Slashdot Mirror


Girls Don't Want To Be Geeks

Silas writes "According to a new study by the American Association of University Women, highlighted in this AP article, 'Girls have the ability to learn and use computers, but they are turned off by technical careers that they view as full of geeky guys'. The study blames the general sentiment on a gender imbalance in access to computers, and on social pressures that steer girls away from technology. What say you, women of the Slashdot population?" Stand up and shout on this one, ladies. I think that it takes a special breed of person to be attracted to this line of work, not necessarily a specific gender. Tell us what you think.

624 of 624 comments (clear)

  1. Re:Miranda and Ki by VereSomnia · · Score: 1

    For the record, since it seems important to this conversation, I'm a woman.

    I am also a geek. I'm one of the few I know, despite the fact that I am attending a university in the computer science department. Most of the women I meet there are much more interested in making money. They look at computers, even when they're the ones at the keyboard, and gawk. They make comments like, "Isn't it neat what computers can do these days?" while referring to the transitions in PowerPoint.

    I love User Friendly and GPF. And I would undoubtedly be interested in anyone who thought that Ki would make a good date. On the other hand, User Friendly has been dissapointing me as far as gender balance.

    Miranda is portrayed as an intelligent woman who's up to snuff in all technology issues. But she's also portrayed as very different from the men at Colombia Internet. Take the recent camping trip. Miranda, interested in a "get to know each other" session, takes all the techs out to the wilderness. The techs complain, and show an amazement about the outside world they rarely visit. On the other hand, Miranda is perfectly comfortable and doesn't understand the faux pas she has made.

    Miranda also considers herself above the geeks, as in this cartoon (http://ars.userfriendly.org/cartoons/?id=20000607 ) when she refers to them in terms of children with her as a parental figure.

    These examples made me very sad. When it comes does to it, I get outside just as rarely as most of my fellow geeks. I can spend hours vegging on a game and not be ashamed. I can sleep till noon and eat Doritos for breakfast like the best of them. It makes me very sad that User Friendly, one of my favorite comics, draws an arbitrary line between the genders in the same way the much of the media does.

    -Marcella
    dragonmlf@earthlink.net

  2. Re:Computergrrrl vs. The Man by Frymaster · · Score: 1
    Here's a question for you, though, will your beloved be recognized and get raises or promotions at this company?

    No. I must say that this has more to do with the size and organization of the company than anything else though. The org chart is: suits: top gord: answers to suits everyone else: answers to whoever isn't one of them.

  3. Re:The Real Problem(s)? by Acrucis · · Score: 1

    I think a major part of the problem is how people are taught to think. Little girls are given barbies for their birthdays and play with clothes, makeup, and the like. Little boys are given toys like legos that help them learn logical thinking skills. Hmm, could I be on to something here? Once the kids are older these skills learned early-on are still there, giving the boys the advantage in understanding things that require logical thinking skills, and producing social norms about girls not doing as well with math, science, or computers. I believe it all has a lot with what parents encourage in their children when they are very young.
    I was the little girl who played with legos =)

  4. Re:Geek - 1 / Suit-Wearing Stick - 0 by Troutgirl · · Score: 1

    Hmmmm. Speaking of stereotyping... I'm a software engineer at a Silicon Valley startup, and let me tell you my supergeek colleagues can shotgun a beer with the best of them. They're manly (except the ones who are women) *and* they know Unix -- what a concept, huh?

  5. Re:Gender Imbalance....WTF? by redhog · · Score: 2

    Becoming hacker to just to make money makes no geek. If girls where only in it for the money, I wouldn't want to be anywhere near any of them. Thankfully, not all of them are (Even though, the most of traditional men-jobs that woman gets into are high-paid, non-techie). Becoming a geek is to love the tech. To live with it. For it. And don't care about money, altought, money won't probably be any problem...
    --The knowledge that you are an idiot, is what distinguishes you from one.

    --
    --The knowledge that you are an idiot, is what distinguishes you from one.
  6. Re:Do ya REALLY want a girl just like you? by infinite_twilight · · Score: 1

    If I might say something to your statement of what turns us off...

    You are correct, at least from my point of view as a once-just-a-shy-chick-now-an-altena-girl-geek-of-s orts. Girls who are not fully geekified, or who care about what the rest of society thinks, are embarassed by guys who rant in public about the virtues of Linux over all other os (although we probably agree :) or how much so-and-so sucked at UT at the last LAN party...

    If we are not already a geek, you are probably going to have to live with it... If you want to convert them, go slowly.. Introduce them to Quake, but don't whip their @ss the first time.. Show them cool sites, such as slashdot (i worshipped the guy for like a month after he showed me this site in ninth grade). Don't make fun of them if they don;t understand and don't be too too critical of their efforts (there is no worse turn off than having your just-learned-and-wanted-to-try-it-myself code shot down and totally dissed by some guy). Encourage them and if there is a spark of geek in them, perhaps it might catch!

    Some chicas want a geek guy... The guy just has to be able to handle the fact that they probably think very alike... and he will be faced with a reminder of work at home... Most chicas can handle it, how about you?

    just my cdn 2 cents

    ~me
  7. I accuse my parents... by nano-second · · Score: 3
    While your observation might be entirely valid, I don't think it has much to do with the capability of a particular gender.
    Most parents, unintentionally, will treat their children differently based on their preconcieved notions of that gender. It is most likely very unconcious, but it happens. It is this social conditioning that I think really creates the disparity in technology careers. By the time girls (and boys) first reach school, these concepts are already programmed in. It doesn't just affect interest in math/science/comp.sci... but that is one effect.
    (For example, in the average grade 1 class, most girls are much better with "fine motor skills"... they can use scissors much more effectively than the average boy. This is likely because boys are encouraged to play outside more often when they are young.)

    These sort of seemingly trivial differences end up affecting how girls view math and science, and they are less likely to pursue those topics in high school and university. It becomes a vicious circle, because there are few women in these fields, there are fewer role models.
    ---

    --
    I hope you're not pretending to be evil while secretly being good. That would be dishonest.
  8. Re:If I were a girl.... by Azundris · · Score: 1

    I don't quite see the point? : )

    If you suffer from Cinderella Complex, you need
    to find a guy that promises

    - social security (okay, geeks have money)
    - status (well, you know what people think of
    geeks)
    - protection (well...)
    - and perchance someone to generally take care
    of your decisions and shite.

    One out of four isn't great. And trainable...
    well, having to do that at 17 is okay-ish, I
    suppose, but at 25 or 30, most people I know
    expect their partner to know what they're doing.
    ; )

    If OTOH you have no particular need of dating a
    father figure or what-not, why not date someone
    who can *really* understand the way you feel? ; )

    HHOS,
    Azou

    Disclaimer: I'm not saying all geeks are as
    described above; I'm referring to
    how the unassuming public seems to
    see you guys, in terms of stereotypes.
    Azundris

  9. Re:Environment is important by Buggernut · · Score: 1


    Don't assume we're in it for the guys.
    </i>
    <p>
    You've got to be kidding! (Geek guys...come on!)

  10. Re:Fundamentals by softsign · · Score: 2
    Woo woo! Common ground.

    See, now if everyone in the world could reach a consensus like this, all our problems would be solved! =)

    *sigh*

    --

  11. Re:Girls don't watch the Man Show or play Football by spanky555 · · Score: 1

    Oh, please...it definitely has its moments. My FEMALE roommate and I were watching it, and they had this bit where they go to the mall and postulate this question to women: "If you could have an operation that made you smarter, but your butt got bigger, would you do it?" To a one, every woman asked said "no". Both my roommate and I found it very funny. Of course, being male, I enjoy the girls on trampolines, and my roommate leaves the room during that bit...

  12. Digital Women by Ursa_Minor · · Score: 1

    So 70 teenage girls and an unspecified number of grown women talk about their impressions? And this is supposed to explain why women are underrepresented in comp sci and information science? The article seemed to blame the girls for their lack of participation in 'geek' pursuits; it's all the fault of their superficial preconceptions, etc etc.

    As a recently-minted (female) geek, this stuff makes my blood boil. Since when do we blame girls for believing what they are told throughout their lives - that tech stuff is hard and boring, that they are made for better things (left, of course, unspecified), that there will always be a man somewhere to fix their mistakes. It's a social problem, hardly limited to the minds of young women, yet the article makes it sound as if their little bubbleheads just can't hold the necessary information.

    I stayed away from the technical side of computers for a long time because I was afraid of getting something wrong (and when you had an overbearing father like mine, this was a valid fear). It seemed better to avoid the challenge than to fail. I realized a while ago that this was a stupid way to go about life, and started learning more and stretching my boundaries of 'acceptable failure'.

    Young women are poorly educated - on the whole - in math and science in the U.S. public schools. So why should computers be any different? All young people need to be socialized better to explore challenge and potential failure, whatever their gender. From my seat, that's the only possible solution.

    --

    --
    this is not my beautiful wife. TH
  13. The Female of the Species by DowntownCoder · · Score: 1

    When the Himalayan peasant meets the he-bear in his pride,
    He shouts to scare the monster, who will often turn aside.
    But the she-bear thus accosted rends the peasant tooth and nail.
    For the female of the species is more deadly than the male.

    When Nag the basking cobra hears the careless foot of man,
    He will sometimes wriggle sideways and avoid it if he can.
    But his mate makes no such motion where she camps beside the trail.
    For the female of the species is more deadly than the male.

    ...When the early Jesuit fathers preached to Hurons and Choctaws,
    They prayed to be delivered from the vengence of the squaws.
    'Twas the women, not the warriors, turned those stark enthusiasts pale.
    For the female of the species is more deadly than the male.

    ...So it comes that Man, the coward, when he gathers to confer
    Whith his fellow-braves in council, dare not leave a place for her
    Where, at war with Life and Conscience, he uplifts his erring hands
    To some God of Abstract Justice--which no woman understands.

    And Man knows it! Knows, moreover, that the Woman that God gave him
    Must command but may not govern--shall enthral but not enslave him.
    And She knows, because She warns him, and Her instincts never fail,
    That the Female of Her Species is more deadly than the Male.

    - Rudyard Kipling, 1911

  14. Re:Important!=powerful by SciBoy · · Score: 1
    You are right and you are wrong. Ultimately, the only thing that counts is your own life. I call anyone in control of their own life powerful.

    Living a life completely cut off from the world and being in control of your own life is powerful in a way. But it is not influential. A teacher can be influential, which is another form of power. You are very right in calling some teachers powerful. But there are a lot of teachers who are unable to do their job (teach) because of the circumstances at their workplace (being full of weapons, lack of funds, whatever). These teachers are powerless.

    In short, you are right when you say that influence over others is power. You are also wrong when you imply that influence is the only form of power.

    Feeling in control of your life makes you feel powerful and secure about yourself. Certainly, this is more important than being able to control others. There are probably a huge number of CEO's and VP's of all kinds of companies around the world who feel an enormous lack of control over their own lives, but who are at the same time very influential. They make decisions concerning thousands of people's daily life every day, yet they can't just take time off whenever they want to play with their kids (or even be home at 6 to see them after work).

    There is power and there is power.

    --
    "War is God's way of teaching Americans geography." - Ambrose Bierce (1842-1914)
  15. Re:I'd believe them, except that... by bendude · · Score: 1

    >>Total I think there is like 12 computer geeks, about half of that which are morons.

    Having never met the six people you are refering to, I need to ask you - Are they morons because their personal priorities don't match up to what you judge as good and propper? If so, mayby you'd better go back up to the top of the page and start again.

    --


    Get the Hell off my planet, you slimy mobster Bush!
  16. Geeks in General by knurr · · Score: 1

    I think Geeks in General have still not been accepted into society. The Pressures to fit in , be with the right people,and even on occasion be the right color, play a huge role. Even the the Tech Industry is a money making one(even thought geeks do it becuase they like it) it does not look "good." If the want more girls make geeks socially acceptable

    --
    If we refuse to be flexible, we are in effect opting out of the game of life. The world moves on without us.
  17. Re:Maybe it's a technology thing? by oceangal · · Score: 1

    i dont believe thats true. i'm in school majoring in computer programming and in my computer classes the majority of students are female. there are a fair amount of males, but us women are surely taking over! it has nothing to do with "geeky guys" being interested in computers, i know a lot of guys that are NOT geeky that work with computers. if anything i would think more women would want to get into this field to try and meet guys! i've found that they are nicer and not so egotistical :)

    --
    dont let the system crash you...crash the system! -oceangal
  18. Re:Geeks GET Girls, Though. by infinite_twilight · · Score: 1

    Sudbury, Ontario ~me

  19. Re:There are two genders, folks, not one. by misty123 · · Score: 1
    My point is that females are just different than males. Just what is so wrong with *most* women not liking the same things as men? Trying to figure out *why* this is the case is irrelevant, and so far it's leading to a whole slew of stupid assumptions in this thread, since it's fairly obvious that it won't change a whole lot in the near future.

    The fairly general argument in this discussion has been that "women think emotionally and men think logically". This argument can also be reversed to say that (most) men are emotionally impaired. In their childhood, girls are allowed to show their feelings openly while a boy who shows his emotions is thought to be weak and "girlish". Most boys learn before long that if they want to be popular, they'd better play by the rules of the majority or they will be alienated in school. Maybe some of these (alienated) children become geeks at a later time. Many geeks have told to be unpopular at school, but assuming this as a sole reason for geekhood is oversimplification.

    Yeah, I was an emotional male child, I had my difficulties in school, but I've pretty much came over it. And I'm proud I've not become autistic in the process, despite the peer pressure. I was also laughed at because I spent all my free time with computers. Nowadays I'm working as a UNIX sysadmin in a big multi-national company and I probably get twice as much salary as those who laughed at me. The one who laughs last laughs best, they say:) But I don't really really believe that being emotional and logical at the same time would be impossible or even difficult for the same person. Actually that's the biggest and most ubiquitously accepted lie I've ever heard. You can be purely a technical person, but that doesn't help you in your private life. Or if you think your VCR's remote control is technical enough not to be worth learning, that can be quite restrictive nowadays, too.

    --
    misty@sgic.fi
  20. Re:I'm a geek girl! by Dementyia · · Score: 1

    I've been reading slashdot for about a year now, and I love it. I know html coding. I know that that does not make me a geek, but I cannot find anything real that I could do with any of the other languages. I know that C C+ and C++ can be used to create a MUD, but that is all the use I know for it. With java and perl, pretty pictures,moving text, and cgi. Maybe if there were more on what all the languages can do? I have always been rather slow at math, but all of the computer languages I have seen and tried through tutorials on the web have been really easy for me to pick up on. If ppl spoke about languages, instead of mathematical code, and there were more examples of what the different languages do, maybe more people, including women, would join the geekhood?

  21. Would someone please address this issue... by Some+Dumbass... · · Score: 1

    Why is it that people have such a hard time believing that men and women are "wired up" as much by nurture as by nature? Seriously, how exactly do you know that women weren't persuaded by their culture to move into other careers?

    It's really annoying to argue this point in an environment in which posts refer to people who ask important questions like this as "feminazis" (Score: 5). But come on, really! I'm not saying that women are poor and downtrodden. I'm not ignoring decades of work towards gender equality. But I am saying that perhaps upbringing makes a difference. That could be good, bad, neither, whatever... I don't care. But why the hell do some people fail to acknowledge the possibility?

    Maybe because it implies that, as much as everyone wants to believe in free will, our decisions are ultimately, very heavily, influenced (though not determined entirely) by our environment and experiences?

  22. Re:My own (vicarious) experience... by bridgette · · Score: 2

    In general, men and women aren't the same.

    When people try to deny it, I think they are really oversimplifying because it's easier to "assume that everyone is the same" than it is to grok and communicate the real issues involved in treating people fairly. And our societey tries to value fair play.

    Ultimately, eneralizations are of limmited use when dealing with individuals.

    --
    - bridgette
  23. As usual, the guys argue who is correct by noidentity · · Score: 1

    The geek guys here constantly arguing that they are right about how the situation is for girls, as if their life depends on it being a certain way. Earn your trophy! From outside this competition, it looks so silly, but they won't listen.

  24. Putting the Geek in Girl by seinethinker · · Score: 1

    I am a girl. I would definitely classify myself as a geek. I love computers, science.. and so forth.

    I admit I find this situation a bit sad, but I also have very strong and different feelings regarding this subject.

    I do wish there were more girls in science. It would be nice. Sometimes I would not feel so alone in the male throng. Its kind of tough sometimes.

    I definitely agree with others that socialization plays a huge factor in what people choose as their lifestyle and careers - both men and women. Don't be one sided, men are encouraged in high school to be jocks more than scientists these days (but hey this has happened for a while now). Girls are still encouraged in areas that gift the world with homemakers and entertainment (dating, advertising, waitressing, + the rest of the whole yuck yuck in crowd).

    What really bugs me is that its not just school and open human mingling that influence -- its parents, blind role models, businesses, peers, & the almighty buck combined with glitz.

    Although -- I am tired of hearing of women whine about how men get this and that when women do not actively go after the jobs they feel women need to part of. In truth women and men are cultures amongt themselves. There is nothing wrong in showing pride and desire in yourselves(-) the inflated ego. But there should be equality... but I think for the right reasons. I wish we didn't have to have affirmative action. However, it is still a necessity.

    However, I strongly believe... if you ain't got the skills and know how for the position you have been hired into... then the position has gone to waste and there is no contribution. (--mind you I know this can't speak for every situation).

    I sometimes wished I had the opportunity to have been paid more attention in high school. It seemed that I got overlooked when I was truly interested in math and science when others were being recruited to fill quotas. What I mean is why do people who really really want to be in a certain field get overlooked. These programs are coming way too late in my opinion. It is going to take years to unravel the damage done to women ..and men.

    These are just some thoughts on the matter.

    Ciao, Seine

    --
    Truth like surgery, may hurt, but it cures. - Han Suyin, Chinese Physician and Writer
  25. The mommy track by Mr.+Sketch · · Score: 1

    The reason this is so is because of the ideology of 'the mommy track' that several sociologists have written about. The theory is that 'all women are going to grow up to become mothers and then quit their job to take care of their children'. I can't recall the authors name right now, but there is an article in the book 'Feminist Frameworks' that talks about it.

    Thus companies are reluctant to advance women to higher positions because they believe that it won't be a good investment because they're just going to leave after they have children. So why bother making an investment like that in a woman whos going to leave when they can just make the investment in a man who won't.

    Now before I personally get flamed, I'm just presenting the ideology that created the 'glass ceiling' concept. I personally don't believe in the mommy track, but I can't deny that it is probably a major component in creating the glass ceiling.

  26. Re:Geek Girl and proud of it! by harmonica · · Score: 2

    We are constantly bombarded with media images of women who are obsessed with lipstick, clothing, weight, popularity, perfect skin and hair.. and the list goes on and on. Under this constant pressure, and even for reasons completely unrelated to it, many women are indifferent or even contemptuous towards intellectual pursuits.

    The media might be responsible for some bad ideas that girls get of what a woman should be like.
    However, as women make up about 50 percent of the people at universities, that obviously doesn't keep them away from the intellectual challenges of university. They simply seem to study other things, for whatever reason.

    There is an interesting article on that, 'Why Are There So Few Female Computer Scientists?'.

  27. Re:Baloney by alienmole · · Score: 1
    ...a social misfit or an absent minded fool (e.g. Richard Feynman was neither)

    Have you ever read any of Feynman's books, like "Surely you're joking, Mr. Feynman"? I'd say misfit describes him quite well, in the same sense that it does many other brilliant people. And I don't confuse "absent-minded" with fool, having often been accused of being the former, and knowing why.

    Regarding the original quote that spawned this debate, it sounds like so much apologism to me.

    Actually, I agree, but despite any between-the-lines messages, I thought it was an interesting idea. You could say something similar about managers in most companies: their job is to look at the big picture and not worry about the small details. This doesn't necessarily make them less useful (an arguable point in many cases!) In the case of the best managers or executives, though, their level of focus is invaluable. My previous post was just pawing weakly at the idea that perhaps our wonderful technical skills shouldn't be the envy of everybody else, as we so often seem to assume it should. We're just the janitors and garbagemen of the digital age, digging around amongst the mucky details allowing the rest of the world to serenely pretend they don't exist. Oh well, at least we're well paid!

  28. We make grrls feel stupid by billcopc · · Score: 3

    My S.O. could testify for this : when we geek guys unleash our techspeak, we just make any non-geek feel stupid and ignorant, both men and women. Now don't start tossing eggs in my direction, I don't sit on these stereotypes but I will use them simply to expose my theory.

    Now the problem might stem from the common observation that men are typically better with pure logic and can usually figure the stuff out with a few well placed questions ("So you're saying this CPU thing is like the carburator ?"). Anyways, in contrast, women seem to have (in general) much more difficulty in relating abstract concepts to more physical/familiar counterparts; they're more confortable sticking with purely abstract things, not crossing over with metaphores and real-life examples.

    Let's take our favored example : Math. I'd have to say that 90% of all women I've known totally suck at math, yes even my geek mother. It's a very exhausting experience watching my gf do her math homework, mainly because she asks me more questions than she has to answer. How hard can it be to understand that a trapezoid is really just a square + 2 triangles ? I must have spent the whole afternoon shoving some spatial sense into her head.

    Anyways, PC's are prime applications of this abstract-to-concrete train of thought. We have small rectangular icons we call "objects". They're not the objects like coke cans, or long-range throwable desk phones.. but if you can look beyond the physical aspect, the computer representation of an object is right on par with the real-life object. This is the key analogy that most female specimens seem to have trouble with. I'm not saying they're too stupid to figure it out, because the ones who persevere DO end up grokking the goods, but it's a relatively long process for women, at least from my personal observations. IMHO, women who have difficulty with this type of symmetric thinking are the ones who shy away from technical jobs because they have more trouble deriving solutions when faced with unexpected hurdles.

    Another thing I've noticed is not necessarily the hostility of non-geeks vs geeks, but more importantly the reverse situation. Intellectual, technical types such as myself look upon the rest of the crowd as somewhat ignorant and pointless. Spending a day without thinking, without creating.. that's a wasted day to me.

    My gf throws a small fit whenever I spend more than 10 seconds at the keyboard when she's around, which usually results in her being totally ignored for a few hours to pressure her. It's a natural reaction to her hostility toward my career, and I'm sure it gives her a bad impression of the type of people I work with. We're all highly focused tech-gods, each trying to prove him/herself right and the other person wrong. This holds for "geek girls" as well. We have a spoonful of them here, and they're a bunch of sore-tempered perfectionists. Now quite frankly, I'd rather have a dumb but sociable assistant, than these long-haired psychos. Anyone who knows a true geek girl will agree with me that they're independent, stubborn, and aggressive. Just like us guys. The problem is that this behavior may be expected in men, but most managers just don't know how to handle it in women. The workplace is such a gender-centric environment. I'm one of two tech guys transplanted into a human resources department, and wouldn't you know, we're the only guys on the whole floor. Managers hire along certain gender patterns, and people apply for work along similar patterns as well. All these things are slowly changing with the implementation of a gender equity process, but for the time being, every single department is dominated either by men or women. And gender favoritism set aside, there will always be more guys in tinkering work and more women in paperwork. That's just what we each do best.

    --
    -Billco, Fnarg.com
    1. Re:We make grrls feel stupid by [Dilbert] · · Score: 1
      when we geek guys unleash our techspeak, we just make any non-geek feel stupid and ignorant, both men and women.

      Budweiser: "True, true." 'Nuff said.

      Anyways, in contrast, women seem to have (in general) much more difficulty in relating abstract concepts to more physical/familiar counterparts; they're more confortable sticking with purely abstract things, not crossing over with metaphores and real-life examples.
      bullshit. total and utter bullshit, sorry.

      i've got a wonderful metaphor for computer hardware that women understand completely fine. men get it too, but note: you used a "Computer to car" concept, and that makes sense - people expect a non-geek guy to know about cars or something. my metaphor just takes something that more women happen to be familiar with (namely because guys are so damn lazy in this area): the kitchen.

      [cringes at the oncoming blows of feminists]

      i'm not being male-centric here, i'm simply putting things to light in a way that many women are familiar with...

      you + your hands == cpu counter == L1 cache, drawers == L2, cupboards == RAM, fridge or pantry == HDD, the freezer in the basement == CDROM

      i think i've made it clear. it works, it makes sense, it's really damn extensible too.

      i'm going to continue on and ruin your math theory too... my ex-gf was a calculus WHIZ. AP calc in high school, everyone would be sitting there banging away at their TI-85s and -86's... she had an 85 yet didn't know how to USE half of the functionality and thus banged out a ton of the calc by hand. this girl was SMART. she LOVED doing it too, i attempted to persuade her into trying to code - her mentality was such that she would've enjoyed it and done well at it... but she was so cemented into her one-track mind that she wanted to be a doctor, she wouldn't consider my suggestions. :-/

      oh and sidenote to the story - she was great at math and i absolutely SUCKED. i find it somewhat difficult to do ANY mental math. at times when i'm real bad, i count on my fingers. i'm a bit better at theory stuff, but i still prefer to use a tool (TI-89/mathematica/maple) to do my work, which is obviously frowned upon by math profs.

      in short, i'd say that most of your post is based upon one or two experiences, and i'm just trying to give you the flip side, not bash you to smithereens. please don't take it wrong, just gather knowledge from this. ;)

      --
      From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
    2. Re:We make grrls feel stupid by billcopc · · Score: 1

      What an eye twitching coincidence : mine's dreaming of entering the medical field as well. I wouldn't throw any calculus at her though. She has enough trouble just figuring out the square of a binomial. Anyways, we're each put through our own experiences which may differ wildly. I've been with both social geeks and technical geeks, and at least in my life they followed very identifiable behavioral patterns. And as far as that kitchen metaphor goes, it's not bad actually, but the trend is heading away from that "housewife" stereotype. Maybe I'm just living in some alien colony here, but I have yet to meet someone (of compatible age) who can cook and clean and whatnot. Ask my gf to make anything more than pasta and you'll be tossing it in the garbage on your way to the restaurant. Thank goodness for Stir-fried Random.

      --
      -Billco, Fnarg.com
  29. Re:Where have all the moderators gone? by __aaedhn419 · · Score: 1

    I'd suggest modding this up from (score 0, Troll) to (score 2, Insightful)

    Moderators: have you heard of "I disagree with you but will defend to the death your right to say it?"

    "This was the noblest Roman of them all"

  30. Important!=powerful by SciBoy · · Score: 1
    Important is not the same as powerful. Of course society would fall apart if all the cleaning-crews in the world would go on strike. They are a powerful group, if they act together. Problem is that it's hard for them to act together. Why? Because they don't have the time to make a world-wide network. They have so low wages that they have to work a lot to make ends meet (a lot of them anyway).

    So, tell me, would you consider them a powerful group? If they where so powerful right now, they would be paid more. This is just an example picked out of a million similar examples.

    The ability, opportunity and will to work together makes a powerful group. This group can be small, with huge assets (money, companies, land, governments) or a large group with small means (unions (not always poor), environmental groups) and so on.

    Being powerful means being able to influence your own life. That is what makes poor people powerless, because they have very little means of changing their life.

    What makes it important to make women interested in technology? It's purely survivalist in my book. I want diversity. I want every type of human being to participate in every part of society. This makes society sturdy, and more capable of handling extreme situations. Incorporating views of many different kinds of people into the creation of any product makes that product so much better.

    What people want can be influenced and changed. What we need, is always the same: Power to affect our lives and time to enjoy it.

    --
    "War is God's way of teaching Americans geography." - Ambrose Bierce (1842-1914)
    1. Re:Important!=powerful by softsign · · Score: 2
      See, this is another problem. You have your definition, I have mine. I don't necessarily agree with yours and you have issues with mine.

      If everyone agreed with everybody else, this planet would be boring as hell. =)

      The trouble comes when a group decides that their world-view is the "right" one. There is nothing so arrogant as believing your personal belief system is more valid than someone else's.

      This is why I so dislike these politically correct societal revisionists telling me that "my kind" is responsible for "repressing" group X. Instead of pointing fingers at me and demanding restitution, why don't they do something constructive and help out the underprivileged?

      --

    2. Re:Important!=powerful by softsign · · Score: 2
      Being powerful means being able to influence your own life. That is what makes poor people powerless, because they have very little means of changing their life.

      I would argue that being powerful means being able to influence the lives of others. By this definition, teachers wield a lot of power.

      Lots of people have absolute control over their own lives but can't do a thing to affect others. Would you call them powerful, or empowered?

      Those crackpots who stock up on guns and refuse to pay taxes, what are they called, the Freemen or something? By your definition they are extremely powerful. I argue that they are only minimally powerful in that they can endanger the lives of their neighbours and federal agents.

      OTOH, someone Gandhi and Jesus Christ are extremely powerful, even though they are no longer among us, because they affect people's lives on a daily basis.

      --

  31. Re:Hello?! Did Anybody Read This Sentence? by jjohn · · Score: 1

    Here! Here!

    Wait, is that bad?

    :-)

  32. Re:My own (vicarious) experience... by bridgette · · Score: 2


    This is mostly because of carrer choice. Tech jobs can pay very well. Some people feel that gender pay inequality is bad for society in general - contibuting to the childhood poverty rate and such.

    There are rather more factors involved. Many of which are outside of "employment" issues. One of these is that whilst it is not acceptable for a man to "marry for money" it is acceptable for a woman to do so. (Women demanding husbands and boyfriends earn more than they do undoubtedly contributes to these kind of statistic.) Another factor is that state and charity "welfare" are often not gender neutral in their application.
    Much of this statistical difference could be accounted for by men having to "pay their way" more often than women.

    There are lots of reasons but I believe that the 70% figure only counted people who actually work, so housewives and welfare mothers weren't counted. The statistical analisis concluded that the biggest determing factor in one's pay is one's job choice (No, really?) . There are lot's of other factors but carrer choice was the biggest. Women who don't feel pressure to be head of the household, because their husbands make more money, may choose less demanding positions that don't pay as well. But remember that there are single mothers, single women, women who don't subscribe to the man-as-breadwinner mentality and women who don't end up with a high-earning man. And with the increasing finacial pressure on the middle class (it's well documented that the middle class is shrinking) 2 income households have gone from being an option to being a necessity.

    --
    - bridgette
  33. Re:My own (vicarious) experience... by bridgette · · Score: 2

    One thing that bothered me about that article, is the 'oooh, icky-poo!' attitude of the female people they quoted. IMHO, the woman they quoted can go have and have her stupid non-tech career, and I hope she fails miserably and has a disgusting job while seeing all those icky geeks around her do well. I hate this attitude, and nothing makes me shut down more with regards to helping someone than hearing it.

    The chicklets they quoted were super annoying. Makes me wonder whether most highschoolers are that vapid and grateing or if the reporter went out of his/her way to pick the most inflamatory comments.

    --
    - bridgette
  34. It's not a gender thing... by Rower227 · · Score: 1

    I am a mechanical engineering major, which I consider to be a technical field. I am also female. Although there are not many women in engineering/computer science majors at my university, I think that the imbalance is not due to social pressures.
    As a kid, I was always playing with Legos. I began programming at the age of 5. I have always known that I would have a career in engineering. Despite the fact that neither of my parents have technical careers, I am just the sort of person who enjoys technology and engineering. It's part of who I am. I know a number of other women who have the same abilities and enjoyment of technical subjects. Vice versa, I know males who do not.
    I can see where the socialization argument comes from, that girls are discouraged from technical careers. I would have agreed with that 20 or even 10 years ago. Today, however, I have never been told that I am unable to have a technical career or that I am going to be a bad engineer on the basis of my gender. None of my female classmates have been told that either.
    Essentially, technology is in my blood...engineering is something that I am good at and that I plan to do for a long time...no one can tell me that I can't do it, simply because I'm a girl.

    Katie

    --
    "The future belongs to those who can look at a challenge and see an opportunity."
  35. Re:More grrlgeeks by tofus · · Score: 1

    one word: duh!

  36. Why don't they want to? by nano-second · · Score: 2

    That's exactly the point... but you still don't get it. WHY don't women want to go into these fields and why are they generally less interested in math and science at school?
    I don't think it's because they are "wired differently". I think it's because of unconcious social conditioning. Subtly, our parents and schools have molded our expectations, based on theirs. Most girls, no matter how 'progressive' their parents are, have dolls, and most boys, have action figures. The mode of play encouraged is very different. What does this suggest? Sure, you can brush this off as of no real importance, but these small differences when we are children is what make us into the adults we are and what controls what we want to do. I bet if girls had more of a chance to play with computers when they were young, and if they were not discouraged, there would be more women in technology.
    Note: when I say 'discouraged', I don't mean directly being told they aren't smart or that computers are for boys. I refer to the subtle pressures of their teachers and classmates. (Don't kid yourself, they are certainly there. Despite being in the same classroom, boys and girls often DON'T receive the "same" education. Reliable studies have shown that boys are more likely to get chosen to answer questions, for instance.)
    ---

    --
    I hope you're not pretending to be evil while secretly being good. That would be dishonest.
  37. Re:Computer geeks and normal geeks by GenericBoy · · Score: 1

    normal geeks as in science, math, band, chorus geeks, just like me. :>
    Chris Armstrong

    --

    Chris Armstrong
  38. Another example of America being the whole world by harry_nobody · · Score: 1

    This is a cultural issue.

    Over here in the UK, we have a pretty high proportion of technical women (as opposed to women who train, or simply operate first-line Helpdesk/tech admin type positions). Certainly, it's geeky work - but there are plenty of women who are unafraid of being pointed at and called "geek-chick", provided they're taking home the nice, fat, geeky wage packet at the end of the day. Perhaps the American issue with a low number of technical women has less to do with the perception of "geek" as an unattractive position, and more to do with the slightly old-fashioned middle-class-white-American perception that the men should be the ones who earn the money.

    While working in the US over the last few years, I have noticed that the majority of caucasian women who work in IS tend to be based on the customer-care side of the business (training etc); while there seem to be quite a few asian women in very technical roles (DBAs, cutting code etc).

    This is no derogation of either caucasian or asian women - but perhaps this is a cultural issue where both cultures define "doing well" differently - one seems to be based on traditional western "feminine" standards; and the other is more focussed towards career-based issues, rather than whether one is perceived as "feminine" or not.

    H.

  39. Re:Computers not just for boys? by __aaedhn419 · · Score: 1

    If in reality "Most link self-esteem to technical knowledge, and sometimes the easiest way to elevate yourself is to belittle someone else"

    I am suprised no one has gone postal yet.

    The situation you describe is not healthy. Most people would consider it an honour to pass on their knowledge, especially if they were taught by such a person in the beginning.

    Hmm... perhaps the nature of the common self-exploration of computer knowledge inspires intellectual arrogance?

  40. IT != Geeks by mulch · · Score: 1

    Maybe the problem with getting women into IT is the perception that anyone working in the field has to be a 'geek'? Just because you work with computers, doesn't mean you have to eat sleep and breathe computer (although it helps :).

    It doesn't seem to be computers-as-technology that keeps women away; I think it's presenting computers as-a-life-choice that's the problem.

    --mulch

    --mulch

    --

    --mulch
    The .signifier is the .signified.
  41. Shoot me! by tofus · · Score: 1

    The reason that there are so few geek girls out there, as opposed to geek guys, is actually rather simple: On average, as many girls as guys start their geek carreer. But, then it happens: because geek guys are so very sexy and fertile, the geek girls get pregnant and turn into wetware-hackers (a.k.a. 'mothers'). So that's why we don't see em that often! Wow.

  42. More grrlgeeks by ChrisUK · · Score: 2

    If there was more girl geeks, it'd make for interesting mid-coitus arguments about BSD and Linux.

    1. Re:More grrlgeeks by Alcazar · · Score: 1

      I remember my programming classes being the same way. At my current job i would say only 15 -20% of the employees are women.

    2. Re:More grrlgeeks by Valdrax · · Score: 2

      It's all a question of the sample group. Of course, I go to a college with a 4-to-1 male-to-female ratio. I'm also in Computer Science, a male dominated major. I would honestly have to say that my classes are under 10% female. Sometimes, it's worse, sometimes it's better. Of course, the classes that are better are ones also taken by non-CS majors. For example, my databases class was about 25% women, but it was only about 30% CS majors and the rest were of other majors, mostly management and industrial engineers.

      I also work a co-op job to pay for school. In both companies I've worked for, women filled less than 10% of technical roles. Most women were in accounting, management, sales, and other non-geek roles. The engineering, quality assurance, technical support, and IT deparments were almost completely staffed by men.

      You should check out this gender poll on Slashdot. Note that out of over 20000 respondants, only 5% clicked on female. It's not unsubstanitated. There are far less women in this field than men, much to the dismay of us men. We wish there were more girls interested in this area, but the linked story is probably right. If more women found computers to be an area of interest, many of us might have been less angsty in high school. <grin>

      --
      If it's for-profit but free, you're not the customer -- you're the product (e.g., the Slashdot Beta's "audience").
    3. Re:More grrlgeeks by Rei · · Score: 1

      No girl who wants to be respected on a forum like slashdot would *ever* write this. I doubt it is a girl. How nice... and on an article about why there aren't that many geek girls....

      - Rei

      --
      The yellowcake is a lie.
    4. Re:More grrlgeeks by Rei · · Score: 1

      Excuse me, but I think you underestimate people. I am currently rooming with a girl who won a 5,000$ scholarship from the state for scoring the best on some statewide mathmatics test, and recently scored in the top 200 nationwide on the Putnam (a *very* difficult mathmatics test). She started out as a chemistry major, switched to a math major, and is starting to wish more and more that she switched to CS. I, for one, got her using Linux on her laptop. As for myself, I attend the same private college (Rose-Hulman Institute of Technology, ranked the #1 technical school in the nation last year by... oh, I can't remember which college guide did the study), and have long been a CS geek, since I first programmed in basic in 7th grade and begged my father to get me my first C compiler a year later.

      So, before you start posting again about there being no intellegent women out there, and that its "grade inflation" that causes current women to appear to be smart, close your mouth, before someone else does.

      (read: error exists between keyboard and chair)

      - Rei

      --
      The yellowcake is a lie.
    5. Re:More grrlgeeks by PerpetualSmile · · Score: 1

      I don't know about mid-coitus, but definitely interesting conversation.

      Nothing is more fascinating than a brilliant man, and so many "geeks" are vastly intelligent.

      Perhaps the tequila that I've had this evening is speaking through me... even so, I know that I am but an aspiring geek, with lofty goals regarding the famous BSD and Linux... perhaps one day soon I will be able to converse with at least minimal knowledge regarding the wide world of programming and open source.

      However, for now I will continue in my quest for intellectual higher ground by surveying the beautiful land of slashdot....

      Girl geeks will soon take over the world! (or at least all the most attractive men... you know, the one's who converse with intelligence!!

      -k-


      --

      ~ * ~ * ~ * ~ * ~ * ~ * ~ *
      1984 wasn't just a book..it was a warning --from a post by Lughlamfainn
    6. Re:More grrlgeeks by dgph · · Score: 1

      What does spell checking have to do with good grammar?

    7. Re:More grrlgeeks by oV3Rd0n3 · · Score: 1

      wow...

    8. Re:More grrlgeeks by Dianae · · Score: 1

      My sister, you speak with my words also : ) -K-

    9. Re:More grrlgeeks by larkost · · Score: 1

      They are few between, but can cause fun situations. I was at Apple's WWDC this year, and there was an attractive young woman there in very tight outfits everyday, I think she was from the Czech Republic (the styles were right for that). So she got a lot of looks from the overwhelmingly-male crowds (although I am told this years ratio was much better than last's).

