Slashdot Mirror
Girls Don't Want To Be Geeks
Silas writes "According to a new study by the American Association of University Women, highlighted in this AP article, 'Girls have the ability to learn and use computers, but they are turned off by technical careers that they view as full of geeky guys'. The study blames the general sentiment on a gender imbalance in access to computers, and on social pressures that steer girls away from technology. What say you, women of the Slashdot population?" Stand up and shout on this one, ladies. I think that it takes a special breed of person to be attracted to this line of work, not necessarily a specific gender. Tell us what you think.
For the record, since it seems important to this conversation, I'm a woman.
7 ) when she refers to them in terms of children with her as a parental figure.
I am also a geek. I'm one of the few I know, despite the fact that I am attending a university in the computer science department. Most of the women I meet there are much more interested in making money. They look at computers, even when they're the ones at the keyboard, and gawk. They make comments like, "Isn't it neat what computers can do these days?" while referring to the transitions in PowerPoint.
I love User Friendly and GPF. And I would undoubtedly be interested in anyone who thought that Ki would make a good date. On the other hand, User Friendly has been dissapointing me as far as gender balance.
Miranda is portrayed as an intelligent woman who's up to snuff in all technology issues. But she's also portrayed as very different from the men at Colombia Internet. Take the recent camping trip. Miranda, interested in a "get to know each other" session, takes all the techs out to the wilderness. The techs complain, and show an amazement about the outside world they rarely visit. On the other hand, Miranda is perfectly comfortable and doesn't understand the faux pas she has made.
Miranda also considers herself above the geeks, as in this cartoon (http://ars.userfriendly.org/cartoons/?id=2000060
These examples made me very sad. When it comes does to it, I get outside just as rarely as most of my fellow geeks. I can spend hours vegging on a game and not be ashamed. I can sleep till noon and eat Doritos for breakfast like the best of them. It makes me very sad that User Friendly, one of my favorite comics, draws an arbitrary line between the genders in the same way the much of the media does.
-Marcella
dragonmlf@earthlink.net
No. I must say that this has more to do with the size and organization of the company than anything else though. The org chart is: suits: top gord: answers to suits everyone else: answers to whoever isn't one of them.
2 1337 4 u!
I think a major part of the problem is how people are taught to think. Little girls are given barbies for their birthdays and play with clothes, makeup, and the like. Little boys are given toys like legos that help them learn logical thinking skills. Hmm, could I be on to something here? Once the kids are older these skills learned early-on are still there, giving the boys the advantage in understanding things that require logical thinking skills, and producing social norms about girls not doing as well with math, science, or computers. I believe it all has a lot with what parents encourage in their children when they are very young.
I was the little girl who played with legos =)
Hmmmm. Speaking of stereotyping... I'm a software engineer at a Silicon Valley startup, and let me tell you my supergeek colleagues can shotgun a beer with the best of them. They're manly (except the ones who are women) *and* they know Unix -- what a concept, huh?
Becoming hacker to just to make money makes no geek. If girls where only in it for the money, I wouldn't want to be anywhere near any of them. Thankfully, not all of them are (Even though, the most of traditional men-jobs that woman gets into are high-paid, non-techie). Becoming a geek is to love the tech. To live with it. For it. And don't care about money, altought, money won't probably be any problem...
--The knowledge that you are an idiot, is what distinguishes you from one.
--The knowledge that you are an idiot, is what distinguishes you from one.
If I might say something to your statement of what turns us off...
You are correct, at least from my point of view as a once-just-a-shy-chick-now-an-altena-girl-geek-of-s orts. Girls who are not fully geekified, or who care about what the rest of society thinks, are embarassed by guys who rant in public about the virtues of Linux over all other os (although we probably agree :) or how much so-and-so sucked at UT at the last LAN party...
If we are not already a geek, you are probably going to have to live with it... If you want to convert them, go slowly.. Introduce them to Quake, but don't whip their @ss the first time.. Show them cool sites, such as slashdot (i worshipped the guy for like a month after he showed me this site in ninth grade). Don't make fun of them if they don;t understand and don't be too too critical of their efforts (there is no worse turn off than having your just-learned-and-wanted-to-try-it-myself code shot down and totally dissed by some guy). Encourage them and if there is a spark of geek in them, perhaps it might catch!
Some chicas want a geek guy... The guy just has to be able to handle the fact that they probably think very alike... and he will be faced with a reminder of work at home... Most chicas can handle it, how about you?
just my cdn 2 cents
~meMost parents, unintentionally, will treat their children differently based on their preconcieved notions of that gender. It is most likely very unconcious, but it happens. It is this social conditioning that I think really creates the disparity in technology careers. By the time girls (and boys) first reach school, these concepts are already programmed in. It doesn't just affect interest in math/science/comp.sci... but that is one effect.
(For example, in the average grade 1 class, most girls are much better with "fine motor skills"... they can use scissors much more effectively than the average boy. This is likely because boys are encouraged to play outside more often when they are young.)
These sort of seemingly trivial differences end up affecting how girls view math and science, and they are less likely to pursue those topics in high school and university. It becomes a vicious circle, because there are few women in these fields, there are fewer role models.
---
I hope you're not pretending to be evil while secretly being good. That would be dishonest.
I don't quite see the point? : )
If you suffer from Cinderella Complex, you need
to find a guy that promises
- social security (okay, geeks have money)
- status (well, you know what people think of
geeks)
- protection (well...)
- and perchance someone to generally take care
of your decisions and shite.
One out of four isn't great. And trainable...
well, having to do that at 17 is okay-ish, I
suppose, but at 25 or 30, most people I know
expect their partner to know what they're doing.
; )
If OTOH you have no particular need of dating a
father figure or what-not, why not date someone
who can *really* understand the way you feel? ; )
HHOS,
Azou
Disclaimer: I'm not saying all geeks are as
described above; I'm referring to
how the unassuming public seems to
see you guys, in terms of stereotypes.
Azundris
Don't assume we're in it for the guys.
</i>
<p>
You've got to be kidding! (Geek guys...come on!)
See, now if everyone in the world could reach a consensus like this, all our problems would be solved! =)
*sigh*
--
Oh, please...it definitely has its moments. My FEMALE roommate and I were watching it, and they had this bit where they go to the mall and postulate this question to women: "If you could have an operation that made you smarter, but your butt got bigger, would you do it?" To a one, every woman asked said "no". Both my roommate and I found it very funny. Of course, being male, I enjoy the girls on trampolines, and my roommate leaves the room during that bit...
So 70 teenage girls and an unspecified number of grown women talk about their impressions? And this is supposed to explain why women are underrepresented in comp sci and information science? The article seemed to blame the girls for their lack of participation in 'geek' pursuits; it's all the fault of their superficial preconceptions, etc etc.
As a recently-minted (female) geek, this stuff makes my blood boil. Since when do we blame girls for believing what they are told throughout their lives - that tech stuff is hard and boring, that they are made for better things (left, of course, unspecified), that there will always be a man somewhere to fix their mistakes. It's a social problem, hardly limited to the minds of young women, yet the article makes it sound as if their little bubbleheads just can't hold the necessary information.
I stayed away from the technical side of computers for a long time because I was afraid of getting something wrong (and when you had an overbearing father like mine, this was a valid fear). It seemed better to avoid the challenge than to fail. I realized a while ago that this was a stupid way to go about life, and started learning more and stretching my boundaries of 'acceptable failure'.
Young women are poorly educated - on the whole - in math and science in the U.S. public schools. So why should computers be any different? All young people need to be socialized better to explore challenge and potential failure, whatever their gender. From my seat, that's the only possible solution.
--
this is not my beautiful wife. TH
When the Himalayan peasant meets the he-bear in his pride,
He shouts to scare the monster, who will often turn aside.
But the she-bear thus accosted rends the peasant tooth and nail.
For the female of the species is more deadly than the male.
When Nag the basking cobra hears the careless foot of man,
He will sometimes wriggle sideways and avoid it if he can.
But his mate makes no such motion where she camps beside the trail.
For the female of the species is more deadly than the male.
They prayed to be delivered from the vengence of the squaws.
'Twas the women, not the warriors, turned those stark enthusiasts pale.
For the female of the species is more deadly than the male.
Whith his fellow-braves in council, dare not leave a place for her
Where, at war with Life and Conscience, he uplifts his erring hands
To some God of Abstract Justice--which no woman understands.
And Man knows it! Knows, moreover, that the Woman that God gave him
Must command but may not govern--shall enthral but not enslave him.
And She knows, because She warns him, and Her instincts never fail,
That the Female of Her Species is more deadly than the Male.
- Rudyard Kipling, 1911
Living a life completely cut off from the world and being in control of your own life is powerful in a way. But it is not influential. A teacher can be influential, which is another form of power. You are very right in calling some teachers powerful. But there are a lot of teachers who are unable to do their job (teach) because of the circumstances at their workplace (being full of weapons, lack of funds, whatever). These teachers are powerless.
In short, you are right when you say that influence over others is power. You are also wrong when you imply that influence is the only form of power.
Feeling in control of your life makes you feel powerful and secure about yourself. Certainly, this is more important than being able to control others. There are probably a huge number of CEO's and VP's of all kinds of companies around the world who feel an enormous lack of control over their own lives, but who are at the same time very influential. They make decisions concerning thousands of people's daily life every day, yet they can't just take time off whenever they want to play with their kids (or even be home at 6 to see them after work).
There is power and there is power.
"War is God's way of teaching Americans geography." - Ambrose Bierce (1842-1914)
>>Total I think there is like 12 computer geeks, about half of that which are morons.
Having never met the six people you are refering to, I need to ask you - Are they morons because their personal priorities don't match up to what you judge as good and propper? If so, mayby you'd better go back up to the top of the page and start again.
Get the Hell off my planet, you slimy mobster Bush!
I think Geeks in General have still not been accepted into society. The Pressures to fit in , be with the right people,and even on occasion be the right color, play a huge role. Even the the Tech Industry is a money making one(even thought geeks do it becuase they like it) it does not look "good." If the want more girls make geeks socially acceptable
If we refuse to be flexible, we are in effect opting out of the game of life. The world moves on without us.
i dont believe thats true. i'm in school majoring in computer programming and in my computer classes the majority of students are female. there are a fair amount of males, but us women are surely taking over! it has nothing to do with "geeky guys" being interested in computers, i know a lot of guys that are NOT geeky that work with computers. if anything i would think more women would want to get into this field to try and meet guys! i've found that they are nicer and not so egotistical :)
dont let the system crash you...crash the system! -oceangal
Sudbury, Ontario ~me
The fairly general argument in this discussion has been that "women think emotionally and men think logically". This argument can also be reversed to say that (most) men are emotionally impaired. In their childhood, girls are allowed to show their feelings openly while a boy who shows his emotions is thought to be weak and "girlish". Most boys learn before long that if they want to be popular, they'd better play by the rules of the majority or they will be alienated in school. Maybe some of these (alienated) children become geeks at a later time. Many geeks have told to be unpopular at school, but assuming this as a sole reason for geekhood is oversimplification.
Yeah, I was an emotional male child, I had my difficulties in school, but I've pretty much came over it. And I'm proud I've not become autistic in the process, despite the peer pressure. I was also laughed at because I spent all my free time with computers. Nowadays I'm working as a UNIX sysadmin in a big multi-national company and I probably get twice as much salary as those who laughed at me. The one who laughs last laughs best, they say:) But I don't really really believe that being emotional and logical at the same time would be impossible or even difficult for the same person. Actually that's the biggest and most ubiquitously accepted lie I've ever heard. You can be purely a technical person, but that doesn't help you in your private life. Or if you think your VCR's remote control is technical enough not to be worth learning, that can be quite restrictive nowadays, too.
--misty@sgic.fi
I've been reading slashdot for about a year now, and I love it. I know html coding. I know that that does not make me a geek, but I cannot find anything real that I could do with any of the other languages. I know that C C+ and C++ can be used to create a MUD, but that is all the use I know for it. With java and perl, pretty pictures,moving text, and cgi. Maybe if there were more on what all the languages can do? I have always been rather slow at math, but all of the computer languages I have seen and tried through tutorials on the web have been really easy for me to pick up on. If ppl spoke about languages, instead of mathematical code, and there were more examples of what the different languages do, maybe more people, including women, would join the geekhood?
Why is it that people have such a hard time believing that men and women are "wired up" as much by nurture as by nature? Seriously, how exactly do you know that women weren't persuaded by their culture to move into other careers?
It's really annoying to argue this point in an environment in which posts refer to people who ask important questions like this as "feminazis" (Score: 5). But come on, really! I'm not saying that women are poor and downtrodden. I'm not ignoring decades of work towards gender equality. But I am saying that perhaps upbringing makes a difference. That could be good, bad, neither, whatever... I don't care. But why the hell do some people fail to acknowledge the possibility?
Maybe because it implies that, as much as everyone wants to believe in free will, our decisions are ultimately, very heavily, influenced (though not determined entirely) by our environment and experiences?
In general, men and women aren't the same.
When people try to deny it, I think they are really oversimplifying because it's easier to "assume that everyone is the same" than it is to grok and communicate the real issues involved in treating people fairly. And our societey tries to value fair play.
Ultimately, eneralizations are of limmited use when dealing with individuals.
- bridgette
The geek guys here constantly arguing that they are right about how the situation is for girls, as if their life depends on it being a certain way. Earn your trophy! From outside this competition, it looks so silly, but they won't listen.
I am a girl. I would definitely classify myself as a geek. I love computers, science.. and so forth.
I admit I find this situation a bit sad, but I also have very strong and different feelings regarding this subject.
I do wish there were more girls in science. It would be nice. Sometimes I would not feel so alone in the male throng. Its kind of tough sometimes.
I definitely agree with others that socialization plays a huge factor in what people choose as their lifestyle and careers - both men and women. Don't be one sided, men are encouraged in high school to be jocks more than scientists these days (but hey this has happened for a while now). Girls are still encouraged in areas that gift the world with homemakers and entertainment (dating, advertising, waitressing, + the rest of the whole yuck yuck in crowd).
What really bugs me is that its not just school and open human mingling that influence -- its parents, blind role models, businesses, peers, & the almighty buck combined with glitz.
Although -- I am tired of hearing of women whine about how men get this and that when women do not actively go after the jobs they feel women need to part of. In truth women and men are cultures amongt themselves. There is nothing wrong in showing pride and desire in yourselves(-) the inflated ego. But there should be equality... but I think for the right reasons. I wish we didn't have to have affirmative action. However, it is still a necessity.
However, I strongly believe... if you ain't got the skills and know how for the position you have been hired into... then the position has gone to waste and there is no contribution. (--mind you I know this can't speak for every situation).
I sometimes wished I had the opportunity to have been paid more attention in high school. It seemed that I got overlooked when I was truly interested in math and science when others were being recruited to fill quotas. What I mean is why do people who really really want to be in a certain field get overlooked. These programs are coming way too late in my opinion. It is going to take years to unravel the damage done to womenThese are just some thoughts on the matter.
Ciao, Seine
Truth like surgery, may hurt, but it cures. - Han Suyin, Chinese Physician and Writer
The reason this is so is because of the ideology of 'the mommy track' that several sociologists have written about. The theory is that 'all women are going to grow up to become mothers and then quit their job to take care of their children'. I can't recall the authors name right now, but there is an article in the book 'Feminist Frameworks' that talks about it.
Thus companies are reluctant to advance women to higher positions because they believe that it won't be a good investment because they're just going to leave after they have children. So why bother making an investment like that in a woman whos going to leave when they can just make the investment in a man who won't.
Now before I personally get flamed, I'm just presenting the ideology that created the 'glass ceiling' concept. I personally don't believe in the mommy track, but I can't deny that it is probably a major component in creating the glass ceiling.
Things you think are in the Constitution, but are not.
We are constantly bombarded with media images of women who are obsessed with lipstick, clothing, weight, popularity, perfect skin and hair.. and the list goes on and on. Under this constant pressure, and even for reasons completely unrelated to it, many women are indifferent or even contemptuous towards intellectual pursuits.
The media might be responsible for some bad ideas that girls get of what a woman should be like.
However, as women make up about 50 percent of the people at universities, that obviously doesn't keep them away from the intellectual challenges of university. They simply seem to study other things, for whatever reason.
There is an interesting article on that, 'Why Are There So Few Female Computer Scientists?'.
Have you ever read any of Feynman's books, like "Surely you're joking, Mr. Feynman"? I'd say misfit describes him quite well, in the same sense that it does many other brilliant people. And I don't confuse "absent-minded" with fool, having often been accused of being the former, and knowing why.
Regarding the original quote that spawned this debate, it sounds like so much apologism to me.
Actually, I agree, but despite any between-the-lines messages, I thought it was an interesting idea. You could say something similar about managers in most companies: their job is to look at the big picture and not worry about the small details. This doesn't necessarily make them less useful (an arguable point in many cases!) In the case of the best managers or executives, though, their level of focus is invaluable. My previous post was just pawing weakly at the idea that perhaps our wonderful technical skills shouldn't be the envy of everybody else, as we so often seem to assume it should. We're just the janitors and garbagemen of the digital age, digging around amongst the mucky details allowing the rest of the world to serenely pretend they don't exist. Oh well, at least we're well paid!
My S.O. could testify for this : when we geek guys unleash our techspeak, we just make any non-geek feel stupid and ignorant, both men and women. Now don't start tossing eggs in my direction, I don't sit on these stereotypes but I will use them simply to expose my theory.
Now the problem might stem from the common observation that men are typically better with pure logic and can usually figure the stuff out with a few well placed questions ("So you're saying this CPU thing is like the carburator ?"). Anyways, in contrast, women seem to have (in general) much more difficulty in relating abstract concepts to more physical/familiar counterparts; they're more confortable sticking with purely abstract things, not crossing over with metaphores and real-life examples.
Let's take our favored example : Math. I'd have to say that 90% of all women I've known totally suck at math, yes even my geek mother. It's a very exhausting experience watching my gf do her math homework, mainly because she asks me more questions than she has to answer. How hard can it be to understand that a trapezoid is really just a square + 2 triangles ? I must have spent the whole afternoon shoving some spatial sense into her head.
Anyways, PC's are prime applications of this abstract-to-concrete train of thought. We have small rectangular icons we call "objects". They're not the objects like coke cans, or long-range throwable desk phones.. but if you can look beyond the physical aspect, the computer representation of an object is right on par with the real-life object. This is the key analogy that most female specimens seem to have trouble with. I'm not saying they're too stupid to figure it out, because the ones who persevere DO end up grokking the goods, but it's a relatively long process for women, at least from my personal observations. IMHO, women who have difficulty with this type of symmetric thinking are the ones who shy away from technical jobs because they have more trouble deriving solutions when faced with unexpected hurdles.
Another thing I've noticed is not necessarily the hostility of non-geeks vs geeks, but more importantly the reverse situation. Intellectual, technical types such as myself look upon the rest of the crowd as somewhat ignorant and pointless. Spending a day without thinking, without creating.. that's a wasted day to me.
My gf throws a small fit whenever I spend more than 10 seconds at the keyboard when she's around, which usually results in her being totally ignored for a few hours to pressure her. It's a natural reaction to her hostility toward my career, and I'm sure it gives her a bad impression of the type of people I work with. We're all highly focused tech-gods, each trying to prove him/herself right and the other person wrong. This holds for "geek girls" as well. We have a spoonful of them here, and they're a bunch of sore-tempered perfectionists. Now quite frankly, I'd rather have a dumb but sociable assistant, than these long-haired psychos. Anyone who knows a true geek girl will agree with me that they're independent, stubborn, and aggressive. Just like us guys. The problem is that this behavior may be expected in men, but most managers just don't know how to handle it in women. The workplace is such a gender-centric environment. I'm one of two tech guys transplanted into a human resources department, and wouldn't you know, we're the only guys on the whole floor. Managers hire along certain gender patterns, and people apply for work along similar patterns as well. All these things are slowly changing with the implementation of a gender equity process, but for the time being, every single department is dominated either by men or women. And gender favoritism set aside, there will always be more guys in tinkering work and more women in paperwork. That's just what we each do best.
-Billco, Fnarg.com
I'd suggest modding this up from (score 0, Troll) to (score 2, Insightful)
Moderators: have you heard of "I disagree with you but will defend to the death your right to say it?"
"This was the noblest Roman of them all"
So, tell me, would you consider them a powerful group? If they where so powerful right now, they would be paid more. This is just an example picked out of a million similar examples.
The ability, opportunity and will to work together makes a powerful group. This group can be small, with huge assets (money, companies, land, governments) or a large group with small means (unions (not always poor), environmental groups) and so on.
Being powerful means being able to influence your own life. That is what makes poor people powerless, because they have very little means of changing their life.
What makes it important to make women interested in technology? It's purely survivalist in my book. I want diversity. I want every type of human being to participate in every part of society. This makes society sturdy, and more capable of handling extreme situations. Incorporating views of many different kinds of people into the creation of any product makes that product so much better.
What people want can be influenced and changed. What we need, is always the same: Power to affect our lives and time to enjoy it.
"War is God's way of teaching Americans geography." - Ambrose Bierce (1842-1914)
Here! Here!
Wait, is that bad?
:-)
This is mostly because of carrer choice. Tech jobs can pay very well. Some people feel that gender pay inequality is bad for society in general - contibuting to the childhood poverty rate and such.
There are rather more factors involved. Many of which are outside of "employment" issues. One of these is that whilst it is not acceptable for a man to "marry for money" it is acceptable for a woman to do so. (Women demanding husbands and boyfriends earn more than they do undoubtedly contributes to these kind of statistic.) Another factor is that state and charity "welfare" are often not gender neutral in their application.
Much of this statistical difference could be accounted for by men having to "pay their way" more often than women.
There are lots of reasons but I believe that the 70% figure only counted people who actually work, so housewives and welfare mothers weren't counted. The statistical analisis concluded that the biggest determing factor in one's pay is one's job choice (No, really?) . There are lot's of other factors but carrer choice was the biggest. Women who don't feel pressure to be head of the household, because their husbands make more money, may choose less demanding positions that don't pay as well. But remember that there are single mothers, single women, women who don't subscribe to the man-as-breadwinner mentality and women who don't end up with a high-earning man. And with the increasing finacial pressure on the middle class (it's well documented that the middle class is shrinking) 2 income households have gone from being an option to being a necessity.
- bridgette
One thing that bothered me about that article, is the 'oooh, icky-poo!' attitude of the female people they quoted. IMHO, the woman they quoted can go have and have her stupid non-tech career, and I hope she fails miserably and has a disgusting job while seeing all those icky geeks around her do well. I hate this attitude, and nothing makes me shut down more with regards to helping someone than hearing it.
The chicklets they quoted were super annoying. Makes me wonder whether most highschoolers are that vapid and grateing or if the reporter went out of his/her way to pick the most inflamatory comments.
- bridgette
I am a mechanical engineering major, which I consider to be a technical field. I am also female. Although there are not many women in engineering/computer science majors at my university, I think that the imbalance is not due to social pressures.
As a kid, I was always playing with Legos. I began programming at the age of 5. I have always known that I would have a career in engineering. Despite the fact that neither of my parents have technical careers, I am just the sort of person who enjoys technology and engineering. It's part of who I am. I know a number of other women who have the same abilities and enjoyment of technical subjects. Vice versa, I know males who do not.
I can see where the socialization argument comes from, that girls are discouraged from technical careers. I would have agreed with that 20 or even 10 years ago. Today, however, I have never been told that I am unable to have a technical career or that I am going to be a bad engineer on the basis of my gender. None of my female classmates have been told that either.
Essentially, technology is in my blood...engineering is something that I am good at and that I plan to do for a long time...no one can tell me that I can't do it, simply because I'm a girl.
Katie
"The future belongs to those who can look at a challenge and see an opportunity."
one word: duh!
That's exactly the point... but you still don't get it. WHY don't women want to go into these fields and why are they generally less interested in math and science at school?
I don't think it's because they are "wired differently". I think it's because of unconcious social conditioning. Subtly, our parents and schools have molded our expectations, based on theirs. Most girls, no matter how 'progressive' their parents are, have dolls, and most boys, have action figures. The mode of play encouraged is very different. What does this suggest? Sure, you can brush this off as of no real importance, but these small differences when we are children is what make us into the adults we are and what controls what we want to do. I bet if girls had more of a chance to play with computers when they were young, and if they were not discouraged, there would be more women in technology.
Note: when I say 'discouraged', I don't mean directly being told they aren't smart or that computers are for boys. I refer to the subtle pressures of their teachers and classmates. (Don't kid yourself, they are certainly there. Despite being in the same classroom, boys and girls often DON'T receive the "same" education. Reliable studies have shown that boys are more likely to get chosen to answer questions, for instance.)
---
I hope you're not pretending to be evil while secretly being good. That would be dishonest.
normal geeks as in science, math, band, chorus geeks, just like me. :>
Chris Armstrong
Chris Armstrong
This is a cultural issue.
Over here in the UK, we have a pretty high proportion of technical women (as opposed to women who train, or simply operate first-line Helpdesk/tech admin type positions). Certainly, it's geeky work - but there are plenty of women who are unafraid of being pointed at and called "geek-chick", provided they're taking home the nice, fat, geeky wage packet at the end of the day. Perhaps the American issue with a low number of technical women has less to do with the perception of "geek" as an unattractive position, and more to do with the slightly old-fashioned middle-class-white-American perception that the men should be the ones who earn the money.
While working in the US over the last few years, I have noticed that the majority of caucasian women who work in IS tend to be based on the customer-care side of the business (training etc); while there seem to be quite a few asian women in very technical roles (DBAs, cutting code etc).
This is no derogation of either caucasian or asian women - but perhaps this is a cultural issue where both cultures define "doing well" differently - one seems to be based on traditional western "feminine" standards; and the other is more focussed towards career-based issues, rather than whether one is perceived as "feminine" or not.
H.
If in reality "Most link self-esteem to technical knowledge, and sometimes the easiest way to elevate yourself is to belittle someone else"
I am suprised no one has gone postal yet.
The situation you describe is not healthy. Most people would consider it an honour to pass on their knowledge, especially if they were taught by such a person in the beginning.
Hmm... perhaps the nature of the common self-exploration of computer knowledge inspires intellectual arrogance?
Maybe the problem with getting women into IT is the perception that anyone working in the field has to be a 'geek'? Just because you work with computers, doesn't mean you have to eat sleep and breathe computer (although it helps :).
It doesn't seem to be computers-as-technology that keeps women away; I think it's presenting computers as-a-life-choice that's the problem.
--mulch
--mulch
--mulch
The
The reason that there are so few geek girls out there, as opposed to geek guys, is actually rather simple: On average, as many girls as guys start their geek carreer. But, then it happens: because geek guys are so very sexy and fertile, the geek girls get pregnant and turn into wetware-hackers (a.k.a. 'mothers'). So that's why we don't see em that often! Wow.
If there was more girl geeks, it'd make for interesting mid-coitus arguments about BSD and Linux.
Maybe he's onto something.. if there ARE chicks in CS, I definitely think they should partake of some fine canadian beer.
BilldaCat
it can't be social pressures steering girls away from technology, because frankly, social pressures steer GUYS away from technology too! I mean, really, football is a lot more popular than chess club, and the social pressure is always on in school to perform athletically. It's no different for girls than it is for us guys.
What's your damage, Heather?
We I started University there were very few women engineers, by the time I left (6 years later) there was quite an improvement. I think that support is needed to associations like the Society of Women Engineers, PASAW, and other womens groups. I sure that having male members support is just as key, the females.
CAD, kicked, good
Must be terrible on people looking for a geek wife.
guvf vf zl fvt
Shine on, you crazy diamond.
Amen to this. The real problems happen once a female attempts to have any leverage in a company...from my gf's experience at corps and startups it varies not by the size of the place. (Yep, the grrrls DO get sent off to "Web design!!!)
But don't blame it all on the "money guys"...at all those places she's been they used to be "the programmers"
Seems to be that the problem is...a GUY thing.
I will have to say that it's been a difficult trip for me, especially since I'm one who is hardware inclined, which is, I think, one of the rarest of geekchick types. I've been tearing apart and putting my computer together since high school, and have noticed that when guys discover this, I get one of 2 reactions:
1. Utter Disbelief.
2. Instant attraction.
Serously, even my husband said that he was more attracted to me when he found out that I had my own computer and liked to take the bits out and rearrange them and put them back in.
The biggest problem I have had in the work environment is the Utter Disbelief category. Most guys I run into refuse to believe that I know anything about computers. It is so frustrating to run into this, time and again. Even where I work now, I'm call center support instead of true IT, because of any number of different excuses, yet I see them hire some completely new male bozo instead of making an in-house hire.
*sigh* but I guess that's what I have to put up with for not being the accepted gender.
Oh, please...it definitely has its moments. My FEMALE roommate and I were watching it, and they had this bit where they go to the mall and postulate this question to women: "If you could have an operation that made you smarter, but your butt got bigger, would you do it?" To a one, every woman asked said "no". Both my roommate and I found it very funny. Of course, being male, I enjoy the girls on trampolines, and my roommate leaves the room during that bit...
... if i could make my butt as big as Jennifer Lopez, I wouldn't need brains :)
it wasn't every woman they asked, it was every woman they showed. They probably asked 50 women and edited it down to the 5 funniest. That's how t.v. works. I'm sure if they asked guys the same questions, except making the penis smaller they'd get simmilar results.
Although, they probably didn't ask any latina or black chicks
Quoting my MALE hubbie: "I've seen teenagers getting high for the first time not giggle during the man show, I'd rather read Bazooka Joes. "
- bridgette
Hear hear. There's more diversity in programming than in plenty of other fields: say, high school teaching ("source" of ideas like these) or newspaper journalism (where these reports get written and published!)
Don't recall meeting too many women high-up in either....although it's true every company wants a killer babe in marketing
This is exactly what I was trying to say. Computers are highly technical things, and thats why more males seem to go for them. To suggest the reason there *aren't* more females in computer science fields is because they're afraid to or don't think they can is just nutty.
I tend to believe (ie- might not be pure fact, but it sure has evidence, IMHO) that most females just plain aren't interested in the IT field. Most don't *want* to become sysadmins or programmers.
My girlfriend, for example, is a very typical female. She's 20 and trying to attain her degree in Theatre and already has had about a half-dozen requests from some fairly prominent organizations before she even had a degree! Now take me, a fairly typical geek male. for example. I never want to be a Stage Manager because a) it involves a LOT of stress b) The whole theatre community is about 100x more social than I like to be. Ergo, it's nowhere near my line of work.
Would she make a very good programmer? Of course not. She's been using computers for years now and still is afraid to experiment with her Windows95 Appearance settings.
Now what point was I trying to make here... kinda went of on a tangent. Anyway, my gf and I have completely different interests which is mostly due to our gender. Neither of us can help it, and no amount of convincing is going to get her to take up something like software development.
I am a 15 year old girl who is very interested in computers. I find that girls don't really want to be noticed in this field because it is such a male dominated one. Some of these males even like to intimidate the women so that we do not feel comfortable OR they think that we aren't as knowledgable when it comes to computers. This is not true! Give us a chance! So the next time you come across a girl in your field, don't jump to conclusions! Thank you...
Well I went specifically out of my way not to sterotype every single person of a specific sex into one group (ie- Every male likes cars). But it is, however, fairly obvious to me that most people of a specific gender tend to exhibit the socially recognized traits of that gender. (ie- Most females have painted their fingernails.)
I realize that not every male is a computer geek, but anyone can tell that a female computer geek is the exception and not the norm. Which is not to say that I don't think it shouldn't be the norm... I personally don't care one way or another what % of the geek population is a certain gender. Things just are what they are.
"The way NT mounts filesystems is something I'd expect to find in a barnyard or on a stock-breeding farm." -Mike Andrews
Must have accidentally slipped their minds... :)
That was cool man.
Much/most of mainstream society has already shifted to eliminate any obvious bias against any one group going into any particular field (yes, I'm sure you can bring up instances where it hasn't but I'm talking in general here). So why do we still have an abscence of women in tech fields, men in nurturing fields, indigenous peoples in college, etc etc etc?
Personally, I think it comes down to us expecting society as a whole to change too quickly. We can change the concious public statements easily. Funding, sure thing. Obviously racist/sexist application schemes? No problem. Underlying attitudes you learned at the age of three, when times were less enlightened (and you're in your mid twenties)? Err... no.
Like it or lump it, while your conciousness may say 'There's no difference', your unconcious makes certain assumptions and uses various biases that are so ingrained you don't even realize them any more. Think of the old brain teaser about the boy and his dad in an accident, the boy is hurt and goes to surgery, the dad is in the waiting room, and the surgeon says "I can't operate on htis boy, it's my son", and you're supposed to get caught by not thinking the mother could be a surgeon.
The same kind of biases get taught very early on. Anyone over 20 right now, maybe even over 10, is probably pretty mired in them. God help anyone over 40 (IE: the execs/management in many firms). They're trying, don't get me wrong, but their basis of reality can't shift that much and their concious will always be at odds with their instincts.
For something as major as "everyone really IS equal", I'd say you're looking at two, maybe three generations before it will become truly pervasive. By my (non-sociologist) take on it, we're about up to the second generation. Once our kids get into power, the entire thing should be leveled out, and a more natural balance will take effect.
