallelism and potential discernment of a pattern out of a high number of samples?
I'm interested in your replies, even though my Dad says he doesn't want to meet a Bug. Even if I had that viewpoint I'd rather know they were coming.. and maybe the above thought experiments could help select the ones we want to meet. It just might be that this kind of an attitude could mean a lot to the Earth, sooner than later. We've already been broadcasting for 50 years, ET can sense even a 100 year thin bubble of radiation. Why not search DNA, or look for nanoscale structure in cosmic dust. Or maybe it is just a matter of a new way of looking at things we already see every day..
"Over 7 Billion Served!"
'nuff said.
http://tinyurl.com/3t236
As we get better at analyzing the composition of
planets we can determine which would support life
as we know it vs dead worlds like the moon or mars.
That would narrow the search area down quite a bit.
Styrofoam seems to last several million years. Perhaps an alien had a coffee break and left one behind with a message of hope and peace....
Insert Witty Remark Here ===>____________________________
It doesn't work this way. Your aliens can not detect a 'change' in the entangled particle. To determine the particle has changed, and what it's 'changed' into, requires bringing back the information (measurement) of the particle sent to earth to it's counterpart.
EPR is fascinating and can certainly help us get around Heisenberg, which is usefull in 'teleporting' tricks (or simply in quantom computer terms, data transportation), but in all scenarios, a piece of information must be communicated to the destination via normal (relativity obeying) means.
-Malakai
A Dragon Lives in my Garage
From article: "an alien message designed to last millenia should be 'inside a large number of self-replicating, self-repairing microscopic machines programmed to multiply and adapt to changing conditions', otherwise known as living cells. Are we the message?" Remember that episode of ST:TNG where the Creators had encoded a message in DNA and then seeded life throughout the galaxy in the hopes that all the species would come together to solve the mystery? And then it backfired and they all (for the most part) were suspicious of each other and the lesson of the message was all but lost on the most of the handful of people that witnessed it. Just thought it was interesting. BTW, ST:TNG was the BEST!
...because there's nothing there. I used to believe in the possibility of ET life, but not anymore. I've come to realize how unique the Earth probably is. Conditions for life on a planet have to be just right, and while it's probable there are more earth-type planets out there, I don't think there's many with that perfect set of circumstances to support life. Paraphrasing Tom Skerrit's character in Contact, "Either there's nothing out there but dust and noble gasses, or they're so far away we'll never find them". I have to agree with that. I'm all for space exploration, but for man's direct benefit (harnessing of resources in space/other planets). Sorry, but older and wiser (and maybe more cynical) adulthood has dashed those old hopes of little green men. If you want aliens, you're going to have to get them in Star Trek reruns, because they're not "out there".
Life is hard, and the world is cruel
Only problem?
:(
We're perfectly in line with the sphere's axis.
So, let me get this straight....we want to put SETI in our DNA? Does this mean we should turn everyone on the planet into a component in a massive, global computer? Maybe we need a way to include the whole earth? And while we're at it, maybe we can program this computer to come up with a really cool question whose answer would be "42" too???? Sounds like a pretty novel idea to me! ;)
They are here.
If "over 400 government, military, and intelligence community witnesses testifying to their direct, personal, first hand experience with UFOs, ETs, ET technology" isn't good enough for you, then start hereto research our gov's own documents, and then go here and dismiss these reports with "swamp gas" or "venus" or "a flock of birds".
This "we may contact other intelligent creatures someday" is a farce. They are here and have been for millenia. SETI is merely a lightning rod for distraction, nothing more.
"The greatest obstacle to discovery is not ignorance - it is the illusion of knowledge." - Daniel Boorstin
Like, one bit per year. Imagine a sender turning a star off and on, ala Vinge.
The post says that we are not going to have radio communication in a certain amount of time, but what about the prolipheration of wi-fi and cell phones? If I'm not mistaken this ain't just a couple of bugs talking in tin cans with string working for us.
Yes it's unfortunate, the radio pollution we cause and I do hope that we switch to laser everything but the current trend definitively does show more radio and not less like the blurb states.
Yea I mean I can squirt out at least a kajillion bytes of data multiple times a day.