      Well, despite what some people were thinking this lady had a brain, turns out she is one of the best OpenGL game programer's in Europe, and was attending the conference in order to 'rip a new one' for some of the Apple OpenGL Engineers. She apparetly asked one difficult question after another about obscure bugs in the implimentation, both on MacOS 9, and the OpenGL implimentation for MacOS X DP3 that had been out only a coupple of weeks then. I am not saying that either implimentation was bad, she just was at the outer edge of both implimentations, and there to make sure that her games would work on MacOS. It was fun to watch!

      And on another note, it is fun to discuss shell scripting with a girlfriend. One of mine was the one to teach me, I was a freshman in college, and she was a upperclassmen CS/EE double-major who knew/knows her stuff. Never was a foreplay thing... but to each their own...

    10. Re:More grrlgeeks by Tja · · Score: 1

      Quoted from The Geek Code: "... Geeks, unlike the lower lifeforms known as ners, have lives. They have things to do that are in the outside world. Of course, this is usually done with other geeks, but that's not the point. The point is, that geeks are not necessarily the outcasts society often believes they are. The fact is that society isn't kool enough to be included in our activities." -nuff said

    11. Re:More grrlgeeks by mllenerd · · Score: 1

      Hmmm... I generally bill myself (proudly) as a nerd, but I am rather fond of calculus. Just out of curiousity, where is the line drawn between a nerd and a geek? I have my own theories on this, but I'd like to hear some other ones.

      --

      --

      --
      The geeks shall inherit the earth.
    12. Re:More grrlgeeks by jjohn · · Score: 1

      for interesting mid-coitus arguments about BSD and Linux

      mmm. Wouldn't the argument start before sex? Wouldn't that precipitate the make sex later?

      "Can't you understand?! CVSup is the one true package management system!"

      "Bah! RPMs all the way!"

      "You're just like your mother."

      "Sys V is nothing to be ashamed of."

    13. Re:More grrlgeeks by bozojoe · · Score: 1

      Damn why didnt I get this one?

      --
      lick the cancle button (at least thats what our Chinese QA says)
    14. Re:More grrlgeeks by mayar · · Score: 1

      Well, as a girl i can only say that I have never been meet with anything then curiosity from fellow geeks. Its mostly salesmen in computer stores that show their preset mind: Girls couldn't possible know anything about computers. Recently I bought a new CPU-fan. And belive it or not the salesperson called his computer wiz over to make sure I got the right fan. As if I didn't know.. duhh.. I agree with some other guys, computer atracts a certain kind of person not gender.

    15. Re:More grrlgeeks by Frank_D · · Score: 2

      The idea that cyberspace was a "man's world" probably began in the labs where mainframes were developed: male-dominated Tech Colleges. This stereotype was probably dragged into the PC world, and became a self-fulfilling prophecy. History (as usual) refutes the stereotype: While in the U.S. Army, I had guard duty guarding two computer vans -- one ran in a hot and humid environment; the other in a cold, dry environment (you figure out why). Both were manned by male and female techs. The year-1967(!)

    16. Re:More grrlgeeks by Stephen+Samuel · · Score: 2
      Thing to note: sails droids are rarely geeks. Most geeks know that women in the field tend to be above average.

      In my experience, the females who get into comp sci/math in university have generally tended to be near the top of the class. It may be because women, once they get in, are just inately better than guys, but my bet would be that girls in school who are 'just' good at the sciences aren't generally encouraged to take that path unless they're overwhelmingly brilliant.
      (e.g. one friend, in first year pre-med who took an honours calculus course 'for the fun of it' (with her girlfriend). Our math prof convinced her that she didn't REALLY want to be a doctor. She was much happier after she agreed with him. She was also the best student in our class.)

      The lack of encouragement to go into the math-oriented sciences results in a statistical bend to fun stuff that is guy-ish in nature. Unless you have a group that consciously looks to make sure that female interests are taken care of (e.g. female-dominated management), it's pretty easy for the women to feel left out. This is accidental social pressure against females in geekdom.

      From what I've seen, where women have had a real say in the design of social activities, they seem to feel more welcome. In fact, once that happened, they started to bring non-geek women into the fold (this was my experience at U of Alberta).

      BTW: The kinds of stuff it takes to have women feel included isn't all that majour. It's not that guys mind, it's just that we don't think about it.
      `ø,,ø`ø,,ø`ø,,ø`ø

      --
      Free Software: Like love, it grows best when given away.
    17. Re:More grrlgeeks by grammar+nazi · · Score: 1

      Even grammar nazis know that girls don't have horrendous grammar. Please try and show this by spell checking your comments. I won't be specific, I'll just say that you misspelled a lot.

      I will, however, be specific about using the wrong form of met, possibly, and It's, starting a sentence with and, not using necessary commas, ...(the list goes on)

      I'll be honest with you, mayar. If you talk the same way that you write, then I don't blame the salesperson for doubting you.

      --

      Keeping /. free of grammatical errors for ~5 years.
    18. Re:More grrlgeeks by OracleDBA · · Score: 1

      checkout www.calculusgirls.com , good geekgirls there and they are proud of it :)

    19. Re:More grrlgeeks by dadadadigital · · Score: 1

      I'm a girl geek. I work for a High-Definition Computer manufacturer. We designed our own motherboard and BIOS. I do research and development with RedHat Linux, 64M Video cards and XFree86. I went to an SGI Linux Seminar in Austin, Texas. The only other woman there was speaking. ;) We're out here!

      --
      the loudest words are the ones we never say
    20. Re:More grrlgeeks by LinuxWoman · · Score: 1

      Hey, don't know where they're looking for girl geeks, but there are plenty of us. I currently work as a Systems Administrator for a major web hosting company and well over half of the other Sys. Admins. are female like me. Before I moved to take this job, I belonged to a Linux Users Group that was close to half female (and all of us females were programmers or sys admins or serious HTML coders). No girl geeks...maybe whoever wrote that should leave their computer once in a while....

    21. Re:More grrlgeeks by sabine · · Score: 1

      I'm happy to report a positive experience with sales staff, believe it or not. My bf was with me yesterday when I was buying a new internal modem (which I later installed all by my widdle self), and we got talking to one of the salesmen about modems and linux compatibility. He started out by talking to my bf, but when he realized the system was mine, he switched to me and didn't turn a hair. Cool.

    22. Re:More grrlgeeks by Captain_Carnage · · Score: 1

      Well where the hell was that? Inquiring male geeks wanna know... :)
      Check out the OSS linux clustering technology called

    23. Re:More grrlgeeks by Jim+the+Bad · · Score: 1
      My girlfriend had a simular experience, when she mentioned her Linux machine wasn't working right (turned out to be a faulty HDD) whilst in a computer shop.

      The sales droids laughed and told her that "Linux is not for beginners" (assumtion - she is a girl, therefore is new to computers) and to "...get a real OS!" (assumtion - Linux is too complicated for them, so must be way over the head of a mere girl).

      --
      -- And when Justice is gone, there is always... Force. --Laurie Anderson, "Oh Superman"
  43. Re:Whatever happened to beer? by BilldaCat · · Score: 2

    Maybe he's onto something.. if there ARE chicks in CS, I definitely think they should partake of some fine canadian beer.

    --
    BilldaCat
  44. I'd believe them, except that... by Brento · · Score: 4

    it can't be social pressures steering girls away from technology, because frankly, social pressures steer GUYS away from technology too! I mean, really, football is a lot more popular than chess club, and the social pressure is always on in school to perform athletically. It's no different for girls than it is for us guys.

    --
    What's your damage, Heather?
    1. Re:I'd believe them, except that... by toad_007 · · Score: 1

      No not at all... See there is a zero period comp class ( before school ). 8 kids are in that class, only about 2 or 3 know a didly dunk about computers. You are supposed to already have a good aptitude to take this class, which is obviously very low, on my scale at least. Then there is the other guys that can't take the class, or don't want to get up that early. Sorry if I wasn't clear on that. No harm..... Now, these 'half' or so 'computer geeks' i speak of only deserve that name because of their frantic C&C gaming.... Hell, they probably couldn't tell you what I/O means, much less resolve serious hardware issues. Its pathetic, I mean they can't even setup a decent server, they should be using NAT ( since all the damn teachers complain about not being able to use Real Player, streaming that is... ) where they are using some slow proxy server, that I cannot recall the name of. Get this, we have around 300 computers on campus... Well, they can't quite seem how to networkt them all effeciently with CAT 5, so what they did is throw down some fibre optic between wings... Now if this isn't a waste of my parents precious tax money, I do not know what is. Sure, it will be useful in the future.... But not for a LONG time, since it is a very small town....

      --
      "Ignorance is bliss...." Cypher- 'The Matrix'
    2. Re:I'd believe them, except that... by rainbowfyre · · Score: 1

      Hear! Hear! The majority of discrimination against girls in tech occurs in high school. Some girls here are talking about getting lots of respect in college... well that's too late for most of us. I go to a private boarding school in MA. Girls are taught to conform a lot more than guys. If a guy is different, he's an individual. If a girl is different, she's a freak. Most geeks hated high school, but the guys were not being re-educated. THAT's the difference between guy and girl geeks. It takes a girl a lot to get through that. -rainbowfyre

      --
      Vericon is coming!
    3. Re:I'd believe them, except that... by Azure+Khan · · Score: 1

      I have to concur with Nicolas. Your post lacks any sort of cohesive meaning whatsoever.

      --

      --- I'm going sane in a crazy world.
    4. Re:I'd believe them, except that... by Tony-A · · Score: 1

      If you do have a difference in ground potential between wings, like with electrical disturbances closer to one than the other,fiber will save a lot of equipment from being fried.

    5. Re:I'd believe them, except that... by weisserw · · Score: 1

      I always thought that being a homophobe was kinda stupid.

      -W.W.

      --
      "Well it should be obvious to even the most dim-witted individual who holds an advanced degree in hyperbolic topology...
    6. Re:I'd believe them, except that... by timmyd · · Score: 1

      not exactly. our school doesn't have a football team but lots of people do the chess club... well the chess club is a joke...but, still...

    7. Re:I'd believe them, except that... by Simm75 · · Score: 2

      No joke. The sample is *way* too small. And where's the sample from?

      Ugh--where can I get the *real* study? Most studies are pure crap anyway. It amazes me that there are even *published* studies that use bad statistics and 90% rhetoric to get a point across. *Published* studies! My God! Rhetoric doesn't prove anything! Quotes don't prove anything. The quote at the beginning of the article? I can find you *at least* 70 men that would say the same thing.

    8. Re:I'd believe them, except that... by denshi · · Score: 2
      being with tons of other pale looking geeks at 4am is not exactly called being *social*. i mean...come on. do you really expect /. readers to swallow that one ?
      Yes, he expects us to swallow that one. In the same way that staggering home, often with someone who's name you can't remember, at 3 am can be considered *social*. Pull your head out of your ass and remember that different social groups prosecute their social rituals differently.
      personally i see most girls being to scared off/repelled by geeks & technology to really call themselves geeks.
      Geeks love technology, that's one of the pillars of the definition. If you don't love technology, how can you call yourself a geek? There are lots of job opportunities in tech fields where you go home at 5 pm. You are welcome to take them.
    9. Re:I'd believe them, except that... by Cramer · · Score: 1

      Yes, actually, that is being "social". You are interacting with other people. I used to play Marathon with helpdesk on Saturday mornings while running backups. Or set in the helpdesk area and chat with the (often bored) network techs and helpdesk toadies. And we hardly ever talked about work.

      However, you are correct in saying girls avoid most geeks. Geeks speak a different language. And there's the stereotype of geeks not being overly preoccupied with personal hygene -- there are elements of truth to it (eg. I hate to shave.)

      I would have to say girls avoid geeks because they know where our priorities are... I carried a pager for four years. I was sans pager for a total of two weeks in those four years! (I answered a page in the middle of Christmas dinner once.) "I'll be home in an hour" means "I'll be home when I get home."

    10. Re:I'd believe them, except that... by BilldaCat · · Score: 1

      Just to knock down another stereotype, not ALL geeks are uninterested in sports either. I have ESPN on my TV pretty much every time I'm in the house, and I play in a hockey league, and honestly, it's the most fun I've ever had.

      --
      BilldaCat
    11. Re:I'd believe them, except that... by Truth_nz · · Score: 1

      You can be social at the same time while coding at 4 in the morning.
      E.g. assignment/project due - find a lab, or stay at work and gather other geeks who are doing the same thing.

      It actually works out better this way at uni - because when the security guards come around at 1am and you are by yourself, they will attempt to throw you out on suspicion. Get an entire lab full, and they ignore you.

      ~
      There is no religion higher than the Truth

    12. Re:I'd believe them, except that... by Grendel+Drago · · Score: 1

      Hey, I was *on* ESPN! (It was just for half a second in the background while I was playing with my HS band, but still...

      --
      Laws do not persuade just because they threaten. --Seneca
    13. Re:I'd believe them, except that... by Grendel+Drago · · Score: 1

      My first all-night hacking run was inspiring and euphoric (at the end, until sleep deprivation caught up with me at six-thirty), but mostly on a personal level. My lab partner became giggly and incoherent around 3 AM, but before that I had a wonderful sense of teamwork...

      - Grendel Drago

      --
      Laws do not persuade just because they threaten. --Seneca
    14. Re:I'd believe them, except that... by mezzo · · Score: 1

      Well, at my school, I really didn't feel discriminated as a female CS person. My fellow students treat me well, and they ask me for help in their hw, just like I ask them for help. It depends on the environment I guess, but my uni is pretty cool about that. And about those males that are afraid of smart women? Well, they are less interesting then those who aren't afraid :) So just fish from other pools, pass over those frat boys and give me some less popularity-driven man that is not looking for a prize to show off.

      Though, my guy friends still freak out when I frag them in Unreal.

      A happy geek girl.

    15. Re:I'd believe them, except that... by j-pimp · · Score: 1

      While I couldn't think of doing auctual work in a university lab, they are great places to go to read slashdot ans talk with fellow nerds, face to face, well auctualy face adjacent to face with both geek staring at their own monitors. However, social or unsocial, such behavior is seen undesireable by girls because of ("social values" && "peer pressure" && "estrogen"). Now there are exceptions of course, most of which are reading slashdot, but we must allow time and conscience efforts not to pass on these biases to future generations to occur before there can be more women in our proud, but pale ranks. Until then I can only dream of a women who know the true power of the source.

      --
      --- Justin Dearing http://www.justaprogrammer.net/ We're just programmers.
    16. Re:I'd believe them, except that... by Anonymous Coward · · Score: 1

      Football and programming are not mutually exclusive.

    17. Re:I'd believe them, except that... by BigNar · · Score: 1

      I don't know that that's entirely correct. What you say was true, particularly at the HS I went to, where you were expected be both athletic AND academic. But, I think that in greater society, girls are under a greater pressure not to be intelligent. For example, if you're a guy its generally accepted that you're into gadgets, mechanical devices, be it cars or computers. If you also happen to play a sport, then you're really golden. However, it is not "socially acceptable" for girls to be inclined toward anything to do with math or technology. Just for the record, that kind of thinking really pisses me off. "Idiocy...never underestimate the power of stupid people in large groups"

    18. Re:I'd believe them, except that... by MrsG · · Score: 1

      I agree, it has to be something else than geeky guys steering women away from technology... Personally I see that as a kind of shallow cop out. For one thing women are very bright and have the abilities to learn about technology to the point of manipulateing it to her satisfaction. I dont see why any woman wouldnt want to explore that further. It cant be the men because I myself have met some "geek" guys that are down right hotties and besides, who wants a dumb jock? the geeks make all the Money! not that a woman couldnt make her own living from technology, I do. However, It does depress me to see less women finding their way through technology and more women doing typical things like nursing and the likes. I just think that most girls out there are intimidated by the lack of respect women get in the field. Im not saying in all places its like that, but most woman have to work very hard to get the same respect. It's commendable if you ask me.

    19. Re:I'd believe them, except that... by dobes · · Score: 1
      I don't think that technology is the only industry thats short of females. Probably the only sector showing an obvious oversupply is the service industry. Not that I mind... but I think that we are mostly disgruntled about the shortage of grrrl geeks because we are.. well... geeky. Girls are less attracted to pale, skinny (or obese), poorly dressed geeky types; this is a biological bias I think and there's not much we can do about it.

      But really, I dont think we should consider ourselves terribly "special" just because we have a poor male/female ratio.

    20. Re:I'd believe them, except that... by grammar+nazi · · Score: 1
      "hey look people, we have an anti-homophobe here ! Start the witch hunt ! err but that would make us anti-anti homophobes, which is also not PC....."
      That's okay since we're anti-PC.
      --

      Keeping /. free of grammatical errors for ~5 years.
    21. Re:I'd believe them, except that... by selpcmac · · Score: 1
      There is a difference in social pressures experienced by women, at least, I felt different pressures as a girl in school, especially as an extremely bright (my teachers sometimes said brilliant) student:

      I felt pressured to dumb myself down, hide the fact that I had a brain or (and I quote) "Boys might not find me attractive."

      I've had this discussion with other women (about why there aren't more women amonk the ranks of techies and geeks), and we've come to the conclusion that, for a lot of women, it's just too difficult to openly say "Look, I'm NOT stupid! I CAN deal with math and science and tell a hard drive from a floppy drive." Because, really, if you do computer work, right from the get-go you can't play dumb!

      Well, that's my two cents, and I welcome any and all comments. Peace, fellow geeks.

    22. Re:I'd believe them, except that... by nEoN+nOoDlE · · Score: 1

      well, maybe girls are more susceptible to social pressure than guys are.

      --
      Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
    23. Re:I'd believe them, except that... by Anonymous Coward · · Score: 1

      Guys are tougher and more guys can withstand peer pressure and stuff.

    24. Re:I'd believe them, except that... by toad_007 · · Score: 1

      As a highschool sophomore( upcoming year ) I can say with all honesty, that there is DEFINATELY NOT an abundance of 'geek girls'. Much less computer geeks at my school. Total I think there is like 12 computer geeks, about half of that which are morons. At least at my school I do not feel pressured to persue sports ( even though I play football and lift weights winter-spring ), or bombarded by comments associating with my 'geekism'. My friends that know I am an active computer geek does me no harm, if anything they feel a little jealous! However, I do feel as though I cannot be intelligent, the least bit compassionate towards others, or overall active in academic perseedings. People do some mean shit ( me included ) to their peers, its almost a sport. I do feel boxed in with my emotions. People in highschool can't show the least amount of compassion for another person without being ridiculed. It's almost as if us guys are groomed into being emotionally-num drones, whether it be the public, or the crackhead media. Don't even get me started on the word 'humane'! Anyway, thats my rant ( better leave room for someone else! ).

      --
      "Ignorance is bliss...." Cypher- 'The Matrix'
    25. Re:I'd believe them, except that... by spyderbyte23 · · Score: 2
      Well, of course, you'd probably get these kinds of responses out of a majority of high-school age men as well. Anyone who's talking like this isn't going to be staring at a monitor for hours at *any* point in their lives.

      You know, I didn't see a single thing in that article that backed up what they were saying. All they had established was that *these girls* were uninterested in computers as a trade -- for reasons that might just as easily be something a typical pubescent male, concerned with popularity and the opposite sex and such, might say.

      I mean, come on! They interviewed 70 girls. That doesn't strike me as a sample with which I'd like to predict the behavior of all high-school age girls.

      --
      -- Support Ometz le-Serev.
    26. Re:I'd believe them, except that... by Cally · · Score: 2
      How depressing that this gets moderated up to 5, Insightful. Some people could use a course in basic rhetoric and logic, and perhaps some social science as well...

      >it can't be social pressures [...] because social pressures
      >steer GUYS away from technology too!

      Right. And viruses can't be spreading via email on Windows, because Linux has email too !

      > It's no different for girls than it is for us guys.

      Refraining from abuse by a heroic effort... let me just repeat this 'Insightful' phrase again. Take a deep breath, read it through... notice anything ?

      > It's no different for girls than it is for us guys.

      >sniff sniff Anyone here have any actual data or studies on women in technology, or are we just gonna cite anecdotal evidence as gospel, and repeat the "common sense" ideas that we haven't really reassessed since we were 11? Ask a silly question...


      Camaron de la Isla 'When I sing with pleasure, my

      --
      "None are more hopelessly enslaved than those who falsely believe they are free." -- Goethe
  45. female population growth by purefizz · · Score: 2

    We I started University there were very few women engineers, by the time I left (6 years later) there was quite an improvement. I think that support is needed to associations like the Society of Women Engineers, PASAW, and other womens groups. I sure that having male members support is just as key, the females.

    CAD, kicked, good

  46. Finding a geek wife by dashmaul · · Score: 1

    Must be terrible on people looking for a geek wife.

    --
    guvf vf zl fvt
    1. Re:Finding a geek wife by meturner · · Score: 1

      I am not overly concerned with computers, however I am in an engineering major (Chemical engineering) and am in a relationship with a self-pronounced geek. My advice - don't try convincing her to do anything. Let her do what she wants. Maybe you could suggest to her that she may be happy in another line of work, but don't pester her about it. You may only succeed in driving her away from computers. I am always more than happy to put a salesman, professor, etc, in his place when he thinks I don't know what I'm talking about, but please, don't call me a geek. I can leave the house withouth much coaxing, and I can go a week without checking my e-mail.

    2. Re:Finding a geek wife by Erbo · · Score: 2
      Sometimes the problem's not so much "finding a geek wife" as it is "helping your SO find her inner geek."

      Case in point: When my wife first moved in with me around four years ago (and about three and a half years before we finally tied the knot), she knew virtually nothing about computers. Before going to work one day, I sat her down in front of my PC and showed her, "this is how you switch it on, this is how you connect to the Internet, this is how you can send email to me at the office, and--oh yeah--here's where the Web browser is." It didn't take her long to get hooked.

      She continued her explorations, learning about different things the computer could do. I provided her more help as she needed it, showing her how to use the word processor and other applications. Eventually, it got to the point, about a year and a half ago, where I had to buy her her own machine because she and I were starting to fight over mine. The one I bought her was more powerful than mine, and its arrival not only restored domestic tranquility, but enabled her to further expand her knowledge.

      Today, she uses that box for at least several hours every day. She corresponds with family and friends via e-mail, shops online at many different sites, talks with people around the world on ICQ, and listens to music via RealAudio and MP3 (she even rips her own MP3 files, stashing them on a Samba server I have set up). I've added a CD burner to her system recently, and provided her with additional software as she needed it. After she got jealous of my Palm VII, I bought her her own Palm IIIe, and she's rapidly becoming proficient in its use. Her machine runs Windows 98, but she wishes that the people working on WinModem support under Linux would get something working so she can try it out herself. She's not a programmer yet, but she's been thinking of learning something like Visual Basic or Java; she has, however, been learning HTML. She now has no problem understanding computer talk; if we ever go shopping for a notebook for her, I think I'll just let her talk to the sales guy.

      My advice for anyone else contemplating attempting to bring out your SO's inner geek:

      • Don't push her. Let her learn at her own pace.
      • Be ready with help when she needs it, but encourage her to experiment and find the answers herself.
      • Try not to get too upset at her hogging the computer :-).
      • If you have to spend money on getting her her own hardware, that's a good sign.
      • Try to explain why you have the opinions you have about certain subjects (AOL, Microsoft, the RIAA, what have you); not only will this help her understand why you like/hate something so much, but it may help you refine your own advocacy techniques.
      • Your own SO may not be as receptive as my wife was to learning all this stuff. Don't sweat it if she isn't.

      Our experience has been generally positive; it has improved my wife's self-confidence as well as her marketable job skills, and it's also helped our relationship. Here's hoping you have the same good fortune.

      Eric
      --

      --
      Be who you are...and be it in style!
    3. Re:Finding a geek wife by GodOfHellfire · · Score: 1

      here's how i went from microbiologist to unix admin/dba/soon to be ccna: the person who did the "computer stuff" at the lab where i worked quit. the president came down to the lab and asked "does anybody here know anything about computers?" since i had been an irc junkie in college i said "i do". next thing i knew, i was running/troubleshooting a network of 20 macs, 15 pc's running old novell, and 2 sun boxes (all while still being a data analyst and lab tech). i found that i liked the computer stuff more than the lab work. so i put a resume out, got a couple of interviews, and got an offer with an 85% salary increase (i was making $20k as a biologist).

      probably the best decision i have made - even on the bad days with hosed machines and mad users, i love the challenge of making it all work.

      hope this helps some.

      -Stacey

    4. Re:Finding a geek wife by Signal+10 · · Score: 1

      The problem isn't finding a geek wife, but finding her geek husband and getting him out of the way...

      Oh.

      My girlfriend is into genetics pretty hard core... she's a bit of a computerphobe, but I love her anyway... She knows HTML, due to a "networking" class that she accidentally took... Now if only I could slip in some C instruction into some casual conversation... heh... she loves to say "When god created man, he gave him two heads, and only enough blood to power one at a time.", so one day, I had to prove her wrong... wrote up a PHP script (albiet a very basic one) while she sat on my lap, wearing a nice short skirt of hers... I'll leave the details to your imagination...

      On the topic, I know plenty of geek grrls... Know a few that are better coders than me... Unlike most of the geek guys I know, I don't feel a need to compete with them on the grounds that they don't have a Y chromosome... They call geek guys sexist because of this. Understandable. When I ask them for help, I'm suddenly 'hitting on them' (I'm not. I'm not even vaguely interested in them. I've got a beautiful girlfriend that I love more than the world, and I hardly even notice other chicks...) Who's sexist??

      --
      -o Disclaimer: You smell like shit, so does your mother, and I fuck her up the ass every day. o-
    5. Re:Finding a geek wife by llywrch · · Score: 2

      Actually, it's not hard to find a geek wife. You just have to remember, that most of the math-savvy ones end up going into accounting. My wife worked for several years at a woman-run accounting firm. And most bookkeepers I have met have been female.

      Which bring me to another question, since she passed the CPA test (on the first try, nonetheless! A feat worthy of passing the CCIE on the first try), she has decided public accounting is not for her. But she is good with computers & networking (she decided the cable guy didn't do a good job of connecting our television to the cable lines, & tore it apart & redid it herself without looking at any manuals), how do I convince her to work towards a good job in the Computer Industy.

      I have to ask for advice on this point, since I started by working at Stream -- & I wouldn't inflict this on anyone I loved.

      Geoff

      --
      I think I see a trend here. Maybe for them it really would be easier to muzzle the entire internet than to produce p
    6. Re:Finding a geek wife by Stephen+Samuel · · Score: 1
      One place that might have some ideas for you would be UBC SWIFT (Supporting Women in Information Technology) site.

      One thing to note here is that Maria Klawe (head of SWIFT) used to be the head of Computer Science. She did so much for UBC CS that she became a VP of the university, but she reserved the time to continue her research. (i.e. this is one serious geek babe!)

      A quote from one of her Technical Reports just caught my eye:

      But another, equally critical, issue is at stake: by systematically discouraging girls from entering the fields of math and science, a way of approaching those fields that may be qualitatively different from the approach taken by males is also lost. Women are needed as engineers, scientists, and technologists. They are needed for their numbers; they are needed for the fresh outlook they may bring to these professions.

      `ø,,ø`ø,,ø`ø,,ø`ø
      --
      Free Software: Like love, it grows best when given away.
  47. Sucks to be me... by linuxonceleron · · Score: 1
    Damn, well at least most of the girl geeks are asains ;)

    --

    Shine on, you crazy diamond.
    1. Re:Sucks to be me... by acidrain · · Score: 1

      I wish this weren't the case, but 5/6 of the females in my graduating class this year were Asian. Thats as much flamebait as saying there aren't many girls in CS.

      --
      -- http://thegirlorthecar.com funny dating game for guys
    2. Re:Sucks to be me... by Sarkdas · · Score: 1

      Blah go jump in a lake with a rock in your mouth chuckle head. That comment by the dolt HAS to be the STUPIDEST most sexist thing Ive heard Note to self Build HERF gun Test on mr anon's computer. -Sarkdas (I am not a crook! Ok maybe a little one..)

    3. Re:Sucks to be me... by imroy · · Score: 1

      uuum, I'm not sure if this should be flamebait. I have noticed that most of the technical females at my last two employers tended to be of asian origin. Maybe linuxonceleron could have been more tactful in stating this, and spelt better :)

      Maybe it's their (or their parents) culture.

      I'm also thinking it's to do with the images of "beautiful" women in magazines, TV and movies; almost nothing but anglo/european women. I'm sure they feel left out, and don't feel the 'need' to live up to these 'perfect' examples of beauty. So they're more likely to persue (sp?) higher education than HS, and get into more technical fields.

      Doesn't a similar thing happen to use geek guys? We're shunned in school because we're not confident or not popular. So we look to "less popular" activities that we can do away from the people who harass us.

      So us geeks *tend* to be shy "nerdy" guys and asian girls. At least, in my part of the world. YMMV :)

    4. Re:Sucks to be me... by dlparker · · Score: 1

      I can tell that THIS guy has never been intimately involved with and subsequently pissed of a hot, sexy, bright and spirited Asian woman!

    5. Re:Sucks to be me... by wyn · · Score: 1

      Now this has to take the cake for sexist stereo typing. If you really all asian women are bony, and flat chested. I can't help you because you obviously have serious vision problems. As for them all being docile, and easily controlled. If you really think that I know quite a few of them that would happily eat you for lunch. -wyn

  48. Re:Computergrrrl - Amen! by satanic+bunny · · Score: 1

    Amen to this. The real problems happen once a female attempts to have any leverage in a company...from my gf's experience at corps and startups it varies not by the size of the place. (Yep, the grrrls DO get sent off to "Web design!!!)

    But don't blame it all on the "money guys"...at all those places she's been they used to be "the programmers"

    Seems to be that the problem is...a GUY thing.

  49. Being a geekchick myself.... by kpitta · · Score: 1

    I will have to say that it's been a difficult trip for me, especially since I'm one who is hardware inclined, which is, I think, one of the rarest of geekchick types. I've been tearing apart and putting my computer together since high school, and have noticed that when guys discover this, I get one of 2 reactions:

    1. Utter Disbelief.
    2. Instant attraction.

    Serously, even my husband said that he was more attracted to me when he found out that I had my own computer and liked to take the bits out and rearrange them and put them back in.

    The biggest problem I have had in the work environment is the Utter Disbelief category. Most guys I run into refuse to believe that I know anything about computers. It is so frustrating to run into this, time and again. Even where I work now, I'm call center support instead of true IT, because of any number of different excuses, yet I see them hire some completely new male bozo instead of making an in-house hire.
    *sigh* but I guess that's what I have to put up with for not being the accepted gender.


  50. Re:Girls don't watch the Man Show or play Football by bridgette · · Score: 2

    Oh, please...it definitely has its moments. My FEMALE roommate and I were watching it, and they had this bit where they go to the mall and postulate this question to women: "If you could have an operation that made you smarter, but your butt got bigger, would you do it?" To a one, every woman asked said "no". Both my roommate and I found it very funny. Of course, being male, I enjoy the girls on trampolines, and my roommate leaves the room during that bit...

    it wasn't every woman they asked, it was every woman they showed. They probably asked 50 women and edited it down to the 5 funniest. That's how t.v. works. I'm sure if they asked guys the same questions, except making the penis smaller they'd get simmilar results.

    Although, they probably didn't ask any latina or black chicks ... if i could make my butt as big as Jennifer Lopez, I wouldn't need brains :)

    Quoting my MALE hubbie: "I've seen teenagers getting high for the first time not giggle during the man show, I'd rather read Bazooka Joes. "

    --
    - bridgette
  51. Re:Hello?! Reality Check! by satanic+bunny · · Score: 1

    Hear hear. There's more diversity in programming than in plenty of other fields: say, high school teaching ("source" of ideas like these) or newspaper journalism (where these reports get written and published!)

    Don't recall meeting too many women high-up in either....although it's true every company wants a killer babe in marketing

  52. Re:There are two genders, folks, not one. by Eil · · Score: 1


    This is exactly what I was trying to say. Computers are highly technical things, and thats why more males seem to go for them. To suggest the reason there *aren't* more females in computer science fields is because they're afraid to or don't think they can is just nutty.

    I tend to believe (ie- might not be pure fact, but it sure has evidence, IMHO) that most females just plain aren't interested in the IT field. Most don't *want* to become sysadmins or programmers.

    My girlfriend, for example, is a very typical female. She's 20 and trying to attain her degree in Theatre and already has had about a half-dozen requests from some fairly prominent organizations before she even had a degree! Now take me, a fairly typical geek male. for example. I never want to be a Stage Manager because a) it involves a LOT of stress b) The whole theatre community is about 100x more social than I like to be. Ergo, it's nowhere near my line of work.

    Would she make a very good programmer? Of course not. She's been using computers for years now and still is afraid to experiment with her Windows95 Appearance settings.

    Now what point was I trying to make here... kinda went of on a tangent. Anyway, my gf and I have completely different interests which is mostly due to our gender. Neither of us can help it, and no amount of convincing is going to get her to take up something like software development.

  53. Girls Don't Want To Be Geeks? Yeah, right... by Parker12 · · Score: 1

    I am a 15 year old girl who is very interested in computers. I find that girls don't really want to be noticed in this field because it is such a male dominated one. Some of these males even like to intimidate the women so that we do not feel comfortable OR they think that we aren't as knowledgable when it comes to computers. This is not true! Give us a chance! So the next time you come across a girl in your field, don't jump to conclusions! Thank you...

  54. Re:Nature doesn't do binary, monsieur by Eil · · Score: 1


    Well I went specifically out of my way not to sterotype every single person of a specific sex into one group (ie- Every male likes cars). But it is, however, fairly obvious to me that most people of a specific gender tend to exhibit the socially recognized traits of that gender. (ie- Most females have painted their fingernails.)

    I realize that not every male is a computer geek, but anyone can tell that a female computer geek is the exception and not the norm. Which is not to say that I don't think it shouldn't be the norm... I personally don't care one way or another what % of the geek population is a certain gender. Things just are what they are.

  55. Geek and proud of it by marete · · Score: 1
    I happen to be very proud of myself, both for being a woman, and being a geek to the core.
    BEGIN GEEK CODE
    GCS d s:- a- C++ UB+++ P++ L- E W++ N+ o K+ w++ O- M V- PS++(+) PE+(-) Y(++) PGP+(++) t(+) 5 R++ tv(-) b+(+++) DI+ D+++ G++ e++ h r x?
    END GEEK CODE
    --
    "The way NT mounts filesystems is something I'd expect to find in a barnyard or on a stock-breeding farm." -Mike Andrews
  56. Re:uhm.. actually women dominated from the start by __aaedhn419 · · Score: 1

    Must have accidentally slipped their minds... :)

  57. Re:Hello?! Did Anybody Read This Sentence? by 7dragon · · Score: 1

    That was cool man.

  58. How fast can society change? by RollingThunder · · Score: 1

    Much/most of mainstream society has already shifted to eliminate any obvious bias against any one group going into any particular field (yes, I'm sure you can bring up instances where it hasn't but I'm talking in general here). So why do we still have an abscence of women in tech fields, men in nurturing fields, indigenous peoples in college, etc etc etc?

    Personally, I think it comes down to us expecting society as a whole to change too quickly. We can change the concious public statements easily. Funding, sure thing. Obviously racist/sexist application schemes? No problem. Underlying attitudes you learned at the age of three, when times were less enlightened (and you're in your mid twenties)? Err... no.

    Like it or lump it, while your conciousness may say 'There's no difference', your unconcious makes certain assumptions and uses various biases that are so ingrained you don't even realize them any more. Think of the old brain teaser about the boy and his dad in an accident, the boy is hurt and goes to surgery, the dad is in the waiting room, and the surgeon says "I can't operate on htis boy, it's my son", and you're supposed to get caught by not thinking the mother could be a surgeon.

    The same kind of biases get taught very early on. Anyone over 20 right now, maybe even over 10, is probably pretty mired in them. God help anyone over 40 (IE: the execs/management in many firms). They're trying, don't get me wrong, but their basis of reality can't shift that much and their concious will always be at odds with their instincts.

    For something as major as "everyone really IS equal", I'd say you're looking at two, maybe three generations before it will become truly pervasive. By my (non-sociologist) take on it, we're about up to the second generation. Once our kids get into power, the entire thing should be leveled out, and a more natural balance will take effect.

    Hopefully.

  59. Comment removed by account_deleted · · Score: 1

    Comment removed based on user account deletion

  60. Maybe too late, but better than nothing... by Mary+had+a+little+la · · Score: 1
    Typically, all these studies are pieces of shit. Where is the problem? Girls will really come with new way to solve the problem? You are kidding, if it is true, it means there is a gender oriented way to write a printer device driver. This is pure speculation...

    Harder for women than men? You are kidding again, if you want to do something, just do it and stop bashing it's the next door guy faults if you are not what you think you should.

    The problem is with women themselves, the day they will see themselves as human and not a special human, things will really change for them on an individual basis. In the mean time, I don't feel guilty of anything and I will not do something special to make life easier for women than for men.

    Everyone is responsible for his/her ass!

  61. Okay, so I'm some sorta sicko. . .^_^ by Sub+Girl · · Score: 1
    At the risk of having my fellow females beat the crap outta me, I like having the "geek industry" dominated by males.

    Granted, I'm only a lowly HTML programmer/artist with a very small capacity for programming and mathmatical brain functions, but damn! I love being in that little clique of the world where I don't have to put up with cattiness. To me, guys have always been more well-suited to the world of computers. I mean, c'mon! Can you imagine what the world would be like if women ran the industry? No Quakes, no Diablos, and no other bloody, dark, shoot 'em ups! Instead, we'd be plagued with "Barbie's 3D Shoppin' Spree," or, "Twiggy and the 13 inch waistline: Quest for Dexatrim!" or other horrible ventures! *weep*

    I don't buy any of the "it's a gender cap" or, "women aren't encouraged" crap. My parents had me on a computer as soon as they could afford one. (When I was 9 or so.) I have two sisters; neither of them are nearly as interested in computers as me. The prefere boys, shopping, etc. Probably why I don't get along with them too well. ^_~

    Anywho, at the risk of being rambly, I'm tossing in my two cents and being glad that for the most part, I don't hafta put up with a bunch of girls. *ick*

    ~Sub Girl
    "'Cause we're living in a material world, and I am a material girl. . ."

    1. Re:Okay, so I'm some sorta sicko. . .^_^ by PigleT · · Score: 2

      ' I like having the "geek industry" dominated by males. '

      *nod*. What I think is worthwhile pointing out is that these people who say "look everyone, the geek industry isn't 50% male/female, there's something wrong here" really don't know fsck-all. They start from the assumption that what works for members of one sex works for the other and say "all probabilities are 50%". Er....
      What's *wrong* with there being an uneven distribution of skill level, interest, suitability, whatever, between the sexes?
      (Stereotypical caricature alert: I wouldn't "go for" a woman into chopping trees and I would be surprised if all females on the planet "went for" guys who knitted and sew!!)

      ~Tim
      --
      .|` Clouds cross the black moonlight,

      --
      ~Tim
      --
      .|` Clouds cross the black moonlight,
      Rushing on down to the circle of the turn
  62. girls and geeks, ladies and gentlemen. by chtank · · Score: 1

    It's not that girls are turned off by technology, science or math, it's that girls are turned off by geeky guys canstantly hitting on them. This is easy to see when working on IRC. And as a side note, some of us guys are turned off by geeky gals hitting on us, too. HEHE, fewer guys are turned off by geeky gals, than the other way around, though.

    --
    Retired dinosaur, simple user, volunteer, guinea pig
  63. Statistical Sampling... That's why. by Valdrax · · Score: 1

    See this poll for evidence. There's another one from 10/23/99, but it was screwed up a bit that had 10% of respondants claiming to be women.

    Why are all the highly moderated comments written by men? Because the vast majority of all comments here, even in spite of the fact that articles like this seem to draw more women posters than usual, are written by men. It's all statistical sampling.