Hopefully.
Comment removed based on user account deletion
Harder for women than men? You are kidding again, if you want to do something, just do it and stop bashing it's the next door guy faults if you are not what you think you should.
The problem is with women themselves, the day they will see themselves as human and not a special human, things will really change for them on an individual basis. In the mean time, I don't feel guilty of anything and I will not do something special to make life easier for women than for men.
Everyone is responsible for his/her ass!
Granted, I'm only a lowly HTML programmer/artist with a very small capacity for programming and mathmatical brain functions, but damn! I love being in that little clique of the world where I don't have to put up with cattiness. To me, guys have always been more well-suited to the world of computers. I mean, c'mon! Can you imagine what the world would be like if women ran the industry? No Quakes, no Diablos, and no other bloody, dark, shoot 'em ups! Instead, we'd be plagued with "Barbie's 3D Shoppin' Spree," or, "Twiggy and the 13 inch waistline: Quest for Dexatrim!" or other horrible ventures! *weep*
I don't buy any of the "it's a gender cap" or, "women aren't encouraged" crap. My parents had me on a computer as soon as they could afford one. (When I was 9 or so.) I have two sisters; neither of them are nearly as interested in computers as me. The prefere boys, shopping, etc. Probably why I don't get along with them too well. ^_~
Anywho, at the risk of being rambly, I'm tossing in my two cents and being glad that for the most part, I don't hafta put up with a bunch of girls. *ick*
~Sub Girl ."
"'Cause we're living in a material world, and I am a material girl. .
It's not that girls are turned off by technology, science or math, it's that girls are turned off by geeky guys canstantly hitting on them. This is easy to see when working on IRC. And as a side note, some of us guys are turned off by geeky gals hitting on us, too. HEHE, fewer guys are turned off by geeky gals, than the other way around, though.
Retired dinosaur, simple user, volunteer, guinea pig
See this poll for evidence. There's another one from 10/23/99, but it was screwed up a bit that had 10% of respondants claiming to be women.
Why are all the highly moderated comments written by men? Because the vast majority of all comments here, even in spite of the fact that articles like this seem to draw more women posters than usual, are written by men. It's all statistical sampling.
If it's for-profit but free, you're not the customer -- you're the product (e.g., the Slashdot Beta's "audience").
Oh, hey. I wonder why both links to his site are broken? Could it be because he's full of nonsense? You know, if you're lying, you're guilty of libel.
Having read some of his posts due to the link someone else provided, you can see that he has posted a long series of utter garbage in 3-5 minute increments. This could easily be categorized as a denial-of-service attack. I hope they honestly are taking him to court, and I hope they clean him out for it. This is a privately-owned forum, and they have every right to bar unwanted people from posting on it and from wasting their server resources. All those aritcles he flooded with nonsense have to be archived in full or manually trimmed. This is an abusive waste of Slashdot's resources, and we don't need his kind here.
That's what USENET's for, after all.
If it's for-profit but free, you're not the customer -- you're the product (e.g., the Slashdot Beta's "audience").
Certainly. The problem is that much of society still has this sexist/romantic view that, when the going gets tough, the men come and save their "weaker" companions . . .
There have been studies (I personally hate studies, as well as benchmarks) that support the idea that females, in general, learn best in a classroom or other formal setting. The studies show that males, on the other hand, learn best by trial and error (reason we usually don't read the directions?).
If this were true, it would certainly help explain the discrepancy in the ratio of females to males. The computer industry in general needs people who can relate their lego building skills to solving Real World problems, and not just run to Ken when something more than the normal classroom situation comes about.
Think about how you first learned to program, use an operating system, or whatever. Chances are you didn't go out and get some stupid yellow covered book (most of the people here not talking about Beer, Grits, and Portman at least).
--
Never trust anyone over 90000.
It is because of social pressure that many girls and women do not want to be associated with geekdom in any way.
One reason people have not mentioned but which I have sometimes seen is the usual "one of the boys" argument -- a woman who is seen as being "one of the boys" because she is a geek is therefore sometimes seen as being a lesbian. This does not make sense and smacks of homophobia, but some people do see it that way. The social pressure to be a "normal" straight woman who has a life and career that are expected of straight women is quite strong.
Being a lesbian myself, I've seen that there are actually a lot of lesbians who are programmer geeks, but there are also a lot of women in these fields who are straight. There's certainly no direct correlation. I also know a lot of gay man who are geeks. It's true that the computer industry has been historically more gay-friendly than most industries -- some companies had domestic partnership policies as early as the 1970s (Apple for example).
So that's one extra thing about social pressure.
As for intimidation, take this scenario -- woman is behind the Help Desk. User walks up. User ignores woman, and says to the off-duty male help desk person who is lounging off to the side "Can you help me?" assuming the woman, because she is a woman, is not even worth bothering to ask. This is especially true if the woman is feminine and pretty -- the users and the other consultants/help desk (guys) often condescend to the lone woman.
Third, there's the misperception among all people of all genders and sexualities that the computer world is solely a technical domain. This is not true. For example, I worked for eight years in a place where the humanities melded well with computing, creating a beautiful mix -- a rich and rewarding environment in which to work.
Just like some men. The point is, not all men are good with technology and computers and code, and not all women are good with them either. Unfortunately, due to this article and many others like it, we are going to see an influx of women who just want to get into it because they are ticked off that it is "male dominated". What this really means is that we are going to have a whole bunch of new people who really have no natural talent for computers, but are in the industry anyways. For all of us "real" geeks, the ones who got into it for the love of the craft, this means that we are going to be spending the vast majority of our time either training people who really have no basic interest in what we're teaching, or cleaning up the messes made by people who have no skill for computers.
I know I'm probably sounding like a pretty chauvanistic jerk right now, but the same thing goes for guys who are getting into the industry just because it offers larger salaries. The only reason to get into a technical field is because you love the field and you have a talent for it, not to "balance out the gender gap" or to "make the big bucks".
That's just my thoughts on the matter.
The chains are broken
Loki is free
Ragnarok is at hand...
Actually, there are many girls studying math. More than guys, iirc...
.sig
phobos% cat
phobos% cat
cat:
Shouldn't have to. But this is the real world. In an environment where everyone "owns" her/his projects (and everyone is over-worked), how do you deal with the loss of a quality employee for six months?
It's very difficult to transfer all the knowledge, the contacts, the understanding of a project to someone new - particularly if the recipient is already burdened with her/his own work. It's even more difficult to train a temp or a new employee.
There can be a definite expense to the company to lose an employee on maternity/paternity leave. Legislation or not, it's still an inconvenience at best.
Touche.
Labour law is one thing. Working environment is another. Is it reasonable to expect in this industry that when you return after six months, that nothing will have changed?
In that time, customers who used to deal with you directly may have forged new contacts with your co-workers. You may have been passed over for promotion. Projects you were working on may have wrapped up.
All of these are very possible. They may be unjust, but nobody ever said life is fair. It's definitely a setback.
I have a problem with this reasoning. Often these types of grants are very poorly advertised, and the only people who end up getting them are the ones whose parents know about them in the first place - not the parents who work 60 hours a week in some hot kitchen to make ends meet.
Studies have also shown a predisposition towards different types of "play" in infants - who are very unlikely to have been contaminated by social expectations.
I don't think it's entirely valid to point to just one study and say "this is conclusive proof". There's no such thing as a conclusive study in psychology. It's virtually impossible to design a study that isn't riddled with confounds. Nobody is really sure how much is nature or nurture... but pretty much everyone agrees by now that most behaviour is a product of both.
Good for you! I think this is exactly more of what's needed. Positive role models, not legislation. More importantly, active participation for everyone involved, not selective exclusion by gender.
--
Speaking from personal experience, I do believe
that alot of girls do not wish to pursue technological careers, but I do not agree with
the reason given, that:
'they are turned off by technical careers that
they view as full of geeky guys'
I admit that while I was a highschool student
( and immature ), I was indeed turned off by geeky guys, but that did not stop me from getting a degree in computer science and becomming a programmer, that would have been foolish to let
such a thing stand in my way. In fact, when I got older and more mature I no longer saw geeky guys as geeks, but rather as intelligent human beings, and I ended up marrying one.
I believe that girls who won't pursue a career
because they are afraid of being associated with the wrong crowd, or are turned away by the
'geeky guys' in the field, are weak in general, and probably let their friends and family run their lives in all respects, and probably don't have the determination and self-discipline to
make it very far in the field anyway.
I have a collection of lectures by Ursula Franklin (a retired physicist from the U of Toronto) that sort of addresses what you're talking about. She doesn't go along gender lines though. The book is very dry too. I hope she was a much better speaker.
But anyways, she does mention a book called "Economic Anthropology" by M.J. Herskovits (NY: Alfred A. Knopf, 1952) that apparently addresses some of the holistic/directed issues.
For the record, while I wouldn't go so far as to generalize and say women are better, I agree that both approaches are complementary.
Furthermore, it's just more evidence that men and women aren't the same. Why do we have to deny this? It is such anathema to our society.
--
GeekGrrl: Oh GrammarNazi, the sun shining in your hair makes me feel -- oh, let's quickly go home and make babies!
GrammarNazi: Don't touch me woman. I shall not be sullied by one who can so casualy split an infinitive.
-- And when Justice is gone, there is always... Force. --Laurie Anderson, "Oh Superman"
You've gotta be kidding me! Who the heck did they ask, a bunch of guy-crazed teenagers? This "study" they did is totally biased and the results do NOT reflect reality.
:)
:)
I can't imagine they could have asked any mature females, because if they had they wouldn't have gotten the answers they did I'm sure. It doesn't matter one iota what gender you are as to whether you're drawn into geekdom or not. Some PEOPLE are drawn into computers and some aren't, just the same as any other field. If "girls" don't want to go into the computer field it's just as likely to be due to narrow-mindedness on the part of those around them as opposed to a lack of desire on their part. Those folks probably either live a life of hell or become closet geeks
We have women in pretty much every field of work there is now. It's time to stop proliferating biases against women going into certain fields ("Oh, Susie wouldn't want to be a doctor, that's too HARD for a woman, she should go into nursing instead.")
Furthermore, there's not much difference (other than gender, of course) between a male geek and a female geek. Both love the challenge of exploring computers and there are even female hackers and crackers out there. I do, however, think that most female geeks try to be non-destructive in their hacking just as females in general seem to try to be less destructive than men. I'm not trying to bash men here, by any means, it just seems like men enjoy blowing things up
And yes, I am female. Not only that, but I am the "alpha geek" of not only my workgroup (comprised of 50% about women) but also of my circle of friends and acquaintances (comprised of about 20% women).
-- Some people live life in the fast lane. I live life in oncoming traffic.
That is a very slippery slope you've built yourself there. It has been very well documented that in general men have much better spatial perception than women, while women have superior language ability.
This is just one of many studies from a quick Google search: from John's Hopkins.
Also, social trends != discrimination. If you don't want to work in an industry because there's a large proportion of "geeks", I'd suggest that you are the one who is prejudiced and discriminating.
--
You missed the line where I said the whole thing was sarchasm. I was giving you the exact same treatment that you were giving me. And guess what? You didn't like it, did you?
My little demonstration got you to admit that YOU DON'T KNOW ME.
How does that crow taste?
Think before you judge next time.
Gotta give you credit though - you flamed me with your real name and I respect that. The one other person who flamed me was an anonymous coward as well as a hypocrite.
If tits were wings it'd be flying around.
But it's not like I don't know a hundred girls who had the exact same education as we did, came from the exact same socioeconomic background as us, and simply chose to do other things with their time. Because I do. They went on to become doctors, lawyers, whatever. The thing to notice here is that they were never discouraged from choosing a tech field.
What, you followed these girls around all the time, you stalker perv?
A former girlfriend was once told flat out that women couldn't do science. Of course, this was the absolute wrong way to get her to not do something (this was not always a good thing) so she went on to get her PhD in physics.
I'm not saying that it's the only reason for the disparity, but before you whip "feminazi" out of the ol' Limbaugh Lexicon, consider the possibility that maybe, just maybe, it happens somewhere outside your sharp watch.
Make me aerodynamic in the evening air
Comment removed based on user account deletion
Actually my wife-to-be codes. She was trained to ;-)
work in a hospital X-Ray lab but she felt she had more potential than that and she applied for a
training with a major IT firm. (Cap Gemini).
Now she's a programmer and she actually is a very god one too! Still she couldn;t be called a geek though. She prefers reading novels and going out to coding
Here's my kneejerk response...
gender
1 a : a subclass within a grammatical class (as noun, pronoun, adjective, or verb) of a language that is partly arbitrary but also partly based on distinguishable characteristics (as shape, social rank, manner of existence, or sex) and that determines agreement with and selection of other words or grammatical forms b : membership of a word or a grammatical form in such a subclass c : an inflectional form showing membership in such a subclass
2 a : SEX b : the behavioral, cultural, or psychological traits typically associated with one sex
sex (non-intercourse definitions)
1 : either of the two major forms of individuals that occur in many species and that are distinguished respectively as female or male
2 : the sum of the structural, functional, and behavioral characteristics of living things that are involved in reproduction by two interacting parents and that distinguish males and females
Keeping
Bravo! This is the first good comment I've read in here.
:) ). I was in an club called Young Astronauts. I wanted a telescope. I read up on physics. In high school I did a science fair project on photons and quantum theory. I was forunate enough to have parents who, while encouraging me to be lady-like (unsuccessfully!), also encouraged my learning. They let me learn about anything I wanted to, took me to science centers, bought me ant farms, and kept the station tuned to PBS.
This is a topic I've given a lot of thought to. Growing up, I was always into science type things. As a three year old, I studied bugs, and as a 6 year old I could pronouce the work Etymologyist (it's what I wanted to be when I grew up). I loved one little Apple IIe we had at school, and would spend as much time as I could get on it (5 minutes a month or so
I also suffered a great deal for my geekyness. I was once a very outgoing child, until first grade, where through humiliation from both my teacher and my peers, I started to imagine myself as a social lesser, a self-image I continue to battle today, even though I know it's false. It only went down-hill from there, and fortunatly, I choose my brain over what other people thought of me. At any time I could have chosen to shun learning, shun science and math, and re-build an outer-image based on playing with Barbies, talking about guys, and going shopping.
I think this is what girls tend to do though. None of their friends like computers, or astronomy, or biology. They find that when they do get curious, these behaviors are frowned upon by parents, teachers, and most importantly, their peers. That is who they feel are the most important influence -- their friends, or lack thereof.
While it's bad for boys, it isn't nearly as bad. Boys can get A's in math, and as long as they don't act or look geeky, it's ok. In fact, one of the most popular guys in my high school was a 4.0 GPA, who took as many math and physics and chemistry classes as he did drama and sports.
I do think this is a serious problem. I've felt some discrimination in my workplace. I know I make less money than my male co-worker who has fewer responsibilites and fewer skills than I do. Yes, it bothers me. I'm not going to burn my bra or lobby for legal changes, or sue anyone (I'm generally conservative), but I have been wanting to do something about it.
I've been thinking about starting an organization, or finding an existing one and become very active in it. There are organizations for women in construction, why not computers/technology?
And one of my main goals would be helping bright young girls find a place to belong, show them that there are other girls and women who like math and science and computers, and encourage them. Show them how much fun learning and discovery can be.
Just a note to you guys, it has nothing (at least for me) to do with not wanting to work with "geeky guys". For girls, it has more to do with being thought of AS a geek, as BEING a geeky girl. And this has nothing to do with intelligence either, but of social acceptance.
I think one of the things that makes me the most upset is when I see a girl or woman who has the potential, yet denies it, shakes her head, laughs, and says, "Oh, I could never learn to do that!" Because they're wrong, and they have no idea how much their loosing out on: the ability to think for themselves and grow.
This isn't relevant to the topic of "Girl Geeks", except for clouding the discussion. Sommers' arguments tend to miss feminist points in a way that looks deliberate to me. Take for instance the that Atlantic Monthly article you linked ...
"today's girls outshine boys" (Sommers' words in my italics) because they "now outnumber boys in student government, in honor societies, on school newspapers, and in debating clubs". The skills practiced here are mostly social, not deeply technical. Actually so are many examples of girls' behavior illustrated in this article -- irrelevant to the subject of math/science education for girls.
Boys as a group probably have a different constellation of needs that aren't being met in the school system (as acknowledged not just by Sommers but by Sommer's feminist whipping girl Carol Gilligan). This doesn't disprove or contradict that girls with potential to excel in technical fields are shortchanged, only that boys are probably shortchanged in different ways.
That Summers chooses to characterize this issue as a "feminist" "War on Boys" strikes me as opportunistic and unnecessary, like she's looking for the big media attention that was given Camille Paglia and Katie Roiphe (as opposed to the academics she criticizes but nobody reads). Even her Atlantic Monthly bio lists "tart essays about feminist disingenuousness" as one of her specialties. Nothing wrong with criticism & honest debunking, but she could address this issue without invoking her pet demon.
Sommers makes good points in that there are prejudices against boys, and attention needs to be given in schools to how they socialize, and they have special needs that different from girls. And it's obvious that Sommers care about boys a lot. But I'd be a lot more receptive to what she has to say if she didn't spend so much time vilifying feminism in general, and the American Association of University Women's "fishy" research (not my phrase, or even Sommers' come to think of it) in particular.
Here's a link to an NPR show with Christina Hoff Summers discussing her War Against Boys idea, with RealAudio. The host likes her a lot.
__________
You've never laughed when someone said something completely idiotic, when you weren't expecting it?
You fucking hypocrite.
If tits were wings it'd be flying around.
Excuse me, but I have already hit the glass ceiling at my job here. There is a strong good old boys network in management, and they will not take me seriously about anything. I know my stuff. I'm responsible. I do all the work of an IT Manager, but they will not give me that title or pay, and instead we currently have no IT Manager, because no one else is qualified, and the ones they could hire cost too much.
Now, I don't know if it's because I'm female or not. I have no way of proving it. The management in question are 97% computer illiterate, and don't have any idea what I actually do here. They also don't have any idea what an IT Manager does. And who knows, maybe I really am a terrible worker. But it's not like I don't try, like I don't take responsibility. The more ambition I show, the more boats I rock, and that only sets me back.
Discrimination in the workplace DOES still occur. If you don't realize that, then it's either because you work for a good company, or because you're a guy.
The problem, as I see it, is a social one. In this country, at least, the majority of girls are told - whether outright, or more subtly - that they: 1 - shouldn't learn about computers because they'll never be good at it; 2 - shouldn't use computers because it's not girly/feminine/appropriate for a female-type person to use, whether for social, religious, or other reasons; 3 - shouldn't use computers because it would take their attention away from what should be their priorities, which are marriage and children; 4 - shouldn't learn about computers because it makes them less attractive to guys.
Before anyone tries to argue these, I have to mention that I, as a geek girl, have been given ALL of those arguments.
In discussions with my female geek friends,
I have found that - guess what? - they have also had to go through the same things.
At every level of school - from elementary, junior high, high school, and even college - girls are discouraged from pursuing anything even remotely geeky. Hell, I once was told by a high school guidance counselor that I should take home ec (rather than pre-calc) because "You're a girl. Girls don't need math. Girls need to know how to cook for their husbands." This was when I told him I wanted to go to college and major in math.
I have had to fight opposition from teachers, school admin, other students, and even my own family. And once I got through all of that, and got out into the 'real world'... I found that it's not much better sometimes.
We can look at statistics and argue them for years, but we're not going to see a change until we, as a society, begin to encourage any girls who want to be geeks, rather than suppressing them.
Just my estrogen-filled $0.02...
reverend lola
the titanium sheep
provider of steel wool
Also, I've come across many geek guys that just haven't grown up - they're still playing computer games at 30. Are you sure that /. is the right forum for you, if you think that playing computer games is immature? :) I can't see that it's any different from watching telly at 30; the only real difference is that computer games are interactive. if anything, I would say computer games require a higher level of maturity to enjoy them than staring passively at a TV prog.
Hey,
I think the reason that most Males pursue IT-related careers is because they love technology, where as most women don't. The big question is, however, *WHY* do we like technology?
My theory is simple: All technology was sreated with one aim: Women...
Fire --> Keep warm, whilst seducing women.
Club --> Threaten and impress women.
Printing press --> Look at women.
TV --> Watch women.
VCR --> Watch more women.
Internet --> Look at neked women without having to go into embarrasing shops.
etc...
It could easily be true, you've got to admit...
Michael Tandy
"Goodness me, how unlike the FBI to abuse the trust of the American public." -- The Onion
Don't rule out other areas that have geek women. Theater lighting and sound design (College Majors) have quite a few of them.
:-)
...Ferox...
I am currently dating a Theater Arts Techie, and she is one of the brightest people I know! I am in the last year of my Electrical Engineering degree, and she picks up on stuff that I explain to her. She amazes my friends/classmates with some of the stuff she picked up from me.
They all wish they had geek girls!!
I drive WAY too fast to worry about cholesterol!
I always hace to ask myself if I really am a geek. My guy friends in Comp. Sci. say I am a geek and how I should be proud to be one like them.
But others who are not from comp. sci. say I'm not a geek at all, because I have social skills, thought I don't think that a lack of social skills make you a geek, that's more like a nerd.
And other say I have geek tendencies or geek moments and if I am a geek I am in the larval stage.
Geeks think that being a geek is cool and that it is more of being someone who has an interest in technical issues and is very good at such thing. But other think a geek is a nerd who has no social skills or only talks to other nerds.
I must admit I do have geek tendencies that my friends love to point out. But at the same time I really don't want to be associated with the nerdy image most non-geeks think of.
To be a geek you have to be ascribed by others as well as yourself. So until the day I can comfortably call myself a geek, I guess I'm not one, just a girl with a lot of geek moments.
This was brought to you by the Sweet 'N Lovely ~ChocoLux~
It's all about continuums, don't think black vs. white and digital, even gray scale is closer to the truth. Just because Your Average Human sorts everything into rigid categories doesn't mean that those categories are for real. Don't mistake the map/model/whatever for the terrain. Aww do I really have to tell you this?!
Dude, for me this has very little to do with feminism or equality. It has to do with anyone who has a brain who doesn't use it because it's not popular. It is less popular for girls than for guys (though guys have the problem too). I don't care if a girl learns, and then chooses to stay home and raise kids. Fine. But don't give me women who think there's no reason to learn. And especially don't give me women who say, "I can't."
... It's kinda like Miranda on User Friendly. Though I'm not nearly as good at Quake as she is :)
I agree that men and women are wired differently, think differently, and have a different way of looking at things. But I think that this perspective is beneficial in a technical setting. It is more of a social thing than a wiring thing. It's just not "cool" to be geeky. Even less cool to be geeky AND a girl, because at least you have your little group of guy geeks, and when I step into it, I'm the only girl. And sometimes I get flack for that from guy groups just like yours.
And I would never suggest a change in the laws. The laws are adequate. I'm suggesting a change in social attitudes and perspectives. And it starts with individuals.
It burns me that you said girls are never discouraged. I read an article in either InternetWeek or NetworkWorld. There were women in there from big companies with horror stories. I thought this stuff didn't go on anymore, but it does. One lady said that just 10 years ago, her high school councilor told her to stop taking math classes, that she needed to major in something more feminine, and math wouldn't help her towards that goal. !!! This was an American High School. This particular girl didn't listen to her councilor, but how many more do??
Another woman said that none of the men in management would take her seriously, despite being the most qualified. She said in the past, she has explained a problem over the phone to someone, they wouldn't listen to her, then she would hand the phone to a guy in the room, have him repeat exactly what she said, and only THEN would they listen.
The problem still exists, and it's close-mindedness like yours that keeps it up. I go to LAN parties some weekends. I am THE only girl who goes. I have a hard time fitting in. Sometimes I just wish I was "one of the guys". I want to blend in. Sure, they treat me with respect, but I still feel different. The first couple of weeks I went, guys were telling me how to do things. "Just plug your network cable in there.." I felt like screaming, "I'm a network administrator! I know more about this stuff than you do!"
OOG has no secrets to getting chicks. Oog idea of getting chicks is fucking them when they're passed out from bleeding because of all the times he smacked them with his club.
Oog reason for smacking chicks over head is because he can't get any otherwise. Reasons? Of course:
OOG SCREAM LIKE HIS VOICE IS STUCK ON CAPS LOCK! NO WOMAN LIKE!
Oog not have shower in cave. Oog smell like long dead cave tiger Oog too cowardly to kill. Which is another reason women no like oog. Oog 93 pound coward. When cave woman wake up after being clubbed in the head cave woman beat Oogs ugly ass up.
Oog have no cave money to take cave woman to fancy restaraunt afterwards oog might actually get some. Oog spent it all on cave beer and cave weed. Oog was so cheap he took all the cave weed and cave beer and gave it to himself so oog ugly stupid cowardly caveman who's stoned with a hangover.
Other reason cave woman hate oog is oog thinks that smart cave woman who might actually be smarter than oog is automatically labeled "unattractive cave woman"
smart cavewoman finds psuedo intellectualism of many slashdot posters attractive. So what if slashdot poster is nerd.
Slashdot poster gets laid more than oog.
Enough said.
Kris
botboy60@hotmail.com
Nerdnetwork.net
Kris
botboy60@hotmail.com
Nerdnetwork.net
I consider myself to be a humanist, not a feminist. I fell in love with my partner, because he's awesome; we had great conversation and great sex. I couldn't care less how much money he makes, and as for his looks, he's beautiful to me...which is all that matters. There are more people like that than not. As for being "freaky, ugly, and strange looking..." Why do you give a shit what people say about you? "Pretty is as pretty does" goes both ways. Maybe people think you're ugly, because you have an ugly heart. I grew up in the South with assholes like you running amok and in droves. You want to believe we're all feminist lesbian whores, but the truth is that you're simply inadequate as a person, much less a man.
Honestly, I don't know where the people that did that study were researching, or who they were questioning. I think if girls have a choice of: getting ahead in the world through intelligence and knowledge of computer skills; (let's bring up that 5-1 ratio again) always having a date; talking to guys who share similar interests and having INTELLIGENT conversations; relying on themselves instead of tech support or slimy salesmen; and generally making themselves less helpless, the smart thing to do would be to be a geek. but haven't the geeks always known that?
I personally have never met a girl turned off for that reason. I have because the science bored them.
I might agree with this if "technical fields" wasn't such a ridiculously broad term. It's like saying guys can't grasp "liberal arts." I will agree completely that men and women are different, even when it comes to the ability to solve certain problems or work in certain jobs. But the kind of thinking which is encompassed by "technical fields" is just basic intelligence coupled with an interest in the way things work.
An analogy to writing (i.e. a book) is in order. On one hand you have Tom Clancy and Isaac Asimov, on the other Nora Ephram, and while most people can agree they're all good writers, but the subjects they approach and the way they approach them vary widely. Computers are so flexible that they can and will accommodate the perspectives both (all?) genders bring.
Perhaps the reason there are so few women in technical fields is that even what a technical field is has been defined almost entirely by men before now. There is more to be done with computers than database tuning or meticulous coding.
"If you look 'round the table and can't tell who the sucker is, it's you." -- Quiz Show
Okay let's throw this into your mix...
My folks thought I was going to be a boy. My room was not pink, and growing up I had equal numbers of Barbies and Star Wars, Strawberry Shortcake and He-Man, jump ropes and speak&math. All through school I was different, smarter in some ways, but mostly oblivious to the whole cheerleading/prom queen/homecoming girlie crap. I was in show choir and drama, and the NHS. Now I am the web department for an ad agency (no typo, I'm the whole dept.) and all my friends are geeky guys. I was never pushed to be anything but successful. My little sister played sports, where I hated them, but now she's the prissy jewelry whore with no future and I'm the computer geek Sugar Mama.
Not sure where I was going with that... I guess what I'm trying to say is that I agree with what you said about how kids play affecting their abilities and choices later in life...just maybe not exactly how you think it does.
The Divine Creatrix in a Mortal Shell that stays Crunchy in Milk
The House Between - Original Sci-Fi Series
Exactly!
There may be something to the gender bias after all, something that goes beyond social roles and expectations. At least for me, the stereotypes have a painful amount of truth in them.
For starters, I'm not stupid. My idea of really fun recreational reading ranges from books about how (biological) viruses work to studies of artificial intelligence, the biochemistry and evolution of venom and toxins and medical case histories of human and animal envenomations. I enjoy and appreciate computers (especially the practical and philosophical benefits of Linux).
I can also kick a reasonable quantity of butt; my former hobbies have included swordfighting with the SCA and martial arts. Currently I enjoy wrestling alligators and doing unusual things to them in the name of science. I play with venomous snakes professionally (you can see me doing this on an upcoming ep of National Geographic Explorer).
Social pressures don't concern me; I don't spend a lot of time worrying about clothes, makeup, or conformity. I don't consider myself limited by this society's predefined gender roles in what I'm allowed to do with my life. Obviously. So that isn't a factor.
But I can't code, and math is hard. I also have a hard time reading maps and solving spatial relationship problems. I can read and retain complex information at a moderately unghodly speed (a geek bf once clocked me at two to three seconds a page), and have always done exceptionally well in tests of vocabulary and language learning. I have written and published.
As I said, I'm not stupid. But I'm not the same kind of smart as other types of geeks for whom math is second nature and coding a natural language. Out of frustration and disgust for what I used to think was my own stupidity when it came to left-brain tasks, I tried to apply myself to learn these things. I wanted to code. There is so much that is fascinating about computers and getting them to do things for you, and I wanted a part of it.
The result was a lot of frustration and misery. I learned - slowly - and I hated it. I was not having fun. Finally I went back to my biology textbooks with a sigh of relief. I have to conclude that for whatever reason, I have no talent or aptitude in that direction. I can sit down and solve a math or logic problem with a lot of cursing and muttering, but I don't enjoy it. If hard pressed, I could probably figure out (slowly) how to tinker with some gadget long enough to find the problem or fix it, but I would hate every second of it and it would make my brain hurt. I would rather pay somebody else to do it while I did experiments and wrote up a paper on the learning curve exhibited by members of the Agkistrodon genus. Now that's fun.
Am I stupid? No. My brain works fine in the academic fields I pursue with enjoyment. My brain does not work fine when I try to apply it to traditionally "male" tasks such as programming, engineering, spatial relationships, math and logic. It falls down on the job and leaves me feeling stupid when I try. I don't like this feeling, but there is nothing I can do about it.
If I can hypothesize that some of the studies I have read are correct, and I am an absolutely classic example of female brain wiring (language yes, math no, social/behavioral perceptions yes, spatial perceptions no), there is some merit to the stereotype. I completely understand girls who say, "Math is hard," and avoid the tasks they aren't good at. It isn't just social conditioning; it's not wanting to take an unpleasant job you're pretty sure you'll fall down on and look stupid in the process.
As for dating...I like geeks. Smart men are sexy men, and I would never go out with a man who couldn't hold an intelligent conversation on academic subjects. Unconventional men are also more likely to appreciate and accept my diverse and unconventional interests, and not be threatened by my vocabulary or academic interests themselves.
But there is one thing. Sometimes being with a geek makes me feel stupid in comparison when I can't do the same things he can do. I don't like that much, but I can live with it if I remind myself that we have different skills and a different set of smarts. I wonder if women who don't like geeks simply don't like to feel stupid, and compensate by scorning men who are "too intellectual"?
I really don't know. I don't think I'll ever have a lot of insight as to what goes on in the mind of a typical airhead gal or a typical jock guy, and I'm not sure I really want to. I do know the frustration I feel when I attempt a task that my brain doesn't seem to be wired for, and I can guess how someone else with less confidence and more social conditioning might act out their frustration if they felt the same way. Possibly the result would be much like what you are seeing as stereotypical female behavior.
A sample of one is insufficient to draw any meaningful conclusions from, of course, but I know how it feels from the inside, and I know what I believe on the subject. So what do you think?
Regards,
Tanith
pleasure at netcom dot com
http://venom.herpkeepers.com
"We bring you the bust, re, best in news!"
NEW YAWK, NEW YAWK:
Pah! to that report. I'm a happily geeky girl who reads userfriendly and slashdot at least once a day, and is planning to study Computer Science at Uni with hope to be an evil Sysadmin at the end of it.
--
No sig and proud of it. fnord.
I don't know where you work, but I don't get to see many girls at our office. I'll welcome any! But if they really are dumb, I wouldn't put it up with it I guess.
not all male geeks are dirty, longhaired, bearded tubs of lard...
I for one actually shower at least once a day, more if i've been working my ass off on like 4 different boxen in rapid succession, thus creating a skanky odor...
pigeonholes suck. 'nuff said.
ok and while i'm at it... i'm a single male who lives in a town of old people. being still in college and such, i still reside with my parents, 'scuse me for living. sure, i play computer games. however,
teen male mentality? we all know an average teen male would tell you to take that & shove it. i prefer to instead ask you to clarify further... maybe some people fit that pigeonhole, but not all do.
wow, mindless ranting about a subject about which i have almost passionate feelings is extremely gratifying.
hey grammar nazi, wanna check this for me? i'm too lazy to do it myself, but i feel that aside from the capitalization (or lack thereof) it should be fine and dandy. (yes, i know that is a trite cliché, deal with it.)