My UID is prime is yours?
Well, I guess that TNG Season 6-7 episode where all the races work together to figure out the DNA message was true after all. Too bad we haven't met up with the Klingons yet, since they have a critical piece of the message. Oh well. ;-)
Stiny! Get me a danish!
You want to respond to the interstellar equivelant of "Marco!" with "ack"?
WTF is wrong with you.
We should send out a high energy response with the ever decipherable "POLO!" encoded...Then imediately move our entire civilisation to Barnard's star.
If Mr. Edison had thought smarter he wouldn't sweat as much. --Nikola Tesla
There's a good chance that if we focus SETI on protien unfolding we'll find g0d.
OK, I know this is Slashdot and all, but so far I've seen no one consider the obvious possibility that the incredible entropy of DNA's 6-billion bit quaternary code might actually be an indication that there is some creative intelligence behind life after all.
Years ago, I once asked a coworker who was an avowed atheist if he would be convinced that SETI had found a "hit" if it encountered an endlessly repeating quaternary code millions of symbols long. He replied, "Oh yeah!" and I pointed out that such a result was already in his own DNA. The length of time he took to stop and think about that was immensely satisfying.
To me, the idea that man can think he created God and not vice versa is the epitome of arrogance.
(NT)
The best idea I've seen for getting the attention of ET's is to dump a few tons of elements into the sun that do not occur naturally, such as technetium. Basically, it's nuclear waste, and when an alien astronomer looks at our star, they'd see spectral lines of elements that could only be produced in a nuclear reactor...A sure sign of intelligent civilization.
The article states that we should be looking for intentional lasers, but why wouldn't a civilization that wants to be contacted simply emit a strong radio signal for others to find? It doesn't really matter if no ones uses it anymore, simply put a bunch of strong emitters in space and let them radiate.
then why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth? Think about it.
If you're using Star Trek as your model, you should remember there are plenty of pre-warp civilizations that are under observation by the Federation but are not to be tampered with until they achieve Warp.
The universe is big enough that any race that is smart enough and constructive enough to achieve off-world travel is probably not a hollywood mad-insane-bad-guy race that plunders just for jollies. The Earth's resources probably aren't that special when you consider the billions of other stars available in the galaxy.
You make a good point though - if they exist and wanted to be here they would be here already.
So, either they don't exist (odds are against it) or they're leaving us alone (the remaining hypothesis).
Personally, I think they're waiting for us to speak up. When we get over our paranoid fear-of-monsters stage we'll say, "Hello," and they'll answer.
Until then, we're probably not worth talking to. I run Seti@Home, just in case, but it's probably not worth the electricity until we start broadcasting.
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
Wasn't this already explored in ST:TNG? Don't we need to travel to a bunch of planets to figure this sequence out and need a tricorder to play the .mov?
In other words,
"The vulcan science directorate has determined that time travel is impossible."
i've only been saying this for around a decade (proof of at least three years :/)
in this age of communication i'm just not getting through
It's interesting that so many stories of this sort are bubbling to the surface in so many forms. The collective unconscious of the human race is on fire at the moment! --Just in big television and movie media alone, stories regarding genetics, mutations, secret government, our hidden past and the changes which are happening to not just us, but our whole planet. . , it's plentiful and it says something. --SG Atlantis, X-Files, Signs, Taken, X-Men, Spiderman, Day After Tomorrow, all those comet impact movies. Even our world leaders are shoring up resources and locking down controls in anticipation of. . , something.
.
Crop circles made by guys with planks and rope? Sure. But anybody who really wants to know rather than look away from taboo ideas will quickly run into certain facts. (Rats. Facts, eh? Those things hurt.) Those who have looked into the circle phenomenon have discovered that many of them contain features which cannot be reproduced with planks and rope. --All the plants forming the circle bending only at the stalk nodules, (the first, second or third one down the stalk depending on the distance from the middle of the formation,) or in those circles created by the 'dark-side' to mislead, stalk nodules exhibiting microwave scar damage. --Among many other little items which so many people would really rather not look at too closely for what it all implies. .
Indeed, some believe that Alien life has already contacted us, (there are numerous modes through which this can happen, and none of them involve radio telescope dishes or Jodi Foster.)