    --
    If it's for-profit but free, you're not the customer -- you're the product (e.g., the Slashdot Beta's "audience").
  64. Re:GIRLS WANT JUSTICE FOR OSM by Valdrax · · Score: 1

    Oh, hey. I wonder why both links to his site are broken? Could it be because he's full of nonsense? You know, if you're lying, you're guilty of libel.

    Having read some of his posts due to the link someone else provided, you can see that he has posted a long series of utter garbage in 3-5 minute increments. This could easily be categorized as a denial-of-service attack. I hope they honestly are taking him to court, and I hope they clean him out for it. This is a privately-owned forum, and they have every right to bar unwanted people from posting on it and from wasting their server resources. All those aritcles he flooded with nonsense have to be archived in full or manually trimmed. This is an abusive waste of Slashdot's resources, and we don't need his kind here.

    That's what USENET's for, after all.

    --
    If it's for-profit but free, you're not the customer -- you're the product (e.g., the Slashdot Beta's "audience").
  65. Differences in Learning Style by cnj · · Score: 1
    I believe it all has a lot with what parents encourage in their children when they are very young.

    Certainly. The problem is that much of society still has this sexist/romantic view that, when the going gets tough, the men come and save their "weaker" companions . . .

    There have been studies (I personally hate studies, as well as benchmarks) that support the idea that females, in general, learn best in a classroom or other formal setting. The studies show that males, on the other hand, learn best by trial and error (reason we usually don't read the directions?).

    If this were true, it would certainly help explain the discrepancy in the ratio of females to males. The computer industry in general needs people who can relate their lego building skills to solving Real World problems, and not just run to Ken when something more than the normal classroom situation comes about.

    Think about how you first learned to program, use an operating system, or whatever. Chances are you didn't go out and get some stupid yellow covered book (most of the people here not talking about Beer, Grits, and Portman at least).

    --

    --
    Never trust anyone over 90000.
  66. It's social pressure, intimidation, misperception by chickenbird · · Score: 1

    It is because of social pressure that many girls and women do not want to be associated with geekdom in any way.

    One reason people have not mentioned but which I have sometimes seen is the usual "one of the boys" argument -- a woman who is seen as being "one of the boys" because she is a geek is therefore sometimes seen as being a lesbian. This does not make sense and smacks of homophobia, but some people do see it that way. The social pressure to be a "normal" straight woman who has a life and career that are expected of straight women is quite strong.
    Being a lesbian myself, I've seen that there are actually a lot of lesbians who are programmer geeks, but there are also a lot of women in these fields who are straight. There's certainly no direct correlation. I also know a lot of gay man who are geeks. It's true that the computer industry has been historically more gay-friendly than most industries -- some companies had domestic partnership policies as early as the 1970s (Apple for example).
    So that's one extra thing about social pressure.
    As for intimidation, take this scenario -- woman is behind the Help Desk. User walks up. User ignores woman, and says to the off-duty male help desk person who is lounging off to the side "Can you help me?" assuming the woman, because she is a woman, is not even worth bothering to ask. This is especially true if the woman is feminine and pretty -- the users and the other consultants/help desk (guys) often condescend to the lone woman.
    Third, there's the misperception among all people of all genders and sexualities that the computer world is solely a technical domain. This is not true. For example, I worked for eight years in a place where the humanities melded well with computing, creating a beautiful mix -- a rich and rewarding environment in which to work.

  67. Some women have what it takes by felis_panthera · · Score: 2

    Just like some men. The point is, not all men are good with technology and computers and code, and not all women are good with them either. Unfortunately, due to this article and many others like it, we are going to see an influx of women who just want to get into it because they are ticked off that it is "male dominated". What this really means is that we are going to have a whole bunch of new people who really have no natural talent for computers, but are in the industry anyways. For all of us "real" geeks, the ones who got into it for the love of the craft, this means that we are going to be spending the vast majority of our time either training people who really have no basic interest in what we're teaching, or cleaning up the messes made by people who have no skill for computers.

    I know I'm probably sounding like a pretty chauvanistic jerk right now, but the same thing goes for guys who are getting into the industry just because it offers larger salaries. The only reason to get into a technical field is because you love the field and you have a talent for it, not to "balance out the gender gap" or to "make the big bucks".

    That's just my thoughts on the matter.

    --

    The chains are broken
    Loki is free
    Ragnarok is at hand...
    1. Re:Some women have what it takes by seinethinker · · Score: 1

      I somewhat agree with what you are saying, but speaking from truth... you are never going to see it happen where everyone in a particular field are in it because they love it.

      It would be a oompas dream in willy wonka land before societies become devoid of class, payroll, cultural, racial, sexual, economic, and trend boundaries. It isn't going to happen anytime soon. Our system is too dependent on this way of life.

      If this happened it would be like pulling a pacifier out of a baby's mouth. Your looking forward to a long crying session.

      Believe me I would love for the stereotypical and inherent boundaries we have to melt away.

      Wouldn't it be dreamy? Personally, every day I wake up I take red pill...

      --
      Truth like surgery, may hurt, but it cures. - Han Suyin, Chinese Physician and Writer
  68. Re:Girls are more sociable???? by ~MegamanX~ · · Score: 1

    Actually, there are many girls studying math. More than guys, iirc...

    phobos% cat .sig

    --
    phobos% cat .sig
    cat: .sig: No such file or directory
  69. Re:My own (vicarious) experience... by softsign · · Score: 2
    These are all great points, and I must say, it's difficult to argue with them - but for the sake of discussion (and since I like to play the Devil's Advocate) I'll play the cold-hearted right-winger.
    Regardless, your friend shouldn't have to choose between getting a big salary or getting maternity leave.

    Shouldn't have to. But this is the real world. In an environment where everyone "owns" her/his projects (and everyone is over-worked), how do you deal with the loss of a quality employee for six months?

    It's very difficult to transfer all the knowledge, the contacts, the understanding of a project to someone new - particularly if the recipient is already burdened with her/his own work. It's even more difficult to train a temp or a new employee.

    There can be a definite expense to the company to lose an employee on maternity/paternity leave. Legislation or not, it's still an inconvenience at best.

    What is going on is that people are trying to enourage and help women get themselves in better paying positions.

    Touche.

    Ummm, it's called compliance with labor law and I require it of any company I consider working for (and I don't even want to have kids).

    Labour law is one thing. Working environment is another. Is it reasonable to expect in this industry that when you return after six months, that nothing will have changed?

    In that time, customers who used to deal with you directly may have forged new contacts with your co-workers. You may have been passed over for promotion. Projects you were working on may have wrapped up.

    All of these are very possible. They may be unjust, but nobody ever said life is fair. It's definitely a setback.

    As for the boys who want to go but can't afford it, there are grants available for them as well.

    I have a problem with this reasoning. Often these types of grants are very poorly advertised, and the only people who end up getting them are the ones whose parents know about them in the first place - not the parents who work 60 hours a week in some hot kitchen to make ends meet.

    Studies have shown that boys can be very agressive which has a negative affect on girls in school. So the idea of a computer camp for girls sounds kinda cool to me.

    Studies have also shown a predisposition towards different types of "play" in infants - who are very unlikely to have been contaminated by social expectations.

    I don't think it's entirely valid to point to just one study and say "this is conclusive proof". There's no such thing as a conclusive study in psychology. It's virtually impossible to design a study that isn't riddled with confounds. Nobody is really sure how much is nature or nurture... but pretty much everyone agrees by now that most behaviour is a product of both.

    Well, as far as self-serving charitable contibutions go, this would hardly be the worst culprit. But given the choice between spending my free time tutoring girls or tutoring random kids, this might be enough to make me lean towards tutoring girls through a SWE program

    Good for you! I think this is exactly more of what's needed. Positive role models, not legislation. More importantly, active participation for everyone involved, not selective exclusion by gender.

    --

  70. Wrong Reason by FireWoman · · Score: 1

    Speaking from personal experience, I do believe
    that alot of girls do not wish to pursue technological careers, but I do not agree with
    the reason given, that:
    'they are turned off by technical careers that
    they view as full of geeky guys'

    I admit that while I was a highschool student
    ( and immature ), I was indeed turned off by geeky guys, but that did not stop me from getting a degree in computer science and becomming a programmer, that would have been foolish to let
    such a thing stand in my way. In fact, when I got older and more mature I no longer saw geeky guys as geeks, but rather as intelligent human beings, and I ended up marrying one.

    I believe that girls who won't pursue a career
    because they are afraid of being associated with the wrong crowd, or are turned away by the
    'geeky guys' in the field, are weak in general, and probably let their friends and family run their lives in all respects, and probably don't have the determination and self-discipline to
    make it very far in the field anyway.

  71. Re:My own (vicarious) experience... by softsign · · Score: 2
    I have read a wonderful book on this but as I can't remember the name/title/publisher/isbn I probably shouldn't bother to mention it ;-)

    I have a collection of lectures by Ursula Franklin (a retired physicist from the U of Toronto) that sort of addresses what you're talking about. She doesn't go along gender lines though. The book is very dry too. I hope she was a much better speaker.

    But anyways, she does mention a book called "Economic Anthropology" by M.J. Herskovits (NY: Alfred A. Knopf, 1952) that apparently addresses some of the holistic/directed issues.

    For the record, while I wouldn't go so far as to generalize and say women are better, I agree that both approaches are complementary.

    Furthermore, it's just more evidence that men and women aren't the same. Why do we have to deny this? It is such anathema to our society.

    --

  72. Re:This is kinda awkward... by Jim+the+Bad · · Score: 1
    Imagine the scene:

    GeekGrrl: Oh GrammarNazi, the sun shining in your hair makes me feel -- oh, let's quickly go home and make babies!

    GrammarNazi: Don't touch me woman. I shall not be sullied by one who can so casualy split an infinitive.

    --
    -- And when Justice is gone, there is always... Force. --Laurie Anderson, "Oh Superman"
  73. Girls Don't want to be Geeks...Yes we do! by Ninjacam · · Score: 1

    You've gotta be kidding me! Who the heck did they ask, a bunch of guy-crazed teenagers? This "study" they did is totally biased and the results do NOT reflect reality.

    I can't imagine they could have asked any mature females, because if they had they wouldn't have gotten the answers they did I'm sure. It doesn't matter one iota what gender you are as to whether you're drawn into geekdom or not. Some PEOPLE are drawn into computers and some aren't, just the same as any other field. If "girls" don't want to go into the computer field it's just as likely to be due to narrow-mindedness on the part of those around them as opposed to a lack of desire on their part. Those folks probably either live a life of hell or become closet geeks :)

    We have women in pretty much every field of work there is now. It's time to stop proliferating biases against women going into certain fields ("Oh, Susie wouldn't want to be a doctor, that's too HARD for a woman, she should go into nursing instead.")

    Furthermore, there's not much difference (other than gender, of course) between a male geek and a female geek. Both love the challenge of exploring computers and there are even female hackers and crackers out there. I do, however, think that most female geeks try to be non-destructive in their hacking just as females in general seem to try to be less destructive than men. I'm not trying to bash men here, by any means, it just seems like men enjoy blowing things up :)

    And yes, I am female. Not only that, but I am the "alpha geek" of not only my workgroup (comprised of 50% about women) but also of my circle of friends and acquaintances (comprised of about 20% women).

    --
    -- Some people live life in the fast lane. I live life in oncoming traffic.
  74. Re:My own (vicarious) experience... by softsign · · Score: 2
    Well, since there is no evidence that women don't like tech fields due to a genetic difference (and you would probably have a hard time arguing that there is one since there is no real evolutionary advantage to it), then the cause must be social influence.

    That is a very slippery slope you've built yourself there. It has been very well documented that in general men have much better spatial perception than women, while women have superior language ability.

    This is just one of many studies from a quick Google search: from John's Hopkins.

    Also, social trends != discrimination. If you don't want to work in an industry because there's a large proportion of "geeks", I'd suggest that you are the one who is prejudiced and discriminating.

    --

  75. Re:Forgot a comment... by PD · · Score: 2

    You missed the line where I said the whole thing was sarchasm. I was giving you the exact same treatment that you were giving me. And guess what? You didn't like it, did you?

    My little demonstration got you to admit that YOU DON'T KNOW ME.

    How does that crow taste?

    Think before you judge next time.

    Gotta give you credit though - you flamed me with your real name and I respect that. The one other person who flamed me was an anonymous coward as well as a hypocrite.

  76. Re:Gender Imbalance....WTF? by Phillip+Birmingham · · Score: 1

    But it's not like I don't know a hundred girls who had the exact same education as we did, came from the exact same socioeconomic background as us, and simply chose to do other things with their time. Because I do. They went on to become doctors, lawyers, whatever. The thing to notice here is that they were never discouraged from choosing a tech field.

    What, you followed these girls around all the time, you stalker perv?

    A former girlfriend was once told flat out that women couldn't do science. Of course, this was the absolute wrong way to get her to not do something (this was not always a good thing) so she went on to get her PhD in physics.

    I'm not saying that it's the only reason for the disparity, but before you whip "feminazi" out of the ol' Limbaugh Lexicon, consider the possibility that maybe, just maybe, it happens somewhere outside your sharp watch.

    --
    Make me aerodynamic in the evening air
  77. Comment removed by account_deleted · · Score: 1

    Comment removed based on user account deletion

  78. my fiancee is a programmer by robra · · Score: 1

    Actually my wife-to-be codes. She was trained to
    work in a hospital X-Ray lab but she felt she had more potential than that and she applied for a
    training with a major IT firm. (Cap Gemini).
    Now she's a programmer and she actually is a very god one too! Still she couldn;t be called a geek though. She prefers reading novels and going out to coding ;-)

  79. grammar nazi kneejerk response... by grammar+nazi · · Score: 1

    Here's my kneejerk response...

    gender
    1 a : a subclass within a grammatical class (as noun, pronoun, adjective, or verb) of a language that is partly arbitrary but also partly based on distinguishable characteristics (as shape, social rank, manner of existence, or sex) and that determines agreement with and selection of other words or grammatical forms b : membership of a word or a grammatical form in such a subclass c : an inflectional form showing membership in such a subclass
    2 a : SEX b : the behavioral, cultural, or psychological traits typically associated with one sex

    sex (non-intercourse definitions)
    1 : either of the two major forms of individuals that occur in many species and that are distinguished respectively as female or male
    2 : the sum of the structural, functional, and behavioral characteristics of living things that are involved in reproduction by two interacting parents and that distinguish males and females

    --

    Keeping /. free of grammatical errors for ~5 years.
    1. Re:grammar nazi kneejerk response... by dgph · · Score: 1
      In your first sentence, you made the word my a hyperlink to Merriam-Webster's Dictionary. This is wrong. My (refering to you, the grammar nazi) is not a dictionary, so it is incorrect to link the two. A reader seeing the link on my might reasonably expect it to point to, say, your User Info page, not a dictionary.

      The sentence could be better written like this (for example): ``My kneejerk response is to consult a dictionary:''

      Remember, grammar nazi Sir, good grammar doesn't just apply to ordinary text, it applies to hypertext as well.

      The hypergrammar nazi. Keeping /. free of hypergrammatical errors for three minutes.

  80. Why girls don't go for computers, math, science... by JammmGrrl · · Score: 1

    Bravo! This is the first good comment I've read in here.

    This is a topic I've given a lot of thought to. Growing up, I was always into science type things. As a three year old, I studied bugs, and as a 6 year old I could pronouce the work Etymologyist (it's what I wanted to be when I grew up). I loved one little Apple IIe we had at school, and would spend as much time as I could get on it (5 minutes a month or so :) ). I was in an club called Young Astronauts. I wanted a telescope. I read up on physics. In high school I did a science fair project on photons and quantum theory. I was forunate enough to have parents who, while encouraging me to be lady-like (unsuccessfully!), also encouraged my learning. They let me learn about anything I wanted to, took me to science centers, bought me ant farms, and kept the station tuned to PBS.

    I also suffered a great deal for my geekyness. I was once a very outgoing child, until first grade, where through humiliation from both my teacher and my peers, I started to imagine myself as a social lesser, a self-image I continue to battle today, even though I know it's false. It only went down-hill from there, and fortunatly, I choose my brain over what other people thought of me. At any time I could have chosen to shun learning, shun science and math, and re-build an outer-image based on playing with Barbies, talking about guys, and going shopping.

    I think this is what girls tend to do though. None of their friends like computers, or astronomy, or biology. They find that when they do get curious, these behaviors are frowned upon by parents, teachers, and most importantly, their peers. That is who they feel are the most important influence -- their friends, or lack thereof.

    While it's bad for boys, it isn't nearly as bad. Boys can get A's in math, and as long as they don't act or look geeky, it's ok. In fact, one of the most popular guys in my high school was a 4.0 GPA, who took as many math and physics and chemistry classes as he did drama and sports.

    I do think this is a serious problem. I've felt some discrimination in my workplace. I know I make less money than my male co-worker who has fewer responsibilites and fewer skills than I do. Yes, it bothers me. I'm not going to burn my bra or lobby for legal changes, or sue anyone (I'm generally conservative), but I have been wanting to do something about it.

    I've been thinking about starting an organization, or finding an existing one and become very active in it. There are organizations for women in construction, why not computers/technology?

    And one of my main goals would be helping bright young girls find a place to belong, show them that there are other girls and women who like math and science and computers, and encourage them. Show them how much fun learning and discovery can be.

    Just a note to you guys, it has nothing (at least for me) to do with not wanting to work with "geeky guys". For girls, it has more to do with being thought of AS a geek, as BEING a geeky girl. And this has nothing to do with intelligence either, but of social acceptance.

    I think one of the things that makes me the most upset is when I see a girl or woman who has the potential, yet denies it, shakes her head, laughs, and says, "Oh, I could never learn to do that!" Because they're wrong, and they have no idea how much their loosing out on: the ability to think for themselves and grow.

  81. Re: Not so fast by edgarde · · Score: 1

    This isn't relevant to the topic of "Girl Geeks", except for clouding the discussion. Sommers' arguments tend to miss feminist points in a way that looks deliberate to me. Take for instance the that Atlantic Monthly article you linked ...

    "today's girls outshine boys" (Sommers' words in my italics) because they "now outnumber boys in student government, in honor societies, on school newspapers, and in debating clubs". The skills practiced here are mostly social, not deeply technical. Actually so are many examples of girls' behavior illustrated in this article -- irrelevant to the subject of math/science education for girls.

    Boys as a group probably have a different constellation of needs that aren't being met in the school system (as acknowledged not just by Sommers but by Sommer's feminist whipping girl Carol Gilligan). This doesn't disprove or contradict that girls with potential to excel in technical fields are shortchanged, only that boys are probably shortchanged in different ways.

    That Summers chooses to characterize this issue as a "feminist" "War on Boys" strikes me as opportunistic and unnecessary, like she's looking for the big media attention that was given Camille Paglia and Katie Roiphe (as opposed to the academics she criticizes but nobody reads). Even her Atlantic Monthly bio lists "tart essays about feminist disingenuousness" as one of her specialties. Nothing wrong with criticism & honest debunking, but she could address this issue without invoking her pet demon.

    Sommers makes good points in that there are prejudices against boys, and attention needs to be given in schools to how they socialize, and they have special needs that different from girls. And it's obvious that Sommers care about boys a lot. But I'd be a lot more receptive to what she has to say if she didn't spend so much time vilifying feminism in general, and the American Association of University Women's "fishy" research (not my phrase, or even Sommers' come to think of it) in particular.

    Here's a link to an NPR show with Christina Hoff Summers discussing her War Against Boys idea, with RealAudio. The host likes her a lot.
    __________

  82. Re:Gender Imbalance....WTF? by PD · · Score: 2

    You've never laughed when someone said something completely idiotic, when you weren't expecting it?

    You fucking hypocrite.

  83. Re:glass ceiling by JammmGrrl · · Score: 1

    Excuse me, but I have already hit the glass ceiling at my job here. There is a strong good old boys network in management, and they will not take me seriously about anything. I know my stuff. I'm responsible. I do all the work of an IT Manager, but they will not give me that title or pay, and instead we currently have no IT Manager, because no one else is qualified, and the ones they could hire cost too much.

    Now, I don't know if it's because I'm female or not. I have no way of proving it. The management in question are 97% computer illiterate, and don't have any idea what I actually do here. They also don't have any idea what an IT Manager does. And who knows, maybe I really am a terrible worker. But it's not like I don't try, like I don't take responsibility. The more ambition I show, the more boats I rock, and that only sets me back.

    Discrimination in the workplace DOES still occur. If you don't realize that, then it's either because you work for a good company, or because you're a guy.

  84. It's social pressure, not ability... by |0|4 · · Score: 1

    The problem, as I see it, is a social one. In this country, at least, the majority of girls are told - whether outright, or more subtly - that they: 1 - shouldn't learn about computers because they'll never be good at it; 2 - shouldn't use computers because it's not girly/feminine/appropriate for a female-type person to use, whether for social, religious, or other reasons; 3 - shouldn't use computers because it would take their attention away from what should be their priorities, which are marriage and children; 4 - shouldn't learn about computers because it makes them less attractive to guys.

    Before anyone tries to argue these, I have to mention that I, as a geek girl, have been given ALL of those arguments.

    In discussions with my female geek friends,
    I have found that - guess what? - they have also had to go through the same things.

    At every level of school - from elementary, junior high, high school, and even college - girls are discouraged from pursuing anything even remotely geeky. Hell, I once was told by a high school guidance counselor that I should take home ec (rather than pre-calc) because "You're a girl. Girls don't need math. Girls need to know how to cook for their husbands." This was when I told him I wanted to go to college and major in math.

    I have had to fight opposition from teachers, school admin, other students, and even my own family. And once I got through all of that, and got out into the 'real world'... I found that it's not much better sometimes.

    We can look at statistics and argue them for years, but we're not going to see a change until we, as a society, begin to encourage any girls who want to be geeks, rather than suppressing them.

    Just my estrogen-filled $0.02...

    --
    reverend lola
    the titanium sheep
    provider of steel wool
  85. Re:Maybe it's a technology thing? by Pentagram · · Score: 1

    Also, I've come across many geek guys that just haven't grown up - they're still playing computer games at 30. Are you sure that /. is the right forum for you, if you think that playing computer games is immature? :) I can't see that it's any different from watching telly at 30; the only real difference is that computer games are interactive. if anything, I would say computer games require a higher level of maturity to enjoy them than staring passively at a TV prog.

  86. Obviously, all technology was created by males... by Mike1024 · · Score: 2

    Hey,

    I think the reason that most Males pursue IT-related careers is because they love technology, where as most women don't. The big question is, however, *WHY* do we like technology?

    My theory is simple: All technology was sreated with one aim: Women...

    Fire --> Keep warm, whilst seducing women.
    Club --> Threaten and impress women.
    Printing press --> Look at women.
    TV --> Watch women.
    VCR --> Watch more women.
    Internet --> Look at neked women without having to go into embarrasing shops.
    etc...

    It could easily be true, you've got to admit...

    Michael Tandy


    --
    "Goodness me, how unlike the FBI to abuse the trust of the American public." -- The Onion
  87. What about Theater Arts Techies? by Ferox · · Score: 1

    Don't rule out other areas that have geek women. Theater lighting and sound design (College Majors) have quite a few of them.

    I am currently dating a Theater Arts Techie, and she is one of the brightest people I know! I am in the last year of my Electrical Engineering degree, and she picks up on stuff that I explain to her. She amazes my friends/classmates with some of the stuff she picked up from me.

    They all wish they had geek girls!! :-)

    ...Ferox...


    --
    I drive WAY too fast to worry about cholesterol!
  88. I always ask myself!!! by ChocoLux · · Score: 1

    I always hace to ask myself if I really am a geek. My guy friends in Comp. Sci. say I am a geek and how I should be proud to be one like them.

    But others who are not from comp. sci. say I'm not a geek at all, because I have social skills, thought I don't think that a lack of social skills make you a geek, that's more like a nerd.

    And other say I have geek tendencies or geek moments and if I am a geek I am in the larval stage.

    Geeks think that being a geek is cool and that it is more of being someone who has an interest in technical issues and is very good at such thing. But other think a geek is a nerd who has no social skills or only talks to other nerds.

    I must admit I do have geek tendencies that my friends love to point out. But at the same time I really don't want to be associated with the nerdy image most non-geeks think of.

    To be a geek you have to be ascribed by others as well as yourself. So until the day I can comfortably call myself a geek, I guess I'm not one, just a girl with a lot of geek moments.

    --
    This was brought to you by the Sweet 'N Lovely ~ChocoLux~
  89. Nature doesn't do binary, monsieur by INT+21h · · Score: 1

    It's all about continuums, don't think black vs. white and digital, even gray scale is closer to the truth. Just because Your Average Human sorts everything into rigid categories doesn't mean that those categories are for real. Don't mistake the map/model/whatever for the terrain. Aww do I really have to tell you this?!

  90. Re:Gender Imbalance....WTF? by JammmGrrl · · Score: 1

    Dude, for me this has very little to do with feminism or equality. It has to do with anyone who has a brain who doesn't use it because it's not popular. It is less popular for girls than for guys (though guys have the problem too). I don't care if a girl learns, and then chooses to stay home and raise kids. Fine. But don't give me women who think there's no reason to learn. And especially don't give me women who say, "I can't."

    I agree that men and women are wired differently, think differently, and have a different way of looking at things. But I think that this perspective is beneficial in a technical setting. It is more of a social thing than a wiring thing. It's just not "cool" to be geeky. Even less cool to be geeky AND a girl, because at least you have your little group of guy geeks, and when I step into it, I'm the only girl. And sometimes I get flack for that from guy groups just like yours.

    And I would never suggest a change in the laws. The laws are adequate. I'm suggesting a change in social attitudes and perspectives. And it starts with individuals.

    It burns me that you said girls are never discouraged. I read an article in either InternetWeek or NetworkWorld. There were women in there from big companies with horror stories. I thought this stuff didn't go on anymore, but it does. One lady said that just 10 years ago, her high school councilor told her to stop taking math classes, that she needed to major in something more feminine, and math wouldn't help her towards that goal. !!! This was an American High School. This particular girl didn't listen to her councilor, but how many more do??

    Another woman said that none of the men in management would take her seriously, despite being the most qualified. She said in the past, she has explained a problem over the phone to someone, they wouldn't listen to her, then she would hand the phone to a guy in the room, have him repeat exactly what she said, and only THEN would they listen.

    The problem still exists, and it's close-mindedness like yours that keeps it up. I go to LAN parties some weekends. I am THE only girl who goes. I have a hard time fitting in. Sometimes I just wish I was "one of the guys". I want to blend in. Sure, they treat me with respect, but I still feel different. The first couple of weeks I went, guys were telling me how to do things. "Just plug your network cable in there.." I felt like screaming, "I'm a network administrator! I know more about this stuff than you do!" ... It's kinda like Miranda on User Friendly. Though I'm not nearly as good at Quake as she is :)

  91. Re:OOG TELL SECRET TO GETTING CHICKS!!! by digitalmind · · Score: 1

    OOG has no secrets to getting chicks. Oog idea of getting chicks is fucking them when they're passed out from bleeding because of all the times he smacked them with his club.

    Oog reason for smacking chicks over head is because he can't get any otherwise. Reasons? Of course:

    OOG SCREAM LIKE HIS VOICE IS STUCK ON CAPS LOCK! NO WOMAN LIKE!

    Oog not have shower in cave. Oog smell like long dead cave tiger Oog too cowardly to kill. Which is another reason women no like oog. Oog 93 pound coward. When cave woman wake up after being clubbed in the head cave woman beat Oogs ugly ass up.

    Oog have no cave money to take cave woman to fancy restaraunt afterwards oog might actually get some. Oog spent it all on cave beer and cave weed. Oog was so cheap he took all the cave weed and cave beer and gave it to himself so oog ugly stupid cowardly caveman who's stoned with a hangover.

    Other reason cave woman hate oog is oog thinks that smart cave woman who might actually be smarter than oog is automatically labeled "unattractive cave woman"
    smart cavewoman finds psuedo intellectualism of many slashdot posters attractive. So what if slashdot poster is nerd.

    Slashdot poster gets laid more than oog.
    Enough said.



    Kris
    botboy60@hotmail.com
    Nerdnetwork.net

    --



    Kris
    botboy60@hotmail.com
    Nerdnetwork.net
  92. Re:99% of women are WHORES by g33kch1ck · · Score: 1

    I consider myself to be a humanist, not a feminist. I fell in love with my partner, because he's awesome; we had great conversation and great sex. I couldn't care less how much money he makes, and as for his looks, he's beautiful to me...which is all that matters. There are more people like that than not. As for being "freaky, ugly, and strange looking..." Why do you give a shit what people say about you? "Pretty is as pretty does" goes both ways. Maybe people think you're ugly, because you have an ugly heart. I grew up in the South with assholes like you running amok and in droves. You want to believe we're all feminist lesbian whores, but the truth is that you're simply inadequate as a person, much less a man.

  93. Again, another geek-chick... by inner+lemming · · Score: 1

    Honestly, I don't know where the people that did that study were researching, or who they were questioning. I think if girls have a choice of: getting ahead in the world through intelligence and knowledge of computer skills; (let's bring up that 5-1 ratio again) always having a date; talking to guys who share similar interests and having INTELLIGENT conversations; relying on themselves instead of tech support or slimy salesmen; and generally making themselves less helpless, the smart thing to do would be to be a geek. but haven't the geeks always known that?

  94. girls turned off because of geeks by rgokey · · Score: 1

    I personally have never met a girl turned off for that reason. I have because the science bored them.

  95. Re:Gender Imbalance....WTF? by kubalaa · · Score: 1
    most females ... do not like technical fields. Frankly the crap about gender imbalance to access computers is a load of bull

    I might agree with this if "technical fields" wasn't such a ridiculously broad term. It's like saying guys can't grasp "liberal arts." I will agree completely that men and women are different, even when it comes to the ability to solve certain problems or work in certain jobs. But the kind of thinking which is encompassed by "technical fields" is just basic intelligence coupled with an interest in the way things work.

    An analogy to writing (i.e. a book) is in order. On one hand you have Tom Clancy and Isaac Asimov, on the other Nora Ephram, and while most people can agree they're all good writers, but the subjects they approach and the way they approach them vary widely. Computers are so flexible that they can and will accommodate the perspectives both (all?) genders bring.

    Perhaps the reason there are so few women in technical fields is that even what a technical field is has been defined almost entirely by men before now. There is more to be done with computers than database tuning or meticulous coding.

    --

    "If you look 'round the table and can't tell who the sucker is, it's you." -- Quiz Show

  96. (Sorry I'm late...) by The+Queen · · Score: 1

    Okay let's throw this into your mix...
    My folks thought I was going to be a boy. My room was not pink, and growing up I had equal numbers of Barbies and Star Wars, Strawberry Shortcake and He-Man, jump ropes and speak&math. All through school I was different, smarter in some ways, but mostly oblivious to the whole cheerleading/prom queen/homecoming girlie crap. I was in show choir and drama, and the NHS. Now I am the web department for an ad agency (no typo, I'm the whole dept.) and all my friends are geeky guys. I was never pushed to be anything but successful. My little sister played sports, where I hated them, but now she's the prissy jewelry whore with no future and I'm the computer geek Sugar Mama.
    Not sure where I was going with that... I guess what I'm trying to say is that I agree with what you said about how kids play affecting their abilities and choices later in life...just maybe not exactly how you think it does.

    The Divine Creatrix in a Mortal Shell that stays Crunchy in Milk

    --

    The House Between - Original Sci-Fi Series
    1. Re:(Sorry I'm late...) by Hard_Code · · Score: 2

      I know, it's really a shame. Some of the coolest people are really the most colorful. Hawaiian shirts, crushed velvet hats, whatever. I get a big kick out of that stuff. Actually I have a couple of nice Indonesian batik shirts with designs on them that would probably be considered "effeminate". Funny how only the US is so screwed up and uptight about that stuff.

      --

      It's 10 PM. Do you know if you're un-American?
    2. Re:(Sorry I'm late...) by Hard_Code · · Score: 2

      Well it's good to hear something like this. I've sort of been of the opinion that it is BOTH hardwiring AND social pressure. But it's impossible to know until you try to remove one or the other influence. I wonder if in absence of social pressure would a female still in general choose traditionally "female" careers (proving that there is at least a little "hardwiring"). It would also be interesting to see what would happen to a male if given the same type of social pressure (teach him how to cook and take care of children, etc.). But in that case we'd probably be ending up calling him a panzy or wussy. There is definately a lot of social pressure on males. Just witness the rising trend in male body dismorphia disorder, previously pretty much only occuring in females. If there actually is any "right" way to be, neither males nor females in this country have really attained it. I guess it all goes back to being a "well balanced" person. A guy who doesn't feel his masculinity threatened if he has to take care of the children, or put on an aprin and bake some cookies, and a women who doesn't feel her femininity threatened if she plays rugby or works in a traditionally "male" field.

      --

      It's 10 PM. Do you know if you're un-American?
    3. Re:(Sorry I'm late...) by darkleha · · Score: 1

      Better late then never.. I've been too busy to post as well, and I feel a bit of guilt over it, but nothing to strong. =b

      I have to agree with a lot of what you said about growing up.. toys and all. I've gone through the "girlie" phase, and the "tomboy" phase, and every other "phase" that a girl can go through.. almost as if it was expected of me.

      When I finally got into computers 8years ago, it was strictly to do my job of processing court documents and writing letters to our clients. It wasn't until I met a geek that I was even introduced to the whole idea of doing something other then work with a computer. I was top of my class in math and english all through school, and I just never thought of pursuing those subects outside of the daily humdrum of school. Now, 7 years after meeting a geek, I am addicted to my computer, and people sometimes mistake me for a man if I can't prove that I am actually lacking a penis. In my circle of close friends, I know more females that are "geeks", then males. That isn't to say that I don't know more men that work in the computer field, but of the truly interesting folks, I know quite a few women who work in the computer field. What the article fails to mention, is that not every woman that is interested in the field goes to a 4yr college and gets a degree. My best friend is a great example of someone who actually fought not to be in computers, and now shes been sucked in, and is a network admin for a huge company in the silicon valley. She has no degree, she just buys books and reads, and experiments and teachs herself.

      They may say that only 30% or 14% or whatever are graduating, but that doesn't mean that there aren't people out there that can handle the load of information that is required to be in the computer field.. it just means that there is a ton of us female types that don't think you have to know how to program a calculator in C++ in order to be a good programmer, or net admin, or sys admin or whatever they can forsee conquering in their futures.. me included.

      - DL

      --
      . o O ( Those Voices in my Head Won't Shut Up ) O o .
    4. Re:(Sorry I'm late...) by Kintanon · · Score: 1

      A guy who doesn't feel his masculinity threatened if he has to take care of the children, or put on an aprin and bake some cookies, and a women who doesn't feel her femininity threatened if she plays rugby or works in a traditionally "male" field.


      A fun way to mess with a guys mind is to see what colors they are willing to wear in public. A guy who is REALLY REALLY insecure will refuse to wear anything that isn't dark blue, black, brown or Red. With the possiblity of dark green. A guy who is secure will wear any color. I myself wander around in clothes with pink elephants on them (My wife's pajama shirt) occasionally. Of course, my prents thought I was going to be a girl... Hrmmm... >:)

      Kintanon

      --
      Check out JoshJitsu.info for Brazilian Ji
  97. Re:Another reason to DO computer stuff by slakhead · · Score: 1

    Exactly!

  98. From a woman's point of view by Tanith · · Score: 1

    There may be something to the gender bias after all, something that goes beyond social roles and expectations. At least for me, the stereotypes have a painful amount of truth in them.

    For starters, I'm not stupid. My idea of really fun recreational reading ranges from books about how (biological) viruses work to studies of artificial intelligence, the biochemistry and evolution of venom and toxins and medical case histories of human and animal envenomations. I enjoy and appreciate computers (especially the practical and philosophical benefits of Linux).

    I can also kick a reasonable quantity of butt; my former hobbies have included swordfighting with the SCA and martial arts. Currently I enjoy wrestling alligators and doing unusual things to them in the name of science. I play with venomous snakes professionally (you can see me doing this on an upcoming ep of National Geographic Explorer).

    Social pressures don't concern me; I don't spend a lot of time worrying about clothes, makeup, or conformity. I don't consider myself limited by this society's predefined gender roles in what I'm allowed to do with my life. Obviously. So that isn't a factor.

    But I can't code, and math is hard. I also have a hard time reading maps and solving spatial relationship problems. I can read and retain complex information at a moderately unghodly speed (a geek bf once clocked me at two to three seconds a page), and have always done exceptionally well in tests of vocabulary and language learning. I have written and published.

    As I said, I'm not stupid. But I'm not the same kind of smart as other types of geeks for whom math is second nature and coding a natural language. Out of frustration and disgust for what I used to think was my own stupidity when it came to left-brain tasks, I tried to apply myself to learn these things. I wanted to code. There is so much that is fascinating about computers and getting them to do things for you, and I wanted a part of it.

    The result was a lot of frustration and misery. I learned - slowly - and I hated it. I was not having fun. Finally I went back to my biology textbooks with a sigh of relief. I have to conclude that for whatever reason, I have no talent or aptitude in that direction. I can sit down and solve a math or logic problem with a lot of cursing and muttering, but I don't enjoy it. If hard pressed, I could probably figure out (slowly) how to tinker with some gadget long enough to find the problem or fix it, but I would hate every second of it and it would make my brain hurt. I would rather pay somebody else to do it while I did experiments and wrote up a paper on the learning curve exhibited by members of the Agkistrodon genus. Now that's fun.

    Am I stupid? No. My brain works fine in the academic fields I pursue with enjoyment. My brain does not work fine when I try to apply it to traditionally "male" tasks such as programming, engineering, spatial relationships, math and logic. It falls down on the job and leaves me feeling stupid when I try. I don't like this feeling, but there is nothing I can do about it.

    If I can hypothesize that some of the studies I have read are correct, and I am an absolutely classic example of female brain wiring (language yes, math no, social/behavioral perceptions yes, spatial perceptions no), there is some merit to the stereotype. I completely understand girls who say, "Math is hard," and avoid the tasks they aren't good at. It isn't just social conditioning; it's not wanting to take an unpleasant job you're pretty sure you'll fall down on and look stupid in the process.

    As for dating...I like geeks. Smart men are sexy men, and I would never go out with a man who couldn't hold an intelligent conversation on academic subjects. Unconventional men are also more likely to appreciate and accept my diverse and unconventional interests, and not be threatened by my vocabulary or academic interests themselves.

    But there is one thing. Sometimes being with a geek makes me feel stupid in comparison when I can't do the same things he can do. I don't like that much, but I can live with it if I remind myself that we have different skills and a different set of smarts. I wonder if women who don't like geeks simply don't like to feel stupid, and compensate by scorning men who are "too intellectual"?

    I really don't know. I don't think I'll ever have a lot of insight as to what goes on in the mind of a typical airhead gal or a typical jock guy, and I'm not sure I really want to. I do know the frustration I feel when I attempt a task that my brain doesn't seem to be wired for, and I can guess how someone else with less confidence and more social conditioning might act out their frustration if they felt the same way. Possibly the result would be much like what you are seeing as stereotypical female behavior.

    A sample of one is insufficient to draw any meaningful conclusions from, of course, but I know how it feels from the inside, and I know what I believe on the subject. So what do you think?

    Regards,

    Tanith
    pleasure at netcom dot com
    http://venom.herpkeepers.com

  99. NEWS ITEM: Male Career Under-Representation by Wintermancer · · Score: 2
    Hooters Media, c. 2000
    "We bring you the bust, re, best in news!"

    NEW YAWK, NEW YAWK:
    Government officials reported that men are not entering into certain career paths. Statistics show that men, regardless of government sponsored initiatives, are not entering into certain gender dominated career paths.