From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
Disclaimer: Yes, I am a middle-class white liberal (although I don't really like the terms "liberal" or "conservative").
You realize, of course, that society "molding" people in a certain direction is no better than "self-righteous people who want to mold the world in their own image", right? I mean, it's one thing to go around being self-righteous, but it's entirely another to be aware of the biases which already exist in society for various reasons (e.g. religious-based prejudices, racism, sexism, or just plain-old inerta) and work to counteract them. Actually, I probably shouldn't say that these are entirely different, since you do have to be a bit self-righteous to be confident enough to stand up to anything, especially a well-entrenched social belief. But still, let's not be blind to the fact that there's an institutionalized form of "molding the world" out there. It's one thing to try to mold the world out of arrogance, but it's another to try to balance out the molding which other people or "society" (i.e. lots and lots of other people) are doing.
If women aren't flocking in droves to technical fields, perhaps it is because they don't want to.
in many cases, they don't. however, in many cases, they don't, because they have been conditioned out of it, or just outright told that they could not do that becasue of a simple accident of gender. I'm not all so old (hell, I haven't even finished my BS yet), and I've been told that more than once. now, I'm not claiming that this is a universal experience, but it seems to be fairly widespread.
oddly enough, people do hire me quite readily, and I really do resent the implication that certain people have been known to make (not directly to me) that (in general) it's easier to get by in the computer/science/engineering field as a female, becasue standards aren't as high. as you say, the emphasis is on what you produce -- and if it isn't, it should be.
These fools acts as if thirty years of conscious gender equalization did nothing to level the playing field.
oh, it did. now jobs aren't listed separately by gender, so these jobs are open to women like me now. women aren't systematically excluded from technical schools. etc.
what do we see? a dramatic legal change in status. however, there are some things that are slower to change -- specifically people. right now we get a few types:
1. the throwback -- either older people or people who learned attitudes from them that I am really emabarrassed to hear expressed (example: my step-grandmother said at dinner the other night "well, I don't understand this fuss about women not being paid as much as men. they aren't as competent, and have babies to take care of". it got worse as she tried to backpedal when everyone's jaws dropped)
2. the over-compensator -- if anyone ever were to give me a chance NOT on my merits as a researcher and a scholar, but instead on my femininity, I would be very, very, very upset. there are people who want to "do a favor". they aren't. truthfully, I've never seen this type in action, but the guy I work for says that they exist -- and that, do what I may, graduate school admissions people have a different standard for female applicants. to them, I have to say that lowered expectations reduce the ability of the objects of your (surely unconscious) contempt to perform as her peers.
3. balanced people -- the people who don't have a heart attack on a MUD or a BBS when I happen to mention I'm female, specifically, and the ones who don't see me only as one of a few prospective dates in the EECS department -- and who don't get frustrated beyond belief when they find I don't want a date, thank you very much. they expect that I'll do as well or better than they do, since many of the females who make it as far as college in a technical field tend to be many of the most competent people in the department.
until we have more balanced people -- which will take time -- people who don't have to consciously compensate for any contempt of their own or others, perhaps you should think twice before posting a diatribe of that type. we'll know we have arrived when it simply isn't an issue anymore -- and if you ask women in these professions, you'll find that many of them consider it one.
Lea
If you really work with Perl you would have done this with regular expression substitutions!
but I forgot -- if anyone's interested in discussing this, I'd be more than willing (though there will be several weeks when my email will be unanswered -- but I will do it when I can)]
Lea
My apologies, I should have used an :P or an :), as it was written tongue-in-cheek... but you raise an interesting point - is it inappropriate for 30+ yo males to play computer games? Are they the same as playing sport (eg football)??
I still play some games, but my attitude towards them has changed alot since I was a young teenager. As i said, I found many guys have not moved on from a teen-male mentality - not sure how else to describe it. I hope you understand what I mean.
-- "e-idiot: stupidity for the next Millenium."
Excellent observation; I wonder why that's the case. Probably because those types of work are looked down upon by the stereotypical reporter. It seems that there is always an "elite" class that feels bad for poor folks doing these types of lowly things. These lowly things usually form the backbone of society too, so it's especially ironic that they are looked down on by folks who are doing abstract and, more or less, useless stuff like computer programming.
Parents aren't the only ones to blame here. There's all kinds of factors at work.
;)
A friend of mine was taking a psychocology class in which one of her assignments was to go to a toy store and compare male vs. female toys.
try it sometime, it's really frightening. Walk into the girls section, and what do you see? what are the prevailing colors? what are the toys miniture versions of?
now check out the boys section. ask the same questions. also note that most of the electronics are in the boys section.
check out a playground. what are the boys playing at? and how about the girls?
this stuff is embedded into kids early. from what i've seen, though, someone who chooses to get out of the preconcieved castes has no problems. some of the best people i know with computer are female, but they were certainly ostrasized before they achieved their full fledged geek status.
i think it's also generally harder for a female geek starting out, both by men and women. but the ones who persevere are definatly a benifit to anyone who is in need of a good geek. in some ways, they've fought harder, they have more a want to be where they are. all geeks have to run a gauntlet, but i see women as having to jump through the fire at the end.
but as they say, "that which doesn't kill you makes you stronger", and most of the female geeks i've met definatly live up to that.
damn i wish i knew more female geeks, though. they'd definatly be able to deal with my computer obsession than many of the girlfriends i've had before
----------------
"All the things I really like to do are either immoral, illegal, or fattening."
"All the things I really like to do are either immoral, illegal, or fattening."
- Alexandar Woolcot
BZZZZZZZZT. nope. sorry. Sure, we might be apt to provide for their young... if they actually took the time to think about the whole package
the problem is that most of the women i find myself interested in (not necessarily code jockeys, but smart & attractive females) don't focus on a man/guy/boy/(insert pronoun here)'s personality and moneymaking potential.
as per a PhD in psychology's POV (a friend of mine) - at some low-level part of their brain, women are programmed to look for the "buff," jock-like, "what our society deems as `attractive'" kind of males. this rules out (i'm guessing) about 90% of the "geek" field. personally i'm not worried about heart problems or anything, but at 6'3" and about 225lbs i'm not about to go run a marathon.
now, to get back on to the rest of the reply...
easy, my fellow lonely geek.
the position of "lawyer" (see also "backstabbing ass," "power hungry snake") has been elevated by society. the typical stereotype of a lawyer, that of a really rich, yacht-sailing guy, is considered a good thing for a woman to want.
consider the stereotype of "geek": unkempt, dirty, fat, caring more about electronics than women.
sure, neither one is seen in the eyes of society as "a hot guy," but a woman is certainly much more likely to be attracted to the former than the latter. as you said:
that's exactly the point. those subsets aren't in the majority, but the stereotype is typically one or both of said subsets.
the problem is, as things progress, we only become more geeky and better at what we do, and thus, exacerbate our own problem. ohhh, the tragedy of being a single, intelligent, computer-savvy, not-hot-but-not-ugly-(maybe-termed-"cute"), "geek."
my only hope is that maybe society's eyes will open as *nix becomes "mainstream" and being a geek will be a good thing in EVERYONE's eyes, not just in the eyes of a geek him- (or her-) self.
hmmm... 80% chance that nobody ever sees this to mod it up... i don't post often, but when i do i have good stuff to say, i just get in on the discussion too friggin' late. :-/
From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
Personally I believe that any kind of polarization of any group is a Bad Thing(TM) since it tends to increase certain qualities in that group and decrease others.
An example would be species that have evolved in a very isolated environment. They tend to be very vournerable to outside intrution, ie introduction of a new species that has evolved under a lot more competition.
For humanity's, and society's sake we need to be as diverse as possible. We need all kinds of people in all kinds of places.
The now ever growing "tiredness" of Politically Corectness that we can see everywhere (the evolvement of Southpark being a prime example) is a result of a fundamental law of psychology. It is derived from physics where it goes something like this: "Every action requires an equal and opposite reaction." In psychology the reaction need not be equal or exactly opposite, but its there. Without fail.
What is best is moderation. Critical thinking is always good. (The law of reactions is there for a reason, because polarization, as I stated before, is a Bad Thing(TM)).
P.S. I'm just presenting my personal Humble Opinion and Life Philosophy. These are not fundamental truths at all (even if they are presented that way) and should be very critically examined indeed.
"War is God's way of teaching Americans geography." - Ambrose Bierce (1842-1914)
All of the attitudes in this thread illustrate why women don't want to be involved in the industry - from patronzing head-patting, to the outright hostile.
There doesn't have to be a 50/50 split in everything - however, when the discrepancies are startling, they should be examined.
I don't mind so much, being outnumbered. I'm used to gaming circles, where females are decended upon by geeks desperate to meet a girl that they have something in common with. I don't mind so much because I see it changing, every day. But the crap on this thread scare me equally, 'cause for every girl who's willing to put up with the undercurrents of sexism, there's prolly five that will walk away.
Take a look at the posts in this thread. How many of them that are moderated up are from women?
-Noiz
---------
---------
I'd kill for a Nobel Peace Prize.
Nooooo kidding.
might even agree with that =-) Who say the just cause you're a geek you can excell in amature athletics or be Daddy Smoov on da dance floor. Lost of us are into the martial arts and other such endevors. Its just cause bills scrawny ass gets all the damn press... he gives a bad rep... I mean shit Cmdr Taco and frendz where in Wired... although a bit on the scrawny cyde, I showed the picture to my GF who thought the was a cutie. We just need the public to realize that geeks are no longer the scrawny bill gates type, but the ass kicking, pistol toating, black trench coat wearing, there is no spoon, Neo types =-)
My apologies, check out my reply to a previous message here . ;)
I hadn't anticipated a serious discussion, nor a total refutal of my post, but thanks to all who replied.
-Spud.
-- "e-idiot: stupidity for the next Millenium."
I was refering to personal hygiene - not personal quarantine. :P I never said all guys were "dirty, longhaired, bearded tubs of lard"...in fact, I'd be prepared to broaden my previous statement - why do some young guys spend so much money on clothes and hair gel, yet somehow forget deoderant/anti-persprant? :P
o r-dating-and-conversation-is-for-girls-s o-don't-talk-to-me type attitude that i see in alot of young guys, geeks included! Now before you jump down my throat and say "well I'm not like that", remember, I am not talking specifically about you - I'm just callin it as i see it - it's an observation of young Australian males (geeks included). There's always exceptions to the rule.
With regards to the teen-male mentality, I don't know exactly how to describe it, but it's the competitive-tough-guy-no-emotion-girls-are-just-f
I cannot share your frustration with dating. However, I wish you well in your pursuit of the opposite sex.
-Spud.
-- "e-idiot: stupidity for the next Millenium."
Is it just me or is anyone else disturbed by the fact that the most recent cite in that report which was nothing more than a collection of snippets of other studies was nine years old! 1991 was the latest study cited in that report. 1991. Where were you in 1991? I know where I was, working in a comic shop for a $.25 above minimum wage. 1991 Linux' latest version at the end of the year was 0.11! FreeBSD's 0.1 wasn't released until 1992. In short, girls and boys, this report is so out of date it isn't even funny. It completely ignores all advances in this field and in the social view of this field in the past 10 years. Those 10 years also happen to be when the largest advances on social perception of this field took place.
Yup, the study is invalid from the start yet now we have to deal with the problems it is going to create for years to come.
-- Grey d'Miyu, not just another pretty color.
[mouth forms into dumbstruck grin]
[wonders if she's cute]
i've been thinking this same kind of thing for a long time, but not being female, i've never speculated about it.
the interesting flip-side of this coin is also that if you're a male and are attempting to be on the geek bandwagon, it is often hard to get on if you still have any other persuits, such as the aforementioned "spend time with friends, talk, do charity work, assist in the rearing of children."
i wanna be a full fledged (male) geek but it's often hard to fit it around everything else i wanna do - one of those things being social. :P
[quiet sobs of anguish]
From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
[revelation hits]
if this doesn't work i'm coming back and flaming you to a crisp. :-P
From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
Well, that would be a big improvement for 99% of office pc's... ;-)
I suffer from attention surplus disorder.
As long as they get a job, that's all that matters. Females can be senators or burger-flippers for all I care.
Refrag
I have a website. It's about Macs.
I kinda got a kick out of the ambition statement by Katy in the original article:
``The reason why you see more men doing computer stuff is that girls are more ambitious than that. My parents always say, 'Do something with computers,' because it is stable and stuff, but a lot (of people) don't want to be at a desk from 9 to 5.''
And then they go on about girls spending just as much time on the computer as guys in this statement:
"Girls do keep up with boys when it comes to using computers for leisure activities like surfing the Internet and sending e-mail"
I don't see what's not ambitious about guys and computers. bildstorm's comment was well put. Guys like to tinker. They get ambitious enough to see what makes a computer program work and then that's sparks a semi-competitive interest to want to make a program that does similar work, but make it work better or look better. That's the case with me anyways.
I'd like to see more girl geeks in this world. I'll stay up until sunrise talking with my guy friends about computers but all my girl friends can't hold a conversation past "yeah, i emailed you." I wanna be able to talk to girls about computers. There's a first time for everything, isn't there?
--Malduin
In a country where women are still triviliased as sex objects, molested in Central Park in broad daylight, barely granted the continuing right to an abortion, denied the right to sue rapists because of "state's jurisdiction" or what have you, how dare you argue that the playing field is level? Can you blame women for turning to fields where they have more support from other women?
If women choose not to go into technical fields because they're afraid of no support or having their talents ignored or when they were perfectly competent techies, then that's a shame and a loss for all of us. Those choices are not due to wiring, those are due to things we can and should change.
There is nothing inside our heads that discourages us from going into IT, but there are plenty of mysogynist assholes who do.
My mother was an infant school headmistress,
and said (i) she'd never had an application
from a man wanting to be an infant school
teacher and (ii) if she had, she'd have binned
it.
-- You've got to get a hat if you want to get ahead.
Girls in technical fields don't experience a lot of hardships from my experience. If she has problems with anything all she has to do is ask a guy to help her, and it'll get done.
Disclaimer: The girl has to be attractive to her victim^H^H^H^H^H^H co-worker.
Refrag
I have a website. It's about Macs.
And btw... I don't think all chicks are looking for high-powered executives and lawyers, and the ones who are... well, they're not the ones you want anyway... They're too superficial to realize that true, raw intelligence and know-how are exceedingly attractive and alluring. Plus, I've found that dork-guys are much more endearing, sweet, supportive, understanding, and HOT :) than the average member of the guy population... :)
Another random (but well-intentioned) post brought to you by... :)
heidiporn
heidi
Comment removed based on user account deletion
Okay, very true. The obsessiveness in itself isn't that bad. The problem was the lack of social skills (for relating to people outide their set) many of these guys had. And some of these were that stereotypical CS guy - BO and all the rest. Well, sadly that's the image of CS blokes that people see and it remains is the mind. By which I mean that I admit that there must have been plenty that weren't quite like that, it's just that they aren't the ones I remember.
Tom.
Oh arse
Women and girls are socialized to look for peer reinforcement and approval of our decisions in a different way than men and boys are. This isn't a black and white thing as some have suggested: think of it more like 2 parallel, overlapping bell curves. There's more space at the end of the curve marked 'geek' in the male bell curve than the female, even though any given woman may well be geekier than any given man.
Gender bias is usually, IMO, subconcious & unintentional, but still damn real. When I was in law school, I had my resume reviewed by career services. My previous jobs had been divided between social service/education and (more recently) telcomm policy. I was obviously computer savvy (in the early 1990s when few lawyers were), and still, I was advised to look for family law jobs, not 'tax' or other 'more technical' fields.
Fortunately, I was too stubborn to listen. :)
Liza
These opinions are my own. My employer is not aware of them, does not endorse them, and is not responsible for them.
I can appreciate that some weak-minded people may be turned off by the ratio imbalance, but if you are strong-minded like myself, it doesn't make much difference. As long as you can handle the odd piss-take now and then (and they're getting less as time goes on), give as good as you get, and show them that you mean business, there's really no issue. As for the computer access, that's bollocks. My high school had plenty of computers, but for some reason I was the only girl in the class. I guess the others were simply not interested.
I chose this industry because it interested me, and BECAUSE it was full of guys. Mmmm Male smorgasboard! Most geek guys are not complete wankers, they are sensitive intelligent individuals who are often overlooked because of their social stigma. I am happliy engaged to one. Ok from time to time we find ourselves having 'how many spaces do you indent your code' pillowtalk, but that's half the fun :)
I actually enjoy competing against the guys and beating them in exams/assignments etc (some of them don't like it much!). I also enjoy wearing sexy stuff to work to give the poor bastards some excitement for the day :) *devilish grin*
Or are you talking about desktop publishing, web design, technical/customer support, technical writing, PR?
Sure, there are a lot of women in certain areas of "tech", and in the tech industry in general, but they tend to be in the easier fields that aren't really all that technical.
Designng a webpage is not as technical as programming the actual web server itself.
The AP article was about the lack of women in "creating software", not about using software.
I feel I was just about born a geek
What, you mean you weren't born a geek? You didn't learn C at the tender age of two? Right, out you go. I'm sorry, there's no room for you here. And we'll be keeping that computer and those CD-ROMs, thank you very much.... ;-)
Note: The amount of serious material in this post is well below government-defined acceptable limits. Therefor, we ask you please not to take offense or flame the poster, as he is obviously not in his right mind. Thank you.
-RickHunter
You're awfully judgemental. Do you suppose that I told the *entire* story? OK, OK I left the part out about how we all went down to the cafeteria right after that and had lunch. Shoot me.
If you assume that I didn't explain what a vector was after we were done chuckling, then I can only feel sorry for you. Perhaps someday you will learn that refraining from judgement before you know all the facts is what makes a mature person.
If tits were wings it'd be flying around.
Well...   since everyone is "outing" themselves... hee hee.. might as well join the club.
Yes, I'm a geek lady and one in a management position as well.   I think that the times, they are a-changing, and for those who aren't aware (although based on most of the comments here, people ARE aware), alot of those old "keypunch" operators and data-processing clerks (traditionally the "female" IT occupations) have made the leap to higher tech....
When I was going through college in the late '70s-early '80s, the Computer Science departments were just forming.   Most of the folks who I knew were interested in a career in computers, were electrical or mechanical engineers who might have taken some programming classes in COBOL or Fortran...   Otherwise, folks learned on the job.
Funny how times have changed....  for *everyone*!
-- Win2k: "It's not so much that it's only 65,000 bugs, it's just that they stopped at 65,535 to prevent an overflow."
Dude, share the wealth. It's not like I don't need cave weed too.
I agree about the gender oriented slashdot thing. I usually send them to some of my female friends just to humor them (and don't think they don't get it either. One of them runs a website and is learning C++).
Main reason for my post was to piss off non-psuedointellectual posters by NOT TYPING EVERYTHING IN CAPS LOCK and giving reason why oog gets no lay. Some women find psuedointellegence sexy (but they are few and far between. Which is why slashdot poster may get laid not often, but more than oog).
Fat dude on simpsons:
"I am instating a regulation on reproduction. Reproduction must happen every 7 years. I realize that for some of you this will be much less. For me, however, it will be much much more."
Kris
botboy60@hotmail.com
Nerdnetwork.net
Kris
botboy60@hotmail.com
Nerdnetwork.net
If you're addressing me (techwatcher), I happen to be a woman. A grown woman, it's true, but I do enjoy the company of children of all ages -- as witness my continuing visits to /.!
Brain Sex is a book on the subject of gender differences - focused on the development of mental abilities, gender alignment, physical development and sexual attitudes based on the in utero development of the brain given certain hormonal stimulation. Excellent read.
-- What you do today will cost you a day of your life.
Well, it was an assumption that you used your real name. As long as it wasn't anonymous coward then it's an acceptable primary key.
If tits were wings it'd be flying around.
Computer geeks playing games at 30?
How is that different from 30 year old non-geeks (we really need a term here, too bad Gentile is taken) watching football or any other sport?
And how is THAT different from a 30 year old non-male (we DO have a term here, WOMAN) watching a soap opera or a talk show?
Please - show me a woman who is not into emotionally laden 'Movies of the Week', and I'll show you a fully grown woman?? Come on - branding a geek as a child, just because they play video games rather than stare at the idiot box is wrong.
And for the record, plenty of retirees play bridge and bingo, a complex and simple game, respectively. Does that make the aged children as well?
An argument this flawed just blows the whole of the original post out of the water; I'm glad EVERYONE who responded objected to exactly this point. Feh!
-- What you do today will cost you a day of your life.
(Not directed at author of the parent article, directed at everyone)
> But once girls find out what I do, I'm suddenly a geek.
I have, throughout my entire life, regarded the term 'geek' as a highly derogatory four letter word. If you were to do a fast paced word association test with me, and gave me the word 'geek', the word I would spit out would be 'nigger'(*).
It is based upon the experiences in my life that have taught me my emotional worth and place in society.
I respect the black community for deciding to fight, instead of roll over and play kitten. They did not "redefine" what nigger meant, they took it for what it was, and attempted to change the source of the problem, not ignore it or accept it. It's with a heavy heart that I've watched as the 'minority' I'm a part of has begun playing the part of Uncle Tom.
You've re-defined the term geek in your own thoughts, and in your own way you know you should be or are proud of yourself. But for those who have been affected by being labeled 'geeks', I've never seen it translated into carrying oneself with confidence and pride outside of our little ghetto. And in most places it is infrequently translated into respect from those outside of our community.
You may be 'proud' GEEKS in here, but everyone out there is still thinking 'nigger'.
-C
(*) - Note that I'm not claiming we're as deep in the hole as blacks once were. But I feel that my own feelings, their source, and the feelings of those outside our community, must come from a similar part of the human mind and experience.
Because people confuse equality with equivalence. It's very common, even among programmers.
Uh-huh..
Perhaps I need to give you an analogy, as you clearly don't have much real world experience besides being jealous of some person who plays games.
That man is like a man who goes to the surplus computer store to buy computers. Sure, he may get a lot of 386s (they are only 5$ each!), but they are cheap and slow compared to what you get if you put out the effort. Do you just want to play some quick Doom before deciding to buy another cheap computer, or do you want to work hard to get that nice K7 fully loaded which will last you for years to come and do everything for you?
Your decision.
---
--
Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
Before girls can really grow up to become grrlgeeks, they first have to pass through puberty, during which most boys and girls are not wholly comfortable in the presence of the other sex. Boys and girls both like to hang around in same-sex groups, be in same-sex lab teams, etc. It is very hard for boys and girls both to stand against this tacit code; those who do are ridiculed. So boys seldom choose activities in which girls predominate socially, and vice versa.
About a year ago, a local rag (the New York Times, I think) "investigated" why the rate of girls attending the special public high schools for math/science here had dropped to 37% -- the reason most girls who had passed the admissions test gave for NOT attending was that they didn't want to attend a school in which they wouldn't know anyone else.
I would like to do an intervention in which I formally mentor (for at least a few months) a small group of girls in the 6th and 7th grades, before they take the admissions test for these schools. (Btw, I have assessed and edited items on this test for the past 3-4 years.) Since I currently work as a consultant and basically set my own hours most of the time, I could easily run such an after-school program. So if any parent of a suitable girl (12-13, bright, interested in science/math, living in NYC) should read this, I would work very cheaply with a suitable group:
I am proposing an informal afterschool program of 2-3 hours daily , for up to 4 girls, to be billed at a total of $20/hour (not more than $300/week total, which could be split by the participating parents). My goal is to build connections among a peer group of girls who all want to go to the special school together, and can probably pass the test to qualify -- particularly with my tutoring/enrichment programs. We would meet in museums and libraries, as well as at the apartments of the participating girls.
If the program works as an informal pilot project (i.e., at least some of the girls are admitted and accept transfer to the special schools), we could work to build a larger-scale formal mentoring program, perhaps using local women college or graduate students as paid mentors (work/study?). The program could be called "Brightgrrls" -- and would have its own Web site, of course, to help other grrls build the necessary social links by themselves (using chat), and study with material posted on the 'Net. We could ask sixth grade teachers to identify likely candidates for the formal program; we could also encourage each paying group to include a subsidized low-income candidate.
I have been thinking about this a lot -- as perhaps you can tell! -- but unless I make contact with a suitable parent (or "networker" in the school system), I can't make much progress implementing such a program!
Btw, if G. Bush said "Those who do not remember the past are condemned to repeat it," he was quoting someone who said it a lot earlier than he.
You are a knob.
*** Stop trying to be cool. ***
I once had a girl friend who used to complain every time I started to talk abut programming with some friends at parties. (We were all programmers). It's not like I was only talking about programming but just because it wasen't something she liked. And I've seen lots of women act that way. You can see them roll their eyes and say, "here they go again"...
actually, that's a pretty damn good description of what my boyfriend does, since he's a MechE geek... he actually will not go to parties that he knows are all computer geeks (think Eta Kappa Nu banquet -- he hates to dress up, and he hates to talk about programming)
he's a sweetie, and I can't blame him, becasue the humor gets pretty bad when the EECS geeks get together!
Lea
Props. Respect, 'ups'. Shorthand for 'Hey, that was worthy of props!', in a self-referential sense.
-grendel drago
Laws do not persuade just because they threaten. --Seneca
Apparently Ottawa is the haven for many so called geek gals. In the companies I've worked at, 15-20% of the staff have been very competent geek gals. I'd go so far as to say they combined the best of the technical and non technical (interpersonal) skillsets. As it turns out, today in high tech, geeks (as in people who have to live in closets, get fed through slots, and live to code) are more rare. In a world where the coder is being replaced by the designer, team interactions are becoming even more vital and many women work very well in teams, something a lot of guys have to learn to do. But as it turns out, information technology and computer engineering professionals (regardless of sex/gender) are learning that the soft skills are what makes the industry (especially consulting or contract software development) work and are what translates into those $$$. I'm quite happy to say I've met some awesome gals in high tech - smart, pretty, good in teams, and technically competent. And most of the guys I've worked with have been very happy to see them there, very respectful of their contributions, and more than happy to make a place for them. There are still a few dinosaurs with age-old bias and patriarchal natures, but quite frankly, these beasts will be dead and gone in another decade. For now, gals still run across the occaisional sexist obstruction in the heirarchy. But from what I've seen, most of them are more than capable of dealing well with any such temporary problem. Some have observed there aren't a lot of women CEOs... I say "wait for it". The day is coming. I don't know if we'll ever have a 50-50 balance, because many women want families too and rising to CEO ranks takes time and focus that often precludes that, but things are improving. And any gal that wants to meet nice guys, work in a field that harnesses creativity and where brute strength and testosterone aren't an asset, and who wants to make a good wage, give serious thought to some branch of the computer field. The hours are sometimes long, the commitment sometimes high, but the payoffs are large both in terms of $$$ and satisfaction of having built something and exerted creativity and imagination. Thomas. -- Aut Augere Au Mori! :)
Pleasure in the job puts perfection in the work.
There was never a genius without a tincture of madness.
Aris
>I accuse my parents...
I credit mine! I never heard messages like "girls can't do math" or "girls can't do computers". When I said I wanted to be a mathematician when I grew up, my parents bought be books about how to do it.
When I was 11 or 12, my father taught me how to use the Wyse terminal in the basement to dial up to his office on the acoustic coupler modem, log in, and play adventure and hunt the wumpus. We got a Commodore 64 when they first came out, and Dad taught me how to write programs in basic.
Despite the anecdotal arguments here in this discussion (data is not the plural of anecdote!), there *is* a gender difference in how children are turned away from being geeks. Yes, boys often get beat up for joining the chess club. But they are not bombarded with messages like, "boys won't like you if you're too smart," the way girls are. There is a clear preference for athletics over brains in our school culture, but there is still room for boys to think they'll attract some girls by being the smartest rather than the strongest. However, study after study has shown that girls crash and burn in middle school / junior high. They match the boys score for score in math and science until they get old enough to start thinking about wearing make-up, and then their math and science scores plummet. (And boy, I don't even want to get started on how challenging it is for the kids who are pubescent, geeky, and gay.)
Cara Hart chart@eNOSPAMfurn.com Systems Administrator eFurn.com, LLC. and ARITEK Systems, Inc.
There was only one girl in the class. Partly because all the chicks at my school are stupid, partly because they don't want to be seen in that class. It is embarrassing (or frustrating for their feeble little minds) for the girls at my school to be in there.
Another point: if someone argues that there are a lot of girl geeks, then why do all those guys have to sit around creating Lara Croft?
Geeky girls, I think, are stuck. They don't want to enter a predominantly male field, or they don't like what other people will think about them.
I could be totally off target, too.
http://yottys.homestead.com
What are you trying to tell me? That someone who is gifted enough to fuck beautiful women could NOT have a plain nice girl? You're wrong.
The problem was the lack of social skills (for relating to people outide their set) many of these guys had.
Or maybe others lack the social skills needed to communicate with them.
Just because their communication skills are different, doesn't mean they aren't as good as everyone elses.
Mikael Jacobson
Greylisting is to SMTP as NAT is to IPv4
Um, you're right, staring at code CAN be a socially isolated activity. But it's your job, anyway. And it doesn't have to be - most of my projects in college were group projects. We would frequently have all four people (or whatever) huddled around a computer screen trying to debug somebody's code.
I guess I'll spill my other opinions while I'm here. I am (gasp) yes, another female computer scientist. Yet another voice crying out about this article.
A-hem. Anyway... I have heard these horror stories of teachers who discouraged female students from technical things, but, frankly, I've never actually seen any.
Then again, I was already pretty well into geeky things before I got to school - We got our first computer, a TI 99-4/A when I was four. Sure, not much of a computer, but I learned how to make an infinite print loop that said "Look what I can do!" before I went to kindergarten. My teachers always told me I could be whatever I wanted to - including when I wanted to be an archaeologist in elementary school. :)
In junior high, I attended a summer program at the University of Michigan that the whole point was exposing and encouraging young women to go into science and math.
Finally, I attended the Rose Hulman Institute of Technology. Most people won't have heard of it, because it's pretty darn small - around 1200 students. Total, not per year. This college teaches just math and science. I was in the first class they admitted women. Pretty scary. But you know what? Every professor supported it, at least the ones I had. They wanted us to be there, and they wanted us to succeed. Heck, they even changed the numbers they usually accepted, just so no guys could complain that they weren't admitted because some woman bumped them out.
Most of the high GPAs in my class were from the female students. Oh, incidentally, that's what we were called - females. Not old enough to feel right being called "women" or "ladies" and we felt pretty, I don't know, demeaned being called "girls". So we were females and they were guys and no one really cared that we were there except that 1/13th of the male population didn't have to go across town to find a date.
Okay, that's enough rambling. Sorry about that.
Kria
icq: 259828
I would disagree with your king of the hill mentality. I go to school which only offers Engineering and Sciences. With few exceptions I consider just about everyone a geek. Anyone who stands up and says there smarter than eveyone else quickly gets put to shame. Some of my smartest friends really don't show their "smarts" outside of school work. As far as geeks not growing up I think you are making a gross stereotype. Having gone to an all-male high school I can tell you that the geek population had a higher percentage of mature people than the purely jock population. As far as girls maturing faster I think that's a ignorant statement too. I have seen many a girl get quick vicious about petty things. In my experience is that on average guys resolve agruements more maturely. Sure sometimes guys result to fighting and violence but I think that can be consider to prolonged bitter agruements where people pretend to like each other and just talk about people behind their back. It's not that one gender matures quicker than the other it just that each gender has a tendacy to show maturity in different ways. Your comment on hygenine is quite an insult. Geeks tend to be less superfacil than other types of people but it dosen't make them dirty savages. With little exception all the geeks I know are as clean and hygenic as a normal person. My opinion on why CS is predomitantly male is kinda sexist. I think computer use can be related to testosterone. Computers is an outlet for agression thru computer games. Computers can be outlet for competition. Computers are an outlet for a want of control (don't know if that's a testorone thing). Plus women tend to be more socially oreinted. I found that my social life interfers with my computer life. In conclusion I think the nature of men is more compatable with the nature of computers than the nature of women are to the nature of computers.
Good response!
Most chicas can handle it, how about you?
Oh sure, I can handle it, whether I want/need it or not is another question. I don't think geek girlfriends are bad (they rock!) but I do think that limiting your significant-other search to geeks is bad, and that geek missionaries are extremely bad.
I also think that all relationships need common ground. And hey, what better common ground is there than Q2DM1, or perhaps Q2DM6 if you're handy with a railgun? :)
OtakuBooty.com: Smart, funny, sexy nerds.
I think you are close. My understanding of the situation comes from a show I saw on TV about the sexes. It states that modern behavior differences date back before the dawn of civilizations. The role of men was to go out and hunt for weeks and months at a time. The role of women was to stay home and tend camp and care for kids. Because of this Men developed behavior that was extremly mono-manic; follow the herd and kill some animals. They only worried about two things: survival and hunting . Women and the other hand stay at camp. They have a tendency to be able to focus on many things at once. The camp is also very social compared to the silence of a hunting party. Sure this was 5000 years ago but you must remember that Humans acted this way for close to 2,000,000 years. 2,000,000 greatly outways 5,000. I think there should be more women in the field. With their inherient adaptness with mutli-focus imagine how advanced the field of parallel processing and multi thread would advance. Perhaps the fact that CS is a predomitantly male is severly hurting the field. I'm a strong believer in strength thru diversity. EOC(End of Comment)
Perhaps you are right about the good geek guys hiding, but I can't find any :(
If you had your email address listed, your mailbox probably would have been Slashdotted with 20,000 volunteers. Whether or not that's a good thing is an excercise left to the reader's imagination. :)
OtakuBooty.com: Smart, funny, sexy nerds.