Some also believe that the 90% 'junk' DNA has started in the last few years to re-bundle, and that the finished product will be 12 strands rather than just two. --That as the DNA re-builds itself, humans will properly regain what they have had genetically engineered out of them over the last 300,000 years of alien tinkering.
Some believe that reality is much more vast than we currently perceive, that time is an illusion, and that all of this is in the process of change. And that the changes started a few 'years' ago and will complete themselves within the next eight or so. That many of the strange new diseases and pains people are experiencing are actually the result of DNA re-activation. That 'psychic' phenomenon will only increase as the cycle continues to gather steam.
And some also believe that certain, powerful elements of our society find the idea of the populace growing aware and breaking free of their bondage so appalling that great energies have been invested in keeping people unaware. --And that to do this, many different methods are employed, one of the primary ones being the psychological programming of people with that strong internal feeling of guilt/worry/distaste/squeamishness whenever taboo subjects arise in conversation. (Or on message boards.) --That in fact, many of our internal reactions are automatic psychological programs not of our own making but deliberately installed through many vectors during our childhood years; through television, (the strobe effect which acts as a hypnotic opener to the thousands of messages which it bombards the viewer/listener with), such as the instant desire to ridicule and assume a 'rational' swamp-gas explanation for all things 'unnatural' like Crop Circles and UFO's or ideas of our history not being as we have been taught. --Or upon failing that, the simple desire to look away and, 'never think about it again'. A very, very effective system! What better way to maintain control over a population than to create a strong emotional negative reaction to the very idea of exploring the lies which hold the people chained?
--Deliberately litter the field with lots of genuine kooks, con-artists and gullible idiots, and you've just thrown a ton of reasons to rationalize away the scary possibility that something might really be happening. Interestingly, as the veils grow thinner and the DNA continues to re-bundle, and the instances of weird
In galaxy far, far away.... Death Star fires. You get the idea.
Dyslexics have more fnu.
...a Beowulf cluster of humans!
Sig? No thanks, I'm trying to quit.
This loser has nothing to say, knows nothing about physics, and his most interesting part is a narrative about how he used to believe everything They told us. So he's a champion dumbass. Whoop-dee-doo, dime a dozen, and sure as hell not insightful.
Funny might be more appropriate, given his ideas about physics.
A long discussion of many of the points raised in this thread can be found here.
I often aks myself a number of questions related to discovering civilisations via radio waves.
Firstly, the strength of radio signals decreases proportionally to the inverse cube of the distance from the planet. That means that a signal is extremely weak over the many light years where another listening civilisation might be. Normal radio signals, even those shaped via a satellite dish, are not coherent, such as a laser is, and the spread should easily make that signal almost undeciferable over the cosmic background noise at multi-light year distances.
Secondly, even if the signal is extremely strong and/or coherent, where exactly do you aim it? In oder to reach a possible civilisation, one would probably aim the signal within a star's habitable zone, but which star? Alpha Centauri? Sigma Draconis? And for how long?
Thirdly, how do we know that a civilisation even uses radio signals. Granted, light signals are obvious in view of the natural light and radio of the sun, but what about a civilsation that discovers and uses charged particles as a communication medium before they use radio waves, or what about a signal technology in a civilisation that is far ahead of us and that we have no way of recognising.
WTF?! how exactly do people think that satellites communicate, it isn't voodoo, it's radios waves!!!!!
are stupid.
Anyone with half a brain who is in Astronomy and knows the issues realize Lasers won't cut the distances required for practical communication.
I think the whole thing is quaint.
If there is a big civilization out there....who can raverse the stars, they will know how to defeat the vast distances required for communication and travel.
Simply because we have SETI people saying the distances are too big for space traveling ET's...then turn right around and tell us we should look for Lasers as a practical detection system must have recieved there PhD's from a crack jack box.
-Hack
Got Geometrodynamics? Awe, too hard to figure out? Too bad.
Ah, amper, pound, semi, (£)
I sing thy praises!
Furry cows, furry cows all around,
amper, pound, semi (£)! Amper, pound, semi (£).
Leave us not forget other importants like
amper, amper, semi (&)*,
amper, lt, semi (<), and
amper, gt, semi (>).