    "It's staggering. The female-to-male ratio in certain areas of health care are almost 100-to-1. All areas of nursing are suffering from an acute shortage of male representation." Other sectors also affected are stay-at-home parenting, geriatric care and child care facilities.

    "Our survey data was gathered from secondary school male students. Some of the responses to why they would not choose a career in these traditionally female-dominated areas ranged from, 'There's no math involved. It's all touchy-feely,' 'I don't want to be labeled a homosexual' and 'All the cool jobs are in technology and aerospace. Besides, who wants to be surrounded by emotional chicks all day?'"

    Government officials are at a loss on how to correct this imbalance.
  100. Hrrm.. by prettyhate · · Score: 1

    Pah! to that report. I'm a happily geeky girl who reads userfriendly and slashdot at least once a day, and is planning to study Computer Science at Uni with hope to be an evil Sysadmin at the end of it.

    --
    No sig and proud of it. fnord.

  101. Re:Computers not just for boys? by Municipa · · Score: 1

    I don't know where you work, but I don't get to see many girls at our office. I'll welcome any! But if they really are dumb, I wouldn't put it up with it I guess.

  102. Re:Maybe it's a technology thing? by [Dilbert] · · Score: 1
    I won't start on personal hygiene, because that is something every geek must get together - for the sake of his friends and especially those of the opposite sex. HEY now.

    not all male geeks are dirty, longhaired, bearded tubs of lard...

    I for one actually shower at least once a day, more if i've been working my ass off on like 4 different boxen in rapid succession, thus creating a skanky odor...

    pigeonholes suck. 'nuff said.

    ok and while i'm at it... i'm a single male who lives in a town of old people. being still in college and such, i still reside with my parents, 'scuse me for living. sure, i play computer games. however,

    • i'm still 19
    • i would much rather be out on a date with someone but:
      • it's hard to meet women at my school and
      • it's hard to meet women in my town (which is populated mainly by old people, as i said)

    teen male mentality? we all know an average teen male would tell you to take that & shove it. i prefer to instead ask you to clarify further... maybe some people fit that pigeonhole, but not all do.

    wow, mindless ranting about a subject about which i have almost passionate feelings is extremely gratifying.

    hey grammar nazi, wanna check this for me? i'm too lazy to do it myself, but i feel that aside from the capitalization (or lack thereof) it should be fine and dandy. (yes, i know that is a trite cliché, deal with it.)

    /me wonders if this will get an automatic +1 for length...

    --
    From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
  103. Re:Gender Imbalance....WTF? by Some+Dumbass... · · Score: 1

    Disclaimer: Yes, I am a middle-class white liberal (although I don't really like the terms "liberal" or "conservative").

    You realize, of course, that society "molding" people in a certain direction is no better than "self-righteous people who want to mold the world in their own image", right? I mean, it's one thing to go around being self-righteous, but it's entirely another to be aware of the biases which already exist in society for various reasons (e.g. religious-based prejudices, racism, sexism, or just plain-old inerta) and work to counteract them. Actually, I probably shouldn't say that these are entirely different, since you do have to be a bit self-righteous to be confident enough to stand up to anything, especially a well-entrenched social belief. But still, let's not be blind to the fact that there's an institutionalized form of "molding the world" out there. It's one thing to try to mold the world out of arrogance, but it's another to try to balance out the molding which other people or "society" (i.e. lots and lots of other people) are doing.

  104. Re:Gender Imbalance....WTF? by chialea · · Score: 2

    If women aren't flocking in droves to technical fields, perhaps it is because they don't want to.

    in many cases, they don't. however, in many cases, they don't, because they have been conditioned out of it, or just outright told that they could not do that becasue of a simple accident of gender. I'm not all so old (hell, I haven't even finished my BS yet), and I've been told that more than once. now, I'm not claiming that this is a universal experience, but it seems to be fairly widespread.

    oddly enough, people do hire me quite readily, and I really do resent the implication that certain people have been known to make (not directly to me) that (in general) it's easier to get by in the computer/science/engineering field as a female, becasue standards aren't as high. as you say, the emphasis is on what you produce -- and if it isn't, it should be.

    These fools acts as if thirty years of conscious gender equalization did nothing to level the playing field.

    oh, it did. now jobs aren't listed separately by gender, so these jobs are open to women like me now. women aren't systematically excluded from technical schools. etc.

    what do we see? a dramatic legal change in status. however, there are some things that are slower to change -- specifically people. right now we get a few types:

    1. the throwback -- either older people or people who learned attitudes from them that I am really emabarrassed to hear expressed (example: my step-grandmother said at dinner the other night "well, I don't understand this fuss about women not being paid as much as men. they aren't as competent, and have babies to take care of". it got worse as she tried to backpedal when everyone's jaws dropped)

    2. the over-compensator -- if anyone ever were to give me a chance NOT on my merits as a researcher and a scholar, but instead on my femininity, I would be very, very, very upset. there are people who want to "do a favor". they aren't. truthfully, I've never seen this type in action, but the guy I work for says that they exist -- and that, do what I may, graduate school admissions people have a different standard for female applicants. to them, I have to say that lowered expectations reduce the ability of the objects of your (surely unconscious) contempt to perform as her peers.

    3. balanced people -- the people who don't have a heart attack on a MUD or a BBS when I happen to mention I'm female, specifically, and the ones who don't see me only as one of a few prospective dates in the EECS department -- and who don't get frustrated beyond belief when they find I don't want a date, thank you very much. they expect that I'll do as well or better than they do, since many of the females who make it as far as college in a technical field tend to be many of the most competent people in the department.

    until we have more balanced people -- which will take time -- people who don't have to consciously compensate for any contempt of their own or others, perhaps you should think twice before posting a diatribe of that type. we'll know we have arrived when it simply isn't an issue anymore -- and if you ask women in these professions, you'll find that many of them consider it one.

    Lea

  105. Re:Call me selfish ... (OT) by Municipa · · Score: 1

    If you really work with Perl you would have done this with regular expression substitutions!

  106. bad form to reply to my own post... by chialea · · Score: 1

    but I forgot -- if anyone's interested in discussing this, I'd be more than willing (though there will be several weeks when my email will be unanswered -- but I will do it when I can)]

    Lea

  107. Re:Maybe it's a technology thing? by Spudly · · Score: 1

    My apologies, I should have used an :P or an :), as it was written tongue-in-cheek... but you raise an interesting point - is it inappropriate for 30+ yo males to play computer games? Are they the same as playing sport (eg football)??

    I still play some games, but my attitude towards them has changed alot since I was a young teenager. As i said, I found many guys have not moved on from a teen-male mentality - not sure how else to describe it. I hope you understand what I mean.

    --
    -- "e-idiot: stupidity for the next Millenium."
  108. Re:Gender Imbalance....WTF? by localman · · Score: 1
    Men don't flock towards positions in elder care, nursing or child care yet I don't see articles bemoaning this.

    Excellent observation; I wonder why that's the case. Probably because those types of work are looked down upon by the stereotypical reporter. It seems that there is always an "elite" class that feels bad for poor folks doing these types of lowly things. These lowly things usually form the backbone of society too, so it's especially ironic that they are looked down on by folks who are doing abstract and, more or less, useless stuff like computer programming.

  109. Not just parents... by freakinPsycho · · Score: 1

    Parents aren't the only ones to blame here. There's all kinds of factors at work.
    A friend of mine was taking a psychocology class in which one of her assignments was to go to a toy store and compare male vs. female toys.
    try it sometime, it's really frightening. Walk into the girls section, and what do you see? what are the prevailing colors? what are the toys miniture versions of?
    now check out the boys section. ask the same questions. also note that most of the electronics are in the boys section.
    check out a playground. what are the boys playing at? and how about the girls?
    this stuff is embedded into kids early. from what i've seen, though, someone who chooses to get out of the preconcieved castes has no problems. some of the best people i know with computer are female, but they were certainly ostrasized before they achieved their full fledged geek status.
    i think it's also generally harder for a female geek starting out, both by men and women. but the ones who persevere are definatly a benifit to anyone who is in need of a good geek. in some ways, they've fought harder, they have more a want to be where they are. all geeks have to run a gauntlet, but i see women as having to jump through the fire at the end.
    but as they say, "that which doesn't kill you makes you stronger", and most of the female geeks i've met definatly live up to that.

    damn i wish i knew more female geeks, though. they'd definatly be able to deal with my computer obsession than many of the girlfriends i've had before ;)


    ----------------
    "All the things I really like to do are either immoral, illegal, or fattening."

    --
    "All the things I really like to do are either immoral, illegal, or fattening."
    - Alexandar Woolcot
  110. Re:Miranda and Ki by [Dilbert] · · Score: 1
    And, we tend to have more money (or at least more moneymaking potential - [D]) than the average Joe Six Pack, which is supposed to be attractive (according to the Discovery Channel, because it signals the women that we're more apt to provide for their young).

    BZZZZZZZZT. nope. sorry. Sure, we might be apt to provide for their young... if they actually took the time to think about the whole package

    the problem is that most of the women i find myself interested in (not necessarily code jockeys, but smart & attractive females) don't focus on a man/guy/boy/(insert pronoun here)'s personality and moneymaking potential.

    as per a PhD in psychology's POV (a friend of mine) - at some low-level part of their brain, women are programmed to look for the "buff," jock-like, "what our society deems as `attractive'" kind of males. this rules out (i'm guessing) about 90% of the "geek" field. personally i'm not worried about heart problems or anything, but at 6'3" and about 225lbs i'm not about to go run a marathon.

    now, to get back on to the rest of the reply...

    So, what's up? Why do the women keep flocking to the high-power lawyers (which is just as non-physical, academic a job as programmer), while neglecting us? What the hell is going on?

    easy, my fellow lonely geek.

    the position of "lawyer" (see also "backstabbing ass," "power hungry snake") has been elevated by society. the typical stereotype of a lawyer, that of a really rich, yacht-sailing guy, is considered a good thing for a woman to want.

    consider the stereotype of "geek": unkempt, dirty, fat, caring more about electronics than women.

    sure, neither one is seen in the eyes of society as "a hot guy," but a woman is certainly much more likely to be attracted to the former than the latter. as you said:

    Sure, the occasional one of us is a fat slob or turbo-nerd, but I don't think those subsets are in the majority.

    that's exactly the point. those subsets aren't in the majority, but the stereotype is typically one or both of said subsets.

    the problem is, as things progress, we only become more geeky and better at what we do, and thus, exacerbate our own problem. ohhh, the tragedy of being a single, intelligent, computer-savvy, not-hot-but-not-ugly-(maybe-termed-"cute"), "geek."

    my only hope is that maybe society's eyes will open as *nix becomes "mainstream" and being a geek will be a good thing in EVERYONE's eyes, not just in the eyes of a geek him- (or her-) self.

    hmmm... 80% chance that nobody ever sees this to mod it up... i don't post often, but when i do i have good stuff to say, i just get in on the discussion too friggin' late. :-/

    --
    From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
  111. Fundamentals by SciBoy · · Score: 1
    Well, there should be moderation in everything. All I'm saying is that you can't say "I'm tired of everyone saying we need equality" and claim that everything is hunky dory. There are lots of problems in the world and we do need to identify them before we can rectify them. The problem that the first poster (somewhere back in the lines :) pointed out was that sometimes what is percieved to be a problem in fact is no problem at all.

    Personally I believe that any kind of polarization of any group is a Bad Thing(TM) since it tends to increase certain qualities in that group and decrease others.

    An example would be species that have evolved in a very isolated environment. They tend to be very vournerable to outside intrution, ie introduction of a new species that has evolved under a lot more competition.

    For humanity's, and society's sake we need to be as diverse as possible. We need all kinds of people in all kinds of places.

    The now ever growing "tiredness" of Politically Corectness that we can see everywhere (the evolvement of Southpark being a prime example) is a result of a fundamental law of psychology. It is derived from physics where it goes something like this: "Every action requires an equal and opposite reaction." In psychology the reaction need not be equal or exactly opposite, but its there. Without fail.

    What is best is moderation. Critical thinking is always good. (The law of reactions is there for a reason, because polarization, as I stated before, is a Bad Thing(TM)).

    P.S. I'm just presenting my personal Humble Opinion and Life Philosophy. These are not fundamental truths at all (even if they are presented that way) and should be very critically examined indeed.

    --
    "War is God's way of teaching Americans geography." - Ambrose Bierce (1842-1914)
  112. Girls, Computers - Crap on this thread by NoizAngel · · Score: 2

    All of the attitudes in this thread illustrate why women don't want to be involved in the industry - from patronzing head-patting, to the outright hostile.

    There doesn't have to be a 50/50 split in everything - however, when the discrepancies are startling, they should be examined.

    I don't mind so much, being outnumbered. I'm used to gaming circles, where females are decended upon by geeks desperate to meet a girl that they have something in common with. I don't mind so much because I see it changing, every day. But the crap on this thread scare me equally, 'cause for every girl who's willing to put up with the undercurrents of sexism, there's prolly five that will walk away.

    Take a look at the posts in this thread. How many of them that are moderated up are from women?

    -Noiz



    ---------

    --

    ---------
    I'd kill for a Nobel Peace Prize.
  113. Re:Slashdot as a reflection of the geek community by Commie · · Score: 1
    "The people trolling this story are the same ones that cause females to turn away from technical careers. Even if a female is inclined to technical pursuits, she has a powerful reason not to, when the technical field is filled with sexist, insecure, and socially incoherent people."

    Nooooo kidding.

  114. Man, if I wasnt so GAWDAMN STUDLY I... by dr00 · · Score: 1

    might even agree with that =-) Who say the just cause you're a geek you can excell in amature athletics or be Daddy Smoov on da dance floor. Lost of us are into the martial arts and other such endevors. Its just cause bills scrawny ass gets all the damn press... he gives a bad rep... I mean shit Cmdr Taco and frendz where in Wired... although a bit on the scrawny cyde, I showed the picture to my GF who thought the was a cutie. We just need the public to realize that geeks are no longer the scrawny bill gates type, but the ass kicking, pistol toating, black trench coat wearing, there is no spoon, Neo types =-)

  115. Re:Maybe it's a technology thing? by Spudly · · Score: 1

    My apologies, check out my reply to a previous message here .
    I hadn't anticipated a serious discussion, nor a total refutal of my post, but thanks to all who replied. ;)
    -Spud.

    --
    -- "e-idiot: stupidity for the next Millenium."
  116. Re:Maybe it's a technology thing? by Spudly · · Score: 1

    I was refering to personal hygiene - not personal quarantine. :P I never said all guys were "dirty, longhaired, bearded tubs of lard"...in fact, I'd be prepared to broaden my previous statement - why do some young guys spend so much money on clothes and hair gel, yet somehow forget deoderant/anti-persprant? :P

    With regards to the teen-male mentality, I don't know exactly how to describe it, but it's the competitive-tough-guy-no-emotion-girls-are-just-fo r-dating-and-conversation-is-for-girls-s o-don't-talk-to-me type attitude that i see in alot of young guys, geeks included! Now before you jump down my throat and say "well I'm not like that", remember, I am not talking specifically about you - I'm just callin it as i see it - it's an observation of young Australian males (geeks included). There's always exceptions to the rule.

    I cannot share your frustration with dating. However, I wish you well in your pursuit of the opposite sex.

    -Spud.

    --
    -- "e-idiot: stupidity for the next Millenium."
  117. Did anyone read the article? by greydmiyu · · Score: 1

    Is it just me or is anyone else disturbed by the fact that the most recent cite in that report which was nothing more than a collection of snippets of other studies was nine years old! 1991 was the latest study cited in that report. 1991. Where were you in 1991? I know where I was, working in a comic shop for a $.25 above minimum wage. 1991 Linux' latest version at the end of the year was 0.11! FreeBSD's 0.1 wasn't released until 1992. In short, girls and boys, this report is so out of date it isn't even funny. It completely ignores all advances in this field and in the social view of this field in the past 10 years. Those 10 years also happen to be when the largest advances on social perception of this field took place.

    Yup, the study is invalid from the start yet now we have to deal with the problems it is going to create for years to come.

    --
    -- Grey d'Miyu, not just another pretty color.
    1. Re:Did anyone read the article? by bangpath · · Score: 1

      Fact checking is invaluable. You rule.

      --
      *** Stop trying to be cool. ***
    2. Re:Did anyone read the article? by greydmiyu · · Score: 1

      Nah, I suck. Read this article and another one similar to it and got them confused. :(

      --
      -- Grey d'Miyu, not just another pretty color.
  118. Re:I want to be a geek. by [Dilbert] · · Score: 1
    [eyes glean over]

    [mouth forms into dumbstruck grin]

    [wonders if she's cute]

    i've been thinking this same kind of thing for a long time, but not being female, i've never speculated about it.

    the interesting flip-side of this coin is also that if you're a male and are attempting to be on the geek bandwagon, it is often hard to get on if you still have any other persuits, such as the aforementioned "spend time with friends, talk, do charity work, assist in the rearing of children."

    i wanna be a full fledged (male) geek but it's often hard to fit it around everything else i wanna do - one of those things being social. :P

    [quiet sobs of anguish]

    --
    From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
  119. Re:Who really cares? by [Dilbert] · · Score: 1

    BTW, the reason that most male geeks can't get dates is because you are so non-aggressive that we don't even notice that you like us. Stop sniveling in the corner and ask us out.
    for real? is this really it?

    [revelation hits]

    if this doesn't work i'm coming back and flaming you to a crisp. :-P

    --
    From a motherboard manual, error beep codes: S-L-L-L-SS: Speaker Error
  120. Re:Girls don't watch the Man Show or play Football by orkysoft · · Score: 1
    all computers would crash once a month.

    Well, that would be a big improvement for 99% of office pc's... ;-)

    --

    I suffer from attention surplus disorder.
  121. Who cares? by Refrag · · Score: 1

    As long as they get a job, that's all that matters. Females can be senators or burger-flippers for all I care.

    Refrag

    --
    I have a website. It's about Macs.
  122. Re:Maybe it's a technology thing? by Malduin · · Score: 1

    I kinda got a kick out of the ambition statement by Katy in the original article:

    ``The reason why you see more men doing computer stuff is that girls are more ambitious than that. My parents always say, 'Do something with computers,' because it is stable and stuff, but a lot (of people) don't want to be at a desk from 9 to 5.''


    And then they go on about girls spending just as much time on the computer as guys in this statement:

    "Girls do keep up with boys when it comes to using computers for leisure activities like surfing the Internet and sending e-mail"

    I don't see what's not ambitious about guys and computers. bildstorm's comment was well put. Guys like to tinker. They get ambitious enough to see what makes a computer program work and then that's sparks a semi-competitive interest to want to make a program that does similar work, but make it work better or look better. That's the case with me anyways.

    I'd like to see more girl geeks in this world. I'll stay up until sunrise talking with my guy friends about computers but all my girl friends can't hold a conversation past "yeah, i emailed you." I wanna be able to talk to girls about computers. There's a first time for everything, isn't there?


    --Malduin

  123. Re:Gender Imbalance....WTF? by tahini · · Score: 1

    In a country where women are still triviliased as sex objects, molested in Central Park in broad daylight, barely granted the continuing right to an abortion, denied the right to sue rapists because of "state's jurisdiction" or what have you, how dare you argue that the playing field is level? Can you blame women for turning to fields where they have more support from other women?

    If women choose not to go into technical fields because they're afraid of no support or having their talents ignored or when they were perfectly competent techies, then that's a shame and a loss for all of us. Those choices are not due to wiring, those are due to things we can and should change.

    There is nothing inside our heads that discourages us from going into IT, but there are plenty of mysogynist assholes who do.

  124. Re:Gender Imbalance....WTF? by ghira · · Score: 1

    My mother was an infant school headmistress,
    and said (i) she'd never had an application
    from a man wanting to be an infant school
    teacher and (ii) if she had, she'd have binned
    it.

    --
    -- You've got to get a hat if you want to get ahead.
  125. Re:Slashdot as a reflection of the geek community by Refrag · · Score: 1

    Girls in technical fields don't experience a lot of hardships from my experience. If she has problems with anything all she has to do is ask a guy to help her, and it'll get done.

    Disclaimer: The girl has to be attractive to her victim^H^H^H^H^H^H co-worker.

    Refrag

    --
    I have a website. It's about Macs.
  126. Don't give up... by heidiporn · · Score: 1
    I may not be able to mod you up, but I can give you hope... There are plenty of chicks out there who appreciate geek-men and find them unbelievably attractive and sexy (both mentally and physically). If she doesn't love you for all that you are, she's certainly not good enough for you. Never sell yourself short or deny your geeky nature. Someone, somewhere will be turned on by your qualities. And you may find her in an unexpected place... Just because she doesn't hold a tech job/degree does not necessarily mean she isn't a techie at heart (or another type of geek, for that matter) ...

    And btw... I don't think all chicks are looking for high-powered executives and lawyers, and the ones who are... well, they're not the ones you want anyway... They're too superficial to realize that true, raw intelligence and know-how are exceedingly attractive and alluring. Plus, I've found that dork-guys are much more endearing, sweet, supportive, understanding, and HOT :) than the average member of the guy population... :)

    Another random (but well-intentioned) post brought to you by...
    heidiporn :)

    --

    heidi

  127. Comment removed by account_deleted · · Score: 1

    Comment removed based on user account deletion

  128. Re:some truth to it... by tomknight · · Score: 1
    The interesting question is why is this considered "sad" when other activities which involve just as much dedication/obsession are considered differently

    Okay, very true. The obsessiveness in itself isn't that bad. The problem was the lack of social skills (for relating to people outide their set) many of these guys had. And some of these were that stereotypical CS guy - BO and all the rest. Well, sadly that's the image of CS blokes that people see and it remains is the mind. By which I mean that I admit that there must have been plenty that weren't quite like that, it's just that they aren't the ones I remember.

    Tom.

    --
    Oh arse
  129. Re:I want to be a geek. by Liza · · Score: 1
    IMO, the subject line of this says it all. :)

    Women and girls are socialized to look for peer reinforcement and approval of our decisions in a different way than men and boys are. This isn't a black and white thing as some have suggested: think of it more like 2 parallel, overlapping bell curves. There's more space at the end of the curve marked 'geek' in the male bell curve than the female, even though any given woman may well be geekier than any given man.

    Gender bias is usually, IMO, subconcious & unintentional, but still damn real. When I was in law school, I had my resume reviewed by career services. My previous jobs had been divided between social service/education and (more recently) telcomm policy. I was obviously computer savvy (in the early 1990s when few lawyers were), and still, I was advised to look for family law jobs, not 'tax' or other 'more technical' fields.

    Fortunately, I was too stubborn to listen. :)

    Liza

    --
    These opinions are my own. My employer is not aware of them, does not endorse them, and is not responsible for them.
  130. I'm a Geek Girl and proud of it! by miss_shell · · Score: 1
    I'm a geek and I'm a girl. I know what a mantissa is, and a subnet mask, and a stripe set. I know how to program in a couple of languages. Does that make me a rare species?

    I can appreciate that some weak-minded people may be turned off by the ratio imbalance, but if you are strong-minded like myself, it doesn't make much difference. As long as you can handle the odd piss-take now and then (and they're getting less as time goes on), give as good as you get, and show them that you mean business, there's really no issue. As for the computer access, that's bollocks. My high school had plenty of computers, but for some reason I was the only girl in the class. I guess the others were simply not interested.

    I chose this industry because it interested me, and BECAUSE it was full of guys. Mmmm Male smorgasboard! Most geek guys are not complete wankers, they are sensitive intelligent individuals who are often overlooked because of their social stigma. I am happliy engaged to one. Ok from time to time we find ourselves having 'how many spaces do you indent your code' pillowtalk, but that's half the fun :)

    I actually enjoy competing against the guys and beating them in exams/assignments etc (some of them don't like it much!). I also enjoy wearing sexy stuff to work to give the poor bastards some excitement for the day :) *devilish grin*

  131. Re:NAME ANY COUNTRY WHERE THIS ISN'T TRUE?!?!? by Wolfpack+Commander · · Score: 1
    A 60/40 balance of what? Kernel engineers, software engineers, physicists, mathematicians, computer scientists, sysadmins?

    Or are you talking about desktop publishing, web design, technical/customer support, technical writing, PR?

    Sure, there are a lot of women in certain areas of "tech", and in the tech industry in general, but they tend to be in the easier fields that aren't really all that technical.

    Designng a webpage is not as technical as programming the actual web server itself.

    The AP article was about the lack of women in "creating software", not about using software.

  132. Re:Don't give me that.. by RickHunter · · Score: 1

    I feel I was just about born a geek

    What, you mean you weren't born a geek? You didn't learn C at the tender age of two? Right, out you go. I'm sorry, there's no room for you here. And we'll be keeping that computer and those CD-ROMs, thank you very much.... ;-)

    Note: The amount of serious material in this post is well below government-defined acceptable limits. Therefor, we ask you please not to take offense or flame the poster, as he is obviously not in his right mind. Thank you.


    -RickHunter
  133. Re:Gender Imbalance....WTF? by PD · · Score: 2

    You're awfully judgemental. Do you suppose that I told the *entire* story? OK, OK I left the part out about how we all went down to the cafeteria right after that and had lunch. Shoot me.

    If you assume that I didn't explain what a vector was after we were done chuckling, then I can only feel sorry for you. Perhaps someday you will learn that refraining from judgement before you know all the facts is what makes a mature person.

  134. Re:Geek Girl and proud of it! by JDax · · Score: 2


    Well... &nbsp since everyone is "outing" themselves... hee hee.. might as well join the club.

    Yes, I'm a geek lady and one in a management position as well. &nbsp I think that the times, they are a-changing, and for those who aren't aware (although based on most of the comments here, people ARE aware), alot of those old "keypunch" operators and data-processing clerks (traditionally the "female" IT occupations) have made the leap to higher tech....

    When I was going through college in the late '70s-early '80s, the Computer Science departments were just forming. &nbsp Most of the folks who I knew were interested in a career in computers, were electrical or mechanical engineers who might have taken some programming classes in COBOL or Fortran... &nbsp Otherwise, folks learned on the job.

    Funny how times have changed....&nbsp for *everyone*!

    --
    -- Win2k: "It's not so much that it's only 65,000 bugs, it's just that they stopped at 65,535 to prevent an overflow."
  135. Re:OOG TELL SECRET TO GETTING CHICKS!!! by digitalmind · · Score: 1

    Dude, share the wealth. It's not like I don't need cave weed too.

    I agree about the gender oriented slashdot thing. I usually send them to some of my female friends just to humor them (and don't think they don't get it either. One of them runs a website and is learning C++).

    Main reason for my post was to piss off non-psuedointellectual posters by NOT TYPING EVERYTHING IN CAPS LOCK and giving reason why oog gets no lay. Some women find psuedointellegence sexy (but they are few and far between. Which is why slashdot poster may get laid not often, but more than oog).

    Fat dude on simpsons:
    "I am instating a regulation on reproduction. Reproduction must happen every 7 years. I realize that for some of you this will be much less. For me, however, it will be much much more."



    Kris
    botboy60@hotmail.com
    Nerdnetwork.net

    --



    Kris
    botboy60@hotmail.com
    Nerdnetwork.net
  136. Re: [Making] more grrlgeeks by techwatcher · · Score: 1

    If you're addressing me (techwatcher), I happen to be a woman. A grown woman, it's true, but I do enjoy the company of children of all ages -- as witness my continuing visits to /.!

  137. A book you might enjoy by jabber · · Score: 1

    Brain Sex is a book on the subject of gender differences - focused on the development of mental abilities, gender alignment, physical development and sexual attitudes based on the in utero development of the brain given certain hormonal stimulation. Excellent read.

    --

    -- What you do today will cost you a day of your life.
  138. Re:Forgot a comment... by PD · · Score: 2

    Well, it was an assumption that you used your real name. As long as it wasn't anonymous coward then it's an acceptable primary key.

  139. Amen to THAT! by jabber · · Score: 1

    Computer geeks playing games at 30?
    How is that different from 30 year old non-geeks (we really need a term here, too bad Gentile is taken) watching football or any other sport?
    And how is THAT different from a 30 year old non-male (we DO have a term here, WOMAN) watching a soap opera or a talk show?

    Please - show me a woman who is not into emotionally laden 'Movies of the Week', and I'll show you a fully grown woman?? Come on - branding a geek as a child, just because they play video games rather than stare at the idiot box is wrong.

    And for the record, plenty of retirees play bridge and bingo, a complex and simple game, respectively. Does that make the aged children as well?

    An argument this flawed just blows the whole of the original post out of the water; I'm glad EVERYONE who responded objected to exactly this point. Feh!

    --

    -- What you do today will cost you a day of your life.
  140. Uncle Tom by ckedge · · Score: 1

    (Not directed at author of the parent article, directed at everyone)

    > But once girls find out what I do, I'm suddenly a geek.

    I have, throughout my entire life, regarded the term 'geek' as a highly derogatory four letter word. If you were to do a fast paced word association test with me, and gave me the word 'geek', the word I would spit out would be 'nigger'(*).

    It is based upon the experiences in my life that have taught me my emotional worth and place in society.

    I respect the black community for deciding to fight, instead of roll over and play kitten. They did not "redefine" what nigger meant, they took it for what it was, and attempted to change the source of the problem, not ignore it or accept it. It's with a heavy heart that I've watched as the 'minority' I'm a part of has begun playing the part of Uncle Tom.

    You've re-defined the term geek in your own thoughts, and in your own way you know you should be or are proud of yourself. But for those who have been affected by being labeled 'geeks', I've never seen it translated into carrying oneself with confidence and pride outside of our little ghetto. And in most places it is infrequently translated into respect from those outside of our community.

    You may be 'proud' GEEKS in here, but everyone out there is still thinking 'nigger'.

    -C

    (*) - Note that I'm not claiming we're as deep in the hole as blacks once were. But I feel that my own feelings, their source, and the feelings of those outside our community, must come from a similar part of the human mind and experience.

  141. Re:My own (vicarious) experience... by density · · Score: 1
    WHY DOES THERE HAVE TO BE A 50/50 SPLIT IN EVERYTHING?

    Because people confuse equality with equivalence. It's very common, even among programmers.

  142. Re:Watch what they do, not what they say by Inoshiro · · Score: 2

    Uh-huh..

    Perhaps I need to give you an analogy, as you clearly don't have much real world experience besides being jealous of some person who plays games.

    That man is like a man who goes to the surplus computer store to buy computers. Sure, he may get a lot of 386s (they are only 5$ each!), but they are cheap and slow compared to what you get if you put out the effort. Do you just want to play some quick Doom before deciding to buy another cheap computer, or do you want to work hard to get that nice K7 fully loaded which will last you for years to come and do everything for you?

    Your decision.
    ---

    --
    --
    Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
  143. Re: [Making] more grrlgeeks by techwatcher · · Score: 1

    Before girls can really grow up to become grrlgeeks, they first have to pass through puberty, during which most boys and girls are not wholly comfortable in the presence of the other sex. Boys and girls both like to hang around in same-sex groups, be in same-sex lab teams, etc. It is very hard for boys and girls both to stand against this tacit code; those who do are ridiculed. So boys seldom choose activities in which girls predominate socially, and vice versa.

    About a year ago, a local rag (the New York Times, I think) "investigated" why the rate of girls attending the special public high schools for math/science here had dropped to 37% -- the reason most girls who had passed the admissions test gave for NOT attending was that they didn't want to attend a school in which they wouldn't know anyone else.

    I would like to do an intervention in which I formally mentor (for at least a few months) a small group of girls in the 6th and 7th grades, before they take the admissions test for these schools. (Btw, I have assessed and edited items on this test for the past 3-4 years.) Since I currently work as a consultant and basically set my own hours most of the time, I could easily run such an after-school program. So if any parent of a suitable girl (12-13, bright, interested in science/math, living in NYC) should read this, I would work very cheaply with a suitable group:

    I am proposing an informal afterschool program of 2-3 hours daily , for up to 4 girls, to be billed at a total of $20/hour (not more than $300/week total, which could be split by the participating parents). My goal is to build connections among a peer group of girls who all want to go to the special school together, and can probably pass the test to qualify -- particularly with my tutoring/enrichment programs. We would meet in museums and libraries, as well as at the apartments of the participating girls.

    If the program works as an informal pilot project (i.e., at least some of the girls are admitted and accept transfer to the special schools), we could work to build a larger-scale formal mentoring program, perhaps using local women college or graduate students as paid mentors (work/study?). The program could be called "Brightgrrls" -- and would have its own Web site, of course, to help other grrls build the necessary social links by themselves (using chat), and study with material posted on the 'Net. We could ask sixth grade teachers to identify likely candidates for the formal program; we could also encourage each paying group to include a subsidized low-income candidate.

    I have been thinking about this a lot -- as perhaps you can tell! -- but unless I make contact with a suitable parent (or "networker" in the school system), I can't make much progress implementing such a program!

    Btw, if G. Bush said "Those who do not remember the past are condemned to repeat it," he was quoting someone who said it a lot earlier than he.

  144. Re:Why do IT? by bangpath · · Score: 1

    You are a knob.



    --
    *** Stop trying to be cool. ***
  145. Re:Gender Imbalance....WTF? by chialea · · Score: 2

    I once had a girl friend who used to complain every time I started to talk abut programming with some friends at parties. (We were all programmers). It's not like I was only talking about programming but just because it wasen't something she liked. And I've seen lots of women act that way. You can see them roll their eyes and say, "here they go again"...

    actually, that's a pretty damn good description of what my boyfriend does, since he's a MechE geek... he actually will not go to parties that he knows are all computer geeks (think Eta Kappa Nu banquet -- he hates to dress up, and he hates to talk about programming)

    he's a sweetie, and I can't blame him, becasue the humor gets pretty bad when the EECS geeks get together!

    Lea

  146. Re:WTF is "props"? by Grendel+Drago · · Score: 1

    Props. Respect, 'ups'. Shorthand for 'Hey, that was worthy of props!', in a self-referential sense.

    -grendel drago

    --
    Laws do not persuade just because they threaten. --Seneca
  147. Silicon North: Geek Gal Metropolis by Tomin8tor · · Score: 1

    Apparently Ottawa is the haven for many so called geek gals. In the companies I've worked at, 15-20% of the staff have been very competent geek gals. I'd go so far as to say they combined the best of the technical and non technical (interpersonal) skillsets. As it turns out, today in high tech, geeks (as in people who have to live in closets, get fed through slots, and live to code) are more rare. In a world where the coder is being replaced by the designer, team interactions are becoming even more vital and many women work very well in teams, something a lot of guys have to learn to do. But as it turns out, information technology and computer engineering professionals (regardless of sex/gender) are learning that the soft skills are what makes the industry (especially consulting or contract software development) work and are what translates into those $$$. I'm quite happy to say I've met some awesome gals in high tech - smart, pretty, good in teams, and technically competent. And most of the guys I've worked with have been very happy to see them there, very respectful of their contributions, and more than happy to make a place for them. There are still a few dinosaurs with age-old bias and patriarchal natures, but quite frankly, these beasts will be dead and gone in another decade. For now, gals still run across the occaisional sexist obstruction in the heirarchy. But from what I've seen, most of them are more than capable of dealing well with any such temporary problem. Some have observed there aren't a lot of women CEOs... I say "wait for it". The day is coming. I don't know if we'll ever have a 50-50 balance, because many women want families too and rising to CEO ranks takes time and focus that often precludes that, but things are improving. And any gal that wants to meet nice guys, work in a field that harnesses creativity and where brute strength and testosterone aren't an asset, and who wants to make a good wage, give serious thought to some branch of the computer field. The hours are sometimes long, the commitment sometimes high, but the payoffs are large both in terms of $$$ and satisfaction of having built something and exerted creativity and imagination. Thomas. -- Aut Augere Au Mori! :)

    --
    Pleasure in the job puts perfection in the work.
    There was never a genius without a tincture of madness.
    Aris
  148. I credit my parents! by chart · · Score: 1

    >I accuse my parents...

    I credit mine! I never heard messages like "girls can't do math" or "girls can't do computers". When I said I wanted to be a mathematician when I grew up, my parents bought be books about how to do it.

    When I was 11 or 12, my father taught me how to use the Wyse terminal in the basement to dial up to his office on the acoustic coupler modem, log in, and play adventure and hunt the wumpus. We got a Commodore 64 when they first came out, and Dad taught me how to write programs in basic.

    Despite the anecdotal arguments here in this discussion (data is not the plural of anecdote!), there *is* a gender difference in how children are turned away from being geeks. Yes, boys often get beat up for joining the chess club. But they are not bombarded with messages like, "boys won't like you if you're too smart," the way girls are. There is a clear preference for athletics over brains in our school culture, but there is still room for boys to think they'll attract some girls by being the smartest rather than the strongest. However, study after study has shown that girls crash and burn in middle school / junior high. They match the boys score for score in math and science until they get old enough to start thinking about wearing make-up, and then their math and science scores plummet. (And boy, I don't even want to get started on how challenging it is for the kids who are pubescent, geeky, and gay.)

    --
    Cara Hart chart@eNOSPAMfurn.com Systems Administrator eFurn.com, LLC. and ARITEK Systems, Inc.
  149. Girls don't want to be geeks by pompousjerk · · Score: 1
    I am a geeky guy, and I took an "Advanced Web page design" class. (I didn't expand my knowledge any, but that is another story.)

    There was only one girl in the class. Partly because all the chicks at my school are stupid, partly because they don't want to be seen in that class. It is embarrassing (or frustrating for their feeble little minds) for the girls at my school to be in there.

    Another point: if someone argues that there are a lot of girl geeks, then why do all those guys have to sit around creating Lara Croft?

    Geeky girls, I think, are stuck. They don't want to enter a predominantly male field, or they don't like what other people will think about them.

    I could be totally off target, too.

    http://yottys.homestead.com

  150. Re:Watch what they do, not what they say by Nicolas+MONNET · · Score: 1

    What are you trying to tell me? That someone who is gifted enough to fuck beautiful women could NOT have a plain nice girl? You're wrong.

  151. Re:some truth to it... by mikael_j · · Score: 1

    The problem was the lack of social skills (for relating to people outide their set) many of these guys had.
    Or maybe others lack the social skills needed to communicate with them.
    Just because their communication skills are different, doesn't mean they aren't as good as everyone elses.

    Mikael Jacobson

    --
    Greylisting is to SMTP as NAT is to IPv4
  152. Re:Maybe it's a technology thing? by kria · · Score: 1
    Hmm, personally, I haven't seen any little kids try to take things apart. Maybe that's because we have to give them absolutely safe toys that can't be taken apart because they'll swallow the pieces and hurt themselves. Ooops, that's a separate problem. :)

    Um, you're right, staring at code CAN be a socially isolated activity. But it's your job, anyway. And it doesn't have to be - most of my projects in college were group projects. We would frequently have all four people (or whatever) huddled around a computer screen trying to debug somebody's code.

    I guess I'll spill my other opinions while I'm here. I am (gasp) yes, another female computer scientist. Yet another voice crying out about this article.

    A-hem. Anyway... I have heard these horror stories of teachers who discouraged female students from technical things, but, frankly, I've never actually seen any.

    Then again, I was already pretty well into geeky things before I got to school - We got our first computer, a TI 99-4/A when I was four. Sure, not much of a computer, but I learned how to make an infinite print loop that said "Look what I can do!" before I went to kindergarten. My teachers always told me I could be whatever I wanted to - including when I wanted to be an archaeologist in elementary school. :)

    In junior high, I attended a summer program at the University of Michigan that the whole point was exposing and encouraging young women to go into science and math.

    Finally, I attended the Rose Hulman Institute of Technology. Most people won't have heard of it, because it's pretty darn small - around 1200 students. Total, not per year. This college teaches just math and science. I was in the first class they admitted women. Pretty scary. But you know what? Every professor supported it, at least the ones I had. They wanted us to be there, and they wanted us to succeed. Heck, they even changed the numbers they usually accepted, just so no guys could complain that they weren't admitted because some woman bumped them out.