The Geek Code allows for all kinds of geeks.
Constitutionally Correct
;-)
Keeping
...In that case, it looks as though George Bush did in fact forget the past and repeated it...
I don't know the significance of this, but it's an interesting observation nonetheless.
----
----
"I used to listen to Null Device before they sold out."
I just graduated from Berkeley, and there were a lot of females in my computer classes. The thing was, there were very few American Native Girls in my classes. I don't mean the people that lived in America before stole their land and raped their families - I don't even mean people that are not WASPs. I mean people that were just born here. 2-nd generation immigrants on up. All the girls were from Russia, Taiwan, Vietnam, etc... Only a few that I could tell were born here. And, even then, I remember only a couple girls in any of my classes whose families were likely to have been here for several generations.
So, what does this mean? I have no idea. Just thought I'd mention it. Perhaps it's purely american culture that discourages Geek Girls.
Run a pencil-and-paper RPG campaign with your far-off friends: Gametable!
No one said anything about pushing girls into tech careers. The whole point of the gender (or racial or age or whatever) divide is that assuming people are in fact equal, why is there this huge difference in the percentage of men in tech fields vs women in tech files? Since we assume that people are equal, we expect the percentages to be the same, and if they aren't, then we say, something is "wrong."
Ok, I just have to say this here. I am SOOO Tired of everyone screaming about how everyone is equal. Everyone is NOT EQUAL! NOT! People are Equal in the Eyes of the Law. That does not mean that if JoeBob the weightlifter can bench 415 then I can bench 415, It doesn't mean that if I can strip down a computer to its component parts and then reconstruct it that JoeBob will be able to. We all have different skills, different abilities. Those skills and abilities aren't always divided along racial or gender lines but sometimes they are. No one is Equal to me, I am not Equal to anyone else. We are all viewed as equal by Law. Which is an ENTIRELY DIFFERENT concept.
So now that I've got that rant out of the way you can continue your conversation.
Kintanon
Check out JoshJitsu.info for Brazilian Ji
It is completely different. Specific parts of the brain are hardwired for language with the result that close to 100% of children have the capability to be mulitlingual at age 5. Yet, a vanishingly small percentage of those children have the ability to do anything close to coding at age 5. Later, when some of them learn to code, they are using parts of the brain with no "code" hardwiring.
You posed a reasonable [rhetorical] hypothesis, but it doesn't bear up to close scrutiny. I'm pointing it out because it is a good instructive example of how something should not be taken as truth just because it "makes sense". That is an error many people are making in this thread, people who are claiming to be good at math and science, but citing as their evidence a single, uncontrolled, statitistically insignificant piece of anecdotal data. Claim it all you want, but "I know a girl who is a good coder" is not evidence that girls have the same aptitude for coding that boys do. I mean, I know girls who are good basketball players, and while I'm sure that the NBA is looking for the best, I'm equally sure that we will never see women playing professional basketball in anywhere near the numbers as men.
Here is a better way to think scientifically about the issue than what I've seen in this thread:
Now, I know that the sentiment here is that it would be great if women were every bit as good as men at programming. It's a sentiment that I share. But I recognize it as a sentiment, not science.
yes there is a long history in the united states of women having the "motherly" role.. while feeling unable to function in other circles of their environment.. hopefully in time less women will be hung up on the stigma of being accepted by the majority
Maybe when our society stops thinking of child birth as such a wonderful accomplishment that will decline some. But everyone praises these couples that have 8 kids at once even though there is no way 2 people can support 8 kids. People need to realize that there are 6 billion of us, that's enough for now, let's chill out on the breeding for a little while and learn to manage our current population.
Kintanon
Check out JoshJitsu.info for Brazilian Ji
At the high school I go to, there are plenty of "normal" female geeks, but about 99% of them don't even like to *use* computers. Sad.
Chris Armstrong
Chris Armstrong
Why is it that people always feel that everything has to fit according to statistics or all is not well. Gender imbalance reminds me a lot of the so called Digital Divide...lots of liberal middle class whites who feel that the poor underclass must be forced to be as technically inclined as they are. Frankly, I'm black and I have lived amongst and known black people all my life, and being computer savvy is not high on the average black person's to-do list. No amount of government intervention is going to turn the average poor black person into some cybersurfing, net junkie simply to balance some statistic chart.
Back to the topic at hand, why is it that people feel the need to try to push girls into technical careers? From my experience most females including the ones that are good at Math (both my last two girlfriends got A's in Calculus II but one's an English major while the other is studying criminal justice) do not like technical fields. Frankly the crap about gender imbalance to access computers is a load of bull, this isn't the fifties when women couldn't eat without a man supporting them...any woman worth her salt can get a job and buy a PC or go to the library. The last time I checked the neither CompUSA nor BestBuy was discriminating according to sex. Also, the article describes negative social pressure for women to get into technology, but fails to mention that until the Internet boom of a few short years ago there was negative social pressure for men to get into technology as well. I remember being teased and taunted for being a computer geek while in school and even when I grew older I was still looked upon by others with disdain, off course being uninterested in sports probably didn't help this.
PS: I am very tired of self righteous people who want to mold the world in their own image. Women don't like technical fields, so what? Men don't flock towards positions in elder care, nursing or child care yet I don't see articles bemoaning this.
If girls/women were doing computer work, there'd be almost twice the programmers, and I'd get paid a lot less.
So, what's the incentive here?
I teach web development classes to lots of women. I find that they easily get frustrated with software in a short period of time. I believe this is a result of women primarily deriving their logic from emotions and men primarily deriving their emotions from logic. As computers have a great lack of emotional content and interfaces, women find them cold. As a result they do not have much interest in working with a device that doesn't give them a good feeling more than they have to. Guys get great feelings from working with computers after they make a major accomplishment such as writing and compiling your first C program. It's quite true that there are exceptions to this but I find this typically describes the general population wordwide. Maybe we should write a female interface that comes closer to giving a pleasant experience. Out of the box, no OS I've ever seen even comes close. It would likely have to talk to the user and have them fill out a questionaire as part of the installation/setup process. Then we'd need girls to troubleshoot/develop it as being a guy it would be a terrible experience having to fix something like this. We'd have an excuse as to why we couldn't fix our girlfriends computers too!
What?!?! Where do you work at? Every place I've worked since college has consistently been a melting pot of white, asian, asian indian, latino, etc. men and women, and yes, several gay men/women too. I think you're grossly oversimplifying by saying the industry is flooded with nothing but "straight, white males". The fact here is that the computer industry is one of the most diverse that there is! Sheesh... Someone's got a chip on their shoulder.
I modded the Troll Investigation and I got
at work. *in our society women are almost chided if they try to do anything but power their cheeks and paint their nails. * almost? ever looked in one of those mags they're encouraged to read? ever think about the true nature of the barbie doll, or kid's toys in general? we are all generally brought up to fill certain narrowly defined, well channeled gender roles, specifically designed to give us social 'handles' that can be used to direct our perceptions and therefore actions.. boys do this, girls do that, deviate and you're a 'fag' or a'slut' or something else we've been trained to fear being labeled. and just for the record goths, and other sub-cultural mutations(there are soooo many), are the smart-assed opposite-reaction to this sort of immersive control..
It's interesting which concerns over gender roles receive attention and which don't. Everyone sees computers as the hot field right now, not just because the field is lucrative but because it's symbolic of the leading edge of societal progress. At the same time, the fact that women gravitate (for whatever reason) to different jobs than men do is nothing new. No one talks about the fact that very few women become auto mechanics, but I would venture to guess that the same causes underlie both cases.
Well, I'm definitely a geek girl (math and computer science all the way!), and I don't know exactly why there are so few girls. Ever since I started going to math programs and such in high school, I've noticed that there are always a LOT more guys. Even at the gender-balanced programs, all the INTERESTED people are guys; there are girls, but they don't seem to be there out of any particular interest. Seems to me that the anti-geek tendency for girls starts much before high school, but I don't know why that is.
i think that it just takes a certain type of person to be interested in technology, not a specific gender. it also takes a certain amount of determination as a woman to be willing to dive into a male dominated culture like geekdom.
i think that another thing that holds women back from achieving really well in technology is that to be a true uber-geek you need to put in really long hours. technology has to be your 24hr/day obsession. i think that most women would rather go home at the end of the day, see their friends or family and have a little more balance, a little more of a life.
I was getting all ready to mod you up, then those last two paragraphs...
What is the robbing of a bank, compared to the founding of a bank? -- Bertolt Brecht
I've had a rather bizarre life. I was a lifeguard in high school, a jock AND a lifeguard in college, and am now a network engineer in 'real' life.
/. and in the IT world we throw the term around affectionately, but you must realize that most of the world isn't in our circle and in THEIR world, a geek is not a good thing to be.
:)
I still look basically the same. 6' 1", 210 athletic pounds, dark blonde hair, blue eyes. The anti-geek. But when I was lifeguarding and in college, I picked up WAY more girls than I do now, even though I am exposed to just as many.
My personality is basically the same, but that twinkle in my eye and uncontrollable grin that takes over my face when I talk about encryption or compression or alternative operating systems seems to be a genuine turn-off to girls.
I don't know if they are intimidated by me because they don't understand what I'm saying or they are simply assuming that I'm a geek at heart (which I am) underneath my athletic frame.
Girls are taught that geeks are not desirable men. Here on
I don't wear glasses. I'm not fat. I don't shoot milk out of my nose when I laugh. Well... I *usually* don't...
But once girls find out what I do, I'm suddenly a geek.
I think society's perception will change in time as the IT profession becomes more and more important. Network engineering will one day be thought as 'cool' of a job as being a lawyer or doctor.
The upper echelon (top 15% or so) already makes the same amount or more money than the other 'prestigious' professions. Respect will come in time, I think.
Many people are already dismissing the 'geek' notion just because someone is into computers. But even more are clinging onto the stereotype. People in my company can't even comprehend why I make 2x to 3x more than they do. Sometimes I feel like handing them a keyboard and saying, "If it's so easy, YOU do it."
If they really get to you, just do what I do. Hack into their home machines and leave a "y00 h4v3 ju$7 b33n h4xx0r1z3d bi 4 31337 h4xx0r d00d. $$$$$$$$$ EZ $$$$$$$$" message on their screen.
They'll be your best friend the next day
Remember, you aren't getting paid big bucks for what you know. You're getting paid for what the rest of the world doesn't know.
Knunov
Why do users with IDs under 100,000 or over 700,000 usually have the most worthwhile comments?
I wanted to respond to this as I am a woman (out of college 10 years) who works in the computer science field. I realized, though, I really don't know why more women do not go into this field. I find that the ability to make a machine do something and to *create* is very seductive. Many of my women friends are programmers or engineers as well. I'm much more interested in the comments of women in my age group *not* in computer science, though I doubt that ./ has a large population of them. It would be interesting to compare the perspective of different age groups of women. I certainly hope women my age don't say things like "Guys are more computer-type people." I agree that computer science skill and interest is probably not inherently linked to gender.
Network Security: It always comes down to a big guy with a gun.
Does anyone really want to be the stereotypical geek?
I remember when I was a kid, I wanted to be a fireman, actor, etc... but never a pocket-protector wearing, tape-around-the-glasses, fat-ass guy in tight pants.
Now just try imagining a girl like that!
Maybe on your planet women need fancy clothes and a hot car. I manage all right with neither.
Of course, the fact that lawyers are capable of holding an intelligent, witty conversation might have as much to do with the female selections as the car. Face it, they're _paid_ to talk. That's an incentive to boost one's social skills.
My social skills greatly improved when talking to customers without embarassing myself became part of my job description.
my last girlfriend was pretty geeky. Most of my friends are girls, and very geeky. Well, I think that has some sort of bearing on that you HAVE to be a geek in order to spend more than five minutes with me :-)
:-) And yes, the last relationship failed miserably due to my poor social skills. However, if any girls out there are Nurse With Wound fans . . . :-)
Anyway, I've known just as many geeks who were female as male. Just because a girl doesn't talk about Star Trek or whatever doesn't mean she doesn't like computers, or isn't good with them. I think if you're going to just go from initial impressions, yeah, you're going to find that guys are alot "geekier" than girls. But I find there really isn't too much of a gender split, except on the most shallow levels. Even that is overgeneralization, as that I've known girls who WERE the stereotype.
I guess what I'm trying to say (albeit poorly) is that if we're GOING to make over generalized statements like this, we need to define what makes a "geek" versus "non-geek". Personally, I define it as "devotion regardless of popular opinion". If someone does computers because they think it's the cool thing to do, then they're not a geek. If someone loves obscure movies not because they're obscure, but because they do regardless of what anyone thinks(good or bad), then they're a geek.
As for the article, consider the source
Bad things often happen to good people,
It is up to them to see that they remain good.
Thank the failed "Equal Rights Amendment." It proposed to prohibit discrimination on the basis of sex, and some bright bulb opposed to it realized that "sex" can refer to either a noun (the plumbing) or a verb (what you do with that plumbing). Gender isn't a verb - you'll never here someone singing about how they want to "gender you up."
Toss in a non-unreasonable legal interpretation (if a broader word is used instead of a more precise word, the author must have chosen it deliberately) and a bit of fear-mongering about the Law of Unintentional Consequences, and you get the charming theory that the real effect of the ERA will be to prohibit laws banning sex with members of the same sex (remember, the ERA was debated in the 1970s when gays didn't dare show themselves outside of a few major cities), interracial couples (ditto), to say nothing of pedophilia, necrophilia, etc.
Look at the current debate over "gay rights" and multiply it 100-fold. Most of the opponents of the ERA were misogynists of the type that you only find in the Southern Baptist Convention today (or am I the intolerant one for mocking their stated belief that wives must be subservient to husbands, women must stay out of the pulpit, etc.?), but a significant number of liberals were also concerned with the ERA because of the very real possibility that it could be viewed as covering more than intended.
Unfortunately, as another poster observed other people are defining "gender" in psychological terms. It's not <i>that</i> far from "homosexual female trapped in male body" to "13-year-old horndog trapped in 25-year-old body." The latter may even be a valid description of someone with arrested sexual development, but that doesn't mean that we as a society must condone pedophilia.
Bottom line: you may have had a point a generation ago, but this is one area where the language is rapidly evolving.
For every complex problem there is an answer that is clear, simple, and wrong. -- H L Mencken
I don't agree with that being a reason... Women have run across that mentalitly in quite a few fields. There is a typical "Good Old Boys Network" mentality that people have to get out of and if it wasn't for strong women getting into the problematic fields and showing people they are just as capable of doing the jobs the problem would still exist everywhere. Granted that is a problem in computer science from my experience. But not one that should stop women from entering the field. There are way too many strong women in the world for that to be a reason.
:) I REALLY do believe that!
And no there is no girl looking over my shoulder as I write this...
Guys tend to have few social skills, like giving feedback, discussing in a fair manner, self-reflecting. They don't care about themselves, their rooms, others.
That's not the case with everybody of course but it's a tendency.
Being like this is "cool" or common for men but ugly and a shame for women. They are supposed to care about others in our kind of society and are urged to concentrate on social skills, not the quality of code.
I guess they feel like aliens in geeks' homes.
And the difference between lawyers and IT guys is: Lawyers have to look like trustworthy, serious representants of their clients.
they have to care about their outward appearance and offices more than IT guys.
there's enough for everybody, let's share it
Psychological studies have proven time and time again that men are more concerned with sex than women are. It is a stereotype, yes, but in this situation we must look at the mass numbers. If men care more about sex, and technology is bad for getting sex, wouldn't it make more sense to say that men have the disadvantage? Maybe there are other factors, besides sex appeal, that makes the population of guy geeks so large. By simple logic we prove that there SHOULD be more girl geeks if we only consider sex. I'll leave the real reason up to the intelligent people who came up with the sex appeal one. Bah.
Sometimes i feel really inferior compared to the males, it's almost as if they treat my like i'm stupid because i'm a girl... though i try harder then most of them to learn things...
That's probably also due to the nature of the geek world itself. Most link self-esteem to technical knowledge, and sometimes the easiest way to elevate yourself is to belittle someone else.
Try browsing the bottom of the page for some really lucid, well-thought-out explanations and opinions.
heidi
I hate football AND basketball. Too tense. Too commercialized. Too many rules. Rigidly timed games. Too much stats. Anything deviating from the stats is called an "upset". I always wonder why people watch if they have such a strong pre-determination of what they're about to see.
Baseball is far more relaxing and enjoyable to watch. A little more random. No clock to worry about. No scary buzzers. Far less cheating. No stress. Which is exactly what I need after racking my brain staring at severely inbred (inheritance wise) C++ code.
Aren't there any baseball fans anymore?
I wonder if alt.cooking have forums about men not participating as much as women...
Hey... I'm a girl and I like the man show...
there are many geeks who are just not computer geeks. band geeks... english geeks... et cetera. Some of us geek girls actually do drool at that type of equipment (computers), though. I am guilty occasionally. Perhaps it's just a different set of status symbols or something...
Says who?
I don't think socializing is an activity that's gender-specific. Some people are more social than others. Some of those people are female; some are male.
I think it's more likely that too many girls are still surrounded by the "Math is hard" Barbie doll and the "Oh, you're just going to college to get your 'MRS' degree" attitude to think seriously about studying computers or engineering. The girls who were interviewed are at an age where they are just starting to think for themselves, and haven't had a chance to really explore what they want to do or to look past the misconceptions of what it's like to be a computer programmer, sys admin, whatever.
I think the current breed of tech worker wants to make money. Years ago, this was the type of person that would have become a doctor or lawyer. Now they become CCIEs. We have all met doctors and lawyers who became what they are not for the money, but for the love of the work. If you love something, you excel at it.
That's why I became a tech. Now, just to say that there are more dudes than chicks in the tech industry is not to say that there are more male than female geeks. I'm sure there are, but I'd just like to point out the distinction. Traditionally males have flocked to the higher paying professions. I think if you look at the ratios of female geeks to male geeks, and the ratio of female tech workers to male tech workers, you would see a discrepency.
--- Phyre
This subject goes beyond just one study. I think that it would take many studies to get the "big-picture".
.. stuff that doesn't interest me.
But, I would like to make these points:
Women only began voting approx. 100 years ago. Women only began to work less than that time. And an active encouragement to be educated in anything remotely scientific only truly began in the last 30 years. My mother remembers that she did not have to take maths (physics biology and any other science subject) past the time she was 13. So, I think we really need a bit more time to see if the equal opportunity programs that many countries have implemented have worked.
It has been my personal experience that being a "geek girl" has been, well, lonely dammit. I don't know many other girls that like to talk about computing, and if I start talking to a bunch of guys, the topic can often turn to cars, girls, sport,
Michelle
----
Be true, regret not, and let your star shine forth!
Quite frankly, any group of guys has a tendancy to stray toward the "geeky" side of things. Don't think that "geek" is not synonymous with "aficionado". It is. Listen to the boys talk about the big game. Listen to the connoisseurs talk about last year's Merlot. The subject doesn't change the pattern.
I looked long and hard to find a job were I couldn't describe the Devel. Dept. as "The Nerdery". Some people are willing to work in them, but I won't. I think women, in general, aren't fulfilled by the same work as men. Who expects them to be?
I should probably note that "women in general" means an assortment of girlfriends, past and present, sisters, cousins, etc. and I'm in no way claiming to speak for all woman-dom <shudder>.
The Point: Equality has nothing to do with the number of different groups in any one situation. It just means that everyone has the same access. If a woman doesn't want a job from a tech co sweating to give here one, all the power to her. I'm not going to worry about it, because she'll find another way to contribute to society.
ps. A belated Happy Canada Day, Canadians! Um... is Independence Day "happy"? Anway, a premature Happy Independence Day to those denizens of the U.S. of A.
You can never put too much water in a nuclear reactor.
There are some girls out there that like violent computer games, yeah, who'd want barbie software?
This page explains well what is a geek. Some of the most interesting tidbits where:
So yes, there are girl geeks, in chatrooms everywhere. In the fashion section of AOL. In a barbie discussion forum. Some might even be technically competent.10 LIST : REM MER : TSIL 01
Actually, Gender is what someone associates with themselves. One's gender tends to match one's sex, but that is not always the case. Ergo, it is more appropriate to say gender. Sex is a physical construct. I'm sure that if a biological female had Gender Identity Disorder, he would be more likly to be a geek. As a matter of fact, one of my very good friends is a geeky male who was born female.
Finally using what I learned in women's studies,
Dusty Hodges
This is an interesting subject; the number of women in IT careers has been discussed time and time again at http://www.womengamers.com The Womengamers.com staff members have posted several articles on this subject, but the most relevant to this case would be http://www.womengamers.com/articles/womenIT.html , or "Search for the Techie Woman - Part I" Womengamers.com (no, I don't write for them, nor have I been paid to advertise ;) ) has done numerous studies in this field, especially in relation to the number of young girls playing computer games. The conclusion among "Girl Game" developers seems to be that increasing the number of games targetting a young female audience will increase the number of women in the IT field, as playing games increases the player's comfort level with computers and may increase their interest in the subject once they see what computers have to offer. Their logic sounds about right to me. I am a "girl geek," and I take pride in it. Although I was never considered to be a geek when I was in high school, and even enjoyed a good amount of popularity, there was always a degree of cultural friction as a result of my interest in subjects that were traditionally for boys only, such as programming and robotics. These "tech" hobbies never offered me any field-specific female role models, and my interest in them was something that was frowned upon by both peers and elders. People even had a problem with my playing console games, a hobby which probably lead to my involvement in computers in the first place. My IQ qualifies me for membership in Mensa too, but this was also something to be ashamed of. High intelligence in women is not quite as acceptable as it is in males, as it would seem, so I made use of Barbie's infamous, "Math is hard" mantra and was absolutely bored to death in school. It is just not socially acceptable for women to be "geeks," "nerds," "techies," or whatever else you want to call us. But you know what? Some of us just don't give a damn about what society brands us. I never fit in with the crowds, just like the geeky guys (and that's probably why I date geeks almost exclusively). Women just face a little more ridicule.
I think its rather unfair to be overly judgemental of people who worry about who they will be working with in a chosen field. I'm not saying its right that they want to avoid geeks, basically saying they dislike intelligent men, but that's another topic. The type of people in a field you make a career in are the type of people you will have to deal with on a daily basis for the rest of your career. If most people in a given field tend toward a personality type that you don't get along with or care for, then that is a good reason to consider other options for what you want to do with the rest of your life.
Humans evolved from peripheral beta males who had to find ways to cope with the marginal resources of ecological ranges or die. Frontiers. Technology and its gender bias is an abstraction of this ancient gender bias.
Seastead this.
Ever thought how modern computing would be different if it was women dominated by the start?
I always find these postulations ridiculous. Human nature is similar enough between genders and external factors are constant, so it's not like we would program computers by arranging flowers on screen and all computers would crash once a month. The only difference that would matter is that we would all be reading an article about how guys don't want to be geeks.
And if you are interested in the influence on early computing by a woman, look up Grace Hopper. Of course geeks might not be too happy about her support of COBOL.
Scuttlemonkey is a troll
I have been recently thinking about beer. Beer is the nectar of Gods. We're not talking Guiness or Cerveza here, we're talking the real shit, Steinlager, Heineken, Pete's Ale.
,o(__),_)o(_)O,(__)o
.O(__)o,__).(_ )o(_)Oo_)
.----|......|......|......|......|......|_)0
/^^^.--|......|......|......|......|......|,_) . |o(_) . |_/`) . |O_) . | . |
The problem these days is that people can't appreciate good beer. Too many people just get wasted on cheap-ass Ice House, Coors, or even worse, Bud. And that is a shame.
In the old days, things were different. Beer, that was a commodity. Good, aged beer was valuable. People treasured those moments of enjoying a pint of cold, tasty lager with plenty of head. Nobody would touch an aluminium can, let alone beer in plastic.
Open up a can of MGD today, and you've set yourself up for some major disappointment. Firstly, aluminum leaves a nasty aftertaste in your beer. Secondly, MGD has absolutely no head. It looks like stale tea. Thirdly, it tastes like stale tea too.
Henceforth, I urge you people, don't drink cheap shitty beer!
_, . '__ .
'_(_0o),(__)o().
o(_,-o(_ )(),(__(_)oO)_
|^^/.........|......|......|......|......|.....
|^^|.........|......|......|......|......|.....
|^^|.........|......|......|......|......|.....
|^^|.........|......|......|......|......|.....
|^^\.........|......|......|......|......|.....
\^^'---|.....|......|......|......|......|
'----|......|......|......|......|......|
|......|......|......|......|......|
\......\......\....../....../....../
`"""""""""""""""""`
Enjoy life, drink beer.
thankfully, we 'geek chicks' are smart enough to know that we don't have to settle for men with mentalities like the ones expressed in this post.
"Leave no authority existing which does not answer to the people" --Thomas Jefferson
OOG NO NEED READ ALL THIS NONSENSE ABOUT GEEK GIRLS ON SLASHDOT!!! THAT WHAT OOG FAVORITE PORN SITES FOR ANYWAY!!! BUT SINCE SO MANY POSTERS SEEM NOT TO KNOW SHIT ABOUT WOMEN, OOG THE CAVE PIMP DIVULGE HIS KNOWLEDGE OF GETTING SWEET CAVE LOVING!!!
OOG READ POSTS HERE AND STARTLED ABOUT PEOPLE HERE WONDERING WHY THEY CANT FIND GIRLS!!! OOG KNOW NO WORTHWHILE GIRL COULD STAND OBNOXIOUS PSEUDO INTELLECTUALISM OF MANY POSTERS HERE!!! SO MANY SLASHDOT PEOPLE KNOW-IT-ALLS, KARMA WHORES, ELITISTS, ETC!!! IF YOU LIKE THIS IN REAL LIFE, NO WONDER PEOPLE NO LIKE GEEKS!!! PERHAPS LEAVE MONITOR, CLOSE PROGRAMMING WINDOW, AND LEARN ABOUT REAL LIFE!!! AFTER ALL, OOG NEVER GO NEAR GEEK CAVE WOMAN BECAUSE OOG CANT STAND SUCH ONE DIMENSIONAL MENTALITY!!!
OOG ALSO NOTICE HOW CERTAIN PEOPLE USE GENDER STORIES AS WINDOW TO START BRAGGING ABOUT CONQUESTS AND TRY ONE UP PEOPLE!!! GUESS WHAT, OOG CLUB MORE CAVE WOMEN AND DRAG HOME TO CAVE THAN YOU HAVE KARMA POINTS!!! BESIDES, NOBODY CARE ABOUT YOUR LITTLE BRAGGING STORIES!!! OOG BET YOU ONLY GET RELATIONSHIP BY SETTLING FOR UNATTRACTIVE CAVE WOMAN!!!
IF YOU WANT ADVICE ON WOMEN, OOG HAVE THIS TO SAY: CLUB WOMAN AND BRING HOME TO CAVE!!! IF THAT FAIL, GET CAVE WOMAN DRUNK ON CAVE BEER AND HIGH ON CAVE WEED!!! THAT NEVER FAIL!!!
OOG THE OPEN SOURCE CAVEMAN!!! OOG BREAK HEAD WITH OPEN SOURCE CD!!!
There was a very interesting article in Glamour (I was just flipping through my girlfriend's copy, making fun of the ads!!! I promise!!!) in April, I think, about sexual harrassment at high-tech firms. It focused on Juno. The stories sounded pretty awful. While I do not know how prevalent sexual harrasment is as a whole, things like that aren't going to encourage women to enter the field, even if they occur in only a tiny fraction of high-tech firms.
Just as a side note, women were in fact the first electronic computer programmers. Note the Wired story on the six women who first programmed the ENIAC. Women Proto-Programmers Get Their Just Reward
... that's all i wrote...
I have worked for several companies that have female geeks, several in important jobs. Having worked in several locations abroad where "male only" is a mandatory requirement, I welcome their presence and admire their skills. Companies are in business to make money, and if prejudice gets in the way, it gets downgraded. Many of the women I met in industry were accomplished technicians, programmers, engineers, and even administrators of geeks (Managing engineers is like herding cats). The majority were married and raising families, some while also going to school and working full time. The presence of ladies in the workplace makes life a little better, and I am always happy to have my wife meet any of them. A talented geek will be given more responsibility and more privileges as long as the company continues to profit from her. I saw only a few at high levels, but their knowledge and ability in all phases of their jobs was awesome. I am happy to have them as friends and associates. If they are holding me back, or reducing my salary, it is only because they have more to contribute and a better way to present it. Competition exists, second chances are rare, and life is tough, but everybody gets the same lousy breaks. Sex, race, and religion take a back seat to profit and ability in the USA these days.
I don't think men or women like working in computer fields. The enviornment created by today's high tech companies is terrible. Long hours, no social interaction, constantly fighting stupidity that is out of your control. Most guys in computer fields are unhappy, or at least neutral. You find few working in the field who are truly happy with what they do.
So, what is the difference? Women are willing to put their happiness first, and choose other jobs. Men are more inclined to put up with the crap, in the quest for the dollar. That's why computer sallaries are so high, it's not that techies are really worth that much, rather if they were not paid that much they would go into other fields.
In effect, this is good for women, at least from a mental health point of view, and bad for men. Of course financially this isn't true, and too much of "equality in the workplace" is focued on sallaries, which is a poor way to judge equality.
I think your idea of guys in general is a little off... In my dorm, I'd say 98% of the guys here range in age from 20 to 24 and seem interested in loud music, drinking, fast cars, and pussy. Sorry if that last word might be a little offensive to some, but that is exactly how girls around here get treated. I am the only person I know of here that has more than one computer. A few think it's hip to own a computer, but those that do generally troll AOL and download pr0n.
To summarize, pretty much every guy I know (aside from my one friend and those I meet at LAN parties) doesn't give one pissing iota about technology, so to say that *that's* the reason a lot of girls aren't into it isn't quite the exact answer. I am a male, btw.
I personally would be happy if the guys at work would let me stay forever and work on stuff. But they make me go home all the time. And I disagree that time isn't on our side. I would rather much goto work do some programming, have another discussion trying to convince everyone as to why if you did such and such in *NIX it would be 10 times easier. I do know from school though that a lot of the females think that it takes way to much time to do all of the work, but after awhile you kind of get used to the idea that if you want to be a female in the field well then you are just going to be alone. I personally find that fine, I'd rather be around all of the "geek guys" to talk about stuff that interests me (basically anything computer related) than to hang around people who just don't understand the stuff. If they don't understand it, it drives me crazy. The only thing that I've really noticed about being a female is that where I work, people on the phone naturally assume that I'm the secretary instaed of one of the software developers. Either that or they hang up because they think they got a wrong phone number for a software company. The thing that makes me really sad about being a female in the CS department is that as I've been at school then number of females gets less and less, I'm the only one in most of my classes. That's what really dissapoints me is that most females seem to think it's to hard. (This tends to be true at my university, I can't speak for others.) Just my two cents.
I'd take the Sony ES home theatre over the 750iL any day of the week. Just imagine watching Aliens Special Edition on a huge screen, sound blasting from all directions... damn... now I know why I dont have a girlfriend.
But a Dual P3 933... it's just not fair!
D
The first, last, and only tech news site on the net
That's why they don't go for us. It's interesting though because physically I'm built much more like a jock than a geek but mentally I'm probably 80-90% geek if not 100% :) The girls react to me once they deal with me no differently than they do when they meet the average stereotype geek.
Coding is not a glamorous job to the general public. It really is seen as being as mysterious and arcane as witchcraft (which is fairly easy to understand when you actually study it). I also think many of the females in our society fear geeks because we have skills which make us look like people that are too smart for them.
As for social pressure..... BAH! You're supposed to rise up beyond those around you and achieve the things in life that mean something to you. Right now I'm learning C++ and PERL and am going to strongly consider learning either ObjectiveC or Java so I can learn COCOA development. Frankly I think it's just easier for guys to tell society that it can take its demands that we conform and shove them up its ass.
The final thing I think should be pointed out if it hasn't already been is that even in high school the smart girls don't have the sense to go to the guys they know will adore them and NOT want them to hide their smarts. My school's ACT (academic competition team) has a lot of guys that are in as good a shape as the jocks and we are also very intelligent. Most of the smart girls though don't have the sense to go to us instead of the jocks, even though they know WE WANT SMART GIRLS.