Escape chars, you make this rockin' world go 'round!
* (Interestingly, here on slashdot, you have to use a literal `&' to get an ampersand. How nuts is that!?)
Furry cows moo and decompress.
Hmm.. OK suppose that a futures scientist comes up with a proof that we were created for a purpose. What would such a proof look like. My problem is that I cannot think of any proof that would convince the scientific community of your hypothesis.
:)
I think that there is a somewhat wide difference between genetic algorithms and biological evolution. In a genetic algortihm program. The goals are simple and they stay fixed, whereas in biological evolution the goals tend to change, because the environment of a species is not totally fixed. A an example our species aquired a language around 200000 years ago (if I remember correctly, and if the contemporary theories are right). This meant a change of direction in our evolution. So if you claim that we were created for a purpose then you have to deal with the sudden and seemingly random changes of direction.
Anyway simulating biology on a molecular level is a difficult task. At the moment we can examine a model af a small protein and to guess how it folds. Using newtons method to examine RNA'strings is still not possible on an interesting length scale. If there is an answer to your question, then I doubt that I will get to see it in my lifetime.
PS: No, there is no such thing as a dumb question
We can't prove "1=1". It's an axiom. In general, in all math, we have it as an axiom that a given mathematical object is equal to itself. In an environment where it's not, math is probably all broke and we can't use it. (Although note that it's possible for a logical system to be only partly broken, and still be usable. An example is any computer program that's fairly stable but crashes on rare occasions or on certain invalid inputs.) Any proofs that show 1 = 2 are proving there's a contradiction *somewhere* but they *don't* show you where the contradiction *is*. If you want to decide that 1 = 2, that's fine, but I think you'll find it difficult to balance your checkbook that way. Do you work for Enron?
...
...)
...
Now let's prove 1 = 0.9999...
Please note:
1/3 is "1 divided by 3".
"1 divided by 3", expressed as a decimal fraction is: 0.3333...
Since 1/3 and 0.3333... are merely alternate representations of "1 divided by 3" we are justified in claiming that they're equal, thusly:
1/3 = 0.3333...
Now let us multiply both sides by 3. The lhs (left hand side) poses no real problem and we get
3*(1/3) = 1
without much fuss.
The rhs is where you'll probably be crying fowl. I'm no great mathematician, but I'll do my best.
Let's express 0.333... as an infinite summation. It would look like:
0.3 + 0.03 + 0.003 + 0.0003 +
The next part depends on how much math you have in your brain. If you've had enough experience, then you'll know the distributive property will work just fine here. In other words:
3 * (0.3 + 0.03 + 0.003 + 0.0003 +
is, in fact, valid, and it really does equal
0.9 + 0.09 + 0.009 + 0.0009 +
which, of course, equals:
0.9999...
So, to summmarize, we've got
3*(1/3) = 3*(0.3333...)
1 = 0.9999...
There's also some other, more Calculusish way to show the infinite sum (9/10^n) for n=1 to infinity converges to 1 but I can't even remotely remember what it is right now.
Furry cows moo and decompress.
has been saying for some time that SETI can't work because the signals will be blocked by interstellar debris and the technology used by another civilization would probably be so advanced as to be indetectible by our level of technology anyway.
He compares us to an ant colony next to a superhighway built by humans. The ants are oblivious - unless we run over them.
Richard Steven Hack - This sig is TOO GODDAMN SHORT TO DO ANYTHING USEFUL WITH! MORONS!
Shadowe suddenly notices that when viewed from space, all of civilization spells out the words "T'ch-Klah was here"
A bullet may have your name on it but splash damage is addressed "To whom it may concern."
Recollections of a former laser jock; YMMV...
First, we have to be looking at the right point in space, at the right time, in the right narrow wavelength.
Second, we have to pick the signal off from everything else. It won't be by the beamwidth because of divergence. It won't be by coherence because real lasers have something called 'coherence length,' at which point that quality is largely lost. This happens at well under inter-stellar distances! For the reason of distance and divergence, it won't be by amplitude.