    Most of the high GPAs in my class were from the female students. Oh, incidentally, that's what we were called - females. Not old enough to feel right being called "women" or "ladies" and we felt pretty, I don't know, demeaned being called "girls". So we were females and they were guys and no one really cared that we were there except that 1/13th of the male population didn't have to go across town to find a date.

    Okay, that's enough rambling. Sorry about that.

    Kria

    icq: 259828

  153. Re:Maybe it's a technology thing? by TheKAVH · · Score: 1

    I would disagree with your king of the hill mentality. I go to school which only offers Engineering and Sciences. With few exceptions I consider just about everyone a geek. Anyone who stands up and says there smarter than eveyone else quickly gets put to shame. Some of my smartest friends really don't show their "smarts" outside of school work. As far as geeks not growing up I think you are making a gross stereotype. Having gone to an all-male high school I can tell you that the geek population had a higher percentage of mature people than the purely jock population. As far as girls maturing faster I think that's a ignorant statement too. I have seen many a girl get quick vicious about petty things. In my experience is that on average guys resolve agruements more maturely. Sure sometimes guys result to fighting and violence but I think that can be consider to prolonged bitter agruements where people pretend to like each other and just talk about people behind their back. It's not that one gender matures quicker than the other it just that each gender has a tendacy to show maturity in different ways. Your comment on hygenine is quite an insult. Geeks tend to be less superfacil than other types of people but it dosen't make them dirty savages. With little exception all the geeks I know are as clean and hygenic as a normal person. My opinion on why CS is predomitantly male is kinda sexist. I think computer use can be related to testosterone. Computers is an outlet for agression thru computer games. Computers can be outlet for competition. Computers are an outlet for a want of control (don't know if that's a testorone thing). Plus women tend to be more socially oreinted. I found that my social life interfers with my computer life. In conclusion I think the nature of men is more compatable with the nature of computers than the nature of women are to the nature of computers.

  154. Re:Do ya REALLY want a girl just like you? by John_Booty · · Score: 1

    Good response!

    Most chicas can handle it, how about you?

    Oh sure, I can handle it, whether I want/need it or not is another question. I don't think geek girlfriends are bad (they rock!) but I do think that limiting your significant-other search to geeks is bad, and that geek missionaries are extremely bad.

    I also think that all relationships need common ground. And hey, what better common ground is there than Q2DM1, or perhaps Q2DM6 if you're handy with a railgun? :)

    --

    OtakuBooty.com: Smart, funny, sexy nerds.
  155. Re:Focus by TheKAVH · · Score: 1

    I think you are close. My understanding of the situation comes from a show I saw on TV about the sexes. It states that modern behavior differences date back before the dawn of civilizations. The role of men was to go out and hunt for weeks and months at a time. The role of women was to stay home and tend camp and care for kids. Because of this Men developed behavior that was extremly mono-manic; follow the herd and kill some animals. They only worried about two things: survival and hunting . Women and the other hand stay at camp. They have a tendency to be able to focus on many things at once. The camp is also very social compared to the silence of a hunting party. Sure this was 5000 years ago but you must remember that Humans acted this way for close to 2,000,000 years. 2,000,000 greatly outways 5,000. I think there should be more women in the field. With their inherient adaptness with mutli-focus imagine how advanced the field of parallel processing and multi thread would advance. Perhaps the fact that CS is a predomitantly male is severly hurting the field. I'm a strong believer in strength thru diversity. EOC(End of Comment)

  156. Re:Geeks GET Girls, Though. by John_Booty · · Score: 1

    Perhaps you are right about the good geek guys hiding, but I can't find any :(

    If you had your email address listed, your mailbox probably would have been Slashdotted with 20,000 volunteers. Whether or not that's a good thing is an excercise left to the reader's imagination. :)

    --

    OtakuBooty.com: Smart, funny, sexy nerds.
  157. Geek Code by ChristTrekker · · Score: 1

    The Geek Code allows for all kinds of geeks.

  158. Let's go! by grammar+nazi · · Score: 1
    Would you care to step outside? I beat up dolts like you without breaking into a sweat.

    ;-)

    --

    Keeping /. free of grammatical errors for ~5 years.
  159. OT to techwatcher's BTW by tinyuan · · Score: 1

    ...In that case, it looks as though George Bush did in fact forget the past and repeated it...

  160. Dunno about your experience... by NulDevice · · Score: 1

    ...but all the best sysadmins I know are either 1) women or b) gay men.

    I don't know the significance of this, but it's an interesting observation nonetheless.


    ----

    --

    ----
    "I used to listen to Null Device before they sold out."

  161. Geek Girls and Culture by Iffy+Bonzoolie · · Score: 1

    I just graduated from Berkeley, and there were a lot of females in my computer classes. The thing was, there were very few American Native Girls in my classes. I don't mean the people that lived in America before stole their land and raped their families - I don't even mean people that are not WASPs. I mean people that were just born here. 2-nd generation immigrants on up. All the girls were from Russia, Taiwan, Vietnam, etc... Only a few that I could tell were born here. And, even then, I remember only a couple girls in any of my classes whose families were likely to have been here for several generations.

    So, what does this mean? I have no idea. Just thought I'd mention it. Perhaps it's purely american culture that discourages Geek Girls.

    --
    Run a pencil-and-paper RPG campaign with your far-off friends: Gametable!
  162. Re:I think you miss the point . . . by Kintanon · · Score: 2

    No one said anything about pushing girls into tech careers. The whole point of the gender (or racial or age or whatever) divide is that assuming people are in fact equal, why is there this huge difference in the percentage of men in tech fields vs women in tech files? Since we assume that people are equal, we expect the percentages to be the same, and if they aren't, then we say, something is "wrong."

    Ok, I just have to say this here. I am SOOO Tired of everyone screaming about how everyone is equal. Everyone is NOT EQUAL! NOT! People are Equal in the Eyes of the Law. That does not mean that if JoeBob the weightlifter can bench 415 then I can bench 415, It doesn't mean that if I can strip down a computer to its component parts and then reconstruct it that JoeBob will be able to. We all have different skills, different abilities. Those skills and abilities aren't always divided along racial or gender lines but sometimes they are. No one is Equal to me, I am not Equal to anyone else. We are all viewed as equal by Law. Which is an ENTIRELY DIFFERENT concept.
    So now that I've got that rant out of the way you can continue your conversation.

    Kintanon

    --
    Check out JoshJitsu.info for Brazilian Ji
  163. Re: Legos... by sillysally · · Score: 1
    I mean, for those of us who code, how is our job different from simply speaking another language?

    It is completely different. Specific parts of the brain are hardwired for language with the result that close to 100% of children have the capability to be mulitlingual at age 5. Yet, a vanishingly small percentage of those children have the ability to do anything close to coding at age 5. Later, when some of them learn to code, they are using parts of the brain with no "code" hardwiring.

    You posed a reasonable [rhetorical] hypothesis, but it doesn't bear up to close scrutiny. I'm pointing it out because it is a good instructive example of how something should not be taken as truth just because it "makes sense". That is an error many people are making in this thread, people who are claiming to be good at math and science, but citing as their evidence a single, uncontrolled, statitistically insignificant piece of anecdotal data. Claim it all you want, but "I know a girl who is a good coder" is not evidence that girls have the same aptitude for coding that boys do. I mean, I know girls who are good basketball players, and while I'm sure that the NBA is looking for the best, I'm equally sure that we will never see women playing professional basketball in anywhere near the numbers as men.

    Here is a better way to think scientifically about the issue than what I've seen in this thread:

    If it is shown quantitatively that women are "as good/apt/likely/wired" as men at computer programming, then societal pressure might be a good place to look for a reason why we haven't seen the same numbers. But otherwise, societal pressure might equally be a rational response to a difference in ability. After all, society should not rationally be pressuring women to try out for men's professional basketball as it would likely result in a waste of time.

    Now, I know that the sentiment here is that it would be great if women were every bit as good as men at programming. It's a sentiment that I share. But I recognize it as a sentiment, not science.

  164. Re:I want to be a geek... wait i *am* one. :) by Kintanon · · Score: 2

    yes there is a long history in the united states of women having the "motherly" role.. while feeling unable to function in other circles of their environment.. hopefully in time less women will be hung up on the stigma of being accepted by the majority

    Maybe when our society stops thinking of child birth as such a wonderful accomplishment that will decline some. But everyone praises these couples that have 8 kids at once even though there is no way 2 people can support 8 kids. People need to realize that there are 6 billion of us, that's enough for now, let's chill out on the breeding for a little while and learn to manage our current population.

    Kintanon

    --
    Check out JoshJitsu.info for Brazilian Ji
  165. Computer geeks and normal geeks by GenericBoy · · Score: 1

    At the high school I go to, there are plenty of "normal" female geeks, but about 99% of them don't even like to *use* computers. Sad.
    Chris Armstrong

    --

    Chris Armstrong
    1. Re:Computer geeks and normal geeks by timmyd · · Score: 1

      what are "normal" female geeks?

      At my school, i don't know any girls that like to use computers. the ones that take the computer classes just do it for the easy credit and for looks on a resume. if only they were easier to find. man, i could be at my computer and do IRC with them. and over that, our school is supposed to be a geek school because we don't have a football team and it is a magnet school. i don't even know guys that play on computer as much as me. _this_ is sad.

    2. Re:Computer geeks and normal geeks by infinite_twilight · · Score: 1

      so what is an abnormal geek then?

      what about people who join the school's trivia team? or make digital video stuffs for fun? or hangs out at school after school to work on the yearbook?

      i am geek of above, and math and science... or perhaps nerd... i do not know.

      ~me
  166. Gender Imbalance....WTF? by Carnage4Life · · Score: 5

    Why is it that people always feel that everything has to fit according to statistics or all is not well. Gender imbalance reminds me a lot of the so called Digital Divide...lots of liberal middle class whites who feel that the poor underclass must be forced to be as technically inclined as they are. Frankly, I'm black and I have lived amongst and known black people all my life, and being computer savvy is not high on the average black person's to-do list. No amount of government intervention is going to turn the average poor black person into some cybersurfing, net junkie simply to balance some statistic chart.

    Back to the topic at hand, why is it that people feel the need to try to push girls into technical careers? From my experience most females including the ones that are good at Math (both my last two girlfriends got A's in Calculus II but one's an English major while the other is studying criminal justice) do not like technical fields. Frankly the crap about gender imbalance to access computers is a load of bull, this isn't the fifties when women couldn't eat without a man supporting them...any woman worth her salt can get a job and buy a PC or go to the library. The last time I checked the neither CompUSA nor BestBuy was discriminating according to sex. Also, the article describes negative social pressure for women to get into technology, but fails to mention that until the Internet boom of a few short years ago there was negative social pressure for men to get into technology as well. I remember being teased and taunted for being a computer geek while in school and even when I grew older I was still looked upon by others with disdain, off course being uninterested in sports probably didn't help this.


    PS: I am very tired of self righteous people who want to mold the world in their own image. Women don't like technical fields, so what? Men don't flock towards positions in elder care, nursing or child care yet I don't see articles bemoaning this.

    1. Re:Gender Imbalance....WTF? by bridgette · · Score: 2

      The last time I checked the neither CompUSA nor BestBuy was discriminating according to sex.


      Actually, last time I bought hardware in person, I went to CompUSA (or was it Future Shop? I forget.) Anyway I was getting a modem and I was trying to find out which were PCI and which were ISA (since they were all behind the counter and I wasn't wearing my glasses). Every time I'd ask a question the sales guy kept answering towards my husband - who wasn't even looking/listening - since he dosen't deal w/ the computer's guts. Finally Chris realized that this dork was trying to talk to him and he said "Don't tell me, I don't know anything about it"

      --
      - bridgette
    2. Re:Gender Imbalance....WTF? by UncleRoger · · Score: 2
      Men don't flock towards positions in elder care, nursing or child care yet I don't see articles bemoaning this.

      Well, to get off-topic for a moment, I'll bet that if you checked magazines/websites in those industries, you would find such articles. I spend between 5-10% of my day in a nursing home hanging with my Dad, and I know they are desperate for male nurses; many of the female nurses simply don't have the physical strength needed to lift patients.

      In addition, the school systems are always looking for male teachers -- so many kids these days are without fathers, that there is a real need for male role models in the schools. And, of course, the public schools want to balance out the gender make-up of the staff. (My wife's school has only one male teacher out of about 20.)

      I don't know if it's genetics, cultural biases, societal remnants from bygone eras, or what, but technology is not the only industry that is heavily weighted one way or another.

      And just to broaden the scope a bit, the make-up of the nursing/patient care staff at my father's nursing home is about 90% philippina, with a few russians thrown in. That is most certainly a cultural thing -- My sister-in-law (also a philippina) helped care for my father when he lived with me.

      --
      Stupid people will be persecuted to the fullest extent allowed by law.
    3. Re:Gender Imbalance....WTF? by Kecut · · Score: 1

      I agree with your reply for the most part but I must reply to your PS. Some of these "self righteous people" may actually be far sighted people who can see the kind of social power that can be held by people in technical fields. Should there be inequality then the balance of power is shifted. OTOH those positions that you mentioned men don't want aren't seen as positions of power so... This is actually a more complex issue than can be hashed out in a few short paragraphs. I will let clearer minds post.

    4. Re:Gender Imbalance....WTF? by Michael+Woodhams · · Score: 1

      A minor point - I've seen plenty of articles bemoaning the lack of men in early childhood care/education. I've seen more bemoaning the lack of women in technical fields, but this is biased by my choice of reading. If I read periodicals with names like 'Early Childhood Education Review' or 'Schools Today' rather than 'New Scientist' and slashdot, I expect the number of articles would go the other way.

      --
      Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
    5. Re:Gender Imbalance....WTF? by softsign · · Score: 2
      OTOH those positions that you mentioned men don't want aren't seen as positions of power so...

      What about:

      "The hand that rocks the cradle is the hand that rules the world." - W.R. Wallace

      Would Hitler have been Hitler if he had a different childhood experience? What about Einstein? Bill Clinton? Kurt Cobain?

      Saying that work with children isn't important because you don't make public policy is just plain ridiculous.

      If you ask me, the garbageman contributes more to society than your average hack politician. I still remember my kindergarten teacher - her name, her face. Do you remember who your MP (Congressman) was twenty years ago?

      --

    6. Re:Gender Imbalance....WTF? by Fred+Ferrigno · · Score: 1

      I think the point is not that people aren't aware of the gender imbalance, but that the media don't give it the same attention. (I don't see articles bemoaning this.) The most racist and sexist industry in this country is the same one we rely on for our news and entertainment. Rather sad really. Makes me want to vote Nader and sell my TV. Ahh, on second thought I couldn't live without South Park and Nader's stances on foreign affairs put me off.

      CARTMAN FOR PRESIDENT

    7. Re:Gender Imbalance....WTF? by eshaft · · Score: 1
      Yeah, women aren't as masochistic as us guys... they have childbirth and that's enough pain without having to stare at high-radiation monitors all day trying to find that one missing semi-colon.

      But I kid ;)

      --
      lf.o
    8. Re:Gender Imbalance....WTF? by PD · · Score: 2

      For some reason I've got to tell everyone about my old college grilfiend N****.

      Once she and I were hanging out with my friend A***** (a woman) and we were talking about vectors. A***** was very cool, and she understood scientific stuff. She's still one of my favorite people on this particular planet. Anyway, my grilfiend N**** piped up and said "What's a Vector???" A***** and I just busted out laughing our heads off. We couldn't believe anyone would ask such a dumb question. Looking back on it, I can see that my relationship with N**** was star-crossed. I saved my lifetime committment for a fellow geek (of the college professor type).

      So, I'm not exactly sure how this story is a response to your particular article. The two glasses of wine that I just drank compelled me to write it. I guess it fits into the general theme that it's not BOY against GIRL here folks, it's GEEK against whatever is anti-geek.

      The situation will even out eventually. We geeks are making as much money as doctors (after doctors pay their hefty insurance bills that is...) so eventually the profession will get more respect. It seems to me that there's plenty of women becoming doctors, so maybe with the increasing prestige of technical positions will come increasing numbers of women.

    9. Re:Gender Imbalance....WTF? by Dix · · Score: 1

      Of course women don't go into technical fields because they don't want to - but the problem is if they don't want to because of accumulated social pressure.

      The reason this is a problem is that technology is empowering.

      If society empowers one group relative to others without merit then there are problems with society.

    10. Re:Gender Imbalance....WTF? by drix · · Score: 5

      Jesus Christ, amen to that. If women aren't flocking in droves to technical fields, perhaps it is because they don't want to. I'm consistently amazed at how often this simple point it just overlooked by some self-righteous feminazi with an axe to grind. These fools acts as if thirty years of conscious gender equalization did nothing to level the playing field. Well, guess what, it did. People can carp about the "glass ceiling" all they want, but the fact of the matter is that there are basically no barriers to female employment anymore in many fields. Hell, most companies strive to have female execs, just to curry goodwill in the eye of the public. This is just so especially true in computer fields, where the emphasis has always been on what you produce and not who you are, what you look like, or whether you have a penis. So this whole argument about a "tech fraternity" or woman being somehow excluded is just total bullshit. Almost all of my highly nerdly friends are guys. Do I know why? No. But it's not like I don't know a hundred girls who had the exact same education as we did, came from the exact same socioeconomic background as us, and simply chose to do other things with their time. Because I do. They went on to become doctors, lawyers, whatever. The thing to notice here is that they were never discouraged from choosing a tech field. They. Just. Didn't. No one really stops to consider they maybe men and women are just wired differently, despite the fact that they obviously are. I'm not saying that women are any less smart than men in tech fields, I'm just saying that something inside their heads makes them less interested in it. I think it's rather pointless to try, in vain, to change this.

      --

      --

      I think there is a world market for maybe five personal web logs.
    11. Re:Gender Imbalance....WTF? by bartok · · Score: 1
      Hey, I sympathise with you but this guy probably had to deal with 20 dork women before you that yawned or show disgust just because a guy is being technical.

      I once had a girl friend who used to complain every time I started to talk abut programming with some friends at parties. (We were all programmers). It's not like I was only talking about programming but just because it wasen't something she liked. And I've seen lots of women act that way. You can see them roll their eyes and say, "here they go again"...

      Now, I'm more tolerant to this king of begaviour but I can easily imagine a clerk at a hardware store having this preconceived idea about women.

      But then again, some guys are just plain dorks :-)

    12. Re:Gender Imbalance....WTF? by bridgette · · Score: 2
      And just to broaden the scope a bit, the make-up of the nursing/patient care staff at my father's nursing home is about 90% philippina, with a few russians thrown in. That is most certainly a cultural thing -- My sister-in-law (also a philippina) helped care for my father when he lived with me.

      Actually that's probably an economic thing. It's called working your way up. There are a lot of Philipeno and Eastern European immegants lately and nursing is a crappy difficult underpaied job that's a step up from the really really bad paying jobs. And nursing offers some sort of carreer path, since you can, in theory, start out as an orderly and through successive bouts of schooling, work your way up to Nurse Practitioner (almost an MD). Both my folks emmigrated to the US when they were really young. There are a lot of nurses and contruction workers in my grandparents generation and a lot of professionals in my parent's generation.


      Since I'm now well off topic: We all known the US, our society has traditionally declared certian things "women's work" teaching, nursing, secratarial etc. and those things are generally valued less than "man's work". This is often called the "pink collar ghetto" by those who study it and is a major reason why women make around 70% less than men. I don't know the order of the chicken vs. egg thing (-> women's work -> low pay -> ) but it is still very much a factor today. Women aren't taken seriously when applying for certain kinds of jobs unless the hiring company does gov. contracts and has to meet a quota. If you look at the average person (HS, maybe some college) faced with having to get a career, a lot of the options are quite hostile: police, armed forces, construction trades, some factories, mechanic. There is something to these being physical but it's not like you need to be really strong to be an electrician. So the only options left are service industries and clerical work.


      The thing that makes the engineering\tech situation unique is that it has one of the largest divides amoung proffessional careers. Women in college aren't nearly as turned off (if at all) by management, fincance, law, medicine, psycology, natural sciences, or liberal arts. Since many of these (natural sciences, finance, medicine) are just as technical, detailed, math-oriented and 'difficult' as CS, CE and EE, the CNET quotes about CS being 'too hard' can't be repesentative.

      --
      - bridgette
    13. Re:Gender Imbalance....WTF? by dingbat_hp · · Score: 1

      Women don't like technical fields, so what?

      You make some very good points.

      I'd ask though, what about the borderline ? I know plenty of women, excellent geeks, who still have a problem with accepting that they're damn good at geekery, and that it's OK to be so. Maybe we're now at a situation where no woman who wants to be a geek can be prevented from it, but there are still plenty out there who "decide" that they don;t want to be, because there are so many social pressures that say geeks are still fat, smelly guys with no social life.

      Over the weekend I met a friend's kids; 13 & 16. They'd also been to the HP Labs (where I work) company picnic the day before. Now these are two intelligent kids who could do almost anything in the future they put their minds to, in the next year they have to choose courses etc. that will influence this, yet mention HP (the finest and most well-socialised bunch of geeks around) and they suffered a total gross-out. OK, so some of it was just teenage "everything sucks" angst, but they really did feel that working here at Nerdvana would be their personal idea of Hell. Geek-wise this site is as good as it gets, yet we're absolutely horrifying to a generation of girls.

      How can geeks improve their perceived profile ?

      A big march through London every Summer, T shirts with "Geek Pride" and a big triangle of aluminium checker plate ?

    14. Re:Gender Imbalance....WTF? by Nicolas+MONNET · · Score: 2

      but the problem is if they don't want to because of accumulated social pressure.

      Prove it! Damn, you're just an armchair psychologist. Can I see your degrees?

      There was ZERO social pressure for me to start programming when I was 10. How would that be different for women.

    15. Re:Gender Imbalance....WTF? by alienmole · · Score: 1
      The thing to notice here is that they were never discouraged from choosing a tech field. They. Just. Didn't.

      You're contradicting and pre-empting a lot of research here. The social pressures on girls (and boys, for that matter) to fit certain stereotypical roles are still enormous. All humans are pressured in various ways to conform to societal norms, throughout their lives but with strongest effect during their childhood. The pressures on females are still skewed towards many traditional preconceptions, and there's quite a bit of research to demonstrate how girls are steered away from technical subjects. This bias may be far more societal than genetic. Without knowing more about that, it's wrong to make assumptions about how women's brains are genetically wired.

      The conscious gender equalization you refer to has had some good effects, but many of them are in the legal arena, as you allude to: job equality has improved from a legal standpoint, but not always in reality. Try asking some of the women you know about discrimination they've experienced at work. It happens more often than you might think.

      We're suffering at the moment from the fact that generations who didn't live through the relatively recent social "revolutions" hear all the politically correct talk, and assume everything's OK. You're being fooled by societal camouflage. You don't have to scratch very deep to find the gender and racial discrimination that still goes on every day.

      If you don't see it, perhaps you don't want to, or perhaps you haven't really thought about it. Look around beyond your generation, at the world that you're slotting into, which was created by people with prejudices that might astonish you. Societies change very slowly, even during and after social revolutions. Attitudes are passed through families, churches and communities, and persist with amazing tenacity.

      Yes, we've made improvements over the last number of decades. But does that mean we can just stop worrying about it all now? Only if we have no conscience or consciousness.

    16. Re:Gender Imbalance....WTF? by nEoN+nOoDlE · · Score: 1

      I'll tell you why we're trying to push women into technical fields... cause we geeks need girlfriends, damnit!

      --
      Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
    17. Re:Gender Imbalance....WTF? by KilobyteKnight · · Score: 1

      The most racist and sexist industry in this country is the same one we rely on for our news and entertainment.

      You rely on the church for your news and entertainment???

      I realize this sounds like off topic flaimbait, but frankly you can find the root of most social functions (and disfunctions) in the relegion of that society -- even among the non-relegious.

      What we are beginning to see is a departure from the classic social and relegious ideas about the roles of various groups in the culture. There is a clash between what many of us think is right and good, and what we have be taught and exposed to as "normal".

      I suspect what we will see happen is what always seems to happen. The "rebelious" ideas that work will find their way into mainstream. The "Establishment" will change to embrace the new ideas. And the "rebels" will move on to new unwelcome ideas.... most likely the exact opposite of what the "rebels" of a generation before were championing.

      --
      When will Windows be ready for the desktop?
    18. Re:Gender Imbalance....WTF? by rovfrukt · · Score: 1

      I've just finnished the last year in Swedish school (9 years) with pretty good grades (275 points out of 320 possible), yet I don't know WTF calculus is.

  167. Good thing by Elias+Ross · · Score: 1

    If girls/women were doing computer work, there'd be almost twice the programmers, and I'd get paid a lot less.

    So, what's the incentive here?

  168. Girls in technology. by optisonic · · Score: 1

    I teach web development classes to lots of women. I find that they easily get frustrated with software in a short period of time. I believe this is a result of women primarily deriving their logic from emotions and men primarily deriving their emotions from logic. As computers have a great lack of emotional content and interfaces, women find them cold. As a result they do not have much interest in working with a device that doesn't give them a good feeling more than they have to. Guys get great feelings from working with computers after they make a major accomplishment such as writing and compiling your first C program. It's quite true that there are exceptions to this but I find this typically describes the general population wordwide. Maybe we should write a female interface that comes closer to giving a pleasant experience. Out of the box, no OS I've ever seen even comes close. It would likely have to talk to the user and have them fill out a questionaire as part of the installation/setup process. Then we'd need girls to troubleshoot/develop it as being a guy it would be a terrible experience having to fix something like this. We'd have an excuse as to why we couldn't fix our girlfriends computers too!

  169. Re:Our Sad Technical Frat by broken77 · · Score: 2

    It's unfortunate because when your whole company is made of 25-35 year old straight white males (like mine)

    What?!?! Where do you work at? Every place I've worked since college has consistently been a melting pot of white, asian, asian indian, latino, etc. men and women, and yes, several gay men/women too. I think you're grossly oversimplifying by saying the industry is flooded with nothing but "straight, white males". The fact here is that the computer industry is one of the most diverse that there is! Sheesh... Someone's got a chip on their shoulder.

    --

    I modded the Troll Investigation and I got

  170. Blatant example of Cultural Engineering.. by feck · · Score: 2

    at work. *in our society women are almost chided if they try to do anything but power their cheeks and paint their nails. * almost? ever looked in one of those mags they're encouraged to read? ever think about the true nature of the barbie doll, or kid's toys in general? we are all generally brought up to fill certain narrowly defined, well channeled gender roles, specifically designed to give us social 'handles' that can be used to direct our perceptions and therefore actions.. boys do this, girls do that, deviate and you're a 'fag' or a'slut' or something else we've been trained to fear being labeled. and just for the record goths, and other sub-cultural mutations(there are soooo many), are the smart-assed opposite-reaction to this sort of immersive control..

    1. Re:Blatant example of Cultural Engineering.. by Jason+Earl · · Score: 2

      Who encourages them to do all of these dastardly girl-stereotype things? There is actually quite a bit of evidence that much of this behavior is not learned, but is instinctual.

      I know for a fact that my little 18 month girl already displays many of the stereotypes that you are ascribing to cultural engineering. For example, her favorite toy is a ugly hairless little doll that apparently materialized in our home. I am not exactly how it came to be in her possession (neither my wife nor I was interested in giving our daughter toys that were "gender biased), but I don't dare take the darn thing away from her. Last time I took it away she wandered around the house looking for it for hours, crying all the while. She doesn't even form sentences and she is already playing with dolls!

      I am not stating that cultural engineering doesn't happen. I have lived in different countries, and so I have a pretty good idea at how important our customs can become. I simply am not willing to believe that there is some mysterious "them" that is using our culture as a weapon against us. Nor do I believe that counter-cultures like the Goths are somehow more enlightened than those that more closely fit the gender stereotypes. Painting my hair green and putting a nail through my nose does not make me any harder to stereotype. In fact, it makes it easier. Now instead of guessing my observers could simply conclude that I was a "Goth," with all that this generally entails.

      Cultures have grown, for good or ill, out of the combined observations of millions of people over hundreds and thousands of years. Social norms and morals generally have distinct biological reasoning behind them that has allowed these cultures to pass on to the next generation. In a way cultures evolve in much the same way as the genetic hosts that they are propogated on. The 1950's Beaver Cleaver culture that you rail against is simply a culture that has been fairly successful at being propogated, although it certainly has undergone a great deal of modification in the last few generations.

  171. Selective gender values? by briantr · · Score: 1

    It's interesting which concerns over gender roles receive attention and which don't. Everyone sees computers as the hot field right now, not just because the field is lucrative but because it's symbolic of the leading edge of societal progress. At the same time, the fact that women gravitate (for whatever reason) to different jobs than men do is nothing new. No one talks about the fact that very few women become auto mechanics, but I would venture to guess that the same causes underlie both cases.

  172. I'm a geek girl! by Moogoo · · Score: 1

    Well, I'm definitely a geek girl (math and computer science all the way!), and I don't know exactly why there are so few girls. Ever since I started going to math programs and such in high school, I've noticed that there are always a LOT more guys. Even at the gender-balanced programs, all the INTERESTED people are guys; there are girls, but they don't seem to be there out of any particular interest. Seems to me that the anti-geek tendency for girls starts much before high school, but I don't know why that is.

    1. Re:I'm a geek girl! by infinite_twilight · · Score: 1

      Think of the stories read to you as a little kid or your reader at school: the girl stayed home, played with dolls or made a cake, while the guy went out saved the day, or fixed a car... The only kids books I remember not conforming to that were the original Nancy Drew stories...

      Also, it is in part our teachers and parents. I began using computers at the age of two, but when I arrived in kindergarden, the (male) computer lab person told me I was not allowed to used the computers... meanwhile, one of the little boys in my class was allowed to go and play games to his heart's content... :(

      Even as I have grown older, this still is. I got in trouble in elementary school for using the networked computers for non-classwork... The guy the next row over was downloading pr0n, but the teacher didn't say anything until I set up a cam and feed it through to the principal's office ;) Most recently, I tried to get into the Cisco networking course at my school last year but was not allowed to enroll.. I was in tenth grade, was the excuse I was given... Meanwhile, the year before, two of the guys who are now head of i.t. at our school, were allowed in (they were in tenth grade).. In the fall, a few tenth grade students (male) are being allowed in... Does anyone else see the wrongness here??

      ~me

  173. girls as geeks by rebecca_d · · Score: 2

    i think that it just takes a certain type of person to be interested in technology, not a specific gender. it also takes a certain amount of determination as a woman to be willing to dive into a male dominated culture like geekdom.

    i think that another thing that holds women back from achieving really well in technology is that to be a true uber-geek you need to put in really long hours. technology has to be your 24hr/day obsession. i think that most women would rather go home at the end of the day, see their friends or family and have a little more balance, a little more of a life.

    1. Re:girls as geeks by Simm75 · · Score: 1

      And it depends on the field too.

      There are *several* fields that are becoming more and more technically-oriented. I'm in graphic design, (actually, stuck at a small newspaper right now) and have found that, as a male, I'm in a shrinking minority.

      Why? I dunno. One thing's for sure: while it doesn't require you to edit Sendmail configs or write Perl scripts, it does require one to be able to deal with technical issues and "wing it", an important quality in many technical fields.

      A majority of the work I deal with (from outside houses) is actually sent by women. And, quite frankly, women seem to "get it" better than men. Example: spot color ads. I have had to deal with both women and men on this. In one case, I had a woman that had to be told only *once* to fix everything correctly. I've got some yahoo with a fairly sizeable Midwestern cell phone service company that finally said to me, "well, upper management is picky about how this is done." In other words, he didn't know how to play politics well enough.

      Okay, that rambled. :^) The point I'm eventually going to work up to is this: if you'd like to keep the glass ceiling, keep calling attention to the "differences" between the sexes. If you want that ceiling to disappear, become the most valuable employee (not woman or man) you can be.

    2. Re:girls as geeks by rebecca_d · · Score: 1

      one must live, eat and sleep technology and most woman in my opinion are not willing to do this. They are too obsessed with hair and makeup to put in the hours necessary to become a REAL GEEK!

      that's as much of damaging stereotype as saying women can't be geeks because they're too stupid. of course there are women how prefer hair and makeup, there are men who do too (and they're all crazy in my book). none of these people will become geeks, regardless of their sex/gender because they're the wrong type of person.

    3. Re:girls as geeks by mpe · · Score: 1

      that's as much of damaging stereotype as saying women can't be geeks because they're too stupid. of course there are women how prefer hair and makeup,

      Actually it's simply a variation on the theme of "some obsessions are Politically Correct and others are not."

  174. Re:The natural gender gap. by scruffyMark · · Score: 1
    I didn't know whether to mod you up as insightful, or down as troll.

    I was getting all ready to mod you up, then those last two paragraphs...

    --

    What is the robbing of a bank, compared to the founding of a bank? -- Bertolt Brecht

  175. The 'Coolness' Factor by Knunov · · Score: 3

    I've had a rather bizarre life. I was a lifeguard in high school, a jock AND a lifeguard in college, and am now a network engineer in 'real' life.

    I still look basically the same. 6' 1", 210 athletic pounds, dark blonde hair, blue eyes. The anti-geek. But when I was lifeguarding and in college, I picked up WAY more girls than I do now, even though I am exposed to just as many.

    My personality is basically the same, but that twinkle in my eye and uncontrollable grin that takes over my face when I talk about encryption or compression or alternative operating systems seems to be a genuine turn-off to girls.

    I don't know if they are intimidated by me because they don't understand what I'm saying or they are simply assuming that I'm a geek at heart (which I am) underneath my athletic frame.

    Girls are taught that geeks are not desirable men. Here on /. and in the IT world we throw the term around affectionately, but you must realize that most of the world isn't in our circle and in THEIR world, a geek is not a good thing to be.

    I don't wear glasses. I'm not fat. I don't shoot milk out of my nose when I laugh. Well... I *usually* don't...

    But once girls find out what I do, I'm suddenly a geek.

    I think society's perception will change in time as the IT profession becomes more and more important. Network engineering will one day be thought as 'cool' of a job as being a lawyer or doctor.

    The upper echelon (top 15% or so) already makes the same amount or more money than the other 'prestigious' professions. Respect will come in time, I think.

    Many people are already dismissing the 'geek' notion just because someone is into computers. But even more are clinging onto the stereotype. People in my company can't even comprehend why I make 2x to 3x more than they do. Sometimes I feel like handing them a keyboard and saying, "If it's so easy, YOU do it."

    If they really get to you, just do what I do. Hack into their home machines and leave a "y00 h4v3 ju$7 b33n h4xx0r1z3d bi 4 31337 h4xx0r d00d. $$$$$$$$$ EZ $$$$$$$$" message on their screen.

    They'll be your best friend the next day :)

    Remember, you aren't getting paid big bucks for what you know. You're getting paid for what the rest of the world doesn't know.



    Knunov

    --
    Why do users with IDs under 100,000 or over 700,000 usually have the most worthwhile comments?
    1. Re:The 'Coolness' Factor by timmyd · · Score: 1

      hmm. that sounds interesting, but i don't really want to be a lifeguard. can you tell me if there was any difference in the quality of girls you got when you were a lifeguard and now you aren't? it seems you got quanity as a lifeguard, but were they unique at all?

    2. Re:The 'Coolness' Factor by Knunov · · Score: 1

      I got all types as a lifeguard. Smart. Dumb. Of average intelligence. Flakes. Great personalities. Terrible personalities. Boring. Interesting. But who really cares about that?

      I'm not interested in a long-term relationship. I just like dating. But I think girls like the idea of dating a lifeguard more than dating a network engineer, even though I make 4x now as I did then.

      If you made dollar-for-dollar the same amount as a lawyer or doctor, or even more, the girl would rather be able to say, "I'm dating this doctor." as opposed to "I'm dating this network engineer." Someone in another thread brought up the point that doctors and lawyers tend to spend their money in ways that make their wealth obvious, whereas IT people tend to spend it on gizmos. I drive a 2001 Explorer Sport Trac, but I also drop $10,000 - $15,000 per year on new computer parts and other techie gadgets. If I stuck with one system, instead of the 5-station network I have now, I could be driving a Mercedes instead.

      The girls worth keeping, and we all know how rare THEY are, don't care what you do for a living. I'm currently dating, and I use the term very loosely because we just met in April, an absolutely GORGEOUS Brazilian girl. She is very smart. Her personality is amazing. And she is as far from a geek as a girl can get, but she really doesn't care that I do what I do. In fact, she really likes it and asks me about computers all the time. So some girls, even the really desirable ones, no longer associate computers with geeks. But unfortunately, many still do. I couldn't tell you how many times a day I get called 'geek' at work. Though the people are joking, there is much truth said in jest. Not truth about who I am, but truth about what they think.


      Knunov

      --
      Why do users with IDs under 100,000 or over 700,000 usually have the most worthwhile comments?
    3. Re:The 'Coolness' Factor by timmyd · · Score: 1

      ok, thanks for the reply. yeah, i've had people call me things but usually my friends call me 'computer genius' which i find really annoying, but maybe it beats geek or nerd. i dunno

  176. socialization definitely a factor... by Susan · · Score: 1

    I wanted to respond to this as I am a woman (out of college 10 years) who works in the computer science field. I realized, though, I really don't know why more women do not go into this field. I find that the ability to make a machine do something and to *create* is very seductive. Many of my women friends are programmers or engineers as well. I'm much more interested in the comments of women in my age group *not* in computer science, though I doubt that ./ has a large population of them. It would be interesting to compare the perspective of different age groups of women. I certainly hope women my age don't say things like "Guys are more computer-type people." I agree that computer science skill and interest is probably not inherently linked to gender.

  177. A few exceptional women != dominance by ccoakley · · Score: 1
    Ehh, just because many of the women who were in the field (I'm vague here with "field", grouping all engineering fields that dealt with early computers into one) at the time left lasting impressions doesn't mean that women ever dominated the field. On the contrary, the reason that such women are remembered was because they fought such an uphill battle. I've worked with a number of old farts who worked for General Atomic long ago, and they say the industry was always dominated by men.

    --
    Network Security: It always comes down to a big guy with a gun.
  178. Who? by suwalski · · Score: 1

    Does anyone really want to be the stereotypical geek?

    I remember when I was a kid, I wanted to be a fireman, actor, etc... but never a pocket-protector wearing, tape-around-the-glasses, fat-ass guy in tight pants.

    Now just try imagining a girl like that!

  179. Re:Miranda and Ki by djfiander · · Score: 1

    Maybe on your planet women need fancy clothes and a hot car. I manage all right with neither.

    Of course, the fact that lawyers are capable of holding an intelligent, witty conversation might have as much to do with the female selections as the car. Face it, they're _paid_ to talk. That's an incentive to boost one's social skills.

    My social skills greatly improved when talking to customers without embarassing myself became part of my job description.

  180. not necessarily true by gnarphlager · · Score: 2

    my last girlfriend was pretty geeky. Most of my friends are girls, and very geeky. Well, I think that has some sort of bearing on that you HAVE to be a geek in order to spend more than five minutes with me :-)

    Anyway, I've known just as many geeks who were female as male. Just because a girl doesn't talk about Star Trek or whatever doesn't mean she doesn't like computers, or isn't good with them. I think if you're going to just go from initial impressions, yeah, you're going to find that guys are alot "geekier" than girls. But I find there really isn't too much of a gender split, except on the most shallow levels. Even that is overgeneralization, as that I've known girls who WERE the stereotype.