Geeky guys are hot. I even love a geek. I look forward to the day I can work with geeky guys, and I think any girl who is still intimidated by men is just psychologically unsound. Also, they're obviously dumb. Hello, anyone ever hear of QUOTAS?!?!?! Its those wonderful quotas that mean that girls get hired more easily at better wages than guys, due to the lack of females in the field. So they're being stupid by not pursuing it. Why would we want girls who were shoved into the field versus females who had a passion for it anyhow?
hey, i thought that was pretty funny
It all depends on where you lie in the food chain. At least from the programming end (I've seen studies in literature for this one, see the Mythical Man-Month ), and from my experience on the Engineering side of things, the top ten percent of the people you run into are an order of magnitude better than the average person. I once broke it down for a manager I had this way: you can have superman, or you could have aquaman. You only have to pay superman 40% more. What do you do? (alright, so speed had just come out) Of course as management you run into problems if you think that you've hired superman, and you've really only hired aquaman... and as an employee you run into problems if managements thinks they have aquaman when you're really superman.
I completely agree with you. Albert Einstein was nothing more than a "trained chimpanzee" and he would have benefited modern life/culture soooo much more if he would have written a few piddling songs or poems, rather than come up with his revolutionary theories.
But then, what do I know? I am just a chimpanzee in training.
----(o)----
The solution: create a new course called "Information Technology". This course has less maths and concentrates more on the practical uses of IT rather than the high CS theory and mathematical content that a good CS degree has.
The results were amazing. About 40% of new enrollments were female - quite a few attractive ones as well (this is something that was sadly lacking from Computing Science previously :) It seems that most of the girls who were potentially interested in computing were turned off by the "Science" part of CS.
D
(My girlfriend is Minnie Driver)
The first, last, and only tech news site on the net
I've always preferred the term nerd myself...
:)
In three-space I have actually met two or three true, dyed-in-the-wool hard-core females of the geek species, who can hack C++ with the best of 'em. Hot ones, too. It's an interesting reaction when a member of the tribe finds a female of his own kind out amongst the mundanes. Like female mechanics, however, female hackers are a rare treat. I believe it's because women are on average less interested in cars, computers, and other such techno-toys than men are. They tend not to be fascinated by things but by people. Again, on average. Your mileage may vary.
Guess it all fits into that psychological interplay between men and women. The most I'll ever hope for is someone who's sufficiently fascinated with one particular person, i.e., me. *sigh*
N4st0r, trixx0r h0bb1tz0rz! Th3y st0l3 0ur pr3c10uzz!
How many kids are there that don't care what other people think of them?
My daughter is 10, likes Britney Spears (and Monk, and 'trane - she's 10, not stupid), and got her first computer at 8 (just as her brother did). She's annoyed that *she* is stereotyped as a geek just because she's good with math and can use a computer better than most of her class. The social pressures start early and don't let up.
I told her that most of people that are on top in school peak shortly after, but geek girls just get better with age. I'm very happy that she has some examples of great women that like geeks and/or are geeks.
--
busy, busy, busy
i sort of felt the same way about the creating stuff. i always wanted to "make exe files" because not many people could do that. so i went: vb-delphi-c++. i wish i had learned about gnu/linux earlier though.
;-)
the real problem is that parents (atleast mine) don't understand that I would rather write programs on the comptuer more than anything else. i don't want to go to moves, go out with friends, play baseball, or go skiing or to the beach; i want TO STAY HOME AND PLAY MY COMPUTER!!!
i've never had a gf before. but i think those might rank equal to my computer. so it would be a hard decision whether to go away from my computers then. but i don't have to worry about that; won't happen any time soon... heh
I dont think that just women look at programmers as locked up in a little room with no windows typing away furiously. Most of my friends find my interest in programming insane and cannot understand why I would waste my time debugging some code rather than playing video games (not even perfect dark can compete with a nicely messed up bit of illegible perl code).
but i think for those who understand programmers, there are still those who wont take part. i think of it like mountaining climbing. why climb a mountain? because it is there!
programming is probleming solving and once you get to the precipice (gcc myuglycode.c) you can look back at your accomplishment and revel in your skill (or lack there of if you get errors). when you are solving a problem, you think only about how to solve it and you dont tend to worry about what you look like, what you are putting in your mouth for sustenance, or who is talking to you. i think i can see why this sort of outward degredation might turn off women (although there will always be a percentage of women who get it too).
anyway, looking at my neat little metaphor, it brings up the question: How many women mountain climb for fun?
I work at Nortel Networks. There are very many females in my work area. In my group of twelve people, there are 5 women. That's a pretty good figure, if you think about it. All of them know high-level programming languages, the most relevant to our work being PERL. The age range is also ver large, from 1st year university co-ops to my group manager, who has obviously gotten further than many men.
Okay, this is kinda dorky, so please put up with it. But, I think that there is some legitimacy to it. A few years ago, I saw a home improvement where Wilson was telling Tim about why men like cars. Women have the privilidge of child-bearing. They "create" something. Well, us men need to create something too. In the show they used the example of cars. However, for us geeks, this applies. We write programs, put together hardware, make networks, etc. We're creating just like car. I'm not saying this is 100% true, but what Wilson said seems pretty on.
first off, there are a lot of careers that women, for the most part, don't enter. mechanics, most engineering fields other than 'putes, welders, etc. why single out 'puting?
second, no individual should let the herd decide what they want to do with their life. if you don't wanna be a geek, don't do it. but don't blame men.
if i had cared what the average american male (or female) throught, before, during or after adolescence, i'd probably go kill myself. this is a very sick, putrid society. i'd say we are the cave people of the future, but i think cave people were far more civil that "modern society" with its racist, sexist entrenched corporate greed. so don't listen to anything but your heart, your loved ones, and the facts.
third, two of the best programmers i've worked with are women, and several top computer people are women. most of the girls i knew growing up couldn't study or concentrate for long periods of time. that's a killer for any analytical career.
the women i know who are accomplished scientists all had strong families. that doesn't bode well for the future of today's kids. you can do it, it will require more concentration.
take it or leave it, that's my opinion. Girls, if you want to grow up to be geeks, you're probably going to have to deprive yourself and study just as much as the the penis people. don't know any other way around it.
the imbalance will continue, until you make the change. of course, with so much politics in the technolgies, i'm not sure, if i had to do it all over again, that i would choose CS. quite frankly, there's a massive push in corporate USA to move software and technology overseas, and to bring the top overseas people here.
i'd strongly consider teaching or bio if i were in junior high right now. if your a teacher, you can pick up and go pretty much anywhere -- every town needs a teacher.
but engineers? you're constrained to the cities. make more, but everything costs much more. you'd have the same problem with bio. still gotta study hard!!!
Treatment, not tyranny. End the drug war and free our American POWs.
See my user info for links.
she assumes it's directed toward her, rather than just being the way the group normally acts.
It's possible, but i've experinced it on a one on one basis being around only one person at a time and he won't let me do anything, he'd rather do it and say how easy it was for him to do, then to show me or explain to me why what i was doing is wrong. Which i take as an attack on me, but it's possible that he'd do it to anyone who asked him the same question, just seems as if he's harder on me, but i could be wrong.
bah. all real geeks have dual alphas anyway. :)
The issue of women in computers is more complex than saying that women just prefer clothes and nail polish...I have a ton of both but am also DAMN good at what I do (Network/Systems Admin). I think too many women don't get the thrill of solving a problem on their own because they have never really done so. Many women I know who would be very capable of working in the field don't because they date men that do and leave that area to the man. Too many times I have seen women being patronized by moronic guys who think that because they have a decent salary and a good title that they are network gods. There are a lot of women working on phone support and helpdesk but they never have the confidence to make the leap forward. I feel that most women work better when they receive encouragement from the people around them. I think too many women see the field as a boys' club where they aren't valued. The few women I have worked with have on average been some of the best techies I have known...so maybe if we don't have higher numbers we can just settle for being better at it. :)
Generally, guys are externalized in focus. i.e. They exert control over their world though the manipulation of the material/physical. This is exhibited also in the tendency of guys to be less introspective than women. Though this does seem to be changing gradually over the last decade or so.
Girls however tend to take control of their enviornment though people and relationships, thus internalizing and being less obsessed with changing their physical enviornment to retain control. Someone pointed out in another post that if they give a young boy and a young girl the same toy the boy is more likely to take it apart and the girl is more likely to try to use it. This is an astute and generally correct observation.
I think that these psychological characteristics have more to do with the perceived gender gap. Which I don't think is necessarily a gender gap at all, but a simple outgrowth of the natural differences between guy and girls.
Yes, I'm expecting massive flames here. =)
Well, I read the AP article, and they indicate there that girls in highschool and so on are scared of working in a place full of geeky guys, windowless rooms, and endless hours in front of a monitor.
Now, fortunately, the definition of "geek" is finally becoming more positive, albeit slowly. However, the above description does match pretty well with a lot of high-tech workplaces I've seen. If young women really don't want to work in these environments, then they're probably making the right choice not jumping into CS in college.
The interesting thing to me is that more men aren't turned away by the same description. Honestly, the high-tech people I know, including myself, lead really grueling lives with little personal time. Perhaps the article is really saying that women, even at high school and younger ages, place a higher priority on non-financial "quality of life" things than young men do. Thoughts?
hrm....interesting theories.
my ubergeek boyfriend drives a porche that he races, but he doesn't do the designer clothes thing, or the socializing thing. however, between work (he's on call 24/7), racing, kung fu 5 days a week, and general tinkering with boxen at home, he doesn't have *time* for that other stuff.
*shrug*
all i know is that he is the most wonderful person i have even known in my whole life. yes, Miss M has finally fallen in love.
ps - i'm a geek too!
I teach web development classes to lots of women. I find that they easily get frustrated with software in a short period of time. I believe this is a result of women primarily deriving their logic from emotions and men primarily deriving their emotions from logic.
Ah, I see we're resorting to 19th-century stereotypes to explain gender differences again. "Women derive their logic from emotions"? Come on, be realistic. How hard can it be to realize that people's emotional lives and their professional lives are not the same thing, and frequently are not even related?
I readily admit that when it comes to emotions, I'm not as logical as most men I know (though this isn't true for all women). I'm more likely, in a relationship, to be the one who starts crying in the middle of an argument for no good reason and has to be calmed down. I don't know if it's socialization, biology, or just my birth control pills. But hey, my boyfriend and I can handle a little irrationality in our relationship.
But my emotions do not affect my professional life. I can go home/back to work from an emotionally exhausting day and write a history paper, design a newspaper page, or install my new ethernet card, and my emotions are simply not relevant. Sure, if I get frustrated about a relationship I'm in, I'll act irrational, cry, and call my friends for support. But if I get frustrated during a hardware installation, I read the manual, swear, try a different slot, and troubleshoot until the damn thing works.
A lot of women get frustrated too easily by technology because they think it's too hard. Similarly, my very intelligent geek boyfriend gets confused and annoyed if I ask him to scrub a potato. But these traits are learned, and they can be unlearned.
Unless, of course, people like you keep perpetuating archaic stereotypes about how it's just natural that women are only concerned with emotion, not logic.
Slash has nothing to do with Slashdot.
I run an IRC network for gamers and it is mostly male. I often ask the few female users we have how they feel about the situation. Mostly they don't see what the big deal is that they are female and play games. Usually they have a boyfriend/husband who got them hooked on games. The thing that turns them off is how males treat them. I think we need to get past the whole gender thing. I would love to work with more females. I would love to play online games with more females. I would really love to meet a female who understands why I am a geek and what it is all about.
There dosen't *have* to be a 50/50 split in everything but there are a couple of good reasons why some people are trying to encourage woment to persue sciences:
1) On average, women make less money than men. This is mostly because of carrer choice. Tech jobs can pay very well. Some people feel that gender pay inequality is bad for society in general - contibuting to the childhood poverty rate and such. Some people feel that as long as women have second class finacial status, they will have second class political and social status. Personally, I tend to feel that everyone should have an equal chance to take care for themselves financally and feel these these efforsts help remove barriers.
2) We could use more tech workers and women are an 'untapped resource'. With all the companies lobbying to increase the number of visas, it only makes sence to spend some effort in genreating more applicants at home.
3) Having people from diverse backgrounds working on design and problem solving often yields better results.
4) People already in the industry (both male and female) would, all other things being equal, enjoy having some more women in the office.
- bridgette
I don't know what salary ceiling you're talking about. I'm making 90/hr as a contractor, and I'm only 23. My last permanent position (a startup) offered me 90k/year plus 1% equity to stay -- and I turned it down. Maybe attitudes are different where you live (I'm in Boston). Or maybe you just aren't as technically skilled as I am -- I dropped out of high school five years ago and I've been doing C++ and Java ever since.
While I know sexual harrassment can occur anywhere, I'd be surprised to find that it's very common in technology fields. My technologically-adept male friends, co-workers, and classmates all seem far less interested in the whole power-trip thing that goes along with sexual harrassment and more interested in sharing an idea about how to code something more cleanly, or telling me about the new system they're setting up, etc.
In my experience (I know, not a significant statistical sampling) it seems that the members of the tech-frat care less about what gender you are than about what you know and can do.
BoyGeeks and GirlGeeks are not the enemies. Ask any male in a technical field and he'll tell you that he wishes there were more women in his line of work. If a finger has to be pointed anywhere, point it at the people who make choices and actually have impact on the hiring and encouragement of women in these careers (and classes in school). Further, do something about it.
I don't fall for the statistical bullshit. Men and women are different creatures and there are obvious reasons why there are such rifts between careers paths. It's natural. More women stay at home to be mothers. More women take maternity leave. More women work only part time instead of full-time, to take care of their children. This is just the tip of the ice-berg of differences and we haven't even touched the inherent trend of differences that cause is to find our interests in various fields and areas of life.
So do we just shrug and say "well, that's life and we're different -- I guess we'll just have to live with it".
No. When an industry needs more people to populate its positions, it advertises, reaches out to schools, conducts press-releases, gets as much air-time and play as possible, to attract people.
So if we're so interested in bringing more women "into the fold", then lets do something about it. Offer to help children of all ages, genders and nationalities to learn about technical careers. Some will get bored to tears and give up, but others will sink their teeth into what you have to offer and either run with it as a career or enjoy it as a hobby. Don't focus on males or females, just put the information, encouragement and assistance out there and let it affect as many people as possible. You can't force people into anything, but you can offer them a chance that they didn't have before.
And for businesses -- reach out to a younger crowd. Screw gender; just offer more itnernships, employment or outreach programs to the communities that you are 'a part of' and teach skills to people who want to learn. You tend to offer jobs and careers to people who have had the privelage and oppertunity to attend four year colleges and universities, but what happens to the sixteen-year-old boy or girl who pounds away on coding or other engineering projects in his or her bedroom day and night, but can't afford schooling or certificates to catch your attention? You're exhausting your pool of potential employees, because you're failing to help out. It's cheaper to hire out to other countries and bring people in on visas (not that there is anything at all wrong with that, but then you turn around and complain about it -- citing lack of employable people in this country! God, you're such hypocrits!).
Just because the pay-off isn't within your immediate future doesn't mean the investment isn't worth your time and money. If nothing else, the publicity and good-standing with communities for your efforts to help people who want to learn and get a toe-hold in the business will be worth the cash and time.
---
seumas.com
interesting. it would be nice if /. actually publicised it a bit...OSM launching DDos attacks is certainly grounds for criminal charges. OSM is currently winning the /. population over here with his frequent AC trollish postings..or at least his friends acting on his behalf seem to be...a simple story will make it official and appease everybody. just hope you guys do it quickly or the trolls *will* win this round - and make /. look like its suppressing the first ammendment to boot.
I'm a senior at high and I know everything but high lvl networking and programming. I've had numerous girls after me because of my bod. I don's play in any sports but i bike to school and work( 5 mi one way) everyday. My girlfriend always get comments from other girls about my a$$ so there are good looking geeks out there. And yes I'm proud to call my self a geek!
This This appears to be a good technical summary with lots of subsiduary references. Or try feeding "gender differences math" to the search engine of your choice.
One point must be made is that men and women are different. (and oh what a beautiful difference) This difference starts at a fundamental chemical level and is revealed in physical appearance and social behaviour.
One study which I saw some time ago and alas can no longer find study the way groups of high school math students solved problems. The females were happy to accept a solution, even a wrong one, that the majority of the group accepted. While individual males would support their solution against the majority if they considered it correct. (general disclaimer: whether other groups or individuals behave this way, who knows). What it does show is that social behaviours have a lot to with scientific investigation.
There was also that british study that showed that London taxi drivers grew their brains to better navigate the city. I am sure the amazing adaptable human body can make up for any basic gender differences if the appropriate training is provided.
The questions we should be asking are:
1) To what level should individuals be subjected to training that will change their natural gender tendancies.
2) What level of maturity is required before individuals are allowed to select such training for themselves or are others allowed to make against gender training decisions for them.
3) Is it desirable or detrimental to society as a whole to have the natural gender bias result in gender unbalanced professions. Or should some professions require that a reasonable balanced be maintained between the genders.
These are basic rights questions. We have the technology, should we and to what level be using it.
A friend sent me an article once - I think it may have even been posted on /. - about why a lot of girls don't become programmers. It offered up the notion that most girls are reared not to obsess over how and why things work but, rather, over their social relationships.
In an era when it is cooler than ever before to be a dork-guy, when guys who run internet startups are sought after for their bank accounts and their geeky sensuality :), I'm afraid it is still not cool to be a geeky chick. I think this owes itself at least in part to the fact that there are currently so few (relatively speaking).
The geek-chick bandwagon does not yet exist, so it is hard for even those who desire to immerse themselves in all-things-geeky to jump on...
Girls, ladies, women, chicks, babes, broads, pieces-o'-ass or whatever you want to call them are taught to nurture relationships. Doing so inhibits their ability to sit in front of a computer all day and pore over code or read /. A lot of women don't see overclocking a 1 GHz Thunderbird in mineral oil or soddering or disassembling some piece of electronic equipment, rewiring it, and then reassembling it or sitting in front of a computer screen for hours and hours a day as valid, socially acceptable ways to spend their time. For many women, it is a better use of time to spend time with friends, talk, position themselves in a career where they can work with people, rear their children, or involve themselves in charity work. (Don't get me wrong; these are all noble things.)
Moreover, in an effort to support their social relationships, girls (and the eventual women they become) learn they are supposed to worry about grooming, going out, shopping for the latest trends, decorating their homes, hosting dinner parties, caring for their kids (even in a two-career family), and so on.
I know this is fairly incoherent, and I apologize... I wish I were expressing myself better... because I am very passionate about this issue. I am a chick, and I am a dork, and I am proud to be both.
To sum up that which I have spent several paragraphs babbling about: It's still not cool to be a geek-chick. I hope one day it will be, as I am one of the few, the proud, the sexy :) who aspires to be one. :)
-heidiporn :)
heidi
Yes there are socal pressures pushing you to "the norm". You'r a guy you like football right? Play foot ball.
But if you go against the main and go to computers if you are a guy you are encuraged. If you go to chess club you get a thumbs up. If you go to debate club you make friends.
Girls going to computers get "ahh you don't REALLY want to do that". So even AFTER expressing an intrest they get pushed away.
It is very unusuall for a kid to continue to presue intrests once an athoritry figure trys to discurage them.
Guys might get prodded into taking an intrest in sports but they don't interfear once a guy takes intrest in computers.
Girls however.... The most intelectual thing they were allowed to be involved in was the debate club. Other intrests were heavly discuraged.
Nothing stopped me from preformming atheticly AND intelectually. Where I went to school it was expected. The jocks didn't have it any better than the geeks.
I did catch it for never joinning the football team or the track team. But NEVER for my intrest in technology.
I don't actually exist.
it's up to the parents, not the school to encourage children to do well in school. if the school falls behind, the parents must supplement education at home.
in the workplace? the only problem i have with geek males that i meet is that they usually try to interview me as an anthropoligical specimin, but it's no big deal. get over it. Geeks Rule!
I have a
It's because we worship (yes, worship) equality. Not as in, "Don't discriminate against someone different from you," but as in, "Everyone must be exactly the same!" Our quest for the elusive "equality" has gone beyond what is reasonable and possible. And I don't want to hear any utopian socialists saying that mankind will evolve to perfection or other such crap. Ain't gonna happen.
Women don't like programming, plain and simple. I know quite a few women wanting to major in CS... problem is, they all get turned off quick by programming, and now three of them are changing their major because of it. There are just as many geeks in "chemistry" as there are in "biotechnology" so the whole 'seen as a bunch of geek guys' thing is completely wrong.
witty sig goes here
There already is. Check out Peer 2 Peer.
Act One: Computergrrrl meets the patriarchy
Computergrrrl has been a geek of many stripes for most of her life. About 2 yrs ago, she decided to actually pursue computer programming at school. She went, saw and conquered, and with her freshly-minted diploma in hand, landed a job at an internet startup. Her job description was titled "junior programmer". The immediate reality, however, was different. This company made two hires in the same week, both fresh grads; one was computergrrrl, the other was a boy who we'll call Rob (well, that's his name). Rob was plopped down at a desk in the "back room" and set to work on ASP stuff immediately. Computergrrrl was plopped down at the reception desk and told to answer the phones and compile a list of office supplies. When computergrrrl pointed out to her new employers that she had no secreatrial training whatsoever, she was told that she should find "it came naturally" and that they "couldn't possible have one of the guys do reception"
Act Two: Geeks ride to the rescue
This company is divided into two layers. Business guys who have the money and call the shots, and coders who write the product (service?) and get free pop. After a few days, the "head coder" who we'll call Gord (well, that's his name) started to realize what was going on. At the end of a week, he confronted the owners and told them that they were denying him a valuable resource (computergrrrl) and that this "misallocation of talent"(his quote) was unacceptable. The owners hummed and hawed over transferring her, finally prompting gord to ask them why they had chosen to hire a woman in the first place, if they really felt her gender precluded her from doing her job. The answer: "We figgured she could do the reception work and help you out with little things in her spare time."
Act Three: making a loooong story short(er)
The ultimate compromise, was that computergrrrl was moved to web design (it's artsy! girls are good at artsy!) and, over time, into some backend coding (computergrrrl to owners "java is a new language. I have a talent for languages." language=artsy.)
The long-awaited moral of the story
Geeks tend to work on a merit-ocracy. You're judged on your chops, not your sex, race, religion (unless it's linux) etc. Sadly, a lot of the hire decisions are made by the money people. They can't tell good code from bad code (hmmm. I can't decipher it. It must be a good code...) and tend to have more "traditional" views of women in the work place. If you're a girl and you're a geek, find a boss who's into computers more than s/he's into money.
thank you for your patience.
2 1337 4 u!
I have always thought that maybe the dispartiy of men to women in the IT industry might be linked to human evolution. I believe that a woman's traditional activities over the course of human evolution would have encouraged social interaction much moreso than a man's. This probably would've meant that those women who were more adapted to being social had a greater chance of reproducing, so, via natural selection it seems plausible to me that women are more social creatures than men are. Also, in my experience, I have observed that women tend to be a lot more people and relationship oriented than men. Now, Think about what you had to do to become as good as you are with computers? I don't know if I am a typical "geek" or not but I do know that I spent about 3 years of my life coding from the time I was 17-20, and I can tell you that learning about computers is often times a solitary activity. Given the fact that most women that I know are much more happy when around other people, it makes perfect sense that often times they would not be interested in a field that almost requires so much solitary learning and concentration. just a crackpot theory.
Many so called "geeks" are loners as far as many sitiuations go. They find ways of socializing that aren't "normal" to others, such as chatting. What if the ladies aren't comfortable with this because it violates their nature. Computers take a lot of time and devotion, which isolates ppl from the non computer world a bit. Some people find this unnatural, both men and women. oh well,this rant is really going nowhere.
Don't call my crazy, that's what they called me back in the home!
i'll second that.
Women don't watch The Man Show for the same reason as men - because it isn't funny.
(although I know some guys who will try to catch the girls on tramolines bit at the end)
- bridgette
It's good to be an exception.
I don't know about the rest of you out there, but I love a guy that thinks logically.
And I also happen to love solving problems and learning incredibly difficult stuff.
--
--
The geeks shall inherit the earth.
I don't know what women they spoke to in that study, but I wouldn't have minded adding my two cents. Sorry, but all that junk about women not being able to hack it (no pun intended) in technical jobs is garbage. I'm in a technical field, and I've taken my share of crap from idiot guys who resent my presence, but it all comes down to self esteem, folks. I might not be the best at what I do, but I know that I'm good, or I wouldn't be getting paid :) If you're shying away from a profession you might enjoy just because most of the workers are "geek guys," your priorities are screwed up. People like this are one of the reasons that women still ARE treated as inferior in certain professions. OK, there was my two cents :)
That, and since she likes me. :)
Anyone that goes into the field for any other reason isn't a geek.
-------
CAIMLAS
~/ssh slashdot.org ssh: connect to host slashdot.org port 22: too many beers
I agree that she should accept the lion's share of the blame. But don't forget that a 10 year old has spent at least 4 years in school (more if she went through kindergarten and preschool) and is influenced by people there as well. The mother will have little control over what her children's classmates or teachers say to her daughter, and sometimes events at school will leave a lasting impression.
--
brave little toaster
--
--
brave little toaster
"Remember, don't try this at home until the statute of limitations has expired."
Well, I AM a guy, but I think that the Legos had something to do with my aptitude in language and in computers, too. I mean, for those of us who code, how is our job different from simply speaking another language? As children, with Legos, we learned how to take the simple building blocks that we were given and use them in all the ways they would fit together to accomplish our goals. Both of these processes are just a metaphor for the underlying thinking that one does to become CREATIVE.
True science means that when you re-evaluate the evidence, you re-evaluate your faith.
"Several girls in the study, as well as Katy and some of her classmates, also criticized the popular computer games for being much more appealing to boys than girls. On Amazon.com, for example, a big seller recently was ``Diablo 2,'' which boasts an ``advanced combat system which incorporates class-specific fighting techniques and spells.''"
These "several girls" including Katy, are criticing the gaming industry. The guys run the computer industry and the gaming industry (as this article implies). We rule it, so it makes sense we'll make games that appeal to us. I think the women will need to bite the bullet for now, put up with the bloody games, and get into the industry. By sitting here and crying about the blood, and not doing anything about it, isn't going to help. If the girls sit on their butt, doing what they like to do, then nothing is going to change. We'll make Diablo III and that'll be 2x as bloody as Diablo II. As they say in the open source community: "If you want a feature, write it".
If you think that evolution is what has caused different approaches to career selection and emotional state, you've been living with blinders. And if the other guy geeks on this board agree with you it's no wonder they keep complaining about needing a date.
As a girl, from the time I was old enough to know the difference I was treated different from boys. I was given different chores, different toys, different clothes... I was repremanded for getting dirty and told to that "good little girls" sat quietly, spoke softly and politely. My brothers, on the other hand, were encouraged to be aggressive and "take things apart" because they were boys.
Just in case you think my parents were the only influence of this type... I have been told by countless teachers, counselors, and college department heads (the cs department no less) that my interest in computers was misplaced because it was "no place for a woman". All this inspite of the fact that I graduated in the top 10% of my class, have been programming since I was 12 (on an old tandy that hooked to a tv), and continue to rank first in almost every programming class I take which are made up of 99% men.
The only reason I have managed to stick with it inspite of all the discouragement is that everytime I sit down infront of this damn thing I remember how much I love it.
And as for the different approaches to emotions/analytical thought that you claim are "evolutionary". Try to remember when you were 5... you and your sister both fall down, your mother wraps your little sister in her arms and comforts her with soft words and tells her how cruel the world can be...your father tells you to buck up...boys don't cry.
I just want to say to all of you geek guys, that although there may not be alot of geek girls on the market, there are plenty that would date you in a second. It's just that, most geek guys are too shy, that you wait for the woman to make the first move. Anyway, I married a geek, and not just your typical geek. He's a unix-using, perl-programming, NeXT Station collecting, etc., etc., etc. geek. Well, I guess that is typical for Slashdotters. Anyway, he was one of those guys picked on and harrassed in high school-you know the story. At any rate, we DID meet online, but I don't recommend that for everyone. But, we, the geek-loving women, are out there. Oh yeah, by the way, I'm not the poster child of the "She's got a good personality" club either. Of course, my husband and I are both the unconventional type, so that could also be why I was attracted to him. Freaky chick meets freaky punk and falls in love. Oh yeah, btw, we've been married 2 years, and I'm 23 and he's 21. So, just goes to show, you don't need to wait til your 40 to find some women who finally learnes that geeks are good catches. This has been a ramble, but oh well. I'm just trying to encourage the lot of ya. Anyhow, all those years of typing have made my husband able to do wonderful things with his fingers.
I would guess that the reason that girls that are geeks are classified as geek girls is that there are so few female geeks that being male is implied. It is unfortunate if it made you feel ostracized, but it almost certainly is unintentional on the part of the geek community.
After all, this is the same group of people that wore directory listing down until there was nothing left but `ls' and yet somehow created approximately 400 legal flags for `tar'. We want a maximum of efficiency without sacrificing for flexibility. Hence the more common male geek is simply a `geek' and a female geek is a `girl geek'. Also note how this notation leaves room for geeks from other species (eg. `alien geek'). You will also note that your geek friends probably don't refer to you either as a `girl geek' or even as a generic `geek' (with the male implication), but instead refer to you more directly as the_v (or perhaps simply v).
The "guys" that somehow supposed that "girls can't be geeks" are A) clearly not geeks, and B) probably delusional. After all, anyone who holds to such an idea in the face of all of the available evidence is clearly not geeky enough to truly be considered a geek.
P.S. I prefer the term nerd, but that is probably because I don't have any friends.
I get more offers than I know what to do with, and I'm not a particularly talented programmer
I currently work for a .com company in the southeast area, and I am compensated _very_ well...
I generally get several genuine, (but unsolicited) offers a month (not from recruiters).
I have no real degree, and I am not a C++ guru.
How does this happen?
I work with Microsoft Products!
Instead of being fanatical about what products or platforms I work with, I select a skill set that is in demand, and I identify a particular area that is critical, but not generally well known, then strive to become a 'guru' in that area. Hit the newsgroups, and help others. Make your name known on the pertinent mailing lists. Name recognition is everything in business, and YOU are your own business!
MS products have not always been my mealticket, and will not always be so. (Sybase helped line my pockets for awhile, and InstallShield is currently helping, as well).
Go where the money is..
-jerdenn
Okay, which two of the above categories have to share one of your loves?
I don't care if it's 90,000 hectares. That lake was not my doing.
Actually HP is pretty prograssive about getting the underrepresented into management. They will go out of their way to encourage promising women to consider persuing management.
And, IIRC, the head of the computer division and the head of the printer divisions are both women as well.
- bridgette
I think it's just an idea in education that they are trainning guys to get good jobs and girls to be good wifes.
A tech guy can land a GREAT job in the tech world.
A girl needs to be dumb so she dosn't outsmart (and fighten) potental husbands.
It's all outdated sexist notions that are probably allready dead. We are just living with the side effects. Few geek girls.
I say screw it... teach tech to as many nontech girls as posable.
[Ok so a certen lady friend of mine isn't to happy with it but I will have her writing code at some point]
I don't actually exist.
Women Undergraduate Enrollment in Electrical Engineering and Computer Science at MIT
This is from 1995, but I think many of the issues and criticisms it raises are still quite relevant (at least judging from the male/female ratio in my CS classes)...
Well, my girlfriend does play the viola...
Unfortunately, there are very few who gravitate towards the technical aspects, most do "everything but the robot."
Yep, we have the same problem at my school. Our major problem was not having a lot of adult leadership, so students took up that part, and what we ended up with was the same kind of elitism as sports and other teams. We had a few girls on this years team, and a few are considering going into "geek" fields (some here have done "Everything but the bot"), but i don't think FIRST is having the reaching power that it's meant to because of team politics.
well.. there's my rant..
- rewster
The problem, then, is that we're the same guys that they didn't want to go out with in highschool and didn't want to sit next to at lunch.
Assuming the line of this statement, I am lead to understand that if the industry was full of handsome, athletic jock guys, they would have no problem?
Further, what does 'geeky guys' have to do with a career? Either you like the technical side of life or you don't. What next? "Gee, I don't want to work in the technical fields because of all those foreigners..."?
If anyone is so nearsighted that they'd give up something they're interested in because they don't like the class of people that are already in that field, then maybe they should stay far away in the first place and go find a job where they can gawk at men with firm white asses as they walk by the Sam Goody's in the mall.
I'm a bit geeky. I was also a very successful jock. I'm a young white male. I work with great people. I work with a lot of talented men and women of all ages, backgrounds, educations and ethnicities. If nothing else, the people in this industry are a reason to want to work in it, not shy away from it.
---
seumas.com
What makes it hard for me, as a women in the technology field, is that my parents tried to steer me away from computers and tried to steer my brother towards them. It happened to turn out the exact opposite... i love computers just as much as the next guy, but when the people that you are supposed to listen to tell you that girls shouldn't play with computers, it makes it harder for us to get into that stuff. Lucky for me, in high school i happened to get involved with the Computer Club by accident and totally fell in love. All my friends turned out to be guys, "geeks", who love computers and taught me so much, even got me into using linux. I don't think all women/girls get as lucky as i did and fall in with the right crowd.
:)
It's almost as if it's taboo to be a girl who like computers, at least where i live. I was the only girl in the computer club, I was also the only girl really willing to get involved and learn things. Sometimes i feel really inferior compared to the males, it's almost as if they treat my like i'm stupid because i'm a girl... though i try harder then most of them to learn things...