The clearance system sounds logical. It is not. It is completely arbitrary. -- John Bolton
We assume that aliens will communicate in a similar fashion to us (radio freq., lasers etc) when we have organisms even on earth, whose language of communication we have no clue of. I begin to wonder if we'll be able to recognize an alien signal if we came across it.
"Fighting terrorists with millitary might is like killing a mosquitor on your Dad's forehead with a rifle."
What makes you think any other intelligent life form would ever want to make contact with humans, unless they needed another food source? I mean, c'mon, as a species 80% of us are a waste of oxygen, consuming everything we can get our hands on. And I don't want any of you eurotrashers blaming the USA for over consumption of the worlds resources, have you checked the sales figures for all US companies in Europe lately? You euro-whiners buy almost as much US made crap as we do! Stop buying crap, and we'll stop making crap.
"Patience is not a virtue, it's a waste of time."
Are we the message?"
If we are the message I think we are an away message...
---In a time of Chimpanzees I was a Monkey.
http://www.fourmilab.ch/documents/sftriple/gpic.ht ml
42
I simply offer it as a possibility. I'm neither claiming that I believe it to be true, nor that if it were true, it could be proven.
I agree that biological and algorithmic evolution are very different; however, I disagree with respect to goals. In biological evolution, even if the environment changes, the "goal" remains the same: reproduce. Changes in the environment may affect the fitness of particular population members, but the goal of reproducing to propagate the species remains the same.
Also, genetic algorithms do not require static environments. It's just a matter of how you structure the algorithm. Try a google search with the terms "genetic algorithm" and "nonstationary environment".
I'm in total agreement that simulating our molecular biology is a difficult task. Mapping particular alleles to physical characteristics and modeling how those characteristics determine our fitness in a dynamic environment is damn near impossible. Fortunately, the hyperintelligent gelatinous aliens that encoded our DNA are far more advanced than us.
The Law of Accelerating Returns by Ray Kurzweil
It offers a very well reasoned argument as to 1) why the technological singularity must occur, and 2) why SETI is likely a failure. Actually, I would suggest reading Vernor Vinge's writings on the singularity, then read Kurzweil's work above.
One should then read the story (posted at k5?) called "The Metamorphisis of Prime Intellect".
Finally, read Albert-Laszlo Barabasi's book "Linked" (network theory), Kevin Kelly's "Out of Control" and Steven Johnson's "Emergence" (emergence theory), and Stephen Wolfram's "A New Kind of Science" (The Principle of Computational Equivalence).
There are many more references, both fictional and non-fictional (for entertainment purposes only, I also suggest the anime "Serial Experiments: Lain") - but these which I have listed detail a staggering breadth of information which, after you have digested it and left it to simmer in your mind, just might change your opinions and worldview in radical directions.
Lastly - a plea for help: Does anybody here know of any papers or references from reputable sources which discuss why the singularity can't occur, or is wrong in some manner? I have only read one side of the debate, and I would like to hear the other.
Reason is the Path to God - Anon
And cancer is the message getting pissed off that we haven't received it yet. Kinda like call waiting. Maybe it's an urgent message?
Since when firing a nuclear powered laser is concidered good dimplomacy?
But... the future refused to change.
If we are, I'd like to read natalie portman's message. And she could read mine af well :-)
-- Make software not war
and for possible answers as to why we haven't yet picked up any signals, I suggest a read of David Brin's 1982 article called: The 'Great Silence': The Controversy Concerning Extraterrestrial Life (a web-based version is available at: http://skew.ot.com/three/random/silence.html.
We have exchanged emails about its conclusions and I must say I haven't yet decided where I fall on my own...he suggests that the very fact that there has yet to be a single real signal detected is virtually immaterial. The REAL problem is the fact that we haven't found any evidence at all of alien colonization, directly or via robot proxies, within the solar system or on earth. No sign of unexplained discontinuity in the biological evolutionary history of earth suggesting a flushed alien toilet, no sign of mined asteroids, no sign whatsoever of any terraforming attempts on Mars or Venus.