    I guess what I'm trying to say (albeit poorly) is that if we're GOING to make over generalized statements like this, we need to define what makes a "geek" versus "non-geek". Personally, I define it as "devotion regardless of popular opinion". If someone does computers because they think it's the cool thing to do, then they're not a geek. If someone loves obscure movies not because they're obscure, but because they do regardless of what anyone thinks(good or bad), then they're a geek.

    As for the article, consider the source :-) And yes, the last relationship failed miserably due to my poor social skills. However, if any girls out there are Nurse With Wound fans . . . :-)

    --

    Bad things often happen to good people,
    It is up to them to see that they remain good.
  181. Re:I'm shouting this... by coyote-san · · Score: 2

    Thank the failed "Equal Rights Amendment." It proposed to prohibit discrimination on the basis of sex, and some bright bulb opposed to it realized that "sex" can refer to either a noun (the plumbing) or a verb (what you do with that plumbing). Gender isn't a verb - you'll never here someone singing about how they want to "gender you up."

    Toss in a non-unreasonable legal interpretation (if a broader word is used instead of a more precise word, the author must have chosen it deliberately) and a bit of fear-mongering about the Law of Unintentional Consequences, and you get the charming theory that the real effect of the ERA will be to prohibit laws banning sex with members of the same sex (remember, the ERA was debated in the 1970s when gays didn't dare show themselves outside of a few major cities), interracial couples (ditto), to say nothing of pedophilia, necrophilia, etc.

    Look at the current debate over "gay rights" and multiply it 100-fold. Most of the opponents of the ERA were misogynists of the type that you only find in the Southern Baptist Convention today (or am I the intolerant one for mocking their stated belief that wives must be subservient to husbands, women must stay out of the pulpit, etc.?), but a significant number of liberals were also concerned with the ERA because of the very real possibility that it could be viewed as covering more than intended.

    Unfortunately, as another poster observed other people are defining "gender" in psychological terms. It's not <i>that</i> far from "homosexual female trapped in male body" to "13-year-old horndog trapped in 25-year-old body." The latter may even be a valid description of someone with arrested sexual development, but that doesn't mean that we as a society must condone pedophilia.

    Bottom line: you may have had a point a generation ago, but this is one area where the language is rapidly evolving.

    --
    For every complex problem there is an answer that is clear, simple, and wrong. -- H L Mencken
  182. Re:glass ceiling by Knightmare · · Score: 1

    I don't agree with that being a reason... Women have run across that mentalitly in quite a few fields. There is a typical "Good Old Boys Network" mentality that people have to get out of and if it wasn't for strong women getting into the problematic fields and showing people they are just as capable of doing the jobs the problem would still exist everywhere. Granted that is a problem in computer science from my experience. But not one that should stop women from entering the field. There are way too many strong women in the world for that to be a reason.

    And no there is no girl looking over my shoulder as I write this... :) I REALLY do believe that!

  183. men dominated jobs tend to... be ugly by katho · · Score: 1

    Guys tend to have few social skills, like giving feedback, discussing in a fair manner, self-reflecting. They don't care about themselves, their rooms, others.

    That's not the case with everybody of course but it's a tendency.
    Being like this is "cool" or common for men but ugly and a shame for women. They are supposed to care about others in our kind of society and are urged to concentrate on social skills, not the quality of code.
    I guess they feel like aliens in geeks' homes.

    And the difference between lawyers and IT guys is: Lawyers have to look like trustworthy, serious representants of their clients.
    they have to care about their outward appearance and offices more than IT guys.


    --
    there's enough for everybody, let's share it
  184. Congratulations Guys by batobin · · Score: 1

    Psychological studies have proven time and time again that men are more concerned with sex than women are. It is a stereotype, yes, but in this situation we must look at the mass numbers. If men care more about sex, and technology is bad for getting sex, wouldn't it make more sense to say that men have the disadvantage? Maybe there are other factors, besides sex appeal, that makes the population of guy geeks so large. By simple logic we prove that there SHOULD be more girl geeks if we only consider sex. I'll leave the real reason up to the intelligent people who came up with the sex appeal one. Bah.

  185. Re:Computers not just for boys? by nomadic · · Score: 1

    Sometimes i feel really inferior compared to the males, it's almost as if they treat my like i'm stupid because i'm a girl... though i try harder then most of them to learn things...

    That's probably also due to the nature of the geek world itself. Most link self-esteem to technical knowledge, and sometimes the easiest way to elevate yourself is to belittle someone else.

  186. Where have all the moderators gone? by heidiporn · · Score: 1
    Hey, moderators! There are some really quality responses at the bottom of the page... filled with more coherent arguments and valid points than in almost any other slashdot article I have seen.

    Try browsing the bottom of the page for some really lucid, well-thought-out explanations and opinions.

    --

    heidi

  187. Guess I'm a sports geek too. I like BASEball! by root · · Score: 2
    Football and programming are not mutually exclusive.

    I hate football AND basketball. Too tense. Too commercialized. Too many rules. Rigidly timed games. Too much stats. Anything deviating from the stats is called an "upset". I always wonder why people watch if they have such a strong pre-determination of what they're about to see.

    Baseball is far more relaxing and enjoyable to watch. A little more random. No clock to worry about. No scary buzzers. Far less cheating. No stress. Which is exactly what I need after racking my brain staring at severely inbred (inheritance wise) C++ code.

    Aren't there any baseball fans anymore?

    1. Re:Guess I'm a sports geek too. I like BASEball! by Anonymous Coward · · Score: 1
      Baseball is far more relaxing and enjoyable to watch. A little more random. No clock to worry about. No scary buzzers. Far less cheating. No stress. Which is exactly what I need after racking my brain staring at severely inbred (inheritance wise) C++ code.

      Ah yes. Baseball has not been shaped by television and time slots. Very 19th century in its feel. Not poisoned by technology and trendiness [*]. Games can be short (a no hitter) or span days (I recall an 18 inning game. Yes. This was MLB.) I often listen to ball games while working in the yard on on the car too. I follow the game on RADIO. How often does that happen with football or basketball?

      [*] The expansion teams were an OK idea, but the change to 3 divisions, extension of the pennant games (best 3/5 to best 4/7) and this wildcard bullshit is scaring the crap out of me. Baseball doesn't need to be "fixed" or "jazzed up". They're gonna mess up the game if they keep this up, IMO. And fer godssake! Get them fscking mascots off the field and fire the DH. Damn AL rules. If the pitcher sucks, let him go down swinging like everyone else.

      Baseball hasn't been the same since Lasorda left the game.

  188. social upbringing by acecccp · · Score: 1
    Girls like nice cars, but they aren't going to get oil all over them to crank up the engine a little. I think that's ok, and is just a product of the social upbringing of women in our society.

    I wonder if alt.cooking have forums about men not participating as much as women...

  189. Re:Girls don't watch the Man Show or play Football by DowntownCoder · · Score: 1

    Hey... I'm a girl and I like the man show...

  190. Re:Miranda and Ki by neophile · · Score: 1

    there are many geeks who are just not computer geeks. band geeks... english geeks... et cetera. Some of us geek girls actually do drool at that type of equipment (computers), though. I am guilty occasionally. Perhaps it's just a different set of status symbols or something...

  191. Girls are more sociable???? by restless_ne'erdowell · · Score: 1

    Says who?

    I don't think socializing is an activity that's gender-specific. Some people are more social than others. Some of those people are female; some are male.

    I think it's more likely that too many girls are still surrounded by the "Math is hard" Barbie doll and the "Oh, you're just going to college to get your 'MRS' degree" attitude to think seriously about studying computers or engineering. The girls who were interviewed are at an age where they are just starting to think for themselves, and haven't had a chance to really explore what they want to do or to look past the misconceptions of what it's like to be a computer programmer, sys admin, whatever.

    1. Re:Girls are more sociable???? by Woodlark · · Score: 1

      I think it's more likely that too many girls are still surrounded by the "Math is hard" Barbie doll and the "Oh, you're just going to college to get your 'MRS' degree" attitude to think seriously about studying computers or engineering.

      Heh. When I told my mother's boss (she's a Civil Eng., I don't know what he is) that I was going to major in Electrical Engineering, he looked at me and said, "But electricity can be very dangerous. There's the positive and the negative."

      Mostly when I tell people my major, they ask me how many women there are, whether I think they're being drawn away from the tech industry, and why. My case is simple: my parents were both engineers; they've always encouraged my scholastic pursuits be they musical, literary, or mathematical; and I decided to go for the one of my interests with the highests likelihood of insuring me a good job.

      And it worked. I haven't even graduated yet, but I'm working for a tech company that wants me when I graduate two years from now. They don't care whether or not it will be in the same position I'm filling now. They want me because I'm intelligent, tech savvy, and can get along with all the elements it takes to make up a tech company. Not only that, but I'm happy working for them.

      Droit devant soi on ne peut pas aller bien loin...

      --
      Droit devant soi on ne peut pas aller bien loin...
      Straight ahead of him, nobody can go very far... -- Le P
  192. Real Geeks by Phyre · · Score: 1
    Something that I have been noticing is the lack of *real* geeks in the tech industry as of late. Working with computers != geek. That's something the popular media has forgotten.

    I think the current breed of tech worker wants to make money. Years ago, this was the type of person that would have become a doctor or lawyer. Now they become CCIEs. We have all met doctors and lawyers who became what they are not for the money, but for the love of the work. If you love something, you excel at it.

    That's why I became a tech. Now, just to say that there are more dudes than chicks in the tech industry is not to say that there are more male than female geeks. I'm sure there are, but I'd just like to point out the distinction. Traditionally males have flocked to the higher paying professions. I think if you look at the ratios of female geeks to male geeks, and the ratio of female tech workers to male tech workers, you would see a discrepency.

    --
    --- Phyre
  193. Many influences make the person by chrisom · · Score: 1

    This subject goes beyond just one study. I think that it would take many studies to get the "big-picture".
    But, I would like to make these points:

    Women only began voting approx. 100 years ago. Women only began to work less than that time. And an active encouragement to be educated in anything remotely scientific only truly began in the last 30 years. My mother remembers that she did not have to take maths (physics biology and any other science subject) past the time she was 13. So, I think we really need a bit more time to see if the equal opportunity programs that many countries have implemented have worked.

    It has been my personal experience that being a "geek girl" has been, well, lonely dammit. I don't know many other girls that like to talk about computing, and if I start talking to a bunch of guys, the topic can often turn to cars, girls, sport, .. stuff that doesn't interest me.

    --
    Michelle

    ----
    Be true, regret not, and let your star shine forth!
  194. Relax. It's okay. by Spud+the+Ninja · · Score: 2

    Girls have the ability to learn and use computers, but they are turned off by technical careers that they view as full of geeky guys.

    Quite frankly, any group of guys has a tendancy to stray toward the "geeky" side of things. Don't think that "geek" is not synonymous with "aficionado". It is. Listen to the boys talk about the big game. Listen to the connoisseurs talk about last year's Merlot. The subject doesn't change the pattern.

    I looked long and hard to find a job were I couldn't describe the Devel. Dept. as "The Nerdery". Some people are willing to work in them, but I won't. I think women, in general, aren't fulfilled by the same work as men. Who expects them to be?

    I should probably note that "women in general" means an assortment of girlfriends, past and present, sisters, cousins, etc. and I'm in no way claiming to speak for all woman-dom <shudder>.

    The Point: Equality has nothing to do with the number of different groups in any one situation. It just means that everyone has the same access. If a woman doesn't want a job from a tech co sweating to give here one, all the power to her. I'm not going to worry about it, because she'll find another way to contribute to society.

    ps. A belated Happy Canada Day, Canadians! Um... is Independence Day "happy"? Anway, a premature Happy Independence Day to those denizens of the U.S. of A.

    --
    You can never put too much water in a nuclear reactor.
  195. Re:looks like a chicken and egg thing by jfern · · Score: 1

    There are some girls out there that like violent computer games, yeah, who'd want barbie software?

  196. What is a geek? by qbasicprogrammer · · Score: 1

    This page explains well what is a geek. Some of the most interesting tidbits where:

    "But just what is a geek?" you ask. Well, I'll tell you. At least, I'll tell you my definition... which may be different from "general usage" of the term, webster's definition, and even the definition used by other geeks.

    A geek is someone who spends time being "social" on a computer. This could mean chatting on irc or icb, playing multi-user games, posting to alt.sex.bondage.particle.physics, or even writing shareware. Someone who just uses their computer for work, but doesn't spend their free time "on line" is not a geek. Most geeks are technically adept and have a great love of computers, but not all geeks are programming wizards. Some just know enough unix to read mail and telnet out to their favorite MUD.

    ...

    Geek can also be used as a verb. "To geek" is to sit online and read mail, news, chat, and otherwise waste time in front of a keyboard. This "geeking" often consumes many hours, even if the intention was to "just log in and check my mail." Some would say this time would be better spent being social in person or even just being curled up in a sunbeam.

    So yes, there are girl geeks, in chatrooms everywhere. In the fashion section of AOL. In a barbie discussion forum. Some might even be technically competent.
    --

    10 LIST : REM MER : TSIL 01
  197. Re:Breeding by DustyHodges · · Score: 1

    Actually, Gender is what someone associates with themselves. One's gender tends to match one's sex, but that is not always the case. Ergo, it is more appropriate to say gender. Sex is a physical construct. I'm sure that if a biological female had Gender Identity Disorder, he would be more likly to be a geek. As a matter of fact, one of my very good friends is a geeky male who was born female.

    Finally using what I learned in women's studies,
    Dusty Hodges

  198. "Search for the Techie Woman" and Other Articles by Gadget9 · · Score: 1

    This is an interesting subject; the number of women in IT careers has been discussed time and time again at http://www.womengamers.com The Womengamers.com staff members have posted several articles on this subject, but the most relevant to this case would be http://www.womengamers.com/articles/womenIT.html , or "Search for the Techie Woman - Part I" Womengamers.com (no, I don't write for them, nor have I been paid to advertise ;) ) has done numerous studies in this field, especially in relation to the number of young girls playing computer games. The conclusion among "Girl Game" developers seems to be that increasing the number of games targetting a young female audience will increase the number of women in the IT field, as playing games increases the player's comfort level with computers and may increase their interest in the subject once they see what computers have to offer. Their logic sounds about right to me. I am a "girl geek," and I take pride in it. Although I was never considered to be a geek when I was in high school, and even enjoyed a good amount of popularity, there was always a degree of cultural friction as a result of my interest in subjects that were traditionally for boys only, such as programming and robotics. These "tech" hobbies never offered me any field-specific female role models, and my interest in them was something that was frowned upon by both peers and elders. People even had a problem with my playing console games, a hobby which probably lead to my involvement in computers in the first place. My IQ qualifies me for membership in Mensa too, but this was also something to be ashamed of. High intelligence in women is not quite as acceptable as it is in males, as it would seem, so I made use of Barbie's infamous, "Math is hard" mantra and was absolutely bored to death in school. It is just not socially acceptable for women to be "geeks," "nerds," "techies," or whatever else you want to call us. But you know what? Some of us just don't give a damn about what society brands us. I never fit in with the crowds, just like the geeky guys (and that's probably why I date geeks almost exclusively). Women just face a little more ridicule.

  199. Re:Hello?! Did Anybody Read This Sentence? by seanson22 · · Score: 1

    I think its rather unfair to be overly judgemental of people who worry about who they will be working with in a chosen field. I'm not saying its right that they want to avoid geeks, basically saying they dislike intelligent men, but that's another topic. The type of people in a field you make a career in are the type of people you will have to deal with on a daily basis for the rest of your career. If most people in a given field tend toward a personality type that you don't get along with or care for, then that is a good reason to consider other options for what you want to do with the rest of your life.

  200. Reality is Sexist by Baldrson · · Score: 2

    Humans evolved from peripheral beta males who had to find ways to cope with the marginal resources of ecological ranges or die. Frontiers. Technology and its gender bias is an abstraction of this ancient gender bias.

  201. Re:Girls don't watch the Man Show or play Football by FigWig · · Score: 2

    Ever thought how modern computing would be different if it was women dominated by the start?

    I always find these postulations ridiculous. Human nature is similar enough between genders and external factors are constant, so it's not like we would program computers by arranging flowers on screen and all computers would crash once a month. The only difference that would matter is that we would all be reading an article about how guys don't want to be geeks.

    And if you are interested in the influence on early computing by a woman, look up Grace Hopper. Of course geeks might not be too happy about her support of COBOL.

    --
    Scuttlemonkey is a troll
  202. That's all great, but whatever happened to beer? by brown+syringe · · Score: 1

    I have been recently thinking about beer. Beer is the nectar of Gods. We're not talking Guiness or Cerveza here, we're talking the real shit, Steinlager, Heineken, Pete's Ale.

    The problem these days is that people can't appreciate good beer. Too many people just get wasted on cheap-ass Ice House, Coors, or even worse, Bud. And that is a shame.

    In the old days, things were different. Beer, that was a commodity. Good, aged beer was valuable. People treasured those moments of enjoying a pint of cold, tasty lager with plenty of head. Nobody would touch an aluminium can, let alone beer in plastic.

    Open up a can of MGD today, and you've set yourself up for some major disappointment. Firstly, aluminum leaves a nasty aftertaste in your beer. Secondly, MGD has absolutely no head. It looks like stale tea. Thirdly, it tastes like stale tea too.

    Henceforth, I urge you people, don't drink cheap shitty beer!

    _, . '__ .
    '_(_0o),(__)o().
    ,o(__),_)o(_)O,(__)o
    o(_,-o(_ )(),(__(_)oO)_
    .O(__)o,__).(_ )o(_)Oo_)
    .----|......|......|......|......|......|_)0
    /^^^.--|......|......|......|......|......|,_)
    |^^/.........|......|......|......|......|...... |o(_)
    |^^|.........|......|......|......|......|...... |_/`)
    |^^|.........|......|......|......|......|...... |O_)
    |^^|.........|......|......|......|......|...... |
    |^^\.........|......|......|......|......|...... |
    \^^'---|.....|......|......|......|......|
    '----|......|......|......|......|......|
    |......|......|......|......|......|
    \......\......\....../....../....../
    `"""""""""""""""""`

    Enjoy life, drink beer.

  203. Re:The lack of chicks isn't the problem.. by antigone · · Score: 1

    thankfully, we 'geek chicks' are smart enough to know that we don't have to settle for men with mentalities like the ones expressed in this post.

    --
    "Leave no authority existing which does not answer to the people" --Thomas Jefferson
  204. OOG TELL SECRET TO GETTING CHICKS!!! by OOG_THE_CAVEMAN · · Score: 3

    OOG NO NEED READ ALL THIS NONSENSE ABOUT GEEK GIRLS ON SLASHDOT!!! THAT WHAT OOG FAVORITE PORN SITES FOR ANYWAY!!! BUT SINCE SO MANY POSTERS SEEM NOT TO KNOW SHIT ABOUT WOMEN, OOG THE CAVE PIMP DIVULGE HIS KNOWLEDGE OF GETTING SWEET CAVE LOVING!!!

    OOG READ POSTS HERE AND STARTLED ABOUT PEOPLE HERE WONDERING WHY THEY CANT FIND GIRLS!!! OOG KNOW NO WORTHWHILE GIRL COULD STAND OBNOXIOUS PSEUDO INTELLECTUALISM OF MANY POSTERS HERE!!! SO MANY SLASHDOT PEOPLE KNOW-IT-ALLS, KARMA WHORES, ELITISTS, ETC!!! IF YOU LIKE THIS IN REAL LIFE, NO WONDER PEOPLE NO LIKE GEEKS!!! PERHAPS LEAVE MONITOR, CLOSE PROGRAMMING WINDOW, AND LEARN ABOUT REAL LIFE!!! AFTER ALL, OOG NEVER GO NEAR GEEK CAVE WOMAN BECAUSE OOG CANT STAND SUCH ONE DIMENSIONAL MENTALITY!!!

    OOG ALSO NOTICE HOW CERTAIN PEOPLE USE GENDER STORIES AS WINDOW TO START BRAGGING ABOUT CONQUESTS AND TRY ONE UP PEOPLE!!! GUESS WHAT, OOG CLUB MORE CAVE WOMEN AND DRAG HOME TO CAVE THAN YOU HAVE KARMA POINTS!!! BESIDES, NOBODY CARE ABOUT YOUR LITTLE BRAGGING STORIES!!! OOG BET YOU ONLY GET RELATIONSHIP BY SETTLING FOR UNATTRACTIVE CAVE WOMAN!!!
    IF YOU WANT ADVICE ON WOMEN, OOG HAVE THIS TO SAY: CLUB WOMAN AND BRING HOME TO CAVE!!! IF THAT FAIL, GET CAVE WOMAN DRUNK ON CAVE BEER AND HIGH ON CAVE WEED!!! THAT NEVER FAIL!!!

    --
    OOG THE OPEN SOURCE CAVEMAN!!! OOG BREAK HEAD WITH OPEN SOURCE CD!!!
  205. Re:Our Sad Technical Frat by Fizgig · · Score: 1

    There was a very interesting article in Glamour (I was just flipping through my girlfriend's copy, making fun of the ads!!! I promise!!!) in April, I think, about sexual harrassment at high-tech firms. It focused on Juno. The stories sounded pretty awful. While I do not know how prevalent sexual harrasment is as a whole, things like that aren't going to encourage women to enter the field, even if they occur in only a tiny fraction of high-tech firms.

  206. Female Programmers by Verence · · Score: 1

    Just as a side note, women were in fact the first electronic computer programmers. Note the Wired story on the six women who first programmed the ENIAC. Women Proto-Programmers Get Their Just Reward

    --

    ... that's all i wrote...
  207. Re:Intelligence has nothing to do with gender. by wljones · · Score: 1

    I have worked for several companies that have female geeks, several in important jobs. Having worked in several locations abroad where "male only" is a mandatory requirement, I welcome their presence and admire their skills. Companies are in business to make money, and if prejudice gets in the way, it gets downgraded. Many of the women I met in industry were accomplished technicians, programmers, engineers, and even administrators of geeks (Managing engineers is like herding cats). The majority were married and raising families, some while also going to school and working full time. The presence of ladies in the workplace makes life a little better, and I am always happy to have my wife meet any of them. A talented geek will be given more responsibility and more privileges as long as the company continues to profit from her. I saw only a few at high levels, but their knowledge and ability in all phases of their jobs was awesome. I am happy to have them as friends and associates. If they are holding me back, or reducing my salary, it is only because they have more to contribute and a better way to present it. Competition exists, second chances are rare, and life is tough, but everybody gets the same lousy breaks. Sex, race, and religion take a back seat to profit and ability in the USA these days.

  208. Men don't like computers either. by Above · · Score: 2

    I don't think men or women like working in computer fields. The enviornment created by today's high tech companies is terrible. Long hours, no social interaction, constantly fighting stupidity that is out of your control. Most guys in computer fields are unhappy, or at least neutral. You find few working in the field who are truly happy with what they do.

    So, what is the difference? Women are willing to put their happiness first, and choose other jobs. Men are more inclined to put up with the crap, in the quest for the dollar. That's why computer sallaries are so high, it's not that techies are really worth that much, rather if they were not paid that much they would go into other fields.

    In effect, this is good for women, at least from a mental health point of view, and bad for men. Of course financially this isn't true, and too much of "equality in the workplace" is focued on sallaries, which is a poor way to judge equality.

  209. Re:Maybe it's a technology thing? by Eil · · Score: 1


    I think your idea of guys in general is a little off... In my dorm, I'd say 98% of the guys here range in age from 20 to 24 and seem interested in loud music, drinking, fast cars, and pussy. Sorry if that last word might be a little offensive to some, but that is exactly how girls around here get treated. I am the only person I know of here that has more than one computer. A few think it's hip to own a computer, but those that do generally troll AOL and download pr0n.

    To summarize, pretty much every guy I know (aside from my one friend and those I meet at LAN parties) doesn't give one pissing iota about technology, so to say that *that's* the reason a lot of girls aren't into it isn't quite the exact answer. I am a male, btw.

  210. Re:Time Isn't On Their Side by rulb · · Score: 1

    I personally would be happy if the guys at work would let me stay forever and work on stuff. But they make me go home all the time. And I disagree that time isn't on our side. I would rather much goto work do some programming, have another discussion trying to convince everyone as to why if you did such and such in *NIX it would be 10 times easier. I do know from school though that a lot of the females think that it takes way to much time to do all of the work, but after awhile you kind of get used to the idea that if you want to be a female in the field well then you are just going to be alone. I personally find that fine, I'd rather be around all of the "geek guys" to talk about stuff that interests me (basically anything computer related) than to hang around people who just don't understand the stuff. If they don't understand it, it drives me crazy. The only thing that I've really noticed about being a female is that where I work, people on the phone naturally assume that I'm the secretary instaed of one of the software developers. Either that or they hang up because they think they got a wrong phone number for a software company. The thing that makes me really sad about being a female in the CS department is that as I've been at school then number of females gets less and less, I'm the only one in most of my classes. That's what really dissapoints me is that most females seem to think it's to hard. (This tends to be true at my university, I can't speak for others.) Just my two cents.

  211. Re:Miranda and Ki by derrickh · · Score: 1

    I'd take the Sony ES home theatre over the 750iL any day of the week. Just imagine watching Aliens Special Edition on a huge screen, sound blasting from all directions... damn... now I know why I dont have a girlfriend.

    But a Dual P3 933... it's just not fair!

    D

  212. Coding is not a glamorous job by browser_war_pow · · Score: 1

    That's why they don't go for us. It's interesting though because physically I'm built much more like a jock than a geek but mentally I'm probably 80-90% geek if not 100% :) The girls react to me once they deal with me no differently than they do when they meet the average stereotype geek.

    Coding is not a glamorous job to the general public. It really is seen as being as mysterious and arcane as witchcraft (which is fairly easy to understand when you actually study it). I also think many of the females in our society fear geeks because we have skills which make us look like people that are too smart for them.

    As for social pressure..... BAH! You're supposed to rise up beyond those around you and achieve the things in life that mean something to you. Right now I'm learning C++ and PERL and am going to strongly consider learning either ObjectiveC or Java so I can learn COCOA development. Frankly I think it's just easier for guys to tell society that it can take its demands that we conform and shove them up its ass.

    The final thing I think should be pointed out if it hasn't already been is that even in high school the smart girls don't have the sense to go to the guys they know will adore them and NOT want them to hide their smarts. My school's ACT (academic competition team) has a lot of guys that are in as good a shape as the jocks and we are also very intelligent. Most of the smart girls though don't have the sense to go to us instead of the jocks, even though they know WE WANT SMART GIRLS.

  213. Oh spare me. by Chixor · · Score: 1

    Geeky guys are hot. I even love a geek. I look forward to the day I can work with geeky guys, and I think any girl who is still intimidated by men is just psychologically unsound. Also, they're obviously dumb. Hello, anyone ever hear of QUOTAS?!?!?! Its those wonderful quotas that mean that girls get hired more easily at better wages than guys, due to the lack of females in the field. So they're being stupid by not pursuing it. Why would we want girls who were shoved into the field versus females who had a passion for it anyhow?

    1. Re:Oh spare me. by Devzilla · · Score: 1

      >Geeky guys are hot. I even love a geek. maybye the world has hope yet ::grins:: =)
      Devilish

      --------Irc.destructor.net--------
      --------The Geek Network--------

      --
      Devilish

      www.sci-fact.com - From Fiction to fact -
      Your one stop science news and discusion site.
    2. Re:Oh spare me. by Chixor · · Score: 1

      Well duh ur my geek arent you? :D

  214. Re:But... by timmyd · · Score: 1

    hey, i thought that was pretty funny

  215. Re:Call me selfish ... by benwb · · Score: 1

    It all depends on where you lie in the food chain. At least from the programming end (I've seen studies in literature for this one, see the Mythical Man-Month ), and from my experience on the Engineering side of things, the top ten percent of the people you run into are an order of magnitude better than the average person. I once broke it down for a manager I had this way: you can have superman, or you could have aquaman. You only have to pay superman 40% more. What do you do? (alright, so speed had just come out) Of course as management you run into problems if you think that you've hired superman, and you've really only hired aquaman... and as an employee you run into problems if managements thinks they have aquaman when you're really superman.

  216. Re:because women are "intellectual aristocrats" by quietlysubversive · · Score: 1

    I completely agree with you. Albert Einstein was nothing more than a "trained chimpanzee" and he would have benefited modern life/culture soooo much more if he would have written a few piddling songs or poems, rather than come up with his revolutionary theories.

    But then, what do I know? I am just a chimpanzee in training.

    --
    ----(o)----
  217. It's all in the name by pleitner · · Score: 1
    At the University where I did my Computing Science degree and currently work, the School of Computing was concerned about the lack of gender balance in their courses.

    The solution: create a new course called "Information Technology". This course has less maths and concentrates more on the practical uses of IT rather than the high CS theory and mathematical content that a good CS degree has.

    The results were amazing. About 40% of new enrollments were female - quite a few attractive ones as well (this is something that was sadly lacking from Computing Science previously :) It seems that most of the girls who were potentially interested in computing were turned off by the "Science" part of CS.

  218. Re:Geeks GET Girls, Though. by derrickh · · Score: 1
    Until I see a .png or a .jpg of her, I don't believe you.

    D
    (My girlfriend is Minnie Driver)

  219. Re:definition of geek. by the_v · · Score: 1

    I've always preferred the term nerd myself...

    :)

  220. Re:Miranda and Ki by BitwizeGHC · · Score: 1
    Actually I prefer Lydia but Ki's ok too. :)

    In three-space I have actually met two or three true, dyed-in-the-wool hard-core females of the geek species, who can hack C++ with the best of 'em. Hot ones, too. It's an interesting reaction when a member of the tribe finds a female of his own kind out amongst the mundanes. Like female mechanics, however, female hackers are a rare treat. I believe it's because women are on average less interested in cars, computers, and other such techno-toys than men are. They tend not to be fascinated by things but by people. Again, on average. Your mileage may vary.

    Guess it all fits into that psychological interplay between men and women. The most I'll ever hope for is someone who's sufficiently fascinated with one particular person, i.e., me. *sigh*

    --
    N4st0r, trixx0r h0bb1tz0rz! Th3y st0l3 0ur pr3c10uzz!
  221. Re:some truth to it... by cco · · Score: 1

    How many kids are there that don't care what other people think of them?

    My daughter is 10, likes Britney Spears (and Monk, and 'trane - she's 10, not stupid), and got her first computer at 8 (just as her brother did). She's annoyed that *she* is stereotyped as a geek just because she's good with math and can use a computer better than most of her class. The social pressures start early and don't let up.

    I told her that most of people that are on top in school peak shortly after, but geek girls just get better with age. I'm very happy that she has some examples of great women that like geeks and/or are geeks.
    --

    --
    busy, busy, busy
  222. Re:use the web! by timmyd · · Score: 1

    i sort of felt the same way about the creating stuff. i always wanted to "make exe files" because not many people could do that. so i went: vb-delphi-c++. i wish i had learned about gnu/linux earlier though.

    the real problem is that parents (atleast mine) don't understand that I would rather write programs on the comptuer more than anything else. i don't want to go to moves, go out with friends, play baseball, or go skiing or to the beach; i want TO STAY HOME AND PLAY MY COMPUTER!!! ;-)

    i've never had a gf before. but i think those might rank equal to my computer. so it would be a hard decision whether to go away from my computers then. but i don't have to worry about that; won't happen any time soon... heh

  223. Climbing the mountain by slakhead · · Score: 1

    I dont think that just women look at programmers as locked up in a little room with no windows typing away furiously. Most of my friends find my interest in programming insane and cannot understand why I would waste my time debugging some code rather than playing video games (not even perfect dark can compete with a nicely messed up bit of illegible perl code).

    but i think for those who understand programmers, there are still those who wont take part. i think of it like mountaining climbing. why climb a mountain? because it is there!

    programming is probleming solving and once you get to the precipice (gcc myuglycode.c) you can look back at your accomplishment and revel in your skill (or lack there of if you get errors). when you are solving a problem, you think only about how to solve it and you dont tend to worry about what you look like, what you are putting in your mouth for sustenance, or who is talking to you. i think i can see why this sort of outward degredation might turn off women (although there will always be a percentage of women who get it too).

    anyway, looking at my neat little metaphor, it brings up the question: How many women mountain climb for fun?

  224. Places where people look... by suwalski · · Score: 1

    I work at Nortel Networks. There are very many females in my work area. In my group of twelve people, there are 5 women. That's a pretty good figure, if you think about it. All of them know high-level programming languages, the most relevant to our work being PERL. The age range is also ver large, from 1st year university co-ops to my group manager, who has obviously gotten further than many men.

  225. Home Improvement mentioned this by battery841 · · Score: 1

    Okay, this is kinda dorky, so please put up with it. But, I think that there is some legitimacy to it. A few years ago, I saw a home improvement where Wilson was telling Tim about why men like cars. Women have the privilidge of child-bearing. They "create" something. Well, us men need to create something too. In the show they used the example of cars. However, for us geeks, this applies. We write programs, put together hardware, make networks, etc. We're creating just like car. I'm not saying this is 100% true, but what Wilson said seems pretty on.

  226. buncha shit. by small_dick · · Score: 1

    first off, there are a lot of careers that women, for the most part, don't enter. mechanics, most engineering fields other than 'putes, welders, etc. why single out 'puting?

    second, no individual should let the herd decide what they want to do with their life. if you don't wanna be a geek, don't do it. but don't blame men.

    if i had cared what the average american male (or female) throught, before, during or after adolescence, i'd probably go kill myself. this is a very sick, putrid society. i'd say we are the cave people of the future, but i think cave people were far more civil that "modern society" with its racist, sexist entrenched corporate greed. so don't listen to anything but your heart, your loved ones, and the facts.

    third, two of the best programmers i've worked with are women, and several top computer people are women. most of the girls i knew growing up couldn't study or concentrate for long periods of time. that's a killer for any analytical career.

    the women i know who are accomplished scientists all had strong families. that doesn't bode well for the future of today's kids. you can do it, it will require more concentration.

    take it or leave it, that's my opinion. Girls, if you want to grow up to be geeks, you're probably going to have to deprive yourself and study just as much as the the penis people. don't know any other way around it.

    the imbalance will continue, until you make the change. of course, with so much politics in the technolgies, i'm not sure, if i had to do it all over again, that i would choose CS. quite frankly, there's a massive push in corporate USA to move software and technology overseas, and to bring the top overseas people here.

    i'd strongly consider teaching or bio if i were in junior high right now. if your a teacher, you can pick up and go pretty much anywhere -- every town needs a teacher.

    but engineers? you're constrained to the cities. make more, but everything costs much more. you'd have the same problem with bio. still gotta study hard!!!

    --


    Treatment, not tyranny. End the drug war and free our American POWs.
    See my user info for links.
  227. Re:Computers not just for boys? by Krystalia · · Score: 1

    she assumes it's directed toward her, rather than just being the way the group normally acts.

    It's possible, but i've experinced it on a one on one basis being around only one person at a time and he won't let me do anything, he'd rather do it and say how easy it was for him to do, then to show me or explain to me why what i was doing is wrong. Which i take as an attack on me, but it's possible that he'd do it to anyone who asked him the same question, just seems as if he's harder on me, but i could be wrong.

  228. Re:Miranda and Ki by Zurk · · Score: 1

    bah. all real geeks have dual alphas anyway. :)

  229. Girls Don't Want To Be Geeks by HRbnjR · · Score: 1
    "It's tough work getting it to work exactly correctly and it's frustrating because one misspelled word and you can't get it to work,"
    After three hours of bashing my head againsed my desk I finally change that 'i to a 'j' making it work, at least long enough that I have a chance to read this Slashdot article.
    Referring to Microsoft Corp. chairman Bill Gates, she added, "I say let him have it all, let him do it all."
    Ahh! Let Bill have it all??!!! The first sign of a geek grrl and I'm ready to fall in love...but with a statement like that she really knows how to shatter a geek guys dream!
    "I don't want to take computer science. ... Just looking at it, all the programming and these funny-looking things on the paper. It (takes) so much stuff to do one thing on the computer."
    This girl is obviously cut out for helping debug the balancing issues in the Linux kernel VM code! Or just think of the how rewarded and happy she could have felt if she was the one to write twenty thousand lines of code to have her new I2O camera be able to work with the Linux kernel!
    Several girls in the study, as well as Katy and some of her classmates, also criticized the popular computer games for being much more appealing to boys than girls. On Amazon.com, for example, a big seller recently was "Diablo 2," which boasts an "advanced combat system which incorporates class-specific fighting techniques and spells."
    Yeah, those geek guys and their violent video games! Who would ever find that kind of thing appealing anyhow. Nudges Diablo box under desk
    "My parents always say, 'Do something with computers,' because it is stable and stuff, but a lot (of people) don't want to be at a desk from 9 to 5."
    Ha! Did she say 9 to 5!?! Oh yeah, I can see why she is worried! That would be awefull, having to be in front of the computer till 5 every day. God forbid, one would say, be at work at 10pm on the 3rd day of a long weekend!
  230. As a techie female... by NetChick · · Score: 1

    The issue of women in computers is more complex than saying that women just prefer clothes and nail polish...I have a ton of both but am also DAMN good at what I do (Network/Systems Admin). I think too many women don't get the thrill of solving a problem on their own because they have never really done so. Many women I know who would be very capable of working in the field don't because they date men that do and leave that area to the man. Too many times I have seen women being patronized by moronic guys who think that because they have a decent salary and a good title that they are network gods. There are a lot of women working on phone support and helpdesk but they never have the confidence to make the leap forward. I feel that most women work better when they receive encouragement from the people around them. I think too many women see the field as a boys' club where they aren't valued. The few women I have worked with have on average been some of the best techies I have known...so maybe if we don't have higher numbers we can just settle for being better at it. :)

  231. We are not created identical? by Sedennial · · Score: 1
    In my 20 plus years as a geek I've encountered a few true girlgeeks. Almost without exception, they mirrored the personality traits of guy geeks. Tending (not always) towards obsessive fixation (I mean, come on, what other mentality can happily pull 24+ hour sessions simply because they're compelled to crush that bug or beat that level?), as well as a desire to control their enviornment.

    Generally, guys are externalized in focus. i.e. They exert control over their world though the manipulation of the material/physical. This is exhibited also in the tendency of guys to be less introspective than women. Though this does seem to be changing gradually over the last decade or so.

    Girls however tend to take control of their enviornment though people and relationships, thus internalizing and being less obsessed with changing their physical enviornment to retain control. Someone pointed out in another post that if they give a young boy and a young girl the same toy the boy is more likely to take it apart and the girl is more likely to try to use it. This is an astute and generally correct observation.

    I think that these psychological characteristics have more to do with the perceived gender gap. Which I don't think is necessarily a gender gap at all, but a simple outgrowth of the natural differences between guy and girls.

    Yes, I'm expecting massive flames here. =)

  232. Are the fears women have unfounded? by Manwe · · Score: 1

    Well, I read the AP article, and they indicate there that girls in highschool and so on are scared of working in a place full of geeky guys, windowless rooms, and endless hours in front of a monitor.

    Now, fortunately, the definition of "geek" is finally becoming more positive, albeit slowly. However, the above description does match pretty well with a lot of high-tech workplaces I've seen. If young women really don't want to work in these environments, then they're probably making the right choice not jumping into CS in college.

    The interesting thing to me is that more men aren't turned away by the same description. Honestly, the high-tech people I know, including myself, lead really grueling lives with little personal time. Perhaps the article is really saying that women, even at high school and younger ages, place a higher priority on non-financial "quality of life" things than young men do. Thoughts?

  233. Re:Miranda and Ki by GodOfHellfire · · Score: 1

    hrm....interesting theories.

    my ubergeek boyfriend drives a porche that he races, but he doesn't do the designer clothes thing, or the socializing thing. however, between work (he's on call 24/7), racing, kung fu 5 days a week, and general tinkering with boxen at home, he doesn't have *time* for that other stuff.