I think parents need to encourage both girls and boys equally. That would be the first step in getting more females interested and it could start to even the playing field.
Just my two cents
Krys
uuh...which companies were they ? im sure you'll see a loong line of job hunting geeks lining up outside their front offices after this article.
The friend I mentioned in my previous post was recently hired at Ford Motor Company. IMHO, she's a damned good Controls Engineer and could easily have gotten an excellent starting salary great benefits and far better opportunity for advancement at any of the smaller contractors Ford hires to design and maintain their machines.
Instead, she chose Ford itself - not because they offered to pay her more or because she's on the fast track to management. You know why she chose Ford? Because they offer a great maternity leave package and job security. That was the deciding factor.
She wasn't even looking for the biggest salary or upward mobility - she was looking for a comfortable job with a decent salary. A job that won't make her feel guilty leaving when she decides to have kids.
I don't think it's fair to point to statistics that say "women earn less, pay them more" because there's a fundamental difference in what a large number of women are looking for when they seek employment. Yes, those statistics often cover the value of benefits too. But how do you measure something like the knowledge that your job will still be there when you return after a six-month leave?
Yes, but how are you generating those applicants? Are you in fact generating more applicants, or just different ones?
The article mentions big names like Cisco and IBM sponsoring tech camps for girls. What about the boys that would have _killed_ to go to those? Are you going to get Betty Crocker to sponsor Summer Cooking Camps for boys? =) It sounds ridiculous, because it is.
Can't argue with that. Good point. Although, arguably, removing immigration barriers accomplishes this too. Perhaps even moreso.
This is hardly a good reason to push girls into science and engineering. So that it's easier to put together a co-ed office softball team? =)
--
I guess it depends on the geeks. If you've got to be around teenage guys, I think the geeks are certainly better than the alternatives.
Maybe what we really need is for the media to just portray geeks in a better light and feature them in afternoon specials or whatever kids are watching these days.
I dated a bunch of geeks in high school and they were all sweet, polite, intelligent, and a lot of fun. They also seemed likely to want to spend the evening talking or doing something fun and frivolous (contrasting, it seems, to many guys who were only interested in sex.)
And certainly when trying to date, a 5 to 1 ratio is not a bad thing: at least from the 1 side ;-) Even if there are a few that that aren't yet ready for that level of social interaction, you've probably got your pick (and the rest are usually pretty trainable). I don't think any of my fellow female geeks ever had trouble finding dates. And we used to just laugh at the various complaints of the others about insensitive guys who never called.
Ah, well, perceptions can be so important. Maybe we need to start a date-a-geek campaign.
Maybe if we lure the young ones into math clubs and computer teams with thoughts of dating they'll fnd that the subject matter is pretty interesting too. I can just see the posters in the halls:
Or maybe I'm just getting a little silly now. :-)
Chaosnymph - (who recommends geeks to all her friends)
One day in class she was lecturing on gender bias in the elementary school system and how girls/women are discouraged from careers in science and engineering because teachers have this preconception that boys are better (and subsequently devote more time to them).
At one point, she stopped and we listened to this girl in class describe how she, personally, had experienced this phenomenon in her gr. 5 class and that because of this, she was no longer capable of doing well in mathematics courses.
Well, during this whole sob story, one of my best friends was sitting right next to me, snickering. She later recounted to me her own experience in high school: her gr. 13 physics teacher had laughed in her face when she told him her post-secondary plans. Electrical Engineering. He told her then rather dubiously to come and visit when she got her degree.
She's planning a visit in six weeks.
WHY DOES THERE HAVE TO BE A 50/50 SPLIT IN EVERYTHING? Is it not possible that some women just aren't as interested in some things as some men are? And vice versa? Why do we need to engineer our society to be perfectly symmetrical?
Somebody please give me a good answer to this. Explain to me why.
--
What I have found, is that while many women may find this career enjoyable and rewarding, not so many (I know none) have the passion for it that my friends and I do. How many girls do you see soldering together electronics projects, or writing code for fun, or visiting five news sites as soon as they get home from their tech job, to learn about the same technology that they just got done working 8 hours for? How many girls back in high school did you seen lugging their case to a LAN party?
When I was at orientation for my engineering school, and a lecturer asked the group "Why do you want to be a electrical/computer engineer?" The answers were "I read a great article in Time about how they start out at $45,000 a year!" or "I heard in Forbes magazine that there is a huge computer job shortage and they are willing to pay pay pay!!"
And that's fine, these people don't really care, they just want a career. There are exceptions to this rule, and the vast majority are the exceptions are guys. How many girls out there cut their teeth on Radio Shack's electronic components, redboxing, and plenty of XCOM:Ufo Defense?
Fifty years ago, the same could have been said about women entering the medical field -- as physicians, not nurses. Many were refused entry to medical schools, internships and residencies based only on gender. Others were discouraged by family, friends and peers because being a physician was "a man's job". Women are still underrepresented in surgery specialties. However, the last numbers I saw showed that more than 50% of US medical school students are women. It takes time.
The same has been true for law school.
There are still plenty of engineering managers and educators that don't believe women can perform as well as male engineers. And they aren't always subtle about it. I work with a woman (BSEE, BS Bio Med) who came to work in marketing because of how she was treated during her internship in Engineering. Our gain, their loss.
For those of you looking for a companion/mate that can code, get a life. If you can't have a life away from your keyboard, get a job coding for a porn site.
BOO! What kind of men are you going after? Dumb girls really turn me off, I can't walk into a bar and keep up a conversation about the weather or about how tight pants should be without feeling the urge to vomit. Where are all the smart girls? Playing dumb gets you frat guys, then single and pregnant, in that order. I dig a girl who can match me intellectually or bitch at my sloppy code or kick my ass in quake iii. They're few and far in between.
lf.o
While hardcoded behaviour accounts for a significant amount of the gender differences seen in humans today, I do not believe it can take credit for the huge imbalance of the sexes in the tech workforce. It's true that from an early age girls gravitate toward dolls. This makes a certain amount of sense, as they will one day be mothers, and they need all the training they can get. (Caring for a baby is scary!) Similarly, girls cultivate an empathic response to others' difficulties, perhaps because logic is most often useless when dealing with babies and children. This does not prevent women from exercising their analytical skills. North American culture, however, does. Girls remain strong throughout elementary school in all areas of academics, including math and science. Come adolescence, however, there is overwhelming cultural pressure on girls to conform to a feminine stereotype. Perpetuated through the media and funded by commercial industry, this stereotype dictates not only the teenage girl's ideal body type and weight, but also her ideal societal role. Unsurprisingly, it is submissive, dependent, insecure, and materialy impulsive. Girls' math scores take a huge dive in junior high. Ask a 14 year old girl what she thinks of math, and she will *proudly* declare that she sucks at it. I remember hiding from my peers my own traitorous report card that displayed an 'A' in Math. For many girls, high achievement in an area viewed as unfeminine often results in their being ostracized. At 14, what would most girls rather be, popular or smart? If you think that one does not prevent the other, you have obviously not been a girl growing up in the past 20 years. For those would like a more informed read on how adolescent girls are abused by our culture, I suggest "Reviving Ophelia". Girls today are trained to reject careers focusing on science and math. It has very little to do with the large number of geek guys in the field, or with a feminine reluctance to use logic. (ASIDE: Though I would love to dismiss the latter explanation out of hand, I have only myself and my other geek friends to use as an example. I figure this sample does not quite satisfy the diversity required for a well supported argument.) It has to do with social conditioning. Given an environment encouraging of female development in *all* areas, I think it likely that significantly more women would choose tech jobs.
The problem is the attitudes. "Oh, that's so much work" and "oh, you have to like, be exact and stuff..." -- boo hoo.
``It's tough work getting it to work exactly correctly and it's frustrating because one misspelled word and you can't get it to work,''
Referring to Microsoft Corp. chairman Bill Gates, she added, ``I say let him have it all, let him do it all.''
That's the spirit! Let someone else do the work. After all, who wants to be like, all detailed and stuff. I mean, at least when you're at Burger King, the only important thing is that you squirt some mustard on the burger. Nobody cares where or how much!
'`I don't want to take computer science. ... Just looking at it, all the programming and these funny-looking things on the paper. It (takes) so much stuff to do one thing on the computer.''
I'm having flashbacks to the Barbie Doll that used to say "Math is soooo hard! - let's go shopping!"
``The reason why you see more men doing computer stuff is that girls are more ambitious than that. My parents always say, 'Do something with computers,' because it is stable and stuff, but a lot (of people) don't want to be at a desk from 9 to 5.''
Oh my god. I actually laughed out loud at this last statement. "More ambitious"... What, like being the next Britney Spears or Ricki Lake?! And you have to love the "be at a desk from 9 to 5". I'm not sure about everyone here, but most of the people I know, including myself, are at their "desk" probably at least double that. Further, how can you be looking for an "ambitious" career, where you only have to work under eight hours a day?!
It's nice to know that all of us out here who are making wads of cash -- many without formal educations (or even highschool educations) are lacking ambition.
So, like -- ohmygod!
---
seumas.com
So you want a women
The 7 step guide to getting a lasting relationship.
Note: if you just want to get laid, you're better off masturbating or going to a party where the <ahem> women go to get drunk and laid (bring extra-strength condoms).
Common myths you should forget:
* Women love to hear about other conquests
* Women will get turned on watching women have sex with women
* Women love muscles and/or bodily perfection
Step 1: be presentable. This means you should shower regularly (i.e.: daily or better), wear deoderant (old spice is nice), and try to have your clothes aranged in a suitable fashion (i.e.: shirt untucked if normal shirt, tucked if dress shirt, and never ever partially tucked!).
Step 2: be yourself. Women are attracted to "together" guys (i.e.: confident and assured), not guys who attempt to be all things to all people (if you're not confident, well, that's really another whole essay in itself). Follow the Unix philosophy, and show that you can do one (or a few things) well. Don't make it a pissing contest between you and every other guy on earth, and don't lie about what you know.
Step 3: understand her motivations. By now you've selected a girl, talked to her, and generally had pleasant small talk with her. Use this to find out more about her, and what makes her tick. Knowing a woman's motivations is like having the source code!
Step 4: gently ease into it. Don't just call her up one day and say, "hey, wanna fuck?" Doing so will not get you anywhere (or if it does, you probably don't want that woman anyway). Assume that step 3 will take a month or more. As you know her better, signal that you appreciate her by offering subtle flirtations (i.e.: you seem stiff, would you like me to rub your shoulders?).
Step 5: learn even more! Now that you have a small relationship started, you can take the opprotunity to learn more about her motivations. This is beyond having the source -- this is "understanding to the point of being able to implement new features" having the source. You should be able to help her with any personal problems she might share with you
Step 6: enjoy the relationship. A relationship is not about sex. It's about having a partner of your perfered gender with whom you have a deep, mutual understanding. Sex (and sexual play) is a fringe benefit (a very nice fringe benefit). If you get to step 5, and feel nothing for her, you're probably going to hurt her a lot if you continue.
Step 7: lead into other things. Now is when you get to consider sexual relations. It'll come as a natural extension of everything you've done so far. Enjoy it.
Addendum to step 2: where to find women you'll like, and how to chat them up.
First off, don't assume you'll get the hotest woman with the curves of a goddess, and the cleavage of the Indian subcontinent. Assume instead that you will find a woman whose intelligence is to the levels of Mensa. Those are the kinds of women whom geeks appreciate the most, and geeks are the kind of men those women tend to appreciate the most.
Obviously, the best place would be your local library, or other place of learning. Find a local woman you know through mutual friends, and talk to her via a neutral medium. Shared parties, shared activities, etc. After a while, you'll get to the point where your conversations are private, one to one afairs. The woman will likely not be interested in computers. Get used to it. You probably don't want your sweetie to be intensly interested in the thing you find dearest to your heart, because having her point out your code flaws can be somewhat emasculating. Get a local Unix buddy for that kinda stuff.
Be attentive. You certainly can appreciate it when people's eyes don't glaze over at the mention of "Unix" or "compilers," so try not to do the same when she mentions things important to her. This will make your conversations flow more smoothly, and allow you two to grow closer.
---
--
Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
Stand up and shout on this one, ladies. I think that it takes a special breed of
person to be attracted to this line of work, not necessarily a specific gender.
I think you should be using the word sex instead of gender here. We are talking about people/animals instead of words right? I even got to it before Grammar Nazi, wow.
Ò
a LOT of geeks are transsexuals or cross-dressers - probably about 100X the natural incidence.
I know about 20 TS video game designers I have met or heard about during the past few years. There are plenty of transgender hackers in other genres too.
I realise this is massive gender stereotyping, but perhaps the majority of girls aren't interested in socially-deprived isolated activities like staring at code for hours?
The power of accurate observation is commonly called cynicism by those who have not got it. - G.B. Shaw
OK...this is not meant as a far-reaching and certainly not all-encompassing explanation. This is just my experience. I thought it was relevant (I've been waiting for an article like this on Slashdot for quite some time). I'm a recent high school grad. Valedictorian of my class. I have good experience with computers - I refuse to brag, that's not the intention of my post. I applied to Carnegie Mellon, which you all know is the best school in the country (OK, OK, tied with Stanford and MIT) for computer science. A "technology reseearch mecca" according to at least one newspaper. I was waitlisted, and my financial aid package was sent to me...let's just say I was bitterly disappointed. After a long period of real personal letdown (all I wanted was a chance...a chance to prove myself), CMU gave me a phone call. I had been accepted from their waiting list! Finally...the chance I'd been waiting for! Surely, my financial aid offer could be negotiated slightly and I could go to the school I had been dreaming about since I started high school! (I grew up in Pittsburgh, and I still live within an hour of campus...so I'd known about it for a long time, it was only when I decided on CS that I got really excited.) But when I called back...the answer was no. Since their decision to admit me from the waiting list was only made after May 1, 2000, the financial aid package could not be changed. I would be forced to either pay almost $20,000 for the first year (possibly more each year after), or abandon my dreams. After much soul-searching, I gave up. I went to another school who had offered me a full tuition scholarship, Case Western Reserve University (I applied to six schools including CMU: of those, four offered me as much or more...two being full scholarships). I love CWRU, but that's another story. In hindsight, I realize that two of their three major merit scholarships were not offered to a white male such as myself. It is their money...I understand that they can do with it what they want. But when you're going to give women a free ride strictly for being women (after all, they didn't allow competition from men!)...I just don't know. Finally, CMU was recently written up as "bucking the national trend"...women occupy less than ten percent of computer science majors nationwide. At Carnegie Mellon, they are NEARLY FORTY PERCENT of the incoming freshmen class (in the School of Computer Science). Wonder why? They can pay the exorbitant price with their exclusive scholarship. Forgive me. But CMU has been my lifelong dream...and to this day, I can't think of one thing I could have done else with my life to make myself a stronger student. Feel free to reply to this message. "I may be quite wrong." - Socrates
"I may be quite wrong." - Socrates
but I love it when i hear stories like this. Not just about how girls don't want to enter a technical career, but stories like the skills shortage, inability of IT businesses to find staff, lack of interest amongst school kids to pursue an IT tertiary education etc etc. It just means that the pay packets stay high in our industry ;-)
I think maybe the *creative* possibilities of computers need to be emphasised more to get girls' attention, and the web is a great way to do that. When I was at school I would never have considered going into computer science as it seemed really boring, but I ended up following a kind of roundabout route of arts degree -> journalism -> web design -> programming and realised to my surprise that coding was actually really interesting and rewarding and fun. I hadn't expected the feeling of *power* - not in the sense of dominance but the ability to create stuff out of your own head - or the aesthetic satisfaction you get from really elegant code. It was nothing like my preconceived notions of a programming job as being something akin to eight hours of long division a day.
People trying to encourage girls into computers should be using web development as a point of entry, because it really makes it clear how creativity and code interact, and scripting languages like PHP make it really easy to get started. You can learn a few basic principles and then go in whatever direction your imagination takes you, and once you get over those qualms about the 'funny-looking things' you realise there's heaps more interesting stuff out there.
Of course it's still not going to appeal to everybody, and there's no particular reason why Katy Prendergast *should* care about programming if she'd rather be a travel agent or whatever ... just as long as girls get to have a go and see if it's for them before they write it off as 'too technical'.
(music + neurology) * fiction = feedback
This is not an American phenomenon or some white male sexist chauvinistic conspiracy. It is purely Biology 101. You will find the same "problem" in Russia, Israel, China, Latin America, or Africa. Men greatly outnumber females in tech fields across all racial and ethnic groups all over the world.
The genetic differences between males and females simply lead to different tendancies in how men and women use their brain. In short, men tend to think better spatially and thinking of things as objects, whereas females tend to personalize in their thinking. Women have no trouble going into social sciences or practicing law. The men who go into tech fields tend to have the most extreme levels of spatial/objective ability. Even though most men do not feel comfortable or desire a science/math/engineering/tech career, because these fields really demand the most extreme in spatial/objective ability, most people who do will statistically on average be men, thus men will outnumber women.
Now, whether we want to increase the number of females in tech fields is a seperate issue. It depends on how far we want to social engineer people to do certain things because we want everything to be politically correct.
The excuse that women don't want to go into tech jobs because of us geeks is true, but it is not the core reason why women don't go into the jobs. That's like saying most men don't want to go into daycare because they don't like taking care of little children. Anyways, biology is not really interested in what you want or don't want, that is subjective, and for psychology to interpret. Biology is only interested in action, what you ultimately end up doing.
I agree with you that social pressures start early, and that they don't let up. However, not every kid attaches so much value to what other people think as to give up an interest they may have. Children can be brought up to be independant rather than groupthink oriented.
By the way, I want to applaud your response to your daughter's concerns that she is stereotyped as a geek. That was good parenting in action.
--
brave little toaster
--
--
brave little toaster
"Remember, don't try this at home until the statute of limitations has expired."
It's the same deal with the balance in computers -- the field has been so male-dominated for so long that it's automatically an unpleasant choice for many women because they're so outnumbered.
Dumbing it down is poison.
I've got a part timer here, she took two semester's
worth of C programming at a technical school that had a
"business" orientation. I think most of us would rather
commit hari-kari than sit through that. It's amazing she
still has any interest at all.
She wants to do unix sys admin. That's cool with me.
I've had her build linux boxes, and do a few installs.
She knows vi, gimp, ftp, telnet, web browsing, some HTML,
rudimentary scripting, how to construct a simple make file,
and some C. Getting the modem and printer to work was
asking too much.
About a month ago I handed her Stevens' "Advanced
Programming in the Unix Environment". She hates this book!
It scares her. "This guy was too smart" she keeps saying.
"Do I have to learn everything in this book?", she asked.
"No, just make sure you understand the code, and look
up the system calls in the man pages," I answered. "And
forget about reading ahead, take it page by page."
So, she keeps going. I'm waiting for the bug to bite.
I'm guessing that around chapter 8 she begins to get it.
That's also about the time I expect her to get the
modem and printer to work. Hmm, which means she will
have evolved to sysadmin, JG. I'll have to think up an
appropriate ceremony.
Nature += nurture.
Talking about cheerleading, cheerleaders sure do look nice and I love to look at them but what a waste of talent. Most of them are very talented and yet they do not so usefull jobs.
Their's nothing wrong with the fact that females are different than the males. But they're not so different actually. Both tend to give a huge importance for material stuff (me included) guys go for computers, cars, etc. and girls go for makeup, clothes, etc.
I find myself just as involved in the entire industry as my male counterpart. I'm mainly a programmer, but also do networking, and Unix administration. I do these things because I find them -interesting-. I love to learn about different languages, protocols, networking equipment, and so on. It's exciting. I do not even feel "out-of-place" being a female. I know more than a lot of males in the industry. However, that's not to mean that gender plays any role in the industry. Just as with any other field, you must be sparked by the whole movement. It's just what tickles your fancy. I surely couldn't picture myself as a secretary anymore than Cox could.
I think we are socialized from a young age into gender roles. There has been a long held belief in our society that programming and "computer things" are "boy-things" and not okay for girls to do.
I am a geek, and I am a girl. Well, make that geek light as I am not programmer.....yet. I have found that as an analyst for a big 5 accounting firm, it is my technical skills that are in the most demand, not my accountanting skills.
I think that technology needs to be better integrated with more areas of interest to kids. The exposure to and the encouragement to get involved with technology needs to happen at a young age, and without gender bias (in a perfect world).
Guinness. Spell it right. For God's sake.
What men, in their imbecility, constantly mistake for a deficiency of intelligence in women is merely an incapacity for mastering small and trivial tricks. A man thinks that he is more intelligent than his wife because he can add up figures more accurately and because he understands the lingo of the stock market, and follows the doings of political mountebanks, and knows the minutiae of some sordid and degrading business or profession, any soap selling or the law. But these puerile talents are not really signs of intelligence; they are merely accomplishments, and the differ only in degree from the accomplishments of a trained chimpanzee.
The truth is that the capacity for mastering them is the sign of a petty mind, and Havelock Ellis, in his great study of English genius, shows that men of genius almost invariably lack it. One could not think of Shakespeare or Goethe or Beethoven multiplying 3,456,754 by 79,999 without making a mistake, nor could one think of them remembering the price of this or that stock last July, or the number of beans in a pound, or the freight rate on steel beams from Akron, Ohio, to Newport News, or concerning themselves about the cost of producing a stick of chewing gum, or the pay of street car conductors, or the credit of some obscure shopkeepr in Memphis, Tenn, Such idiotic concerns are beneath the dignity of first-rate minds.
That women always try to evade them - that they have little capacity for the childish complexity of tricks upon which men base their so-called business and professional skill and cunning - this is but one more proof of their intellectual aristocracy. They are not stumped by such enterprises because they are difficult, but because they are trivial.
- from "Meditations on the Fair," H. L. Mencken, 1917
Yours WDK - WKiernan@concentric.net
I work at HP which has a female CEO, and my manager is a woman. Of course that doesn't mean she's any better than the normal clueless managers ;) There has been a lot of press about the CEO though.
Scuttlemonkey is a troll
Yes, there are female geeks! Fewer than male, but there are. The crucial part is socialization. Many girls and later women are driven away from technical stuff and computers and cars and so on with such nice words from society like "this is mens work.." "girls should play with dolls". I could post a long list here. Thus it is a parents task: Encourage your girls on technology, help them, when society does its best to discourage them. And by the way, don't forget your boys. Teach them the right things, too. Gentleness and good behavior is not a girl thing, but a human one that everybody likes.
.....and they'd all be buying tangerine imacs.
---- I made the Kessel Run in under 11 parsecs.
I'm admittedly a geek girl.. I am 22 years old, work for an internet company, design web pages and graphics on the side, and in general live a life filled with a wierd blend of technology and nature. I make great wages with amazing benefits, at the exact same rate as my male co-workers. I also happen to be completely and utterly in love with a guy who is a total geek as well. We work together, and we live together with our 'babies'.. two windows machines, a novell server, a linux server, two commodore 64's, and various other technological toys... with all of this in mind, I'd have to say that no, not all women disdain the technology fields.. and we're not afraid of the 'geek guys'. That's just silly. I love working with other geeks. We get to turn off the lights in our office and decorate our cubes with christmas lights year round. We have LAN parties sponsored by our company. We have tons of fun at work. We volunteer for overtime so that we can spend more time together. We are a huge mixture of men, women, straight and gay, strange and 'normal' people from all races and all backgrounds imaginable.. believe it or not, I even work with 'jocks' (but not many).. I love working with these people. Admittedly, in high school and even in college, I was one of very few females interested in technology, and I was surrounded by mostly males, but I got the impression that it was because alot of females in our society are pressured to be perfect, dainty, and dumb. We are constantly bombarded with media images of women who are obsessed with lipstick, clothing, weight, popularity, perfect skin and hair.. and the list goes on and on. Under this constant pressure, and even for reasons completely unrelated to it, many women are indifferent or even contemptuous towards intellectual pursuits. The same is true for many men, who are pressured by society in different directions which prove just as damaging. I am fortunate: when you're lucky enough to have friends and family who value you for your mind and for your personality, you are actually free to develop both, and you needn't conform to the traditional gender roles our society still tries to impose on us. I believe that in the next 30 years, these constraints will largely disappear as people realize that they are outdated and only hurt us as a society. I think that the idea of women not wanting to work with technology is silly, and if you really believe that we think that way, then I've got a 1.8 billion Mhz processor to sell you CHEAP! ;)
"Leave no authority existing which does not answer to the people" --Thomas Jefferson
Well actually there have been many studies just showing that women do not have the apititude for these kind of careers. My sister does not know anything about computers and would never try to pursue a career in them, but she uses it very frequently. I am not implying that women lack the skills, but in our society women are almost chided if they try to do anything but power their cheeks and paint their nails. That is how the social society works. Then you have your goths, they are just completely out of style ]:P
Not every person can deal with sexist attitudes that many women encounter in tech-related jobs, and so some women choose not to deal with it and persue other careers. While I think this is sad, I personally know two women who left the computer science field because of sexism and other social pressures they continually faced from their peers. It does happen.
That's true. But the opposite is also true: guys would love to see more girls/women in the technology-related fields, and would go pretty far to help them out. (Far from discriminating against women). I have a female friend at MIT in the Intro CS program, and essentially, when she walks into the lab(s), there's this mental 'OMG, it's a GIRL! YAY!' thing that all the guys go through. From what she's told me, at least, everyone (all guys, as it were) have been extremely helpful, etc.
As a member of the Palo Alto High School FIRST: For Inspiration and Recognition of Science and Technology team I can personaly attest to the fact that in the team the ratio of boys to girls is 5:1. We would be happy to have more famales on the team but they don't want to join.
Information wants to be free like speech wants to be free, not like we want beer to be free.
I think the problem here is that people aren't yet understanding that the two genders in our society are not the same. They have different behaviors (in general), and are interested in different things. Does this mean that one sex is obviously better or superior? Of course not. Does this mean that women aren't capable of some of things men are generally more proficient at (such as programming) or vice versa? Don't be absurd.
My point is that females are just different than males. Just what is so wrong with *most* women not liking the same things as men? Trying to figure out *why* this is the case is irrelevant, and so far it's leading to a whole slew of stupid assumptions in this thread, since it's fairly obvious that it won't change a whole lot in the near future.
I see nothing wrong with trying to introduce females (and maybe more males) to technology, computers, and programming. But specifically trying to recruit more women into computer technology fields simply because the male/female ratio isn't balanced is just plain ignorant. It's exactly the same as pushing more females to become NASCAR drivers or encouraging males to do cheerleading in highschool. And if I don't keep repeating this, some troll is going to flame me: This doesn't mean that [gender] can't do [activity], it just means that most [gender] aren't interested in [activity].
is that it doesn't show us a clear picture at all. It quotes a group of teenage girls who say they don't want to pursue *computer* careers. It negates to tell us exactly what careers these girls are pursuing. A few years ago female law students outnumbered male law students, and there have been increases in females entering the medical profession. Lawyers, doctors, scientists, and researchers are just as geeky as IT workers, IMHO. Frankly I don't think articles such as this one helps shed light on any of this.It offers little solutions to the problem of marketing IT to teenage girls.
/ docs/044660.htm
Here is an article that helps to illuminate who the majority of net user are.http://www.mercurycenter.com/svtech/computing
I've been curious, we all know that slashdot itself it operated 100% by men, and the male commenters far outnumber the female commenters. I wonder what the ratio is for those with accounts here. Why are there so few female role models in the OpenSource community?
Nitrozac
Would love to disagree with you but unfortunately you're offering nothing but the truth.
I'd rather be pepper-sprayed by a mountie,
First of all, I am completely sick of these articles about women geeks. Geeks are geeks, shut up already.
Before I get flamed for being anti-woman, I am a woman. I am a woman who went to grad school in pure math, fixes cars and now programs. When I started grad school, I was automatically enrolled in the university's woman association. You will never know how pissed I was. Then I became a mentor for new TA's (it was a cake job) and the female professor in charge of the mentor program and I got in a huge fight because she said that as TA's we were supposed to treat female students different than men students.
Maybe if women like this would stop standing on soapboxes and start talking about their accomplishments, then there would be some respect. As there is, women in this position whine about how women are treated, but they don't do anything to justify being treated any better. There is one woman I know who kicks ass in math, in fact her husband got tenure because of her, and people don't fawn all over her because she is a woman in math. People fawn all over her because she is great in her field.
If you quit making such a big deal about what fields women go into, then they -as individuals- will make the appropriate choice for themselves. Maybe there will be more women in computer science, maybe there won't. But, who cares??? There doesn't have to be the 50/50 split.
BTW, the reason that most male geeks can't get dates is because you are so non-aggressive that we don't even notice that you like us. Stop sniveling in the corner and ask us out. I will guarantee you that if you ask out a bunch of women, some will say yes. -This is said from personal observation of my friends whose idea of flirting is to pay 5% more attention to the person that they are interested in.
I've actually heard from guys who have pinups of Miranda (User Friendly) and Ki (GPF Comics) on their walls. In fact, many of us would like nothing more than a girlfriend who could actually code. Sadly, I know of only two females who can write anything more impressive than basic HTML. (Before I get angry responses, I openly acknowledge that I do not know everyone in the world.)
I wonder why it is that girls don't go for guys in IT. Sure, the occasional one of us is a fat slob or turbo-nerd, but I don't think those subsets are in the majority. And, we tend to have more money than the average Joe Six Pack, which is supposed to be attractive (according to the Discovery Channel, because it signals the women that we're more apt to provide for their young).
So, what's up? Why do the women keep flocking to the high-power lawyers (which is just as non-physical, academic a job as programmer), while neglecting us? What the hell is going on?
"Beware he who would deny you access to information, for in his heart he deems himself your master."
YOu have GOT to be kidding me. THis is the same old "someone else is to blame cause I suck" cop-out. Look here, it's not someone elses fault you aren't ceo, it's yours. Noone is keeping you from excelling in your line of work except you! Seek responsibility, and take responsibity for your actions. In other words, stop whining about it and do something. Show some ambition and you'll get somewhere. Isn't the CEO of napster female? I could be wrong. Sorry. Just my two cents. I just get tired of that argument.
"If you love someone, set them free. If they come home, set them on fire." - George Carlin
Having worked in management consulting, telecommunications and law enforcement, I can assure you that those fields also have no shortage of sexist, insecure and socially incoherent people...
...a Geek Stud(tm) calendar should do the trick and reverse the tide.
Now, the question is, will i have a 12 month calendar or one of those single sheet calendars with Jeff Bezos on it?
__________________________
"Oh, you hate your job? There's a support group for that, it's called everyone, they meet at the bar."
I think that we don't expect girls, in general, to go into technology. @ my high school, the only "technology" class that girls generally take is word processing, and that's only because it's required. the guidance counselors would reccomend that you take creative writing rather than computer science, because that's what everybody thinks females are good at.
There are few "feminine" activities available on computers, which is most certainly a result of few "feminine" people creating the activities (programs). Too bad. Chicken-and-egg problems are usually very sticky to get out of.
Waiting for the ./ effect on Peer 2 Peer right now.
Personally, I think the author who created that theory is simply pressing forth with an archaic stereotype that women aren't interested in anything technical. I am a female who is very interested in the field, and frankly I find men who are quintessentially "manly" and can do things like shotgun a beer in .5 seconds boring; I'll take a Unix geek over some jock-boy any day, as I would rather work in an environment where the majority of folk have Intelligence and Wisdom scores of at least 15.
Bollocks to the 18/% Strength rating.
..>Dana
I remember the first time I saw a comment written by a female slashdotter. Proved that there IS hope for my type.
Honestly, I'm intimidated by technology. My husband certainly is not. Why the discrepancy, I'm not sure. Obviously I'm not the only girlgeek out there with some hesitations though. It's not like I didn't have a geeky role model. My mother's a electrial engineer!
Fact is, GUYS society STILL teaches women to be both maleable and sensitive. As long as we're maleable, we're going to shun the definitive world of ones and zeros. As long as we're supposed to be so sensitive, most will choose not to be "different" (read: geeky).
Somebody had to say it.
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
I have been recently thinking about beer. Beer is the nectar of Gods. We're not talking Guiness or Cerveza here, we're talking the real shit, Steinlager, Heineken, Pete's Ale.
,o(__),_)o(_)O,(__)o
.O(__)o,__).(_ )o(_)Oo_)
.----|......|......|......|......|......|_)0
/^^^.--|......|......|......|......|......|,_) . |o(_) . |_/`) . |O_) . | . |
The problem these days is that people can't appreciate good beer. Too many people just get wasted on cheap-ass Ice House, Coors, or even worse, Bud. And that is a shame.
In the old days, things were different. Beer, that was a commodity. Good, aged beer was valuable. People treasured those moments of enjoying a pint of cold, tasty lager with plenty of head. Nobody would touch an aluminium can, let alone beer in plastic.
Open up a can of MGD today, and you've set yourself up for some major disappointment. Firstly, aluminum leaves a nasty aftertaste in your beer. Secondly, MGD has absolutely no head. It looks like stale tea. Thirdly, it tastes like stale tea too.
Henceforth, I urge you people, don't drink cheap shitty beer!