The basis for the entire problem of the "silence" as he posits it in his paper, is predicated on the belief that interstellar travel is possible whether by robot or via multigeneration starship, etc. To me, it isn't a matter of if being technically possible in THEORY, the real problem is one of practicality. The one hitch is that all it takes is ONE civilization somewhere in the galaxy to beat all the odds and develop space travel and, perhaps, self-replicating surrogates (robotic craft)...after that, barring anything simply making expansion truly impossible, after a total of 6 billion years, even at no greater than 0.1 c max speed, and this civilization (or its surrogates) would expand to fill the entire galaxy. So the question is...where are they?
Ultimately, after much discussion of the Drake equation and its weaknesses, as well as discussion of all the various arguments as to why there are no aliens all around us in evidence, his argument zeros in on twoa few catastrophic scenarios: the first is based on self-replicating surrogates. All it takes is one paranoid civilization creating destructive robots (ala Gregory Benford stories) to trump all the rest. In such a case, alien civilizations are crushed/destroyed by some means before they can get very far by robotic berzerkers or some form, perhaps hurling asteroids at the fledgling civilization's planet(s). Another, somewhat related, and one I find likely due to my biology background, is that once you release ANY self-replicating system, be it nannite or macro robot probes, you lose control over them because NO replication system is 100% accurate (I say that again, NO replication system can be 100% accurate) so that once you release it on its own, it WILL evolve and you cannot control what this leads to. Perhaps destructive replicants.
The main scenario he seems to argue for suggests a series of expansions and collapses of civilizations. A planet evolves a technical civilization, which then expands and colonizes neighboring systems in an expanding sphere once each colonized planet reaches the point where it can send out further colonists. Even being conservative on the timeframe for which this would likely take, it is doable in suprizingly short (relatively) period of time. In any case, all the planets and planetary systems have limited resources. Once a system has consumed them, that's it. It either has to expand outward or collapse. Those at the core of the expanding sphere are screwed and can only make due if they expand out into already colonized space...fights over dwindling resources. Various individuals have made calculations as to how long such an expansion and collapse might take, given a few reasonable assumptions, and all the estimates fall into the 60-70 million year range. Ultimately, Brin suggests that what we may be experiencing at the moment is a recovery from the last collapse. Once such an colonization sphere collapses, with the depleted ecologies it leaves behind, it takes a good long time before evolution can produce the next batch of technically competent animals capable of space travel, etc, which then starts the cycle anew.
This gives short shrift to actually a very interesting (and entertaining) read. I encourage you all to take a look at the article. I am still mulling over his ideas and deciding what objections I have to the whole thing.
In Bushworld, they struggle to keep church and state separate in Iraq as they increasingly merge the two in America.
what you see is all there is. ... the vast majority of people at every stage of humanity's scientific progress believed this.
On the contrary, I think that there is good evidence that most people throughout history, as well as most of the posters here, live in a form of hope that is grounded on thier wishes rather than any evidence.
I think of people who:
Pray to God to heal thier ills
Perform sacrifices in the hope that it will bring them career advancement
Boil horseshit while meditating, to try to turn lead into gold
Claim that a wealth of experimental and theoretical evidence that matter never crosses space faster than light does, and in fact the whole idea is nonsensical and paradoxical, is just 'our current understanding of science' and will evaporate when some new theory contradicts it.
My Karma: ran over your Dogma
StrawberryFrog
There's a neat book called "Where Is Everybody?" by Stephen Webb; it discusses 50 reasons why we haven't heard from ETIs yet.
"The aliens will contact us when they can make money by doing so." -- David Byrne
>why isn't the universe like something out of Star TRek with hundreds of alien species flittering about, dropping in to violate the prime directive, establish moonbases, and so forth?
Because it is difficult for a spacecraft travelling at a high fraction of the speed of light to carry enough energy with it to stop.
That means they are looking for a parking lot - some sort of re-generative braking system like on electric cars.
Your quantum seti ideas brings up an interesting point and would declare instantaneous communications regardless of the distances between partys once the photon is caught.
This also means that the Drake equation has to be mended to allow the civilizations capacity to nurture such forms of communications. My guess is that a civilization that develops quantum communications is more likely to be adventurous and seek out new life (pro), yet more likely to harvest this quantum energy to annihilate itself (con).
Perhaps a civilization that peaks around the time that radio waves are the primary means of communication is not deemed to travel intergalactically anyhow. Technology is a philosophy guage afterall.