    *shrug*
    all i know is that he is the most wonderful person i have even known in my whole life. yes, Miss M has finally fallen in love.

    ps - i'm a geek too!

  234. Re:Girls in technology. Hello, misogyny! by lythe · · Score: 1

    I teach web development classes to lots of women. I find that they easily get frustrated with software in a short period of time. I believe this is a result of women primarily deriving their logic from emotions and men primarily deriving their emotions from logic.

    Ah, I see we're resorting to 19th-century stereotypes to explain gender differences again. "Women derive their logic from emotions"? Come on, be realistic. How hard can it be to realize that people's emotional lives and their professional lives are not the same thing, and frequently are not even related?

    I readily admit that when it comes to emotions, I'm not as logical as most men I know (though this isn't true for all women). I'm more likely, in a relationship, to be the one who starts crying in the middle of an argument for no good reason and has to be calmed down. I don't know if it's socialization, biology, or just my birth control pills. But hey, my boyfriend and I can handle a little irrationality in our relationship.

    But my emotions do not affect my professional life. I can go home/back to work from an emotionally exhausting day and write a history paper, design a newspaper page, or install my new ethernet card, and my emotions are simply not relevant. Sure, if I get frustrated about a relationship I'm in, I'll act irrational, cry, and call my friends for support. But if I get frustrated during a hardware installation, I read the manual, swear, try a different slot, and troubleshoot until the damn thing works.

    A lot of women get frustrated too easily by technology because they think it's too hard. Similarly, my very intelligent geek boyfriend gets confused and annoyed if I ask him to scrub a potato. But these traits are learned, and they can be unlearned.

    Unless, of course, people like you keep perpetuating archaic stereotypes about how it's just natural that women are only concerned with emotion, not logic.

    --

    Slash has nothing to do with Slashdot.

  235. It isn't just in the work place by DevilM · · Score: 1

    I run an IRC network for gamers and it is mostly male. I often ask the few female users we have how they feel about the situation. Mostly they don't see what the big deal is that they are female and play games. Usually they have a boyfriend/husband who got them hooked on games. The thing that turns them off is how males treat them. I think we need to get past the whole gender thing. I would love to work with more females. I would love to play online games with more females. I would really love to meet a female who understands why I am a geek and what it is all about.

  236. Re:My own (vicarious) experience... by bridgette · · Score: 3

    There dosen't *have* to be a 50/50 split in everything but there are a couple of good reasons why some people are trying to encourage woment to persue sciences:

    1) On average, women make less money than men. This is mostly because of carrer choice. Tech jobs can pay very well. Some people feel that gender pay inequality is bad for society in general - contibuting to the childhood poverty rate and such. Some people feel that as long as women have second class finacial status, they will have second class political and social status. Personally, I tend to feel that everyone should have an equal chance to take care for themselves financally and feel these these efforsts help remove barriers.

    2) We could use more tech workers and women are an 'untapped resource'. With all the companies lobbying to increase the number of visas, it only makes sence to spend some effort in genreating more applicants at home.

    3) Having people from diverse backgrounds working on design and problem solving often yields better results.

    4) People already in the industry (both male and female) would, all other things being equal, enjoy having some more women in the office.

    --
    - bridgette
  237. What salary ceiling? by kimbly · · Score: 2

    I don't know what salary ceiling you're talking about. I'm making 90/hr as a contractor, and I'm only 23. My last permanent position (a startup) offered me 90k/year plus 1% equity to stay -- and I turned it down. Maybe attitudes are different where you live (I'm in Boston). Or maybe you just aren't as technically skilled as I am -- I dropped out of high school five years ago and I've been doing C++ and Java ever since.

  238. Re:Our Sad Technical Frat by restless_ne'erdowell · · Score: 1

    While I know sexual harrassment can occur anywhere, I'd be surprised to find that it's very common in technology fields. My technologically-adept male friends, co-workers, and classmates all seem far less interested in the whole power-trip thing that goes along with sexual harrassment and more interested in sharing an idea about how to code something more cleanly, or telling me about the new system they're setting up, etc.

    In my experience (I know, not a significant statistical sampling) it seems that the members of the tech-frat care less about what gender you are than about what you know and can do.

  239. Red Herring and Corporate Hypocricy by Seumas · · Score: 2
    It is much easier for Corporate America to pit genders and classes against each other so that they're too pre-occupied with pointing fingers back and forth to bother doing anything about the general, broad-stroaked shaft that everyone get's hit with in technical careers.

    BoyGeeks and GirlGeeks are not the enemies. Ask any male in a technical field and he'll tell you that he wishes there were more women in his line of work. If a finger has to be pointed anywhere, point it at the people who make choices and actually have impact on the hiring and encouragement of women in these careers (and classes in school). Further, do something about it.

    I don't fall for the statistical bullshit. Men and women are different creatures and there are obvious reasons why there are such rifts between careers paths. It's natural. More women stay at home to be mothers. More women take maternity leave. More women work only part time instead of full-time, to take care of their children. This is just the tip of the ice-berg of differences and we haven't even touched the inherent trend of differences that cause is to find our interests in various fields and areas of life.

    So do we just shrug and say "well, that's life and we're different -- I guess we'll just have to live with it".

    No. When an industry needs more people to populate its positions, it advertises, reaches out to schools, conducts press-releases, gets as much air-time and play as possible, to attract people.

    So if we're so interested in bringing more women "into the fold", then lets do something about it. Offer to help children of all ages, genders and nationalities to learn about technical careers. Some will get bored to tears and give up, but others will sink their teeth into what you have to offer and either run with it as a career or enjoy it as a hobby. Don't focus on males or females, just put the information, encouragement and assistance out there and let it affect as many people as possible. You can't force people into anything, but you can offer them a chance that they didn't have before.

    And for businesses -- reach out to a younger crowd. Screw gender; just offer more itnernships, employment or outreach programs to the communities that you are 'a part of' and teach skills to people who want to learn. You tend to offer jobs and careers to people who have had the privelage and oppertunity to attend four year colleges and universities, but what happens to the sixteen-year-old boy or girl who pounds away on coding or other engineering projects in his or her bedroom day and night, but can't afford schooling or certificates to catch your attention? You're exhausting your pool of potential employees, because you're failing to help out. It's cheaper to hire out to other countries and bring people in on visas (not that there is anything at all wrong with that, but then you turn around and complain about it -- citing lack of employable people in this country! God, you're such hypocrits!).

    Just because the pay-off isn't within your immediate future doesn't mean the investment isn't worth your time and money. If nothing else, the publicity and good-standing with communities for your efforts to help people who want to learn and get a toe-hold in the business will be worth the cash and time.
    ---
    seumas.com

  240. Re:GIRLS WANT JUSTICE FOR OSM by Zurk · · Score: 1

    interesting. it would be nice if /. actually publicised it a bit...OSM launching DDos attacks is certainly grounds for criminal charges. OSM is currently winning the /. population over here with his frequent AC trollish postings..or at least his friends acting on his behalf seem to be...a simple story will make it official and appease everybody. just hope you guys do it quickly or the trolls *will* win this round - and make /. look like its suppressing the first ammendment to boot.

  241. Re:Geek chic(k). by santajon · · Score: 1

    I'm a senior at high and I know everything but high lvl networking and programming. I've had numerous girls after me because of my bod. I don's play in any sports but i bike to school and work( 5 mi one way) everyday. My girlfriend always get comments from other girls about my a$$ so there are good looking geeks out there. And yes I'm proud to call my self a geek!

  242. Gender differences: Do we want to train them away? by RichMan · · Score: 2
    It appears as though lots of study has been done on gender differences in learning, especially in math and science.

    This This appears to be a good technical summary with lots of subsiduary references. Or try feeding "gender differences math" to the search engine of your choice.

    One point must be made is that men and women are different. (and oh what a beautiful difference) This difference starts at a fundamental chemical level and is revealed in physical appearance and social behaviour.

    One study which I saw some time ago and alas can no longer find study the way groups of high school math students solved problems. The females were happy to accept a solution, even a wrong one, that the majority of the group accepted. While individual males would support their solution against the majority if they considered it correct. (general disclaimer: whether other groups or individuals behave this way, who knows). What it does show is that social behaviours have a lot to with scientific investigation.

    There was also that british study that showed that London taxi drivers grew their brains to better navigate the city. I am sure the amazing adaptable human body can make up for any basic gender differences if the appropriate training is provided.

    The questions we should be asking are:

    1) To what level should individuals be subjected to training that will change their natural gender tendancies.

    2) What level of maturity is required before individuals are allowed to select such training for themselves or are others allowed to make against gender training decisions for them.

    3) Is it desirable or detrimental to society as a whole to have the natural gender bias result in gender unbalanced professions. Or should some professions require that a reasonable balanced be maintained between the genders.

    These are basic rights questions. We have the technology, should we and to what level be using it.

  243. I want to be a geek. by heidiporn · · Score: 5
    I think I may be one of the few chicks to answer thus far, and I hesitate because I'm probably not as qualified as most to answer this, as I am not currently a full-fledged geekchick, though I hope to be someday.

    A friend sent me an article once - I think it may have even been posted on /. - about why a lot of girls don't become programmers. It offered up the notion that most girls are reared not to obsess over how and why things work but, rather, over their social relationships.

    In an era when it is cooler than ever before to be a dork-guy, when guys who run internet startups are sought after for their bank accounts and their geeky sensuality :), I'm afraid it is still not cool to be a geeky chick. I think this owes itself at least in part to the fact that there are currently so few (relatively speaking).

    The geek-chick bandwagon does not yet exist, so it is hard for even those who desire to immerse themselves in all-things-geeky to jump on...

    Girls, ladies, women, chicks, babes, broads, pieces-o'-ass or whatever you want to call them are taught to nurture relationships. Doing so inhibits their ability to sit in front of a computer all day and pore over code or read /. A lot of women don't see overclocking a 1 GHz Thunderbird in mineral oil or soddering or disassembling some piece of electronic equipment, rewiring it, and then reassembling it or sitting in front of a computer screen for hours and hours a day as valid, socially acceptable ways to spend their time. For many women, it is a better use of time to spend time with friends, talk, position themselves in a career where they can work with people, rear their children, or involve themselves in charity work. (Don't get me wrong; these are all noble things.)

    Moreover, in an effort to support their social relationships, girls (and the eventual women they become) learn they are supposed to worry about grooming, going out, shopping for the latest trends, decorating their homes, hosting dinner parties, caring for their kids (even in a two-career family), and so on.

    I know this is fairly incoherent, and I apologize... I wish I were expressing myself better... because I am very passionate about this issue. I am a chick, and I am a dork, and I am proud to be both.

    To sum up that which I have spent several paragraphs babbling about: It's still not cool to be a geek-chick. I hope one day it will be, as I am one of the few, the proud, the sexy :) who aspires to be one. :)

    -heidiporn :)

    --

    heidi

    1. Re:I want to be a geek. by Grendel+Drago · · Score: 1

      You've hit the nail on the head. Props to you for coming forth.

      My girlfriend is smart as all-git-out, but she's more the people type. I'm painfully introverted, she's outgoing and charming. Plus, she's cuter than me.

      - grendel drago

      --
      Laws do not persuade just because they threaten. --Seneca
    2. Re:I want to be a geek. by Ninjacam · · Score: 1

      We all become too wrapped up in social stereotypes for our own good. That is certainly part of the problem. When folks think "social event, nurturing, etc." they think "woman", when folks think "need directions, need something technical or mechanical fixed" they think "man." It is a VERY sad commentary on society, but unfortunately still true.

      My fellow females, don't wait to "jump on the bandwagon" because that bandwagon ain't gonna come! Follow your interests rather than worrying about what people will think or say about it. Don't worry about your social life, either...Once all your non-techie friends find out you can fix their computers they will be calling you all the time! :))))))

      --
      -- Some people live life in the fast lane. I live life in oncoming traffic.
  244. Diffrent issues by Felinoid · · Score: 1

    Yes there are socal pressures pushing you to "the norm". You'r a guy you like football right? Play foot ball.
    But if you go against the main and go to computers if you are a guy you are encuraged. If you go to chess club you get a thumbs up. If you go to debate club you make friends.
    Girls going to computers get "ahh you don't REALLY want to do that". So even AFTER expressing an intrest they get pushed away.
    It is very unusuall for a kid to continue to presue intrests once an athoritry figure trys to discurage them.

    Guys might get prodded into taking an intrest in sports but they don't interfear once a guy takes intrest in computers.
    Girls however.... The most intelectual thing they were allowed to be involved in was the debate club. Other intrests were heavly discuraged.

    Nothing stopped me from preformming atheticly AND intelectually. Where I went to school it was expected. The jocks didn't have it any better than the geeks.
    I did catch it for never joinning the football team or the track team. But NEVER for my intrest in technology.

    --
    I don't actually exist.
    1. Re:Diffrent issues by h0udini · · Score: 1

      Yes there are socal pressures pushing you to "the norm". You'r a guy you like football right? Play foot ball. But if you go against the main and go to computers if you are a guy you are encuraged. If you go to chess club you get a thumbs up. If you go to debate club you make friends. Girls going to computers get "ahh you don't REALLY want to do that". So even AFTER expressing an intrest they get pushed away. It is very unusuall for a kid to continue to presue intrests once an athoritry figure trys to discurage them.

      I don't know about that. I took a lot of crap in school for taking a technical route. I never went out for sports of any type in school, even though my size meant "basketball" to most people (I'm tall). Almost no peer support until High School. Even then, only a few people out of the 100+ in the program (alternative school) counted as peers.

      Back in grade school, I did chess club. Got beat up a lot. Didn't do sports back then, either.

      Anyway, the purpose of this is not to whine. The point is: environment only matters so far. I did keep at computers, through a negative environment. If one has a serious enough interest, they can get through the "authority figures" and peers attitude toward the chosen goal.

  245. i hate femminism... by spinster · · Score: 1

    it's up to the parents, not the school to encourage children to do well in school. if the school falls behind, the parents must supplement education at home.
    in the workplace? the only problem i have with geek males that i meet is that they usually try to interview me as an anthropoligical specimin, but it's no big deal. get over it. Geeks Rule!

    --
    I have a .sig?!
  246. Re:My own (vicarious) experience... by Art+Tatum · · Score: 1

    It's because we worship (yes, worship) equality. Not as in, "Don't discriminate against someone different from you," but as in, "Everyone must be exactly the same!" Our quest for the elusive "equality" has gone beyond what is reasonable and possible. And I don't want to hear any utopian socialists saying that mankind will evolve to perfection or other such crap. Ain't gonna happen.

  247. not an excuse by Spider-X · · Score: 1

    Women don't like programming, plain and simple. I know quite a few women wanting to major in CS... problem is, they all get turned off quick by programming, and now three of them are changing their major because of it. There are just as many geeks in "chemistry" as there are in "biotechnology" so the whole 'seen as a bunch of geek guys' thing is completely wrong.

    --
    witty sig goes here
  248. Re:If i was a girl.... by Nezumi-chan · · Score: 1
    Maybe we need to start a date-a-geek campaign.

    There already is. Check out Peer 2 Peer.

  249. Computergrrrl vs. The Man by Frymaster · · Score: 5
    I must relate the recent tale of woe that has befallen my beloved.

    Act One: Computergrrrl meets the patriarchy
    Computergrrrl has been a geek of many stripes for most of her life. About 2 yrs ago, she decided to actually pursue computer programming at school. She went, saw and conquered, and with her freshly-minted diploma in hand, landed a job at an internet startup. Her job description was titled "junior programmer". The immediate reality, however, was different. This company made two hires in the same week, both fresh grads; one was computergrrrl, the other was a boy who we'll call Rob (well, that's his name). Rob was plopped down at a desk in the "back room" and set to work on ASP stuff immediately. Computergrrrl was plopped down at the reception desk and told to answer the phones and compile a list of office supplies. When computergrrrl pointed out to her new employers that she had no secreatrial training whatsoever, she was told that she should find "it came naturally" and that they "couldn't possible have one of the guys do reception"

    Act Two: Geeks ride to the rescue
    This company is divided into two layers. Business guys who have the money and call the shots, and coders who write the product (service?) and get free pop. After a few days, the "head coder" who we'll call Gord (well, that's his name) started to realize what was going on. At the end of a week, he confronted the owners and told them that they were denying him a valuable resource (computergrrrl) and that this "misallocation of talent"(his quote) was unacceptable. The owners hummed and hawed over transferring her, finally prompting gord to ask them why they had chosen to hire a woman in the first place, if they really felt her gender precluded her from doing her job. The answer: "We figgured she could do the reception work and help you out with little things in her spare time."

    Act Three: making a loooong story short(er)
    The ultimate compromise, was that computergrrrl was moved to web design (it's artsy! girls are good at artsy!) and, over time, into some backend coding (computergrrrl to owners "java is a new language. I have a talent for languages." language=artsy.)

    The long-awaited moral of the story
    Geeks tend to work on a merit-ocracy. You're judged on your chops, not your sex, race, religion (unless it's linux) etc. Sadly, a lot of the hire decisions are made by the money people. They can't tell good code from bad code (hmmm. I can't decipher it. It must be a good code...) and tend to have more "traditional" views of women in the work place. If you're a girl and you're a geek, find a boss who's into computers more than s/he's into money.

    thank you for your patience.

    1. Re:Computergrrrl vs. The Man by catfood · · Score: 1

      "couldn't possibly have one of the guys do reception."

      Why the hell not?

      Nothing wrong with that job. If you like talking to people and don't need to make much money, it's really quite a good job.

    2. Re:Computergrrrl vs. The Man by Frymaster · · Score: 1
      Why the hell not?

      Don't ask me, ask Mr. Startup Owner... The gist of the whole scene was that women are designed to do women things (clean, raise kids, be secretaries), men are raised to do men things (fight wars, watch sports, play with computers). Mr. Owner is enslaved to these notions contrary to the evidence around him.

      Nothing wrong with that job.

      No there isn't. The biggest issue was that computergrrrl was hired for one job (programming) and given another (reception). She has no reception skills or training and only had her position altered because of Mr. Owner's afformentioned mentality.

      NB. I answer my own phones.

    3. Re:Computergrrrl vs. The Man by K. · · Score: 1

      And she didn't quit on the spot why exactly?

      K.(at thee have, grammar!)
      -

      --
      -- Proud descendant of semi-nomadic cattle-herders.
    4. Re:Computergrrrl vs. The Man by mjgday · · Score: 1

      "If you're a girl and you're a geek, find a boss who's into computers more than s/he's into money."

      I'd say that this goes without saying for any geek, work for people who understand you, it's taken me a while to realise this, but working for money minded people really sucks.

      There are two kinds of people in the world; those who believe the best product comes from people who are payed to do what they do and those who believe that the best product comes from those who do stuff coz they want to.
      M
      --
      Sic Itur Ad Astra
      www.gatrell.org

      --
      foo
    5. Re:Computergrrrl vs. The Man by Nicolas+MONNET · · Score: 2

      If investors and customers have a boner when they enter the company building, well you're standing much better for that negociation. Some guys are so fucking retarded, they might just want to come back just to have a chance to see that girl. That's why they put a woman. (I've noticed that, the bigger the company, the closer to the central office, the cuter the receptionnists were.)

  250. blah by Dirty+Hippy · · Score: 1

    I have always thought that maybe the dispartiy of men to women in the IT industry might be linked to human evolution. I believe that a woman's traditional activities over the course of human evolution would have encouraged social interaction much moreso than a man's. This probably would've meant that those women who were more adapted to being social had a greater chance of reproducing, so, via natural selection it seems plausible to me that women are more social creatures than men are. Also, in my experience, I have observed that women tend to be a lot more people and relationship oriented than men. Now, Think about what you had to do to become as good as you are with computers? I don't know if I am a typical "geek" or not but I do know that I spent about 3 years of my life coding from the time I was 17-20, and I can tell you that learning about computers is often times a solitary activity. Given the fact that most women that I know are much more happy when around other people, it makes perfect sense that often times they would not be interested in a field that almost requires so much solitary learning and concentration. just a crackpot theory.

  251. could it be because of sociality? by Mr.roboto · · Score: 1

    Many so called "geeks" are loners as far as many sitiuations go. They find ways of socializing that aren't "normal" to others, such as chatting. What if the ladies aren't comfortable with this because it violates their nature. Computers take a lot of time and devotion, which isolates ppl from the non computer world a bit. Some people find this unnatural, both men and women. oh well,this rant is really going nowhere.

    --
    Don't call my crazy, that's what they called me back in the home!
  252. Re:Geeks GET Girls, Though. by Zurk · · Score: 1

    i'll second that.

  253. Re:Girls don't watch the Man Show or play Football by bridgette · · Score: 2

    Women don't watch The Man Show for the same reason as men - because it isn't funny.
    (although I know some guys who will try to catch the girls on tramolines bit at the end)

    --
    - bridgette
  254. Re:The natural gender gap. by mllenerd · · Score: 1

    It's good to be an exception.

    I don't know about the rest of you out there, but I love a guy that thinks logically.

    And I also happen to love solving problems and learning incredibly difficult stuff.

    --

    --

    --
    The geeks shall inherit the earth.
  255. bull by ProudestMonkey · · Score: 2

    I don't know what women they spoke to in that study, but I wouldn't have minded adding my two cents. Sorry, but all that junk about women not being able to hack it (no pun intended) in technical jobs is garbage. I'm in a technical field, and I've taken my share of crap from idiot guys who resent my presence, but it all comes down to self esteem, folks. I might not be the best at what I do, but I know that I'm good, or I wouldn't be getting paid :) If you're shying away from a profession you might enjoy just because most of the workers are "geek guys," your priorities are screwed up. People like this are one of the reasons that women still ARE treated as inferior in certain professions. OK, there was my two cents :)

  256. Girlfriend by CAIMLAS · · Score: 2
    That's bull. Tell my girlfriend that. She's going into it. She doesn't care much about salary - she does it for the love of geekdom. She's every bit as good at what she does as I am at what I do. And in many cases, better.

    That, and since she likes me. :)

    Anyone that goes into the field for any other reason isn't a geek.

    -------
    CAIMLAS

    --
    ~/ssh slashdot.org ssh: connect to host slashdot.org port 22: too many beers
  257. Re:Liberal Sociologists at work! by Brave+Little+Toaster · · Score: 1
    ...according to Scherr (her mother), about her 10-year old. Gee, she's 10! If she's screwed up, it's her mother's fault! Any bets on whether she accepts the blame?

    I agree that she should accept the lion's share of the blame. But don't forget that a 10 year old has spent at least 4 years in school (more if she went through kindergarten and preschool) and is influenced by people there as well. The mother will have little control over what her children's classmates or teachers say to her daughter, and sometimes events at school will leave a lasting impression.
    --
    brave little toaster

    --

    --

    --
    brave little toaster

    "Remember, don't try this at home until the statute of limitations has expired."

  258. Re: Legos... by Jasin+Natael · · Score: 1

    Well, I AM a guy, but I think that the Legos had something to do with my aptitude in language and in computers, too. I mean, for those of us who code, how is our job different from simply speaking another language? As children, with Legos, we learned how to take the simple building blocks that we were given and use them in all the ways they would fit together to accomplish our goals. Both of these processes are just a metaphor for the underlying thinking that one does to become CREATIVE.

    --
    True science means that when you re-evaluate the evidence, you re-evaluate your faith.
  259. Chicken and the egg by battery841 · · Score: 1

    "Several girls in the study, as well as Katy and some of her classmates, also criticized the popular computer games for being much more appealing to boys than girls. On Amazon.com, for example, a big seller recently was ``Diablo 2,'' which boasts an ``advanced combat system which incorporates class-specific fighting techniques and spells.''"
    These "several girls" including Katy, are criticing the gaming industry. The guys run the computer industry and the gaming industry (as this article implies). We rule it, so it makes sense we'll make games that appeal to us. I think the women will need to bite the bullet for now, put up with the bloody games, and get into the industry. By sitting here and crying about the blood, and not doing anything about it, isn't going to help. If the girls sit on their butt, doing what they like to do, then nothing is going to change. We'll make Diablo III and that'll be 2x as bloody as Diablo II. As they say in the open source community: "If you want a feature, write it".

  260. natural gap...my ass by DowntownCoder · · Score: 2

    If you think that evolution is what has caused different approaches to career selection and emotional state, you've been living with blinders. And if the other guy geeks on this board agree with you it's no wonder they keep complaining about needing a date.

    As a girl, from the time I was old enough to know the difference I was treated different from boys. I was given different chores, different toys, different clothes... I was repremanded for getting dirty and told to that "good little girls" sat quietly, spoke softly and politely. My brothers, on the other hand, were encouraged to be aggressive and "take things apart" because they were boys.

    Just in case you think my parents were the only influence of this type... I have been told by countless teachers, counselors, and college department heads (the cs department no less) that my interest in computers was misplaced because it was "no place for a woman". All this inspite of the fact that I graduated in the top 10% of my class, have been programming since I was 12 (on an old tandy that hooked to a tv), and continue to rank first in almost every programming class I take which are made up of 99% men.

    The only reason I have managed to stick with it inspite of all the discouragement is that everytime I sit down infront of this damn thing I remember how much I love it.

    And as for the different approaches to emotions/analytical thought that you claim are "evolutionary". Try to remember when you were 5... you and your sister both fall down, your mother wraps your little sister in her arms and comforts her with soft words and tells her how cruel the world can be...your father tells you to buck up...boys don't cry.

    1. Re:natural gap...my ass by abelsson · · Score: 1

      Ok, but would you classify yourself as a typical woman? The thing is, the grandparent to this never say it applies to all females, just most. Generalising saying all X are like Y is seldom right, but i think there might be a grain of truth in it.

      As for Genes vs. Enviroment i think most researchers are hovering around 50%/50% each (again, on the average).

      Still, i don't think society can account for everything that is today defined as typical female traits. I think that if you put a large no of newborn babies on an island, left and came back 20 years later that you'd find that, on average, women were less agressive and men were more. It's a pattern that repeats over all the world, even in separate cultures that have no connection. It's just too much to be a coincidence. But then again, i could be completly wrong. Happens all the time. :)

      Tell me what you think.. it's an interesting discussion.

      -henrik

    2. Re:natural gap...my ass by dvdeug · · Score: 1

      >If you think that evolution is what has caused
      >different approaches to career selection and
      >emotional state, you've been living with
      >blinders.

      What happens when a child is raised as the opposite of its biological gender? Frequently, that child starts displaying properities more usually associated with its true gender.

      Here's some honest questions: why are the figureheads in virtually every society male? Why are males the agressive sex in almost every society? Why do males have much higher levels of testorone (proven to increase aggression) if it's not biological?

      I'm not saying there isn't discrimination. But most other species, including all the higher primates, are sexually dimorphic at a psychological level. There is no non-ideological reason to believe that humans deviate from that trend.

  261. I married a geek! by Anonymous Coward · · Score: 1

    I just want to say to all of you geek guys, that although there may not be alot of geek girls on the market, there are plenty that would date you in a second. It's just that, most geek guys are too shy, that you wait for the woman to make the first move. Anyway, I married a geek, and not just your typical geek. He's a unix-using, perl-programming, NeXT Station collecting, etc., etc., etc. geek. Well, I guess that is typical for Slashdotters. Anyway, he was one of those guys picked on and harrassed in high school-you know the story. At any rate, we DID meet online, but I don't recommend that for everyone. But, we, the geek-loving women, are out there. Oh yeah, by the way, I'm not the poster child of the "She's got a good personality" club either. Of course, my husband and I are both the unconventional type, so that could also be why I was attracted to him. Freaky chick meets freaky punk and falls in love. Oh yeah, btw, we've been married 2 years, and I'm 23 and he's 21. So, just goes to show, you don't need to wait til your 40 to find some women who finally learnes that geeks are good catches. This has been a ramble, but oh well. I'm just trying to encourage the lot of ya. Anyhow, all those years of typing have made my husband able to do wonderful things with his fingers.

  262. Re:definition of geek. by Jason+Earl · · Score: 2

    I would guess that the reason that girls that are geeks are classified as geek girls is that there are so few female geeks that being male is implied. It is unfortunate if it made you feel ostracized, but it almost certainly is unintentional on the part of the geek community.

    After all, this is the same group of people that wore directory listing down until there was nothing left but `ls' and yet somehow created approximately 400 legal flags for `tar'. We want a maximum of efficiency without sacrificing for flexibility. Hence the more common male geek is simply a `geek' and a female geek is a `girl geek'. Also note how this notation leaves room for geeks from other species (eg. `alien geek'). You will also note that your geek friends probably don't refer to you either as a `girl geek' or even as a generic `geek' (with the male implication), but instead refer to you more directly as the_v (or perhaps simply v).

    The "guys" that somehow supposed that "girls can't be geeks" are A) clearly not geeks, and B) probably delusional. After all, anyone who holds to such an idea in the face of all of the available evidence is clearly not geeky enough to truly be considered a geek.

    P.S. I prefer the term nerd, but that is probably because I don't have any friends.

  263. Re:Call me selfish ... (OT) by jerdenn · · Score: 1

    I get more offers than I know what to do with, and I'm not a particularly talented programmer

    I currently work for a .com company in the southeast area, and I am compensated _very_ well...

    I generally get several genuine, (but unsolicited) offers a month (not from recruiters).

    I have no real degree, and I am not a C++ guru.

    How does this happen?

    I work with Microsoft Products!

    Instead of being fanatical about what products or platforms I work with, I select a skill set that is in demand, and I identify a particular area that is critical, but not generally well known, then strive to become a 'guru' in that area. Hit the newsgroups, and help others. Make your name known on the pertinent mailing lists. Name recognition is everything in business, and YOU are your own business!

    MS products have not always been my mealticket, and will not always be so. (Sybase helped line my pockets for awhile, and InstallShield is currently helping, as well).

    Go where the money is..

    -jerdenn

  264. Re:Hello?! Did Anybody Read This Sentence? by Jeremi · · Score: 1
    I have three loves: my girlfriend, computers, books, and classical music

    Okay, which two of the above categories have to share one of your loves?

    --


    I don't care if it's 90,000 hectares. That lake was not my doing.
  265. Re:glass ceiling by bridgette · · Score: 2

    Actually HP is pretty prograssive about getting the underrepresented into management. They will go out of their way to encourage promising women to consider persuing management.

    And, IIRC, the head of the computer division and the head of the printer divisions are both women as well.

    --
    - bridgette
  266. Re:Geek Girl and proud of it! by Felinoid · · Score: 1

    I think it's just an idea in education that they are trainning guys to get good jobs and girls to be good wifes.
    A tech guy can land a GREAT job in the tech world.
    A girl needs to be dumb so she dosn't outsmart (and fighten) potental husbands.

    It's all outdated sexist notions that are probably allready dead. We are just living with the side effects. Few geek girls.

    I say screw it... teach tech to as many nontech girls as posable.

    [Ok so a certen lady friend of mine isn't to happy with it but I will have her writing code at some point]

    --
    I don't actually exist.
  267. an older study worth reading... by manu · · Score: 1

    Women Undergraduate Enrollment in Electrical Engineering and Computer Science at MIT

    This is from 1995, but I think many of the issues and criticisms it raises are still quite relevant (at least judging from the male/female ratio in my CS classes)...

  268. Re:Hello?! Did Anybody Read This Sentence? by Ptolemarch · · Score: 1

    Well, my girlfriend does play the viola...

  269. FIRST, Girls, and Elitism by rewster · · Score: 1

    Unfortunately, there are very few who gravitate towards the technical aspects, most do "everything but the robot."

    Yep, we have the same problem at my school. Our major problem was not having a lot of adult leadership, so students took up that part, and what we ended up with was the same kind of elitism as sports and other teams. We had a few girls on this years team, and a few are considering going into "geek" fields (some here have done "Everything but the bot"), but i don't think FIRST is having the reaching power that it's meant to because of team politics.

    well.. there's my rant..

    - rewster

  270. Hello?! Did Anybody Read This Sentence? by Seumas · · Score: 5
    turned off by technical careers that they view as full of geeky guys

    The problem, then, is that we're the same guys that they didn't want to go out with in highschool and didn't want to sit next to at lunch.

    Assuming the line of this statement, I am lead to understand that if the industry was full of handsome, athletic jock guys, they would have no problem?

    Further, what does 'geeky guys' have to do with a career? Either you like the technical side of life or you don't. What next? "Gee, I don't want to work in the technical fields because of all those foreigners..."?

    If anyone is so nearsighted that they'd give up something they're interested in because they don't like the class of people that are already in that field, then maybe they should stay far away in the first place and go find a job where they can gawk at men with firm white asses as they walk by the Sam Goody's in the mall.

    I'm a bit geeky. I was also a very successful jock. I'm a young white male. I work with great people. I work with a lot of talented men and women of all ages, backgrounds, educations and ethnicities. If nothing else, the people in this industry are a reason to want to work in it, not shy away from it.


    ---
    seumas.com

    1. Re:Hello?! Did Anybody Read This Sentence? by Seumas · · Score: 2
      I would tend to agree, but if a person's gripe is that they don't like the kind of people they'd have to work with, then it should not be presented as if they are being the short straw.

      Whether or not women are actually paid less than men for the exact same amount, quality and length of work and whether or not they are encouraged to participate and enter that workforce -- they are at least understandable qualms to have. If they are valid, then I have sympathy for those people who are slighted by the way things are.

      If, on the other hand, the problem is that they don't like the type of people they would have to work with, then my answer is "Tough shit. Go work somewhere else.".
      ---
      seumas.com

    2. Re:Hello?! Did Anybody Read This Sentence? by bridgette · · Score: 2

      I know I'm gonna get flamed for this big time but I've got the karma so here it goes....

      Maybe teenage guys (on average, in general) view sex as a commodity more than their female counterparts. At that age hooking up with someone really hot seems like The Most Important Thing In The World. There is the belief (true or not) that hot chicks will fuck/date/marry anyone as long as he's rich. So by that reasoning it dosen't matter where a guy works so long as he's successful.

      Getting a trophy wife seems like a worthy ambition to an upwardly mobile 16 year old guy but his female counterpart would be more likely to expect her mate to make as much or more than her. And teenage girls are probaly more interested in the non-sexual aspects of relationships than thier male counterparts (the guys do catch up eventually). So a HS girl who knows that she wants to have relationships with peers and will want to put herself around as many desireable peers as possible.

      Of course, geek guys aren't all unattractive, trophy wives aren't as satifying as interesting and intelegent women and being rich dosn't necesarily get you laied. But they'll all learn that eventually.

      --
      - bridgette
    3. Re:Hello?! Did Anybody Read This Sentence? by griffjon · · Score: 2

      I myself dance latin dances, paint, play an intrument, and have various other non-geeky pursuits. our sysadmin at work played college football..most of our coders bike in to work, and play basketball--we're not geeks!

      we're riot nrrrrrds.

      --
      Returned Peace Corps IT Volunteer
    4. Re:Hello?! Did Anybody Read This Sentence? by wanna · · Score: 2

      Perhaps the age group that was surveyed was just slightly too young to be focused and more likely to be into pretty clothes, fun parties and exciting group events. It seems likely to me that they find the idea of pounding a keyboard, writing code or re-assembling hardware just a tad dull....right now!

      Most of the females where I work were not formally educated in computer science but happened to be where the action was taking place and took advantage of the opportunities offered.

      Most of those have taken web based classes or have gone back to college for specific courses to increase their productivity or their potential for promotion

      Like myself, I know lots of females, most of them in their 30's plus, who wouldn't work in any other field.

      --
      ah! the internet!! we may still screw up the world but NEVER again will we be able to claim IGNORANCE
    5. Re:Hello?! Did Anybody Read This Sentence? by Elanor · · Score: 1

      There's a saying amongst cyberchicks, who, like meself weren't attracted to a career in IT because of the guys (for flip's sake, as if the money had nothing to do with it).
      "The odds are good, but the goods are odd."
      - Lnr

    6. Re:Hello?! Did Anybody Read This Sentence? by OvisSum · · Score: 1
      Yeah, it's not much of a statement, is it? In case men haven't noticed, women think of *all* men, not just the real geeks, as "geeky guys".

      It's not the geeky atmosphere that's keeping women out of technical jobs. Any woman who's interested in it is going to go for it (and probably appreciate the geek men, who are liable to treat them more like equals than others...at least I've certainly found that to be true).

      --
      Carpe Ovis. Veni, Vidi, Ovisi!
    7. Re:Hello?! Did Anybody Read This Sentence? by Ptolemarch · · Score: 2

      Hear, hear!

      I personally work with a lot of different types of programmers. Where I work, there are--say--four of us who sort of form the core of the development staff.

      • One of them was a CS/English double major, is now a kickass programmer who swears he hates computers and spends much of his free time with a very well-developed social life.
      • One of them is a talented actor/comedian who does stand up in his spare time and is working as a coder (an excllent one) while he tries for a career as a professional actor.
      • One of them is an early middle-aged mother, and probably the best DBA I'll have the privilege of working with.
      • Only one of them (me :-) ) is what you might call your stereotypical geek. I have three loves: my girlfriend, computers, books, and classical music (in roughly that order). Outside of that scope I always feel a bit uncomfortable. But frankly I'm very happy with who I am.

      Whomever says that technical people are straight out of Revenge of the Nerds is very likely someone whose emotional imbalances would be unwelcome among the sort of well-rounded people that make up the men and women of our field.

    8. Re:Hello?! Did Anybody Read This Sentence? by Ptolemarch · · Score: 1
      Only one of them (me :-) ) is what you might call your stereotypical geek. I have three loves: my girlfriend, computers, books, and classical music (in roughly that order). Outside of that scope I always feel a bit uncomfortable. But frankly I'm very happy with who I am.

      Well, I'm happy with who I am except for that whole not-being-able-to-count-to-four thing. Drat.

    9. Re:Hello?! Did Anybody Read This Sentence? by Seumas · · Score: 2
      You certainly have a point and in the NetSlave caste, these would be the GoldDiggers.

      I've never seen any office-romances, unless they already existed before the office. That is, the only romantic relationships I've seen were ones in which both people knew and dated/married each other before the job presented itself.

      I'm not sure how much office-romance stuff goes on elsewhere in society, but it seems to be low here. Of course, the low number of women is probably one aspect of it (although there are still a lot of them).

      Further, I personally am not sure I would want a 'geek girl' as my lover. An intelligent girl, but not a techie. I have enough technical stuff in my life. I'd prefer someone who is perhaps a literary professional, an artist -- anything, just not someone who sits in a dark room drinking Mt Dew and coding like mad.

      Not that I don't find myself the least bit attracted to girls with a very technical profile. I've worked with some very ambitious and intelligent girls that I found insanely attractive. Nonetheless, I'd prefer not to pair-up with someone who is inclined to hop online and check Slashdot two minutes after having sex.

      Geek relationships are really wierd, anyway. I know couples who sit five feet from one another at home, but tend to speak through AIM or ICQ rather than talk. Or who tend to argue the finer points of object oriented perl.

      This suddenly makes me wonder what a techno-geek version of 9-1/2 Weeks would be... I envision an attractive woman writing C++ comments on her lover's body -- or maybe some goofy guy dangling pizza-cheese from his lips to his girlfrield, laying on the floor... *shudder*... make it stop...!
      ---
      seumas.com

    10. Re:Hello?! Did Anybody Read This Sentence? by SpryGuy · · Score: 1

      Thank you for proving my .sig :-)

      - Spryguy

      --

      - Spryguy
      There are three kinds of people in this world: those that can count and those that can't
  271. Computers not just for boys? by Krystalia · · Score: 3

    What makes it hard for me, as a women in the technology field, is that my parents tried to steer me away from computers and tried to steer my brother towards them. It happened to turn out the exact opposite... i love computers just as much as the next guy, but when the people that you are supposed to listen to tell you that girls shouldn't play with computers, it makes it harder for us to get into that stuff. Lucky for me, in high school i happened to get involved with the Computer Club by accident and totally fell in love. All my friends turned out to be guys, "geeks", who love computers and taught me so much, even got me into using linux. I don't think all women/girls get as lucky as i did and fall in with the right crowd.