_, . '__ .
'_(_0o),(__)o().
o(_,-o(_ )(),(__(_)oO)_
|^^/.........|......|......|......|......|.....
|^^|.........|......|......|......|......|.....
|^^|.........|......|......|......|......|.....
|^^|.........|......|......|......|......|.....
|^^\.........|......|......|......|......|.....
\^^'---|.....|......|......|......|......|
'----|......|......|......|......|......|
|......|......|......|......|......|
\......\......\....../....../....../
`"""""""""""""""""`
Enjoy life, drink beer.
whether coding, web design, exploring the kernel, whatever: You actually think! I like mindless computer games, but after a while, I get this urge to actually *DO* something....which playing video/computer games does *NOT* qualify as...I imagine you have a similar urge...
:)\n"
if ($user =~ m/shaldannon/i) {
print "\n-- $user
}
What is your Slash Rating?
Now, now, let's not get all serious and start blathering off about the First Amendment. 'Cause it can't possibly be happening for real. Let's talk instead about literary art.
Go read some of osm's light short fiction, this for example, and then after I dare you to tell me straightfaced that a mind so disorganized as this could ever in any way deliberately inflict meaningful, effective damage against anything bigger, meaner, or better armored than a clothes-moth.
A fan, WDK - WKiernan@concentric.net
And I'm not even a fabulously-rich-on-paper dot-com geek.
Linus is also a good example. Everything I've read and seen indicates that Tove's a cutie, kicks butt (literally, as a multi-time national martial arts champions) and is no dumb bunny. Kids there, too.
Hmmm. Maybe the girls are getting tired of the dumb jocks? Maybe? Or am I too hopeful?
--
Qouting an e-mail discussion I had with hemos:
:-)
"Thanks for proving that Linux guys can get girls too"
"And we can get the best girls !"
The defence rests !
PS. Any of you single geek girls happen to be looking for a geek who works out studies martial arts and writes gothic poetry, mail me
"Semper in excretum set alta variant"
Uh, dude... I know some black folks think it's hip to whine about "liberal middle class whites", but geez, that sounds dumb and gets old. Those "liberal whites" are usually supporting issues first brought up by black activists like Jesse Jackson, Mumia, Al Sharpton, Chuck D, King, Malcolm, .... You don't have to like all those guys, but they sure think these are important issues, even if you don't. (Usually their issues are as much about rich/poor as they are about black/white, including the "digital divide".)
What, you'd rather white people be "conservative whites"? You think that's better? Time to start figuring out who your friends are.
Computer savvy is now a major source of power in this world, not to mention money. Hell yes, I want everyone to have access if they want it-- rich or poor, black or white or latino, man or woman. If they don't want it, OK, but I want them to have the choice. If someone chooses against it, don't blame me if they can't get a job because they don't have computer skills. I'm not against changing things so that other jobs pay better, I'm just talkin' about how it is now.
Maybe you're totally misunderstanding those "self-righteous" people you're so tired of. Maybe they're not trying to mold anyone in any image or force anyone to do anything they don't want to. Maybe they're trying to help people who ask for it. If you're not gonna help, then at least get off their backs.
I think it is healthy with a balanced environment at work. I have seen that male dominated environments often are not as healthy as more balanced environments. With balanced I don't mean 50-50 but let's say 70-30. The mix makes the workplace a better place to work in because girls usually are not that geeky and they maintain the contact with normality when it comes to working hours and behaviour. Because of that people at least try to behave in a normal manner. And they see that it is possible to actually have a life. It can be very fun to work in a totaly geeky workplace, but I don't think it either good or fun in the long run (well, at least if you mind ending up as divorced at 40). So all you guys try to be nice to girls and treat them as buddies (-dirty jokes -farting) and maybe they will stay with us. You have to admit it: it is very frustating looking at just men the whole day.
i don't know about all other computer geeks, but some, like me, had to be a 'non-typical-geek'. meaning, partying with the football guys when they showed up at parties. also, being 6' tall with an attitude to match helped. didn't anyone else think "ya, i like computers, you got a problem with it?" not out to make trouble, but not going to be pushed around. there are others out there, right? or is the typical computer geek true to the stereotype?
Do you see the sig? Do you have it in your sights? Why yes, Miss Moneypenny...
I got the notion that maybe women are not so interested in the technology designed by men. Possibly women would find technology more interesting if more of it was designed by women.
So what I hear here is that girls forsake highly paid careers in fields they are well suited for, just to avoid being around me and my likes?
I see. At least we now have a use for nanotechnology: Examining my self esteem!
most of the girls i knew growing up couldn't study or concentrate for long periods of time. that's a killer for any analytical career.
:)\n"
These girls must have been the exception rather than the rule. My experience is that by and large the girls I knew in gradeschool and college were far more studious than their male counterparts. Most of the guys I've known would rather play (games/sports/...) rather than study.
if ($user =~ m/shaldannon/i) {
print "\n-- $user
}
What is your Slash Rating?
Some other posters have made mention of the girl who demands acceptance because she knows a little HTML. Whether this is as common as it seems or not, there is a burden on women in IT and other technical fields (physics, math) to be better than average just to justify their presence that does not fall upon the geeky male.
Like Miranda from UF and Ki from GPF,we not only have to fit in , we have to be really damn good just to be acceptable. Or, as Pitr demonstrates, our abilities are ignored.
This is not about "making everything 50%/50%", it is about not losing the potential contributions people have to offer fields because they feel pressured to go into something else. If, given equality to begin with, men and women really did choose to go in different directions, there would be no problem. But to assume that the field is level just because you or your friend Mathilda had no problems, and then chasitize women for not getting off their duffs and interested in technical fields, is extremely pompous and ignores the sexism and misogyny still common in American (Western?) society.
Back to the topic at hand, why is it that people feel the need to try to push girls into technical careers?
No one said anything about pushing girls into tech careers. The whole point of the gender (or racial or age or whatever) divide is that assuming people are in fact equal, why is there this huge difference in the percentage of men in tech fields vs women in tech files? Since we assume that people are equal, we expect the percentages to be the same, and if they aren't, then we say, something is "wrong." Now, this mind set obviously is partially flawed since not all human groups are the same especially when it comes to interests. But unless someone shows that in women don't want to be in tech fields due to a genetic difference, then it is some form of social influence causing them to not want to have a tech job. And if society is the cause of women not wanting to get tech jobs, then that is definitely a weakness of society.
It's this kind of rationalization that lead to discrimination.
Please don't moderate down, someone has to stand up to discrimination.
more can be found about dbirchall here
Hey Dan, I'm glad you're a geek enjoying life. You have beautiful wife and best of luck to you.
See, there are geeks who are fairly normal.
Rangers Lead the Way!
I am in network security and my girl is a UNIX sysadmin. Many times she has problems with the geeky guys and their big dick contests. Many geek s really are imature little shits.. threatend by women that know their shit.. It is not that girls can't do it, many don't want to put up with you little worms... ha ha...
http://tinyurl.com/globalwarmingisascam
Now, if I had not been turned on to computers in junior high, and then been introduced to the "geek" society and local BBSes by a good friend in high school (thank you Justin Scott!), I would not have the chance to contribute. I would likely not be in this field at all.
What we can take from this article is that, in order for any child to be comfortable with a computer, they must have regular access to one to experiment with it.
In the article, one person mentioned that when the students are given access to the computer, the girls in that particular class hang back and let the boys take the helm. It's not that they don't want to use the computers, but that they are not getting the regular access to them.
I know this is true because I experienced it myself. In a group where there is a limited number of computers and where there are many boys, the boys tend to be more aggressive and get "dibs" on the computers first. Just watch a middle or high school computer lab and see!
If you take the knee-jerk anti-"liberal social movement" view of this and say, "Girls will go into what they are interested in, we shouldn't push them into it," you're missing the point.
If you give a kid access to a computer, they will play with it. If they play with it, they'll break something, and if you expect them to fix it or make it difficult to get it fixed, they'll learn to do it themselves.
If a kid does not have access to a computer, they will never learn to do this. Then, when they grow out of the "Eww - computer geeks are gross" stage, they will have the background to be able to jump in to a good career (and a great social group! My husband, brother, and friends are all computer geeks, and I'm one happy geek chick!)
The point we can take from this article? We need more computers in schools, a one-to-one ratio, in order to make sure every kid has the opportunity to use one.
--------------------------
"Everything I'm telling you tonight is true - except for the part where the banana *sticks* to the wall." - Spalding Gray
It's not the 'hot chicks vs ugly hags' thing that's in dispute.. it's just that women tend to be turned off by men and people in general whose one and only train of thought seems to be "I can't even associate with someone without checking out their ass". Which is what the previous post was implying. And believe it or not, there are quite a few people out there who are more into personality and intelligence than bust size. I for one would rather date my cute but slightly balding boyfriend who is witty, smart as hell, and tons of fun than some guy with washboard abs and an IQ of -10 who never could figure out how to tie his shoelaces or pronounce his own name. Unfortunately for me, when I was single, I tended to find none of the former and all of the latter.
"Leave no authority existing which does not answer to the people" --Thomas Jefferson
And the salary ceiling that women hit in technical fields if they don't move into project management or sales isn't much of a positive incentive either.
It's unfortunate because when your whole company is made of 25-35 year old straight white males (like mine), you are naturally going to have a limited number of approaches to a given problem. Divesity is a real benefit. Too bad we don't get more of it.
I've been doing various "geeky" things all my life -- good at math, had a Commodore 64 in 2nd grade, and so on. On the other hand, more than one of my male friends has introduced his girlfriend to our heavily-geeky crowd, and it *always* results in her taking a much stronger interest in technology, sometimes to the level of wanting to program herself.
And I don't know if it's just me, but having dated one geek man, I found that other men -- of any sort -- didn't measure up. I'm marrying a geek.
Carpe Ovis. Veni, Vidi, Ovisi!
You'll love this. A girl in one of my CS classes last semester declared that she would love to do the trampoline bit once or twice on The Man Show.
--
Dyolf Knip
Another thing that it doesn't seem to mention is that there is a glass ceiling. Even if a female is smart, or adept at their job, they are held to a limit. How many women CEOs do you see out there? You don't see it because the business is run off of a good ol' boys network. Either you're part of the network or you're not. Advancement isn't really based on merit. I mean how many managers have you met that know what the hell they're talking about?
if you have, please refer to Dilbert to have your brain washed.
CAD, kicked, good
My comment has nothing to do with gender. This article along with a few others I've read recently , some on Digital Devide for example, got me thinking:
Why is it we hear more and more about differences, perceived as inequities, which must be the result of some gender / race / age / religion / political / genetic / discrimination, a wrong to be righted by some government sponsored TLA which will only fsck things up more than they already are?
Why is it that industrious people tend to make more money than lazy people? A more clear case of social injustice could not exist. Our indoctrination into the culture of achievement == reward begins the moment we exit the womb and continues throughout our lives, denying half of all citizens a better than an even chance of achieving their rightful share of the Non Cultural or National Specific Utopian Dream.
Our educational system is but one example where we as a society have failed miserably to prepare and provide for the non motivated. One could almost understand an environment of benign indifference but such is not the case. Test are administered and 'graded' based on the percentage of 'correct' responses. It is no secret that the callous lackeys of the establishment consider those individuals who do their homework, pay attention in class, study and subsequently are able to provide a higher percentage of 'correct' responses to somehow be 'better' students.
The rewards and advantages presented by the establishment to these so called 'better' students are considerable. So is the damage done to the psyche of those considered 'average' and especially 'poor' students. Similar practices in business and industry, and yes even within government, prevail and are obvious to anyone with the courage to remove the social blinders and look. This madness must end. Please join and contribute to:
The Society United to Remove Criteria from Decision Making
%United Nations
2000 Socialist Way
Clinton, Arkansas
ru2b1
I'm speaking from a personal point of view as a 19 year old guy fresh out of highschool who was once a complete geek but now is much more sociable than before. My personal prejudices are my genuine opinions and not to be considered as troll or flame bait. .plan files of people like Steve Gediken (sp?) and certain sentences which show how devoted geeks are to their work (read: "Slept at the office last night again") well... now you know that they don't let the llamas out much :) No offense, Steve, if you're reading this. Anyway, although slashdotters would probably love geekchics more than others, keep remembering that most people, and especially most businessmen and the like still pine for Cindy Crawford who has been seen on covers of enough magazines. Think about a song that is on the radio once, and a song that is on the radio about 10 times a day. You might not like the song to begin with, but you'll learn to tolerate it and even like it. :)
Personally, I believe that a sense of "geekness" is cultivated at an early age (as are most things). At a young age (I'm thinking grade 6-8), girls are most popular if they start trying on make-up and bras, while the girls who sit under a tree and read novels are picked on and teased. Of course, attraction of boys is "addictive," and once you know that you can get a boy's attention, or the attention of your fellow classmates (the good kind of attention), you'll want more. Though, keep in mind, I'm no psychologist. Either way, there will be girls who act to please (and be popular), and there will be girls who don't feel the need to attract TOO much attention to themselves (and therefore become nice girls who read in their spare time).
Now, I would say that even with that simple split, 75% of the girls have already headed down the early non-techie road to become prom-queens and wanna-be's in highschool (and thus, will never have time to cultivate "geekness"). What of the 25%, the secluded girls? Wouldn't they become geeks?
The answer is, very unlikely. Those girls have been picked on from gradeschool, and will either want to become more sociable in highschool, or become more immersed in their books, hopefully using their smarts or their kindness of heart to win guys over (by highschool, almost every girl starts wanting to attract, just in different ways). Now, why not immerse themselves in computer books and the internet? Because it doesn't "change the world" the way they might want to. In a way, they want to fight for a different status quo and either become rich or famous (and show those prom-queens in high-school a thing or two). Think about the movie "Never Been Kissed" where Drew Barrymore tells the prom-queens that they'll never be much in life - she was right. The better-educated girls will be better off in life, having better, nicer, and guys to walk into a restaurant with, being driven to cocktails and balls in fancier cars and better dresses, or maybe one day changing the role of women in society or killing discrimination in itself. Now, what does this have to do with not being a geek? Simple. Who do you think gets more guys chasing after her, a coder girl whose job is staring at the code for Windows 2010 all day, or the banker woman/business woman/lawyer who will see people, meet people, talk with people, and deal with people everyday? Chances are, if I meet 10 people a day I will get someone faster than another person who meets 10 people a month or year. Just think about it. And besides, after reading the
Now, I must say that, being the semi-geek that I am, I would probably love a semi-geek-chic. Currently, my girlfriend is not very technically inclined, but likes to be very argumentative. Of course, being the "man" that I am, I might be a little over-bearing, also, so we argue. For instance, I would say that one can't buy a "decent" digital camera for less than $600 (you guys know what I mean by a decent digi-cam... I mean, anything under 1 megapixel isn't that great at all, and won't work for most purposes). Now, she would argue this and say that the $300 camera they have at school works fine and works really nicely. Of course, when the argument gets out of hand, she complains that I always have to throw my knowledge in her face and offer my opinion on why she's wrong when her opinion is supposed just as valid as mine. Then again, being more technically inclined, I'd like to think that my opinion on digi-cams and other technical equipment would be more valid than hers. Think about it, does David Grossman's opinion of the ever popular debate of Q3 vs UT vs HL:CS matter as much as, say, the staff of the OGL? Think deep, and thanks for reading
i-Chaos
http://ichaos.tripod.com
...I am proof that intelligent beings are not always intelligent...
Would somebody please flame the damn beerspammer !
EVERYBODY KNOWS THAT THE NECTAR OF THE GODS IS VODKA !
Ask James Bond !
"Semper in excretum set alta variant"
Well... ...social pressure does start early I guess. I "blame" one of the facts that I am now what is commonly termed a female geek on going to a highschool where there was a total of two other girls! If anything the 3 of us would have had a miserable life if we _weren't into tinkering with things and taking them apart! Of course we also had plenty of access to computers and when I think of highschool these days coding bad Pascal and playing Kings Quest3 jumps to mind rather than worrying about dates. Just my 2 cents... Btw I prefer being termed a nerd than a geek though :)
"Any sufficiently advanced technology is regarded as magic! - I'm a magician
Again, Why this abundance of ignorace on SlashDot this week? This makes me want to puke!
Jamey Kirby
Your post does'nt make any sense.
Sheesh people. Its not that hard. Look- at age 12 or so (yes, Virginia, there are surveys that back this up, do your own damn research), girls lose interest in computers. Up to about that point, girls and boys regularly enjoy computers. After that, nothing. Why? What sort of computer programs are there to attract the attention of girls? Do you really think a 13 year old girl is interested in playing the latest blood-bath game? Do you really think that a smart teenage girl is really going to get interested in a career in computers by playing 'Barbies Make-Up CD Kit'? Read this, software designers: There Is Nothing For Girls To Do On Computers. If You Make Something For Girls To Do On Computers, Then More Girls Will Learn To Enjoy And Use Computers. If You Make Software That Is Easier For Girls And Women To Navigate, More Girls And Women Will Use That Software. You Will Make More Money. Now, was that so damn hard?
r. (Do not deny not by denying)
While it is true that discrimination happens, this has the feel of someone feeling that someone set out to prove there's inequality for the sexes in technology. Look hard enough for something and you'll find it. This story doesn't deal with schools being harder on female students or employers disregarding apps because of the sex of the applicant.. No, this is a study saying that because there aren't enough females in technology, there aren't enough females in technology. Give me a break! I don't believe in effects causing themselves - especially when it comes to people. As a species, humanity is more stubborn than that. And the half a dozen female geeks I know seem to indicate this to be true. They don't care if the industry is populated by men - geeks are what they are and the "geek lifestyle"(?) is the one they've chosen.
I encourage any woman who wants to go into technology and has even a shred of self-respect to do it. If they meet resistance, keep fighting. I feel I was just about born a geek and I wouldn't let anyone in the world take that away from me - they shouldn't either.
Where does this idea that Geeks somehow have poor personal hygiene come from? It's a poor myth. Of all the Geeks i know, they all keep themselves clean and smart.
:)
Of course, after a 48 hour hacking run, you'll probably need a shower, but then, who wouldn't?
Damnit, Geeks think they don't Stink! Sorry for the rant
Syllable : It's an Operating System
Kinda funny how most other areas of life and society, girls are raving for equality, myself included. But I personally would rather be seen as a bit geeky, and also be seen as intelligent, not to have my information or viewpoints discredited because I'm a girl and am therefore assumed to not know a damn thing about technology. I know I'm not the greatest, but I'm learning.
Girls might also be a little weird about it threatening their 'girlness'. Like guys they like or female friends might think them less 'girl' because of their Linux obsession or skill with HTML. Sounds weird, but it happens to guys all the time, when they like art, or don't show an interest in sports, or something equally silly.
-You're wearing...A bag? I have misplaced my pants.
So the majority of girls don't want to watch the Man Show, or to play Football. (Yes, there are exceptions.) The reason probably isn't so much that they are male dominated. Perhaps women aren't as interested in computers because the male domination has steered everything in a direction that they are really not interested in. Ever thought how modern computing would be different if it was women dominated by the start?
The problem is that people still have there stereotypical views of life and professions. I know many males that are certainly not "computer-type people" and at the same time, I know many women that are. In my most recent programming course, the problem was not that the women couldn't handle the class, or even that they didn't find it interesting, it was that there were only a few there! One of the female students in the class actually ended up getting one of the higher grades there.
Another problem is, though this may make me sound like a misogynist, is that many females (and of course many males too) do not have the dedication to learn "these funny-looking things" and just want to point and click. This certainly isn't true in every case, of course. My younger sister was able to learn VB (of course, most wouldn't even call that language, but) well before a fellow male classmate of mine (currently pursuing a computer engineering degree . . .).
I don't get that bit about being more ambitious though .. .
--
Never trust anyone over 90000.
Yeah, that must be why you're an Anonymous Coward. Fucker. "Taking it like a man" would mean having the balls to use your name when you're baiting flame. Ask your mother what being a woman and having an asshole for a son is like; ask your mother about being a woman. Or did your mother not love you enough and that's why you're so bitter and pathetic?
Ah, I see we're resorting to 19th-century stereotypes to explain gender differences again. "Women derive their logic from emotions"? Come on, be realistic. How hard can it be to realize that people's emotional lives and their professional lives are not the same thing, and frequently are not even related?
The guy you're repying to talks from experience, and you're talking out of your ass. Yes, I'm flaming you, because what he's saying is COMPLETELY on par with MY experience of women.
Answer this: why are so many women into new age bullshit like ASTROLOGY?
Astrology is not logical, it's completely irrational, most men don't give a fuck about it, a lot of women crave it ... even smart women do, though they just claim to just read their horscop for fun.
And even dumb men generally don't give a fuck a bout it.
So there you go. I hate PCness.
This really does depend on which girls you talk to. If it's teeny-boppers who love Britteny Spears and who care lots about what other people think, then yes, they will be concerned about working with 'geeky guys.'
If, however, you talk to a more independently minded young woman, she is more likely to give real reasons besides cooties for not wanting to persue a tech-related field.
The study blames the general sentiment on a gender imbalance in access to computers, and on social pressures that steer girls away from technology.
Now, this I buy. Generally speaking, schools do not do a good job of encouraging our girls to get into science and technology. This has improved in recent times, but there is still a long way to go. Parents also don't always do a good job of encouraging girls to try out computers. In fact, some unwittingly discourage them. (I continually thank my mother for giving me legos instead of an easy bake oven when I was a kid.)
And never underestimate the social pressures women face in the workplace. Not every person can deal with sexist attitudes that many women encounter in tech-related jobs, and so some women choose not to deal with it and persue other careers. While I think this is sad, I personally know two women who left the computer science field because of sexism and other social pressures they continually faced from their peers. It does happen.
Nevertheless, there are many women such as myself who love computers, technology and science, and who thrive on working with geeky people. In fact, for me it's a requirement...
--
brave little toaster
--
--
brave little toaster
"Remember, don't try this at home until the statute of limitations has expired."
[to the tune of Cyndi Lauper's "Girls Just Want To Have Fun"]
she won't stare at the monitor's light
society says "don't you wanna hack all night?"
we just don't care about zeros and ones
and grrls, don't wanna be geeks
no, grrls don't wanna be geeks.
lasted three days in a programming class
those "for loops" and "call stacks" really kicked my teen ass
just can't log into those x-terminals
and grrls don't wanna be geeks
no, grrls don't wanna be geeks.
not what they want, not a geek,
let the boys balance red-black trees,
cuz grrls don't wanna be geeks.
no, grrls, don't wanna be geeks.
they don't wanna, they don't wanna,
they don't wanna, they don't wanna,
grrls, oh, grrls, don't wanna be geeks.
Treatment, not tyranny. End the drug war and free our American POWs.
See my user info for links.
Fresh man year in high scool I actully heard one girl ask "When are we ever ging to use computers?". I suppressed my laughter and petted the mouse in front of me knowing it would bring me lots of nice green paper. I don't know one girl who likes computers to any extent, are we going to be seeing a resurection of the early 1900's where the computer literate man goes to work, and the wife stays home?
.sdrawkcab si gis siht
I keep reading people saying "Well maybe girls just don't want to be geeks." Well, then the quesion is why don't girls want to be geeks? I see two possible answers to this, either there is a genetic disposition to not want to be a geek, or society is telling them not to be a geek. Since I doubt there is a genetic cause (because there is no evolutionary advantage to it), the causes is most likely a societal force. If society is telling girls not to be geeks and girls are just as good at being geeks as guys are, then this is discrimination. Perhaps we just don't see it because it is a whole societal influence that is generally accepted, but that doesn't mean it's not discrimination. Unless society stops deciding girls shouldn't be geeks, how will we ever break the gender divide in the workplace or elsewhere?
(btw, I'm a guy, but someone has to stand up to invoke change)
I think 2/3 of the geeks here can attest similar results. In fact, every time someone tries to ask a young woman if she really wants to go into technology, there's someone beating the crap out of a young man for being a geek. I won't speculate which is worse, but the fact is that schools---at least American schools---favor athletics over intellectuals. As I noted in another message, there's no gender gap or sexism there - just different measures to discourage the intelligent from being so.
For example, this line: "A lot of our socialization has steered girls away from technology", according to Scherr (her mother), about her 10-year old. Gee, she's 10! If she's screwed up, it's her mother's fault! Any bets on whether she accepts the blame?
If young girls aren't getting involved, perhaps the better solution is to take away their telephones. Build a language that lets them model societies (or introduce them to programming through SimCity.) But don't blame the system, and fer cryin' out loud, don't screw up the boys to equalize the stats.
then they shouldn't whine when they don't get the techie geek jobs and the bucks that go with them. Its a shame that women accept the stereotype of geekhood as being unfeminine.
Don't get me wrong! I think that there is definitely a place in geek-dom for women. I married a geek gal, and in a lot of ways she's sharper than me.
Gonzo
This is exactly the kind of idiotic drivel that makes me question the validity of the First Amendment. I hope you're sterile.
Common myths you should forget: Women love to hear about other conquests
Really? Where do you get that from?
I know two really good players. They get LOTS of women. One lives in my area. He keeps talking about:
For having seen him fuck girls (all types, beautiful, ugly, skinny, fat, intelligent, stupid, white, black ...) in less than 2 hours of meeting them ... well see where I'm getting
The other one always carry pictures of his ex girlfriends and show them to the girl he wants to pick up at some point in the conversation, basically implying that they looked better than her. I'm talking about a guy who picks up strippers, actresses, and who's fucked a girl who had just been engaged, who's had sex with two beautiful sisters at the same time, and countless others. No bullshit too, I've seen the pictures.
Sorry guys and girls, life is not like PC advocates would like you to believe. Life is not really fair.
And remember: women are not the pure and virginal innocent beings
some want you to believe.My father wouldn't hear of it (he tended to enforce his opinions by bloodying my nose). After arguing with my reluctant husband for years, I finally dove in. The shop where I bought parts for my first self-built computer told me to go home and knit booties for my grandchildren.(I am not kidding...these are his words!) It took me 4 days, by myself, to get it to work, an AMD 386 DX40. Still works great. A few years later a tech at the University of Miami told me that all the "lady techs" that he knew were dykes (again, his words exactly). Maybe this sort of thing could be a bit discouraging? I have my own shop now, by the way!
technically literate girls there. I had hoped that at least a few would have been because a girl who knows anything about computers is quite...interesting to me. I would appreciate it if there were more girl geeks. I personally try to encourage that sort of behavior but I ended up having to coach many of the girls in the class on basic material. May of the other intelligent girls I meet would prefer to become lawyers. I guess that correlates more with the "social behavior" that girls apparently tend to favor over technical jobs (Arguing in court, technically social). Also, I notice that many of the girls who get high grades in math, as I do, aren't even nearly intersested in the things I am. They have no drive to be astrophysicists or engineers. It is too much to ask for maybe just one girl to even know what number theory is?
Twitter.com/TrentonHyatt
"That which we call a nerd, by any other name, would smell as sweet; so geek girl would, were she not geek girl call'd, retain that dear perfection which she owes without that title; - geek girl, doff thy name; and for that name, which is not part of thee, take all myself."
(Free after: Romeo and Juliet, by W. Shakespeare.)
Stefan.
It takes a lot of brains to enjoy satire, humor and wit-
The truth shall make you fret. (Ankh-Morpork tImes motto)
Geeks, hah, try nerds.
::smirks in an evil fashion::
I have a very low opinion of geeks, they can go shove it for all I care.
Quick refresher: Diffrence between a geek and a Nerd:
geeks get drunk, Nerds read technical manuals.
geeks goto parties, Nerds continue to learn.
geeks waste their lives, Nerds dedicate their lives to knowledge.
Ok, nuff said on that.
The problem is that society has brainwashed the female population so that a very small percentage of them (even fewer then the male population, which is already has a very small ratio of Nerds:jocks) want to abandon any hopes of a social life in order to devote themselves to the completly unselfish goal of obtaining more knowledge to aid the human race.
In addition, society has also brainwashed the female population so that they believe in emotions even more so then males. Emotions are the leading deteriunt to a person being able to completly switch over to a life of acedemic and scholerly acomplishment.
In other words, the day that females don't give a rats ass about how they look or who they know, is the day that females over-take the male population in computer literacy.
Of course, considering what small percentage of the male population is computer literate (oh, about 1% of Slashdot readers sounds about right) you only really need a few dozens females to actualy accomlish said goal.
Need help treating your acne? Come here!
So how come it's a surprise they don't like the same kind of jobs .... ?
Maybe they just don't like the competitive aspect of most games. How does that translate to that job thing? Now, on the internet, no one knows you're a fucking dog. Right? So don't give me that stupid bullshit about peer pressure refraining girls from playing diablo 2. It's utter bollock.
Boys' dolls just have guns and camo clothing is all.. =p
it's not that one should aspire to be a geek.. one should just *be*.. so you might not be the best coder right now.. if you're geeky, you're geeky.. other people can deal..
;) ).
;) (they want tux permanently drawn on their body).. but the female portion of my cohort doesn't feel the same as i do.. they always point out that they are the only girl, this is difficult material, etc.. i listen to them and ask myself (i have long since given up fighting with them) why they focus on that, and not the material/task/problem at hand.. and why is it such a hinderance to their solving problems? i don't see it as a difficulty for me.
;)
as far as being a woman in a "geeky" field.. i don't think i've really noticed that.. i'll go to meetings of the local chapter of the ACM and IEEE, and if there are other women there, they will comment on being the only woman present -- i won't have noticed that attendance is 2 females 20 guys.. (i find it more interesting that i was not included in the female count.. when i ask them about that, they say that "i belong there and they don't".. when i ask them why, they flounder and say they aren't sure...) well, all i see are a bunch of geeks/scholars/people working to accomplish things.. (or not depending on the temperment of the group
sure, i could spout a good deal about gender inequality studies, psychological research, and the like (cs doesn't always get all my cpu time) yes there is a long history in the united states of women having the "motherly" role.. while feeling unable to function in other circles of their environment.. hopefully in time less women will be hung up on the stigma of being accepted by the majority (somehow i have a feeling with recent events, that this may take longer and more difficult journey that i had previously thought) and try different things. i have.. and enjoyed myself tremendously the entire time..
Why do people care so much about this? as i enter my final year of study for my AB degree in CS (yes i know, don't ask-- long strange story), i have never felt that i wasn't included into a geeky group on basis of my gender.. i always have, yes there are jokes and debates that one morning i'll wake up with a tux tatooed on my shoulder like miranda in the userfriendly "got linux" cartoon.. but hey.. they [the guys] are jealous.
probably the nicest thing about being one of the few women is that there finially isn't a line for the bathroom at the expos.
well, that's my spout.. i wish everyone sucess in their quest to fulfill their aspiration of geekness..
/n
Have some Australian beer back. I recommend avoiding Foster's; it's pissweak stuff for tourists and export only.
James Squires Amber Ale is a nice drop.
No matter how cynical you become, it's never enough to keep up.
There are not many computer geek girls (at least not that congregate in the computer lab before school), therefore it's more difficult to learn about computers, and fewer girls turn geek. It's a vicious cycle.
THere is Miranda from User Friendly
----------------------------------------------
*.sig
...the LAST thing in the universe I can think of wanting to do is spend 8 hours a day around geek guys.
Geeks are the wrong end of the gene pool to be hanging around if you're female after all. Not to mention the little things like the caffeene/alchohol addictions, bad fashion sense, complete lack of social skills...
Geeks usually grow out of these problems, but well after girls would decide and stereotype all geeks as icky and decide they want nothing to do with them. Heck _I_ can barely stand younger geeks for the same reasons.
- Adam L. Beberg - The Cosm Project - http://www.mithral.com/
You got "no action" because you're a creepy fucking asshole, not because you were poorer. Why would you want to be with someone who's only interested in your bottom line? Why don't you look for other types of women? Because the only ones who will have anything to do with you are the ones you pay. Don't advertise your portfolio and you won't get money-grubbing women. You must fall into that 99 % of men who are dickheads.
The article seems inherently flawed to me. For one, it's statistical fact that not many people are entering computer science programs, no matter their gender. The biggest flaw, however, seems to be that the University Chicks were asking high school kids what they wanted to do with their lives. Now that's fucking brilliant. I'm going to be 27 this year, and I've only recently figured out in which ball park my career will reside, much less nailed down the specifics... I've gone from a dual major in English and Journalism, right out of high school, to Computer and Information Sciences and Information Design. There is a difference between the two. Asking an 18-year-old child what she wants to do With The Rest of Her Life is the stupidest of grounds upon which to found a study, in my opinion. The fact is simply that being a geek is a life style, not a career choice. It takes a special breed of HUMAN, male or female, to be a geek. If the University Chicks are upset by their stats, the realization should follow that more people should be recruited for technology careers, not just more women. As for the statement, "they are turned off by technical careers that they view as full of geeky guys," I can only retort that I wouldn't want to date anyone with whom I couldn't discuss the things that interest me. At the risk of practicing age discrimination, I'll ask how many high school aged girls know what the hell they're looking for in partners? I know when I was 18, I dated a drastically different kind of boy than the man I am with now. Incidentally, he's a hell of a lot prettier than the non-geeky guys I dated then, too. Frankly, most of the quotes in the article seem to come from girls who are probably great until they open their mouths and ruin the effect. "I don't want to take computer science. ... Just looking at it, all the programming and these funny-looking things on the paper. It (takes) so much stuff to do one thing on the computer." This girl is, in effect, saying, "Math is hard." I'd like to know how well this female did in school over all. The socialization issue warrants further study. Female children are not taught they may manipulate their environments, and some studies link this rearing style to female difficulties in math. If little Jimmy is running through the house and breaks something, boys will be boys. If little Jenny does it, she's being unlady-ish. Still, this issue speaks to a larger socialization issue, and only reflects on the technology industry in the same way it would reflect on any other industry: all PEOPLE should be raised equally. But what do I know? I'm just a poor, helpless girl.