Good post!
"Empathise with stupidity, and you're halfway to thinking like an idiot." - Iain M. Banks
Laser stands for Light Amplification by the Stimulated Emission of Radiation. How many Americans are sat here thinking, "You mean to tell me it's spelled Laser?? Whoa man!! What color is it? What flavor does that come in, do they make it in aluminum??.... Bzzzzt! Bzzzt! Does not compute, speeeelchecka not werking!!!
I would be kind of fun to do a reverse-SETI project. Make a satellite or moon surface radio unit that just screams at the top of its lungs out into space. See what, if anything, we can attract in a few hundred years.
what's mine say? DUDE!
Sweet. Dude, what's mine say?
Sweet!
Dude!
we are the message.
because I have been enjoined by this Holy Office to abandon the false opinion which maintains that the Sun is the centre
Since radio waves and light are basically the same (electromagnetic waves), the problem is not that of possibility, but basically an energy issue...
photon energy is proportional to frequency
So for a given amount of energy you can get either more photons at a lower frequency or fewer photons at a higher frequency.
Since visible light is in the THz range (10^12) and radio waves are in the say MHz range (10^6), that's a factor a million less photons emitted per unit of energy.
Since we are essentially detecting a bunch of photons, this is the gist of the problem.
Of course it follows that the odds of finding one of a million needles in trillions of haystacks is easier than finding 1 needle in a trillion haystacks...
Of course if you are living on a pulsar, then energy (from gravitational collapse) is not a worry (pulsars tend to emit frequencies all over the spectrum from radio up to x-ray), but I don't think "intellegent" civilizations are going to be tossing around that much energy w/o thinking about it.
Note that a signal from a pulsar is very different from an omnidirectional phase-coherent electromagnetic "pulse". A pulsar spews pretty much incoherent EM, but from hotspots on a fast spining object (think about a person with a gardenhose spinning around really fast, you'll see how a stationary observer will see "pulses" of water drenching her when in fact the garden hose is just spraying incoherent water).
However, it is technically possible to generate a reasonably coherent, mostly omnidirectional EM pulse from a process known as superfluorescence.
I suppose it's feasible that this would be able to be repeatable enough to generate a pulse train (imagine a spherical lasing cavity around a superfluoresenct object). For some basic info on this, check this out...
http://ist-socrates.berkeley.edu/~lvov/OSF.html
However, given the "energy" argument above, I doubt any intellegent aliens would have turned on a beacon like that (Did you see the movie independence day? Maybe turning on a beacon isn't such a great idea)...
an alien message designed to last millenia
this guy sounds like he's watching too much sci-fi. any reasonably intelligent being knows we weren't created by anyone.
The easiest artificial signal to differentiate from natural noise are signals with frequency spikes. FM and AM radio have good frequency spikes. VSB modulation which is used in television broadcasts has a decent spike. These are pretty easy to detect as manmade.
These days the trend of RF technology is moving from spiked spectrum to spread spectrum modulations that looks more and more like noise.
For example lets take TV from an alien perspective. There is a move from VSB picture and FM voice to spread spectrum transmissions. With FM and VSB the cells on same frequency must be pretty far away from each other not to interfere with each other. And to get a good picture the transmision must be high over the noise floor. The alien observer would see some strong spikes on his spectrum analyser moving along the frequency as earth turns (dobbler). Now with spread spectrum the signal is spread evenly over the spectrum so no spikes. And because spread spectrum signals don't interfere with each other so easily the cells on same frequency will be closer together. So the alien observer would see more transmitters sending evenly spread transmission over another and another and another,each with a slight changing frequency shift to each other because of dobbler. Impossible to differentiate from noise.
So new technology is changing earth from spiked hedgehodge to fluffy ball, looking just like a natural noise source.
In future the detection bubble may thicken because of microwave power transmission. If there will be solarpower spacefarms, there will be new spikes with enough oomph to an alien observer.
well, we all know what's programmed in there.
The answer is 42.
-- All your bass are below two Hz
If you are worth your karma, *of course* you remember.
It was a fairly good one at that. You had Klingons, Romulans, Cardassians, AND Vulcans.
It was the pinnacle of the spiritual socialist utopia theme. We are all genetic relatives, created to love one another and live in harmony; the wish of the creator race.
Good times.
+1 for nostalgia!
This same idea was advanced by a short story called We'll Return, After This Message, by AutoDesk founder John Walker, written in 1989 and published in 1993.
I also mentioned the same general idea in my 2002 OReillyNet weblog item, SETI not through telescopes but microscopes, about how rugged microscopic messages might be the only ones to survive millions of years.
Why is the basic assumption that aliens have technology as or more advanced as our own?
Maybe we should be the ones broadcasting (But I think we already are a bit...)
My senario goes like this...
1) WE eventualy go deap space travelling...
2) WE find some lowtech aliens, who are hospitible and kind...
3) AS USUAL we kill/subjugate them.
Less look fast, more go fast.
Some Googling turns up not only the original source (http://www.intertext.com/v2n4/junk.html) but many, many mirrors, much to my surprise. Here's one: http://www.maths.ex.ac.uk/~mwatkins/isoc/ernst.htm
Anyway, should you feel like a little light reading, check these out.
At http://www.uwasa.fi/~ts/info/latin1.html
you will find ISO Latin 1 Character Entries
such as à á â ã ä å æ ç
è
é
ê
ë
ì
í
î
ï
ð
ñ
ò
ó
ô
õ
ö
÷
ø
ù
ú
û
ü
ý
ÿ
Aliens exist and have interstellar travel, but they have seen Paris Hilton's porno tape and they are not interested in contacting us.
Aliens exist, but galactic law forbids any contact with us because we are too primitive, or violent (and Paris Hilton lives here).
Some aliens see it as their duty to eliminate all other forms of life that come to their attention. Any technological civilization will develop radio and TV, attract their attention, and be eliminated. They are on their way now, to kill Paris Hilton.
They are here already (Michael Jackson).
we can't find any intelligent life outside out solar sytem becouse there isn't any.......
:P
SETI = BIG WASTE OF TIME
That thing about DNA is funny. It obviousely came from the same idea of the earth being the back a giant turtle....whats below the turtle you may ask??? Well don't try to fool me with your logic its turtles all the way down.
If Aliens constructed out DNA and not evolution then what made the aliens....don't try and fool me with your logic other aliens made those aliens.
Rule one of all good science - always make things more complicated then they are becouse they most complicated answer tends to be the correct one.
stendec@gmail.com
Yes, I'll put my post here, why not. You probably won't read anyway.
/. fashion, you all went off on a tangent to discuss causality paradoxes etc.
In true
You attempted to discredit the very concept of quantum communication by invoking your knowledge of relativity. Eianstein himself, if he were here, would be the first to admit that Relativity is not set in stone and that there are still many 'holes' that are unaccounted for.
I think you have a bit of physics but no grasp of Quantun Entanglement. It has nothing to do with the type of causality you describe. If it even exists at all!, it is an unusual phenomenon. Have a look at the Math(s) of it. It is not classical mechanics thats for sure!.
I can just picture it now, the alien response to a light source 10,000 times brighter than our own sun...
"AAAH! Zee Glasses! Zay do NOTHING!!!!"
"42", if I recall correctly...
some poor soul was too lazy to log in for the mod points.
A planet which harbours intelligent life may produce night time light. A large enough telescope may be able to see it.
There are already plans for a telescope that can take a spectrum of extrasolar planets: TPF.
Yes, I know, the article is old and probably no-one reads this comment anymore. Never mind.
My karma ran over your dogma
Nope, Relativity only says objects with mass cannot be accelerated to C or beyond. Actually what it says is, "If a object with mass were to be traveling at the speed of light then we'd have a non-zero number being divided by zero. And we don't know what that means."
Similarly with faster than light speeds, but in this case it would be a real number being divided by an imaginary number. And we don't know what that means.
At the core of quantum mechanics is the simple fact that you cannot measure without disturbing.
Again, nope. Try reading up on "quantum non-demolition measurement".
Debunking the "59 Deceits"
Everybody is listening and nobody's transmitting!
Debunking the "59 Deceits"