Exqueeze me ?! What are we breeding ? THX-1138 ? Something even weirder ?
When I hear "best of breed", I reach for my Eugenics 101
Gender is for nouns, sex is for people.
When I was younger geek seemed to be a word that was used to describe people with an extreme interest in anything (ex. soccer geek)...
but now it seems that definition has been applied to guys who like computers.. emphasis on _guys_..
It seems that if a girl has an interest in computers, she's singled out as a _geek girl_
girls don't seem to be included in the new definition of geek...
For a while I had a problem with this.. being a member of the female population with a major interest in computer engineering I felt a little put off...
The last thing I wanted was feel excluded from my feild of interest because of my gender... I didn't want to be singled out either..
So I decided to forget about the whole thing until I realized that there was no good reason for it...
Now that I've gotten passed the initial batch of "girls can't be geeks" guys and I've met some really cool people, male and female, who don't have these prejudices and now I get to work on some neat stuff.
ugh. Since so many grrls are going to be reading this, would any like to go on a date with me? I'm kinda geeky, but I also like to go to Goth/Industrial bars, camp, bicycle. I'm from the Detroit vicinity. Reply if interested, we could meet up at City Club.
Please don't moderate this as off-topic until at least a few people have replied. Help me out here!
;-)
Keeping
I'll go a step further with this issue. "Girls not being able to math", that is. When I was a lad, my parents used to move from country to country, we literally didn't stay in one country for more than 3 years.
My school years were plagued with ignorant teachers. In Grade 3, for instance, I was told that I was extremely bad at mathematics, and needed "remedial" help. In Grade 2, I was told that I needed "special help" for dealing with b's and d's. Yes, I got the two confused during writing classes up until Grade 3. But the teachers failed to realize that I'd already started *reading* before I started school.Another example is with my mathematics. In Grades 4-7, I scored quite low, mostly D's. In Grade 8 and 9, I scored C's, but in Grade 10 everything fell apart (mainly due to my betting on horse races, in Grade 6-10 my main thing was playing cards with other kids, for cash), I scored an F for mathematics.
In Grade 11, I scored one of hte lowest scores around, but mainly because I wasn't writing the tests. My teacher told me that unfortunately, I'd have to be dropped into the "stupid math" class. First term of grade 12, I scored 100%. They put me back up to the normal math class level, and I scored an "A" for my high school final.
And yet just a year before, a "teacher" told me I would never be able to get into any technical field, at all. So what do I say about education "tradition"? It stinks, it's actually nearly useless. Teachers in some places complain about low salaries, but perhaps we should actually look at what they're doing. They aren't the saints they're made out to be, and until education undergoes a major paradigm shift, we should look at issues like this. "Girls can't do math." "Cliff Watermore will never get into a technical field." "%Insert your own Bullshit statement here%". I'm sorry if that sounds harsh, but I speak from experience. I've been to more than 14 schools around the world, and they've all led me to this conclusion: Western Education is sorely lacking. Admittedly, I've not been to any "non-Western traditional schools" or alternative education institutions, but perhaps looking at alternative teaching methods in Western World schools is the way to go."A few atoms won't even light a match" - Dr Jones, 1933
There is no 'other type of women'. Or if there is, it does'nt matter. We all (besides the genetically abnormal amongts us, like gays for instance) want a good, healthy looking woman. We can't do anything about it, we're programmed to do it genetically.
Over the last decade, the American Association of University Women has frequently been guilty of sowing politically motivated disinformation of this type based on fishy "research." Check out this recent article by Christina Hoff Summers: http://www.theatlantic.com/issues/2000/05/sommers. htm I have yet to read her latest book, but can highly recommend "Who Stole Feminism?" [http://www.amazon.com/exec/obidos/ASIN/0684801566 /qid=962722496/sr=1-1/102-7334716-147452 9]
I wish I worked for /. in a "Reply to Idiots" capacity. I'm replying to you.
I have an alternative definition. "Geek" is a reference to a very strong (ie beyond the norm... whatever encompasses that hackneyed term) interest in a particular field. This definition is used more than you'd think.
How many times have you heard someone referred to as a "sports geek"? (I believe the phrase has even been used in this discussion a few times.)
I am, personally, proud to be geeky. All that means is I have strong interests in one field of interest or more. That's all it takes, after all, to be a geek.
I'm a bit more than that, tho... I consider myself to be:
- sci-fi geek (I watch Stargate, ST:TNG/DS9/Voy, The X Files - I even used to watch Sliders and Quantum Leap)
- music geek (I analyse music; I look at the percussive flow, the chord structure, the bassline, the melody, the harmonies...)
- Slashdot geek
:) (I have an account, I take part in the discussions, I've moderated (don't shoot! Don't shoot!@#)... I've got 575's user info page and the CYOA page in my bookmarks... :) ) - Net geek (I freely admit I spend too much time on the net. I really must remember to go shopping for groceries tonight...)
To horribly misquote Larry Wall (ooh, does that make me a Perl geek too?) - "there's more than one way to be a geek". =) It's just a question of how geeks are viewed. Personally, I wear my geekhood like a badge. I'm considering printing myself a "Glad To Be Geek" t-shirt.I don't suppose anyone fancies organising a Geek Pride rally?
No boom today. Boom tomorrow. Always boom tomorrow. BOOM!
"and being smart just means you get to see how being popular is more important"
please tell me that's a typo...
I'm often amazed & saddened by the difference gender makes in computing. As "Dr. Mitchell", most people - students and fellow academics alike - assume that I'm male until it's proven otherwise. When they do find out that I'm female there is very often a change in their attitude, often a "dumbing down" of explanations (which is really amusing coming from a student!). Or if they do see me before hearing my name, they assume that I'm one of the secretaries. Go out into the "real world" and it is even worse (On one occassion an employee of a certain national UK computer store spent 20 min trying to persuade me in a very patronising way that Office would run on my Linux box and that as a man with his vast amount of training he knew better than a mere woman)
The sad thing is, this occurs in both women and men, and most people are unaware that they are doing it. When you point it out to them they are often mortified and try and change their behaviour (which tends to work for about 48hrs)
The solution? Well, I'm not sure if there is one for computing alone - it's a society wide problem. Sure more woman in computing would help, but we're not going to get more woman in the technical subjects until peoples (both men and women) attitude's change and we become less hung up on what a person's gender is.
TTFN
Faye
Well I'm sitting in an office which is about 60/40 men/women. But then all the men in the office wash at least every 2 days, don't wear sandals, don't have a beard you could hide a continent in, and generally have a life outside of coding. But then we're mainly mainframe dinosaurs, so you wouldn't be interested anyway.
(I'm joking - spare me the flames)
I got interested in computers in college. However, my college computer group nearly drove me away from the field.
In the beginning, I could barely use windows. I was fine with being treated as a "newbie" when I actually was a newbie. But when idea after idea was ignored (then approved whenever sonmeone else made the same suggestion), when I was excluded from meetings and officer's functions (I was an officer), when help sessions with the TA included his best friend, I realized I would always be a second-class citizen.
I left the computer club after three years. Last I heard, it was in shambles, which doesn't surprise me. I run linux now, I go to local lug meetings, and I'm planning to go back to school and study technical writing.
Girls are definetly discouraged from studing technical stuff. Being treated like a token, or a novelty, doesn't help. Like anyone else pursuing a "nontraditional" career path, I've had to do a lot of stuff on my own.
My point? Female geeks need support from male geeks! Don't treat us like perpetual newbies. Invite us to play Quake sometime. Don't assume we're in it for the guys.Put my clarinet beneath your bed 'till I get back in town.
Based on the women I've spoken with about this topic, it seems that a lot of it has to do with the time involved. Even to middle school kids, C/S careers have a mythos of requiring 80 hour weeks plus "personal time" to keep up with the technologies. Most of these women were more interested in "having a life" outside work than to put up with those sorts of loads, even if they are more of a stereotype than a reality (depending on where you work). These women also tended to be more focused on interpersonal relationship building, both in their private and public lives, and felt that with these loads they would end up with a life less satisfying than they want. Obviously, this isn't scientific, just what I've noticed over quite a few years of talking to people about stuff like this.
Can't argue with that. Good point. Although, arguably, removing immigration barriers accomplishes this too. Perhaps even moreso.
This is hardly a good reason to push girls into science and engineering. So that it's easier to put together a co-ed office softball team? =)
From my 4-year experience at the coalface, there is one big skill that women have more of: management.
Women seem to make better managers than men: less confrontational, more willing to take advice, less territorial, more approachable, more willing to listen to underlings and so on and so forth. Of course there are exceptions. But I can safely say that I've preferred working for female managers over working for male managers.
--
Peter
Guess what, I am a typical geek... I enjoy my computer and video games... C++ is my second language. But guess what... I also played varsity football in high school. My friends complain about being judged, but we do it too. Granted however, my SAT scores were about 500pts higher than the rest of the team, football is actually quite fun, you get to beat the crap out of a total stranger. Not like it was wasy or anything, I got shit from the team about being a geek, and I got shit from the geeks about playing ball. You think you have it bad, try having it from both sides!
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
What else do you expect? They won't let us get l**d! What else are we supposed to do? They are scared of careers filled with geeky guys but are attracted to all the wealth that this industry brings to the geeky guys! There is something to be said about the other side, as well!
I don't know if ignore is the right word... more likely they take one look get scared, or the BO keeps them at bay (nothing like 4am BO after a long, strenous marathon of Quake 3)... lol
lf.o
The line is: "If we were explosed to computers when we were younger, more of us would be Geeks."
I agree--but what's wrong with it right now?
If I were exposed to aircraft when I was younger, I might be a pilot right now. If I were exposed to atheletics I might be an ethelete. If I was put in the kitchen more often, I might be a chef. I'm not crying about it.
I don't care about what might have been. I'm happy with what I'm doing--and if I wasn't, I'd find something I <i>am</i> happy with. I could be the president, a scientist, a lawyer, a teacher if my past was different, but I had fair opportunity to *find* my interest on my own--I didn't need each career spoon-fed to me so I could pick and choose. I have the ability to seek out my interests.
Women are not prevented from getting involved with computers. And as long as everyone has the opportunity to find and do what they like, it's fair.
In my opinion, as a feminist male, one of the main reasons is social bias. Society still has a bit of a push for women to become nurses and such, and, as a result, are pushed away from technological carrers. Most of them just aren't exposed to technology, as a result. If you asked most men who weren't exposed to computers at an early age the same question, you'd probably get similar results. (As defense... How many of the geeks here had a computer before puberty? Most, from what I seem to hear...)
However, the other major barrier is simple psychology. It has been shown in many studies that women tend to think more in terms of emotion and social interaction. While this is not true for all women, it is for the majority. Men, on the other hand, tend to think in terms of logic, black and white. While both have their place in the world at large, in the land of computer programming, you can't very well program in emotions. You have to use logic, which is something that the male brain is wired for more so than the female./ This is not to say that women are not capable of thinking logically. It's just that, on the average, it isn't something that appeals on a day to day basis.
-Dusty Hodges
Hey, how do we know their "poll" is accurate? Have they spanned all classes and income levels? If they sent out a survey with women's Cosmo bills, no wonder the bad results! And hey, I've had more luck with geek guys than your average Joe. Why would you want some pretty boy with no brains when you can have a gentleman with a brain and looks? Hey, look around, the geeks of today aren't the geeks of our fathers ladies. They're cooler. So raise your cramped and carpal-tunneled fists high and be proud to be geeks ladies!
Remember, someday, everyone will work for a geek.
"Spandex, it's a privelege, not a right." -Cereal Killer, Hackers
One problem I see with IT industry guys is that, since we tend to study in male dominated schools (or at least classes) and work in male dominated departments, most of us never got comfortable working with women. This comes out most strongly in social interactions, but social interactions have a strong effect on work, especially in startups and other small companies since they affect job assignments and determine how comfortable individuals are in asking their co-workers for help.
My wife, who is the first and only woman in the Network Operations Center of a major ISP, was shocked to find that the tech who had used her computer the shift before had left porn as the default desktop image and even more shocked that her co-workers (who she got along with well and had not felt particularily discriminated against by) found this humerous. Such a thing would not have occurred in a department with more women in it, or among men who had spent more time dealing with women.
In and of it self the situation is negative, perhaps even actionable in our litigious society, but it is more troubling as a symptom of an insular male dominated sub-class which doesn't yet know how to deal with women. It is not surprising that such gender biases exist, they are or were the same in medicine, armed forces, law and other male dominated fields.
I suspect that as the number of women in IT fields and that this in and of itself will change the geek culture to be more inclusive and welcoming of women. Until then some women who are strong technically will be turned away by the culture, even if they are attracted by the problems.
Until then, be aware of (and stop) your actions that might make a woman uncomfortable, even when there is _not_ a woman present, and make an active effort to give the same encouragement, help, and respect to your female colleagues as male. We're smart, savvy and anti-bullshit. Let us see male-centric part of geekdom for the dumb, old cruft is and get rid of it.
--
"L'IT c'est moi!"
I've read the article. And now I've read the comments. But so what? So girls don't wanna be geeks for the most part? And this is bad, why?
:-)
It takes all types of people doing all kinds of things to make the world go round. These days, so many school leaving males wan't to rush out and be an MSCE, that there need to be people pursuing other things. Women often offer us a 'sanity mirror' that we can look into and see just how mental we're being about things. They have good perspective as a rule. Men lack this. That is why Windows exists
So if women want to do other things, I say go for it. If women want to be geeks too, I'm all for that. Just don't complain if you date a geek and you find out she doesn't have time for you when you want it, because she's working on a cool hack. Been there. Didn't enjoy it. Find a woman who understands and supports what you do, but has her own life as well!
Too tired to be coherent.
/* Wayne Pascoe
From my Wife:)
The authors of the article are sadly mistaken. I work with Geeks and have not been more understood, treated with respect, or laughed so hard than in this setting with these superior beings. These guys not only invite you to the meeting, but proudly introduce you and make it clear that it was your great idea and you did all the work. There is just something about "that big old brain"! Timothy Leary said it best " Intelligence is the ultimate aphrodisiac". Girls, its nobody's fault but your own for missing out on the best of all work worlds.
Those who give up freedom for security deserve neither.-Ben Franklin
not all of us go for the jocks... some of go after the 'geeks'..
Mmmm yea, anonymous coward your insightful psychological assesment makes me want to cry.. Must have cut close to a nerve to get an anonymous coward to jump out on the limb with that verbose sewer output.. Been awhile since you had any female attention? Must be one of those worms I was talking about..
http://tinyurl.com/globalwarmingisascam
Perhaps the reason girls don't go for geek guys is because we use the Discovery channel as a guide to appropriate mating signals?
:-)
Actually, there are plenty of girls out there who go for geek guys. I've dated several of them. OK, maybe not "plenty". Probably not enough to, er, "supply" all the geek guys of the world with a girlfriend. Keep in mind also, that there is a marked difference between "girls who go for geek guys" and "girl geeks". Most of the girls I have dated have not been "geeks", at least not in the IT sense of the word.
Moderators do your worse...
Hello, ever hear of lady Ada Lovelace?
Maybe one thing that turns girls off is that a lot of male geeks make the mistake of becoming geek missionaries and sort of try to ram geekish things down everyone else's throats.
I think it's because deep down inside a lot of geeks just want to be accepted, but without giving up their geekish ideals. So they wish and hope for a girl that they can shape and mold into uber-geek-girl-love-slave who will of course worship them, their Geek Daddy and mentor.
Having a geek girlfriend really sounds like a good idea. I always wanted a girl who was into the things I was into. Finally, I found one! She wasn't a coder, but she was into lots of other geekish things like science fiction, anime, video games, owning swords, etc that I was also into.
I dunno, it was fun, but wasn't really all that great. I mean, after staring at code for 12 hours a day, do you really want to come home and discuss it while you and your similarly-obsessed significant other make dinner/go to bed/etc?
I have a much better relationship with my current girlfriend, who's hardly into any of the stuff I'm into. But we really dig eachother and like eachother so it's fun! I think I'd rather date someone a lot different than me who digs me and has an open mind.
OK, I kind of went off on a tangent there. But I think "geek missionaries" are one turn-off for women when they think of technology...
OtakuBooty.com: Smart, funny, sexy nerds.
People who claim that men and women naturally have identical mental tendencies, and that any aparent differences are due only to societal pressures, are way off the mark.
Humans and other animals are an advanced result of evolution. We have behaviors and tendencies which have guided and resulted from our survival, and these ingrained behaviors are more predominant in us than we would like to admit. Most people like to think that they have severely advanced intellects compared to cats and dogs, and that this intellect allows us to live our lives rationally instead of being bound to silly evolved behavior patterns and tendencies. People who think that are fooling themselves.
That said, women are by nature more caring, affectionate, and emotional. Not ALL women, just MOST. (Statistics demonstrate this time and time again, and this natural gender difference is just as evident in numerous non-human species on this planet that don't have mainstream media affecting their lives.)
As a result, most women either (1) can't understand and/or (2) strongly dislike people who take a logical, problem-solving approach to everything in life.
I've experienced this with my current girlfriend. We love and respect each other, but she can't understand my approach to things, I can't understand hers. This leads to mutual frustration and annoyance.
For example, when she is having an emotional crisis over some kind of problem, my solution is to suggest concrete steps she could take to tackle the problematic scenario and solve it, but what she wants is for me to hold her and tell her everything will be okay, without suggesting anything to actually solve the problem. She can't understand why I always approach things logically, while I can't understand why she won't.
Most men tend to have analytical and problem-solving minds as a result of evolution. Women are equally capable of analytical thought, but most of them simply dislike doing it by nature.
Most women don't dislike geek guys because of appearances or an affinity for computers. Most women dislike them because they are analytical problem-solvers in everything they do. It drives most women crazy that guys try to spread jam on their toast as evenly as possible to maximize the flavor potential. It drives most women crazy that guys try to maximize their savings over time by limiting their entertainment expenses. It drives most women crazy that guys think solving a difficult mental puzzle is more important than dressing attractively. It drives most women crazy that guys would rather fix something themselves than get someone else to deal with it.
And it drives most women crazy to think that they might have to put forth the effort to learn something incredibly difficult, such as a scientific or engineering discipline, or deal with anything in an analytical way. Their thinking is "Why should we do that icky stuff when there are other people (i.e. geek guys) to take care of it for us?"
Seeing the trend?
- "It's just a matter of opinion!" - PRIMUS
Just look at all the prejudices and gender-bashing going on here. It's no different here than in society as a whole.
Give me a break, folks! Don't judge people solely on their gender/color/whatever. Judge people by what they can achieve. If it weren't for a WOMAN, the COBOL language would have never been developed.
Yes, there are differences between the genders, but that doesn't mean that women are incapable of doing traditionally "male" things (get your minds out of the gutter!) just as well, if not better than men. It also doesn't mean that men are incapable of donig traditionally "female" things just as well, if not better than women. Biological limits notwithstanding, of course - men can't give birth for instance.
So, folks, next time you need directions on how to get somewhere don't automatically assume a woman can't help you (or the next time you need a technical question answered). At the same time, next time you need something for a bake sale, don't assume the guys can't/won't bring something (and don't assume us gals WILL bring something 'cause I don't bake ).
-- Some people live life in the fast lane. I live life in oncoming traffic.
I agree with the polls findings in respect to women maybe being pushed away from a career in technology, preferring them to stick to more traditionally female roles. HOWEVER, I do not believe that this has stopped ME, OR ANY OTHER GEEK GIRL from pursuing what makes them happy and whole, whether it be for the purpose of competiting with males, and showing them that ANYTHING YOU CAN DO I CAN DO BETTER or just simply for the pleasure. And I'm sure that my parents would rather that I play with dolls, and not Debian, but I am what I am :) And very proud.
I am a guy geek (boo hiss)that finds many women unable and unwilling to listen when trying to explain something to them about computers. This ISN'T their fault though, many of them have been steered away from technology and even science (although the latter is changing rapidly, thankfully), prefering to go down the roots of languages. This is what happened to my girlfriend, who has just finished her degree in translation (French, English, German). The question now is who is more intelligent? I personally don't like labeling people better than someone else, no matter what they do, whether farmer or director because:
No farmer=no food=no director.
If I were to answer the question, I would say that she is more intelligent. Reasons? I know C++, C, Pascal, VC++ etc. I can program quite happily in them. Learning a computer language has a lot of similarities with learning languages, but she can go from one to the other, mid-sentence. She translates one to the other on-the-fly. Not many geeks can say that they can convert a C++ code into Pascal on-the-fly. We have to examine the code, she just spits it out as though it is completely natural.
Women are very adept to languages because they have been forced to progress and specialise in that direction more than technological. I have no doubt that a women with the same education and years of experience of a computer language would probably out-code a lot of males.
What a lot of teachers and males don't realise is that by introducing more women into the field of computers not only re-balances the subject, but gives a different approach to the subject, thereby increasing the possibility of finding unthought of possibilities. For proof just look at some of the work that women have brought to the medical and scientific community. Amazing. I can't say that I haven't had my fair share of digs at women for following computing in my early years, but now that I have experienced working with female colleages, I have nothing but respect for them, they have had to work twice as hard to get to the same position as me, and I truly believe that that is wrong.
c0rarc
I'm going to be flamed to hell for this, but oh well...
/. readers) are afraid of women with common sense or a modicum of intelligence. This and women's behavioral adaptations have to do with simple biology and instictive patterns. If you don't get it, have someone draw you a picture.
/. at 3:30am. Who's the idiot here? =) (Yet again, a long story..)
Few girls want to be viewed as intellegent.
You heard me.
I was just at a club. I hooked up with a girl who came across as a total idiot ("I like stuff! And shopping at the Gap and driving my Neon!!!"). Until I started rambling about astrophysics (long story)... and SHE CORRECTED ME (*SCHWING!*). She then appoligized for being right and I feel that proves my point.
9 out of 10 guys (not
Of course, I say she came off as a total idiot, yet I'm posting on
Maybe it's that I live in New York, where the dot com revolution was happening up until about this past Thursday.
Girls I know code more than just HTML. My girlfriend codes about as much Perl as I do, and she is doing CS come fall. Several of my close friends do more than "pretty html" and make a ton of money doing it.
I see very few female sysadmins, but ummm, no offense guys, I'd feel uncomfortable too if I were in a setting where all days guys spoke about the size of their drive, the build that they did last night, and had poor personal hygene. That last one, to me, is the clincher.
Geeks! Unite! Smarten your image up! You can afford it, while the dot com thing is in its death throws, vest your options! Join a gym! Get a nice wardrobe! Brush your teeth!
And, umm, tell your younger brothers to do the same. Then, you'll start to see girl geeks.
That's not scientific, though. Just a guess.
Hey, I am a geek...well I think I am. And I love to keep my good old P120 running instead of buying (every two months) the latest Thunderbird/Pentium4/Transmeta/whatever.
What you say about cars and women is not true: I drive an Audi TT which is considered a sports car (well where I live) and it didn't help me getting a woman in no way.
Oh, and (I know it is not on this post), what is everyone bitching about personal hygiene of geeks? I shower everyday...the only thing I loathe is shaving.
Ahhh...the great dumpster continuum. Many a free computer will be found there. -- sowth (748135)
As a Girl Geek, I have the exact opposite problem - I can't get a technical job. 6 Years as a technician, and most of the men don't seem to want to hire a girl who's better at it than they are... Is it me or are they short d!cked losers? Puma "Why did you put our DNS & DHCP & Intranet on a 386?" "Because I could!"
1: My aunt got her BSc degree in math and CompSci at Imperial College, London, in the late 60s - an incredible achievement. She then got into teaching, and for the last 20 years has been working in the west (== very rural) of Ireland, at a Tertiary level college, teaching IT and CS. I remember her saying that twenty years ago, the classes would be full of women. Now thanks to the internet "as soon as the 14 year old boys get near a computer they cluster around it and start pulling down porn."
2: I've known several women in tech careers professionally. All of them were as good as (or better than) their male peers, and all of them (as far as I could see) were consistently patronised, marginalised, shunted into "female orientated" roles (guess who gets to handle telecoms ?) and generally treated like shit.
3: Someone recently posted a brief announcement on the NANOG list about a "women in technology" mailing list starting up. The general tone of the responses seemed to be to be amused superiority; a couple of people got /really worked up/ and came out with some embarrassingly reactionary, MCP-type sexist garbage - confirming the stereotype of male tech workers as poorly socialised, arrogant, and ignorant outside their narrow field of expertise (in which they become obsessively knowledgable.)
4: Only last week a similar discussion happened where I work; apparently intelligent, sensible programmers were seriously advancing the notion that women are genetically unable to code owing to some chromosomal imbalance.
;)
Draw your own conclusions. Oh, you already have
Camaron de la Isla 'When I sing with pleasure, my
"None are more hopelessly enslaved than those who falsely believe they are free." -- Goethe
It's one thing to have a talent for something. But to to truly master a field requires a certain amount of mono-mania. This is what makes true masters of their art what they are. It's also what makes many geeks insufferable people to deal with.
The comfort you demanded is now mandatory - Jello Biafra
My sister is a geek (Aeronautical Engineering), but she made that decision on her own, and never spoke to a councellor or a recruiter. She only applied to a single college, and didn't list any alternative major choices in her application. Most of the geek girls I know fit the same profile. Many of the geek guys I know applied to college under history or literature majors and got recruited into their fields.
Network Security: It always comes down to a big guy with a gun.
The people trolling this story are the same ones that cause females to turn away from technical careers. Even if a female is inclined to technical pursuits, she has a powerful reason not to, when the technical field is filled with sexist, insecure, and socially incoherent people.
A male has to deal with social pressure from outside the geek community, but within the community, there is support and like minded people. I'm generalising here, but a female has to deal with harrassment from both inside the community and without, and for most of them, it just isn't worth it. I have a tremendous respect for females in technical fields, because they have to deal with social difficulties on two fronts.
In other words, don't treat female geeks as aberrations, prospective geek wives, or otherworldly creatures... treat them as fellow geeks.
My parents being unskilled labourer migrants to Austrlia, didn't really understand my choice of career. In fact they hated it. I started my comp. sci. degree against their wishes and with all sorts of nastiness in my family at the time. They wanted me to become a lawyer, doctor or architect, something "decent" like that.
Now, they are so glad I didn't listen to them. I'm in a job I really like and I get paid pretty well. I don't ever see myself being umemployed.
My point is, if the silicon is in your blood, nothing will stop you.
As for all the other guys and grrrrls saying, "yes, there should be more female geeks". I agree and disagree with you. I disagree in that, I don't give a shit what the gender of the geek is. Geekdom transcends race, age, gender, species (on the Internet nobody knows you are a dog) and time (Ada was a geek in a computerless world). On the other hand, I also agree, because I believe that women solve problems in a different way to men and it's a great thing to have different problem solving approaches in a dev team.
I forgot to add this to my other comment...
You seem to think that it's wrong to laugh at stupid people? I do not share that opinion. As I wrote above, we did indeed explain what a vector was to N****. You wrongly assumed that we didn't.
She NEVER FIGURED OUT WHAT WE WERE TALKING ABOUT. You think it was difficult for N**** to admit her ignorance in front of us. Well, that was standard for her. She found it easy to admit ignorance, constantly.
I think you're pissed off because we were laughing at a female. If we were laughing at a dumb guy, you'd be right there laughing right along. Well, I've got news for you. I don't care what sex a person is. I laugh at stupidity wherever it is found. You on the other hand have some kind of sexism problem.
You want more proof? You hope that N**** found someone with decency. Well, that might be because you assume that a woman is incomplete on her own. Why should she have to find anyone at all? She may very well have found someone, but I have no idea. It's been 11 years since I last talked to her. Maybe you should find her a good man before she wastes her life as an old maid?
That's sarchasm for the clueless.
If tits were wings it'd be flying around.
I bet that napkin came in hand later on that night
Don't jerk me off, I've already come
I am a high school quasi-geek-girl. I went to the computer lab to do some programming after school a few times, and found that the chess club was meeting. They were all guys. So that 5:1 ratio isn't even accurate at my school. ;-) I won't go to any chess club meetings. I haven't been to math team meetings, but the people I know on the team are also all male. It's always a bit uncomfortable to be the only girl. The same applies to programming jobs, to some extent.
I think the poster idea would be very amusing, Chaosnymph. :) Bet the math team and the chess club wouldn't object...;)
~kwallace
Regarding the original quote that spawned this debate, it sounds like so much apologism to me. If you read between the lines what it's saying is, "Don't worry your pretty little head about all this trivia; it's just chimpanzee work. You have a `higher' intelligence." Feh.
-JACS (Just Another Chimpanzee Scientist)
classifications.
At my school, there were a few girls novices that did the typical computer users stuff (email, chat, etc), but only four or five guys were serious computer users and none of them were 'geeks.'
I've always said that I broke the classification of being a geek because I played football, I lifted weights, I ran track, I took calculus, and I could do a little programming.
But then I think about the other major computer user, my best friend in fact, wasn't a typical geek either. Sure, he didn't do any sports but he partied like a wildman.
The girl closest to being a geek at my school was in my calc class(amazingly it was 3 girls, 4 guys)
and she breezed through. The girl is a computer novice and can't get through a word processor by herself. And she was a star athlete.
I don't know if I've answer the questioned but all of this seemed OT.
This forum is so overly bias in the tech area, ask the average person what 'slashdot' is and they will give you a blank stare like you are speaking another language. Go to a nite club and try and pick up a girl with a line like "I was just reading on how they overclock the K7's up to 1GHZ..." The girl will run to get away from you (not that i have tried this). Females place certian things higher on a priority list, maslov's 7 requirements seem to slip by most geeks as computer prowless drops to the bottom rung being first over food and shelter.
Get with the program, males and females are different, not just at the chromosome level but in every aspect, would we really want everyone to be the same? how lame would that be, a society full of blandness, we should rejoice in the differences. Long live the hotties.
The bottom line is I don't believe there is a gender bias at work here. Right or not, traditionally men have been more attracted to building things, whether that be buildings, roads, cars, networks or web sites. It's not about physical labor so much as loving to put things together.
And oh yeah, we love to blow things up too. ;-)
Eagles may soar, but weasels don't get sucked into jet engines.
I like to think of it another way. All technology has been created by men. Why? Well, using a simiar list of examples as above...
Fire - Make meat taste better
Club - Hitting mamoths hurts my hand
Printing Press - Writing it down takes too long
TV - Can sit down and still know what's going on
VCR - can sleep while finding out what's going on
Internet - Don't have to adress letters anymore
And there you have it, it all comes down to lazyness. Men are lazy, shiftless people, not unlike cats in that aspect. All technology has been created in order to make our lives easier and allow us males to be even more lazy. Gods bless all those who have made it possible. *G*
The chains are broken
Loki is free
Ragnarok is at hand...
I recently discovered this startling statistic:
Approximately 0% of men become mothers!
This enormous segment of the male population (including me) will never know the wonders of giving birth!
Personally, I blame sex education for imposing these roles.
I also discovered one other interesting statistic:
Approxmiately 99% of all people who try to prove things with statistics are fscking idiots.
I AM KREYGHOLIO!
sig fault
Your dramatic oratory to the contrary, no one around here is saying society has to be 50/50 in everything. That argument is a straw man. This is about understanding power: who has it, who don't, and why. Who are the subjects of their own destiny, who are the objects of another's. Who makes the big money, who subsists on scraps. If those aren't interesting questions to you, they are to me -- and I'm neither white nor a liberal, if that matters. You can't game a complex system until you understand it.
Looking at it systemically rather than anecdotally, it's clear that the more technological a society becomes, the more power adheres to the technocracy. I'm surprised more Slashdot readers don't mention this -- it's a big theme of SF, of Jon Katz's book, of ESR's writing, etc.. Anyone who won't step up and learn tech is increasingly at the mercy of those who will. That's what a technocracy means, right?: if the geeks walk out, the whole society grinds to a halt. In a sense, everyone else in society functions as support staff to the geeks -- burger flippers to make their food, maids to clean their houses, teachers to educate them, doctors to keep them healthy, IRS agents to redistribute their wealth, wives to raise their kids. This historical progression hasn't happened completely yet, but it's not that far off.
I personally intend to be among the technocrats, not the burger-flippers -- and despite your rhetoric about male nannies, I think you do too. That's why it's an interesting question to me. The social responsibility thing is tangential -- it's your right to say "so what?" to the social status quo if you choose. But to me, this topic is about knowledge == power, not about self-righteous liberalism.