    It's almost as if it's taboo to be a girl who like computers, at least where i live. I was the only girl in the computer club, I was also the only girl really willing to get involved and learn things. Sometimes i feel really inferior compared to the males, it's almost as if they treat my like i'm stupid because i'm a girl... though i try harder then most of them to learn things...

    I think parents need to encourage both girls and boys equally. That would be the first step in getting more females interested and it could start to even the playing field.

    Just my two cents :)
    Krys

    1. Re:Computers not just for boys? by vsync64 · · Score: 2
      That's probably also due to the nature of the geek world itself. Most link self-esteem to technical knowledge, and sometimes the easiest way to elevate yourself is to belittle someone else.

      Dude, that's how most people work in general. They feel insecure, so people they feel threatened by get slapped down.

      The geek community is no exception, of course, but I also think part of it comes from simple obsession with the topic being discussed. So you'll have geek guys going "vi forever! vi's X rules!" and "Emacs is soooo better than vi, because it has Y blah blah blah".

      So a wannabe geek girl shows up, and immediately hits this seemingly antagonistic environment. Due to the societal prejudices, or maybe just cause she is the only girl there, she assumes it's directed toward her, rather than just being the way the group normally acts.

      --
      TO BUY A NEW CAR WOULD MAKE YOU SEXUALLY ATTRACTIVE.
  272. Re:More women than men where I work. by Zurk · · Score: 1

    uuh...which companies were they ? im sure you'll see a loong line of job hunting geeks lining up outside their front offices after this article.

  273. Re:My own (vicarious) experience... by softsign · · Score: 2
    1) On average, women make less money than men. This is mostly because of carrer choice. Tech jobs can pay very well. Some people feel that gender pay inequality is bad for society in general - contibuting to the childhood poverty rate and such. Some people feel that as long as women have second class finacial status, they will have second class political and social status. Personally, I tend to feel that everyone should have an equal chance to take care for themselves financally and feel these these efforsts help remove barriers.

    The friend I mentioned in my previous post was recently hired at Ford Motor Company. IMHO, she's a damned good Controls Engineer and could easily have gotten an excellent starting salary great benefits and far better opportunity for advancement at any of the smaller contractors Ford hires to design and maintain their machines.

    Instead, she chose Ford itself - not because they offered to pay her more or because she's on the fast track to management. You know why she chose Ford? Because they offer a great maternity leave package and job security. That was the deciding factor.

    She wasn't even looking for the biggest salary or upward mobility - she was looking for a comfortable job with a decent salary. A job that won't make her feel guilty leaving when she decides to have kids.

    I don't think it's fair to point to statistics that say "women earn less, pay them more" because there's a fundamental difference in what a large number of women are looking for when they seek employment. Yes, those statistics often cover the value of benefits too. But how do you measure something like the knowledge that your job will still be there when you return after a six-month leave?

    2) We could use more tech workers and women are an 'untapped resource'. With all the companies lobbying to increase the number of visas, it only makes sence to spend some effort in genreating more applicants at home.

    Yes, but how are you generating those applicants? Are you in fact generating more applicants, or just different ones?

    The article mentions big names like Cisco and IBM sponsoring tech camps for girls. What about the boys that would have _killed_ to go to those? Are you going to get Betty Crocker to sponsor Summer Cooking Camps for boys? =) It sounds ridiculous, because it is.

    3) Having people from diverse backgrounds working on design and problem solving often yields better results.

    Can't argue with that. Good point. Although, arguably, removing immigration barriers accomplishes this too. Perhaps even moreso.

    4) People already in the industry (both male and female) would, all other things being equal, enjoy having some more women in the office.

    This is hardly a good reason to push girls into science and engineering. So that it's easier to put together a co-ed office softball team? =)

    --

  274. Re:If i was a girl.... by Chaosnymph · · Score: 5

    I guess it depends on the geeks. If you've got to be around teenage guys, I think the geeks are certainly better than the alternatives.

    Maybe what we really need is for the media to just portray geeks in a better light and feature them in afternoon specials or whatever kids are watching these days.

    I dated a bunch of geeks in high school and they were all sweet, polite, intelligent, and a lot of fun. They also seemed likely to want to spend the evening talking or doing something fun and frivolous (contrasting, it seems, to many guys who were only interested in sex.)

    And certainly when trying to date, a 5 to 1 ratio is not a bad thing: at least from the 1 side ;-) Even if there are a few that that aren't yet ready for that level of social interaction, you've probably got your pick (and the rest are usually pretty trainable). I don't think any of my fellow female geeks ever had trouble finding dates. And we used to just laugh at the various complaints of the others about insensitive guys who never called.

    Ah, well, perceptions can be so important. Maybe we need to start a date-a-geek campaign.

    Maybe if we lure the young ones into math clubs and computer teams with thoughts of dating they'll fnd that the subject matter is pretty interesting too. I can just see the posters in the halls:

    Join the math team - 5 guys to every girl
    Need a prom date? Come to the next chess club meeting.

    Or maybe I'm just getting a little silly now. :-)

    Chaosnymph - (who recommends geeks to all her friends)

  275. My own (vicarious) experience... by softsign · · Score: 5
    I took an introductory psych course this year taught by a moderate feminist prof.

    One day in class she was lecturing on gender bias in the elementary school system and how girls/women are discouraged from careers in science and engineering because teachers have this preconception that boys are better (and subsequently devote more time to them).

    At one point, she stopped and we listened to this girl in class describe how she, personally, had experienced this phenomenon in her gr. 5 class and that because of this, she was no longer capable of doing well in mathematics courses.

    Well, during this whole sob story, one of my best friends was sitting right next to me, snickering. She later recounted to me her own experience in high school: her gr. 13 physics teacher had laughed in her face when she told him her post-secondary plans. Electrical Engineering. He told her then rather dubiously to come and visit when she got her degree.

    She's planning a visit in six weeks.

    WHY DOES THERE HAVE TO BE A 50/50 SPLIT IN EVERYTHING? Is it not possible that some women just aren't as interested in some things as some men are? And vice versa? Why do we need to engineer our society to be perfectly symmetrical?

    Somebody please give me a good answer to this. Explain to me why.

    --

    1. Re:My own (vicarious) experience... by eshaft · · Score: 1

      Studies have shown that boys can be very agressive which has a negative affect on girls in school. So the idea of a computer camp for girls sounds kinda cool to me.

      It works both ways. Besides, an all girl tech camp, while it sounds like a great plot for an eighties comedy, probably isn't the best route - what's wrong with coed? I recently played on a coed soccer team, and the girls on the other team were amazing (I'm in real good shape myself!) It makes me think that its better to mix everyone together, rather than try the "separate but equal" education systems taht have persisted for so long. But then again, its 2am and there's no girls working in this office, so maybe that's wishful thinking on my part... ;)
      --
      lf.o
    2. Re:My own (vicarious) experience... by White+Shadow · · Score: 2

      While there doesn't have to be a 50/50 split, the question is why are women not as interested as men with regards to tech jobs? As you should have learned in your intro psych class, human behavior is determined by two factors:

      1. Genetic makeup
      2. Social Influences

      Well, since there is no evidence that women don't like tech fields due to a genetic difference (and you would probably have a hard time arguing that there is one since there is no real evolutionary advantage to it), then the cause must be social influence. So if the reason that women don't want to be geeks is due to social pressures about how a woman should act, then that's discrimination.

    3. Re:My own (vicarious) experience... by bridgette · · Score: 2

      Instead, she chose Ford itself - not because they offered to pay her more or because she's on the fast track to management. You know why she chose Ford? Because they offer a great maternity leave package and job security. That was the deciding factor.

      The fact that women take maternity leave and spend more time on family care also factors into the pay disparity but from what I've read the biggest factor is the job choice. Regardless, your friend shouldn't have to choose between getting a big salary or getting maternity leave. Although anyone (male or female) thinking of rasing a family would want to look for job security.



      I don't think it's fair to point to statistics that say "women earn less, pay them more" because there's a fundamental difference in what a large number of women are looking for when they seek employment.

      Well I don't think it's fair that women earn less. And no one is saying to pay women more. What is going on is that people are trying to enourage and help women get themselves in better paying positions. There is a big difference.



      But how do you measure something like the knowledge that your job will still be there when you return after a six-month leave?

      Ummm, it's called compliance with labor law and I require it of any company I consider working for (and I don't even want to have kids).



      Yes, but how are you generating those applicants? Are you in fact generating more applicants, or just different ones?

      I don't really see what you mean here about more vs. different applicants, but by encouraging new people to study CS there would be a bigger pool of talent. While admission into the best schools is very competivtive, that's the exception, most schools will grow departments to meet the public's need.



      The article mentions big names like Cisco and IBM sponsoring tech camps for girls. What about the boys that would have _killed_ to go to those? Are you going to get Betty Crocker to sponsor Summer Cooking Camps for boys? =) It sounds ridiculous, because it is.

      Well there a lots of boys at the pre-existing tech camps. Any boys who would have kiled to go to tech camp and can afford to pay are probably there right now. As for the boys who want to go but can't afford it, there are grants available for them as well. There should be more funding for summer camps in general, but there should also be more funding for reducing third world debt, eliminating world hunger and providing basline medical care for everyone.


      Studies have shown that boys can be very agressive which has a negative affect on girls in school. So the idea of a computer camp for girls sounds kinda cool to me.



      Although, arguably, removing immigration barriers accomplishes this too. Perhaps even moreso.

      I agree.



      This is hardly a good reason to push girls into science and engineering. So that it's easier to put together a co-ed office softball team? =)

      Well, as far as self-serving charitable contibutions go, this would hardly be the worst culprit. But given the choice between spending my free time tutoring girls or tutoring random kids, this might be enough to make me lean towards tutoring girls through a SWE program.

      --
      - bridgette
    4. Re:My own (vicarious) experience... by streetlawyer · · Score: 1
      (I'm in real good shape myself!)

      Oh fer chrissake, trying to get laid on Slashdot? Why not go to a nightclub already?

    5. Re:My own (vicarious) experience... by softsign · · Score: 2
      Thank you. =)

      (I can't understand why your post hasn't been moderated up, because it's honestly the best one in this entire story.)

      Let me see if I've got this:

      • [society] does need to be engineered to ensure that pathways are open to qualified people based upon performance and ability
      • short term solution is to ensure that women ... can become role models and examples for others to follow
      • Women and men may be interested in different things ... who cares ... so long as they are informed about the wide ranges of opportunities available
      • best ways to solve the problem is to ensure that children are educated ... so that they have enough self-esteem to pursue their goals

      If everyone involved acted based upon these tenets, I don't think anyone in their right mind could argue. Sadly, I don't believe that this is the case. There are just too many radicals who would rather beat down one group to advance their own.

      --

    6. Re:My own (vicarious) experience... by mjgday · · Score: 1

      Good reasons... but I have another

      Women actually make better engineers... this is something my father (a Civil Eng. lecturer) bangs on about a fair bit. Whilst not wanting to deny the existence of these traits in some men, I think it's fair to say that women have a more holostic attitude to life, this holoism means that thier approach to problem solving is in many cases much more effective, as they can see past the immediate apparent problem and to the overall picture where the 'real' problem arises.

      Actually it's probably fair to say that both directed (male) and holositc (female) approaches work and help each other... but at the current moment there are too few women in engineering/science and thus a somewhat damaging imbalance.

      I have read a wonderful book on this but as I can't remember the name/title/publisher/isbn I probably shouldn't bother to mention it ;-)

      M
      --
      Sic Itur Ad Astra
      www.gatrell.org

      --
      foo
    7. Re:My own (vicarious) experience... by mpe · · Score: 1

      This is mostly because of carrer choice. Tech jobs can pay very well. Some people feel that gender pay inequality is bad for society in general - contibuting to the childhood poverty rate and such.

      There are rather more factors involved. Many of which are outside of "employment" issues. One of these is that whilst it is not acceptable for a man to "marry for money" it is acceptable for a woman to do so. (Women demanding husbands and boyfriends earn more than they do undoubtedly contributes to these kind of statistic.) Another factor is that state and charity "welfare" are often not gender neutral in their application.
      Much of this statistical difference could be accounted for by men having to "pay their way" more often than women.

    8. Re:My own (vicarious) experience... by Omnifarious · · Score: 1

      One thing that bothered me about that article, is the 'oooh, icky-poo!' attitude of the female people they quoted. IMHO, the woman they quoted can go have and have her stupid non-tech career, and I hope she fails miserably and has a disgusting job while seeing all those icky geeks around her do well. I hate this attitude, and nothing makes me shut down more with regards to helping someone than hearing it.

    9. Re:My own (vicarious) experience... by matthew_gream · · Score: 1

      If everyone involved acted based upon these tenets, I don't think anyone in their right mind could argue. Sadly, I don't believe that this is the case. There are just too many radicals who would rather beat down one group to advance their own.

      Thank you for your comments: I agree that I am being somewhat idealistic, but ideals are what we try to aim for. My general belief is that people of all different persuasions, beliefs and ideals should be free to live with each other, and free to advance their own agenda and their own way of life, but not to the detriment of other people. Sometimes radical action is necessary, because other means fail - and that does include allowing radical actions that are eventually proven 'wrong' - such is freedom - but radical action does not need to harm or denigrate others if society is consensus oriented. Irrespective of any of that, what is undisputedly wrong are ill conceived stereotypes and judgemental behaviour that denegrates and demolishes the individual spirit. Society should be predicated on a base line respect and tolerance and set of civil codes that all agree to and buy in to, upon which the individual and the group can do and live as they please. It's a complex topic, and I'm no way near to being able to do justice to it.

      --
      -- Matthew - matthew.gream@pobox.com, http://matthewgream.net
    10. Re:My own (vicarious) experience... by matthew_gream · · Score: 1

      I'll try to provide some information to help you think about this. This is not a well considered response, because only a several pages could do justice to the complexity of the topic.

      Society does not need be engineered to be perfectly symmetrical, but it does need to be engineered to ensure that pathways are open to qualified people based upon performance and ability, and not based upon archaic notions of 'tradition', 'roles' and ill-conceived 'stereo-types' that are held by less enlightened people. Even otherwise 'good' people can be unenlightened.

      A short term solution is to ensure that women (or, in general, any disadvantaged group) can pursue these pathways, and then they can become role models and examples for others to follow: they've taken the lead and made headway into new territory - they provide inspiration for others. In the long term, hopefully this means that a lot of barriers are broken down as others realise 'yes, that is possible, people can do that'.

      Women and men may be interested in different things - I can't comment on the basis of that and whether it is founded in genetics or development. Actually, who cares what they are or aren't interested in - so long as they are informed about the wide ranges of opportunities available, and they can pursue those opportunities without prejudices and with the acceptance of people around them. The same applies to men pursuing areas that are considered 'women only'.

      One of the best ways to solve the problem is to ensure that children are educated so that they are less assuming and more accepting, and so that they have enough self-esteem to pursue their goals in the face of opposition - perhaps these things will help build a tolerant society.

      There are many other issues as well (for instance, is part of the goal to ensure that if the male population declines or moves its interest elsewhere, then there are enough women to continue the EE profession ...).

      --
      -- Matthew - matthew.gream@pobox.com, http://matthewgream.net
    11. Re:My own (vicarious) experience... by mttlg · · Score: 1

      Unless I have my history wrong, didn't human evolution take place long before there were technical fields for women to not be interested in? You need to apply something called "intelligent thought" to the situation before you can just dismiss the genetic aspect. The cause of the lack of interest in technical fields is what you would have to debate the evolutionary advantages of, not the resulting effect. There's no evolutionary advantage to being able to fill out a bra either, but women tend to be a lot better at it than men - does this mean that this is due to social influences (aside from the creation and use of the bra, which has nothing to do with ones ability to fill it)?

  276. What I have found... by potsy2 · · Score: 1


    What I have found, is that while many women may find this career enjoyable and rewarding, not so many (I know none) have the passion for it that my friends and I do. How many girls do you see soldering together electronics projects, or writing code for fun, or visiting five news sites as soon as they get home from their tech job, to learn about the same technology that they just got done working 8 hours for? How many girls back in high school did you seen lugging their case to a LAN party?

    When I was at orientation for my engineering school, and a lecturer asked the group "Why do you want to be a electrical/computer engineer?" The answers were "I read a great article in Time about how they start out at $45,000 a year!" or "I heard in Forbes magazine that there is a huge computer job shortage and they are willing to pay pay pay!!"

    And that's fine, these people don't really care, they just want a career. There are exceptions to this rule, and the vast majority are the exceptions are guys. How many girls out there cut their teeth on Radio Shack's electronic components, redboxing, and plenty of XCOM:Ufo Defense?

  277. History tells us ... by jamesl · · Score: 1

    Fifty years ago, the same could have been said about women entering the medical field -- as physicians, not nurses. Many were refused entry to medical schools, internships and residencies based only on gender. Others were discouraged by family, friends and peers because being a physician was "a man's job". Women are still underrepresented in surgery specialties. However, the last numbers I saw showed that more than 50% of US medical school students are women. It takes time.

    The same has been true for law school.

    There are still plenty of engineering managers and educators that don't believe women can perform as well as male engineers. And they aren't always subtle about it. I work with a woman (BSEE, BS Bio Med) who came to work in marketing because of how she was treated during her internship in Engineering. Our gain, their loss.

    For those of you looking for a companion/mate that can code, get a life. If you can't have a life away from your keyboard, get a job coding for a porn site.

  278. Not by eshaft · · Score: 1

    BOO! What kind of men are you going after? Dumb girls really turn me off, I can't walk into a bar and keep up a conversation about the weather or about how tight pants should be without feeling the urge to vomit. Where are all the smart girls? Playing dumb gets you frat guys, then single and pregnant, in that order. I dig a girl who can match me intellectually or bitch at my sloppy code or kick my ass in quake iii. They're few and far in between.

    --
    lf.o
  279. Re:The natural gender gap. by liquidgrrl · · Score: 1

    While hardcoded behaviour accounts for a significant amount of the gender differences seen in humans today, I do not believe it can take credit for the huge imbalance of the sexes in the tech workforce. It's true that from an early age girls gravitate toward dolls. This makes a certain amount of sense, as they will one day be mothers, and they need all the training they can get. (Caring for a baby is scary!) Similarly, girls cultivate an empathic response to others' difficulties, perhaps because logic is most often useless when dealing with babies and children. This does not prevent women from exercising their analytical skills. North American culture, however, does. Girls remain strong throughout elementary school in all areas of academics, including math and science. Come adolescence, however, there is overwhelming cultural pressure on girls to conform to a feminine stereotype. Perpetuated through the media and funded by commercial industry, this stereotype dictates not only the teenage girl's ideal body type and weight, but also her ideal societal role. Unsurprisingly, it is submissive, dependent, insecure, and materialy impulsive. Girls' math scores take a huge dive in junior high. Ask a 14 year old girl what she thinks of math, and she will *proudly* declare that she sucks at it. I remember hiding from my peers my own traitorous report card that displayed an 'A' in Math. For many girls, high achievement in an area viewed as unfeminine often results in their being ostracized. At 14, what would most girls rather be, popular or smart? If you think that one does not prevent the other, you have obviously not been a girl growing up in the past 20 years. For those would like a more informed read on how adolescent girls are abused by our culture, I suggest "Reviving Ophelia". Girls today are trained to reject careers focusing on science and math. It has very little to do with the large number of geek guys in the field, or with a feminine reluctance to use logic. (ASIDE: Though I would love to dismiss the latter explanation out of hand, I have only myself and my other geek friends to use as an example. I figure this sample does not quite satisfy the diversity required for a well supported argument.) It has to do with social conditioning. Given an environment encouraging of female development in *all* areas, I think it likely that significantly more women would choose tech jobs.

  280. Dumb Valley Girls Make Poor Test Subjects by Seumas · · Score: 2
    You're absolutely correct, except they were interviewing high school girls. 16, 17, 18 years of age. That does seem to be the group that they questioned, when you take in all of their other answers to questions. The problem is very obviously not that these girls (at least the sob-story ones indicated in this article) are not given the oppertunities (hell, they're in a high school computer class, learning programming aren't they? When I was in highschool, comptuers were for learning how to type).

    The problem is the attitudes. "Oh, that's so much work" and "oh, you have to like, be exact and stuff..." -- boo hoo.

    ``It's tough work getting it to work exactly correctly and it's frustrating because one misspelled word and you can't get it to work,''

    Referring to Microsoft Corp. chairman Bill Gates, she added, ``I say let him have it all, let him do it all.''

    That's the spirit! Let someone else do the work. After all, who wants to be like, all detailed and stuff. I mean, at least when you're at Burger King, the only important thing is that you squirt some mustard on the burger. Nobody cares where or how much!

    '`I don't want to take computer science. ... Just looking at it, all the programming and these funny-looking things on the paper. It (takes) so much stuff to do one thing on the computer.''

    I'm having flashbacks to the Barbie Doll that used to say "Math is soooo hard! - let's go shopping!"

    ``The reason why you see more men doing computer stuff is that girls are more ambitious than that. My parents always say, 'Do something with computers,' because it is stable and stuff, but a lot (of people) don't want to be at a desk from 9 to 5.''

    Oh my god. I actually laughed out loud at this last statement. "More ambitious"... What, like being the next Britney Spears or Ricki Lake?! And you have to love the "be at a desk from 9 to 5". I'm not sure about everyone here, but most of the people I know, including myself, are at their "desk" probably at least double that. Further, how can you be looking for an "ambitious" career, where you only have to work under eight hours a day?!

    It's nice to know that all of us out here who are making wads of cash -- many without formal educations (or even highschool educations) are lacking ambition.

    So, like -- ohmygod!
    ---
    seumas.com

  281. Translation for those who do not speak OOG by Inoshiro · · Score: 2

    So you want a women

    The 7 step guide to getting a lasting relationship.

    Note: if you just want to get laid, you're better off masturbating or going to a party where the <ahem> women go to get drunk and laid (bring extra-strength condoms).

    Common myths you should forget:
    * Women love to hear about other conquests
    * Women will get turned on watching women have sex with women
    * Women love muscles and/or bodily perfection

    Step 1: be presentable. This means you should shower regularly (i.e.: daily or better), wear deoderant (old spice is nice), and try to have your clothes aranged in a suitable fashion (i.e.: shirt untucked if normal shirt, tucked if dress shirt, and never ever partially tucked!).

    Step 2: be yourself. Women are attracted to "together" guys (i.e.: confident and assured), not guys who attempt to be all things to all people (if you're not confident, well, that's really another whole essay in itself). Follow the Unix philosophy, and show that you can do one (or a few things) well. Don't make it a pissing contest between you and every other guy on earth, and don't lie about what you know.

    Step 3: understand her motivations. By now you've selected a girl, talked to her, and generally had pleasant small talk with her. Use this to find out more about her, and what makes her tick. Knowing a woman's motivations is like having the source code!

    Step 4: gently ease into it. Don't just call her up one day and say, "hey, wanna fuck?" Doing so will not get you anywhere (or if it does, you probably don't want that woman anyway). Assume that step 3 will take a month or more. As you know her better, signal that you appreciate her by offering subtle flirtations (i.e.: you seem stiff, would you like me to rub your shoulders?).

    Step 5: learn even more! Now that you have a small relationship started, you can take the opprotunity to learn more about her motivations. This is beyond having the source -- this is "understanding to the point of being able to implement new features" having the source. You should be able to help her with any personal problems she might share with you

    Step 6: enjoy the relationship. A relationship is not about sex. It's about having a partner of your perfered gender with whom you have a deep, mutual understanding. Sex (and sexual play) is a fringe benefit (a very nice fringe benefit). If you get to step 5, and feel nothing for her, you're probably going to hurt her a lot if you continue.

    Step 7: lead into other things. Now is when you get to consider sexual relations. It'll come as a natural extension of everything you've done so far. Enjoy it.

    Addendum to step 2: where to find women you'll like, and how to chat them up.
    First off, don't assume you'll get the hotest woman with the curves of a goddess, and the cleavage of the Indian subcontinent. Assume instead that you will find a woman whose intelligence is to the levels of Mensa. Those are the kinds of women whom geeks appreciate the most, and geeks are the kind of men those women tend to appreciate the most.
    Obviously, the best place would be your local library, or other place of learning. Find a local woman you know through mutual friends, and talk to her via a neutral medium. Shared parties, shared activities, etc. After a while, you'll get to the point where your conversations are private, one to one afairs. The woman will likely not be interested in computers. Get used to it. You probably don't want your sweetie to be intensly interested in the thing you find dearest to your heart, because having her point out your code flaws can be somewhat emasculating. Get a local Unix buddy for that kinda stuff.
    Be attentive. You certainly can appreciate it when people's eyes don't glaze over at the mention of "Unix" or "compilers," so try not to do the same when she mentions things important to her. This will make your conversations flow more smoothly, and allow you two to grow closer.
    ---

    --
    --
    Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
  282. I'm shouting this... by Anonymous Coward · · Score: 1

    Stand up and shout on this one, ladies. I think that it takes a special breed of
    person to be attracted to this line of work, not necessarily a specific gender.


    I think you should be using the word sex instead of gender here. We are talking about people/animals instead of words right? I even got to it before Grammar Nazi, wow.

    Ò

    1. Re:I'm shouting this... by Sempiternity · · Score: 2

      Sex is physiological, while gender is the mental expression of the physiological nature.

      Gender was correct, because although fewer "girls" are geeks when looked at it from the physiological side, look at how few girls are geeks when looking at it from the gender side.

      <judicial stereotype>I mean look at the football primadonna's, would they be caught dead learning something???</judicial>

      --
      01001000001000000110100101110000100000011000010010 00000010001100101110
    2. Re:I'm shouting this... by BigNar · · Score: 1

      Not quite. Sex=biology Gender=psychology Though, assuming that all the women they interviewed were in women's bodies...then sex would be MORE accurate. Of course, if they were talking to women in men's bodies...well...I think that's another whole article...

    3. Re:I'm shouting this... by Wench · · Score: 1

      True enough, though that technical distinction between sex and gender is not necessarily well known outside the arts degree types. Hi geek guys - think woman/man = sex difference; feminine/masculine = gender difference.

      Femininity and geekdom don't go well together. But femininity totally sucks anyway. It doesn't go with anything involving having a brain.

      (Yes, I know some women do hang onto the dress up pretty part of femininity while tossing the bimbo stuff in the garbage. You go girls.)

      --
      No matter how cynical you become, it's never enough to keep up.
    4. Re:I'm shouting this... by SpryGuy · · Score: 1

      Well, let me put things this way...

      Of the two women I've worked with in my programming career that were actually engineering developers, both were hardly very feminine (one was even lesbian).

      I think 'gender' really IS the correct term.

      Of course, I know lots of gay male programmers as well, but that might come from the loner/outcast camp, no? None of them are particualrly effiminate either.


      - Spryguy

      --

      - Spryguy
      There are three kinds of people in this world: those that can count and those that can't
  283. Geeks wanting to be girls... by jamiefaye · · Score: 1

    a LOT of geeks are transsexuals or cross-dressers - probably about 100X the natural incidence.

    I know about 20 TS video game designers I have met or heard about during the past few years. There are plenty of transgender hackers in other genres too.

  284. Maybe it's a technology thing? by bildstorm · · Score: 4
    Is it because girls ar more sociable? I mean, guys tend to tinker with things, like cars, VCRs, stereos, computers, etc. It's almost a given that if I give an object to a little boy or a little girl, the boy will try to take it apart, and the girl will try to use it.

    I realise this is massive gender stereotyping, but perhaps the majority of girls aren't interested in socially-deprived isolated activities like staring at code for hours?

    --
    The power of accurate observation is commonly called cynicism by those who have not got it. - G.B. Shaw
    1. Re:Maybe it's a technology thing? by danny · · Score: 2
      So maybe when we're all cyborgs, and hacking code is indistinguishable from "hacking people", this won't be an issue...

      Danny.

      --
      I have written over 900 book reviews
    2. Re:Maybe it's a technology thing? by MissMarple · · Score: 1

      More sociable? Hardly. Differently sociable, yes! In my experience, females find more common ground in talking about people and feelings...males are more comfortable discussing their skills and possessions. I've yet to meet a fellow girl who liked playing the "my CPU is bigger than your CPU!" game, nor still any who wanted to talk about Quake II ratings, compare operating systems, or salivate over up and coming technological gadgets. I find that a large part of the fun in being a geek comes from just such interchanges. Most of my female friends would find the same activities dull and unrewarding. It isn't that geek life is isolating...it's that geek-type socialization would hold no interest for them.

      In other words, it's the "I did such and saw so-and-so" vs. "I bought/downloaded such and fragged so-and-so" divide...

      --
      --Everybody wants a rock to tie a piece of string around.--
    3. Re:Maybe it's a technology thing? by Spudly · · Score: 3

      I have found that many geek guys know all too well that they are smart - and it's true, many of them are more intelligent than the average person. Trouble is, they let ppl know about it.
      And I've seen it happen time and again: the geek get's up on his mountain top to show everyone he's the king and knows everything. And that just turns anyone (not just girls) away faster than
      greem stuff between your teeth.
      (unless you happen to have a faster processor, more RAM and a bigger HD - "birds of a feather flock together")

      Also, I've come across many geek guys that just haven't grown up - they're still playing computer games at 30. Girls mature faster than guys, guys laaaaaaaaaag behind signicantly until late teens (so I'm told) - but some guys just don't seem to break the teen-male mentality. I've spoken to many girls who just take one look at a geek guy and see a child...

      I won't start on personal hygiene, because that is something every geek must get together - for the sake of his friends and especially those of the opposite sex.

      -Spud.

      --
      -- "e-idiot: stupidity for the next Millenium."
    4. Re:Maybe it's a technology thing? by Spudly · · Score: 1

      You ARE your biology. Your biology is determined by eons of evolutionary selective pressure. Selection is never wrong, it just is.


      Oh please...don't tell me - you and Darwin share similar views.

      -Spud.

      --
      -- "e-idiot: stupidity for the next Millenium."
    5. Re:Maybe it's a technology thing? by BigNar · · Score: 1

      I wouldn't go that far...It is true (at least as far as modern science seems to indicate) that biological differences have implications upon some psychological realms, it is not necessarily deterministic; i.e. it is not universally applicable to all individuals.

    6. Re:Maybe it's a technology thing? by edunbar93 · · Score: 1
      Or maybe it's because getting your hands dirty pulling wrenches is MANLY. As a result, women are discouraged from doing it by men who are threatened by their presence and other women who find it repulsive that a woman would want to.

      This is an attitude, or perhaps a genetic trait that goes back literally thousands of years. Men are the ones who have traditionally done the dirty work; farming, hunting, fishing, butchering, mechanics, carpentry, war, and anything involving heavy labour. Women have done tons of work nonetheless, but it's traditionally been restricted to less messy jobs like cooking, cleaning, interior decorating, secretarial work and nursing. For all this time, these jobs have been categorized as either masculine or feminine.

      Men interested in feminine work and women interested in masculine work have been discouraged from doing so not only from traditionalists (or bigots... either way, the results are the same) who have openly laughed at them, but from their socialization that has raised them to believe that doing certain things make one less masculine or feminine.

      The point here isn't that men and women should stick to the jobs that are allowed by their gender, but instead that everyone should be allowed to do whatever the hell they feel like without people openly laughing at them - especially the people who are supposed to be teaching them how to do it in the first place. Girls only make bad CS students when the teachers aren't doing a good job.

      Computer science is a pretty open field right now. It's still too new to have truly settled into a defined gender role and most of society still shuns _anyone_ who tries to pursue it. We have the ability right now to make it into a gender-neutral role. It's certainly not as manly a job as mechanics or boxing, and it's not as feminine a job as nursing or interior decorating. Computer science has also had as many great female pioneers as it has had men, yet many mediocre male CS teachers are being snooty about female students, and the overwhelming male majority of the classes aren't helping any either.
      ---

      --
      "No problem. I have the capacity to do infinite work so long as you don't mind that my quality approaches zero."-Dilbert
    7. Re:Maybe it's a technology thing? by nEoN+nOoDlE · · Score: 1

      I realise this is massive gender stereotyping, but perhaps the majority of girls aren't interested in socially-deprived isolated activities like staring at code for hours?

      The hell you say, man!

      --
      Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
    8. Re:Maybe it's a technology thing? by infinite_twilight · · Score: 1

      Girls are not necessarily more sociable... Not all of us anyway. It's a mind set more than anything else that leads (or pushes away) us toward technology.

      I mean, I am a girl and when I was little (i.e. as soon as I could sit by myself and *not* put food in the keyboard, so about 2.5 years old), I used to upset my mother cause I didn't like barbies and spent all day playing on our Atari. Meanwhile, my brother hated computers.

      Some of us girls are interested in social-deprivation, just not all of us readily express it. We have had stuff shoved down our throats all our lives that we are supposed to be soft and nice and caring... But not all of us are. My best friend and I finally figured out this year that CS is where we want to go.. The guidance department at our school was ecstatic when she joined the Cisco Networking course, which I was already in, they were like, Yah another girl!

      Some of us just don't care anymore whether or not we are sociable.. I am painfully shy in person, but was trying to conform to what the majority of people at school thought I should be. They made fun of me when instead of an essay I would hand in an video on cd and other crazy things... I finally figured it out this spring that no matter what I do, they are always going to think that I am a closet geek, so I might as well express myself and not be miserable...

      There were also a couple of other factors that pushed me and my friend to unleashing our geekiness upon the school... Perhaps the fact that some of the guys on our IT staff our pretty hot ;)

      ~me

    9. Re:Maybe it's a technology thing? by mpe · · Score: 1

      I'd say 98% of the guys here range in age from 20 to 24 and seem interested in loud music, drinking, fast cars, and pussy.

      Or maybe simply that people with these kind of interests are "noisy" and thus get noticed more.

    10. Re:Maybe it's a technology thing? by Lars+Clausen · · Score: 1

      I realise this is massive gender stereotyping, but perhaps the majority of girls aren't interested in socially-deprived isolated activities like staring at code for hours?


      Programming doesn't have to be isolated. Have a look at Extreme Programming -- pair programming sounds like fun (haven't tried it much yet) and quite social.

      -Lars

    11. Re:Maybe it's a technology thing? by Rylfaeth · · Score: 1

      Also, I've come across many geek guys that just haven't grown up - they're still playing computer games at 30.

      I'm confused...why is it inappropriate or immature for a 30 year old (or a 75 year old, for that matter) to play computer games? Is it really any more immature than a 30 year old watching a football game or playing catch?
      -Rylfaeth

  285. My Personal Experience by McCart42 · · Score: 1

    OK...this is not meant as a far-reaching and certainly not all-encompassing explanation. This is just my experience. I thought it was relevant (I've been waiting for an article like this on Slashdot for quite some time). I'm a recent high school grad. Valedictorian of my class. I have good experience with computers - I refuse to brag, that's not the intention of my post. I applied to Carnegie Mellon, which you all know is the best school in the country (OK, OK, tied with Stanford and MIT) for computer science. A "technology reseearch mecca" according to at least one newspaper. I was waitlisted, and my financial aid package was sent to me...let's just say I was bitterly disappointed. After a long period of real personal letdown (all I wanted was a chance...a chance to prove myself), CMU gave me a phone call. I had been accepted from their waiting list! Finally...the chance I'd been waiting for! Surely, my financial aid offer could be negotiated slightly and I could go to the school I had been dreaming about since I started high school! (I grew up in Pittsburgh, and I still live within an hour of campus...so I'd known about it for a long time, it was only when I decided on CS that I got really excited.) But when I called back...the answer was no. Since their decision to admit me from the waiting list was only made after May 1, 2000, the financial aid package could not be changed. I would be forced to either pay almost $20,000 for the first year (possibly more each year after), or abandon my dreams. After much soul-searching, I gave up. I went to another school who had offered me a full tuition scholarship, Case Western Reserve University (I applied to six schools including CMU: of those, four offered me as much or more...two being full scholarships). I love CWRU, but that's another story. In hindsight, I realize that two of their three major merit scholarships were not offered to a white male such as myself. It is their money...I understand that they can do with it what they want. But when you're going to give women a free ride strictly for being women (after all, they didn't allow competition from men!)...I just don't know. Finally, CMU was recently written up as "bucking the national trend"...women occupy less than ten percent of computer science majors nationwide. At Carnegie Mellon, they are NEARLY FORTY PERCENT of the incoming freshmen class (in the School of Computer Science). Wonder why? They can pay the exorbitant price with their exclusive scholarship. Forgive me. But CMU has been my lifelong dream...and to this day, I can't think of one thing I could have done else with my life to make myself a stronger student. Feel free to reply to this message. "I may be quite wrong." - Socrates

    --
    "I may be quite wrong." - Socrates
  286. Call me selfish ... by dustpuppy · · Score: 2

    but I love it when i hear stories like this. Not just about how girls don't want to enter a technical career, but stories like the skills shortage, inability of IT businesses to find staff, lack of interest amongst school kids to pursue an IT tertiary education etc etc. It just means that the pay packets stay high in our industry ;-)

    1. Re:Call me selfish ... by nomadic · · Score: 1

      I'm starting to get a little suspicious of the claims that there's this massive shortage in IT. It's odd, but it seems that while some people get a couple of offers a day, a sizeable chunk of the IT population has to really work at it. I get the feeling that recruiters tend to only look at certain parameters, and if you're not in them they don't even bother.

  287. use the web! by xpatiate · · Score: 2

    I think maybe the *creative* possibilities of computers need to be emphasised more to get girls' attention, and the web is a great way to do that. When I was at school I would never have considered going into computer science as it seemed really boring, but I ended up following a kind of roundabout route of arts degree -> journalism -> web design -> programming and realised to my surprise that coding was actually really interesting and rewarding and fun. I hadn't expected the feeling of *power* - not in the sense of dominance but the ability to create stuff out of your own head - or the aesthetic satisfaction you get from really elegant code. It was nothing like my preconceived notions of a programming job as being something akin to eight hours of long division a day.

    People trying to encourage girls into computers should be using web development as a point of entry, because it really makes it clear how creativity and code interact, and scripting languages like PHP make it really easy to get started. You can learn a few basic principles and then go in whatever direction your imagination takes you, and once you get over those qualms about the 'funny-looking things' you realise there's heaps more interesting stuff out there.

    Of course it's still not going to appeal to everybody, and there's no particular reason why Katy Prendergast *should* care about programming if she'd rather be a travel agent or whatever ... just as long as girls get to have a go and see if it's for them before they write it off as 'too technical'.

    --
    (music + neurology) * fiction = feedback
  288. NAME ANY COUNTRY WHERE THIS ISN'T TRUE?!?!? by Wolfpack+Commander · · Score: 2
    Does anyone wonder why men greatly outnumber women in science, math, engineering and technology fields across all cultures, ethnicities, religion, and political lines all over the world, at any given time in human history??

    This is not an American phenomenon or some white male sexist chauvinistic conspiracy. It is purely Biology 101. You will find the same "problem" in Russia, Israel, China, Latin America, or Africa. Men greatly outnumber females in tech fields across all racial and ethnic groups all over the world.

    The genetic differences between males and females simply lead to different tendancies in how men and women use their brain. In short, men tend to think better spatially and thinking of things as objects, whereas females tend to personalize in their thinking. Women have no trouble going into social sciences or practicing law. The men who go into tech fields tend to have the most extreme levels of spatial/objective ability. Even though most men do not feel comfortable or desire a science/math/engineering/tech career, because these fields really demand the most extreme in spatial/objective ability, most people who do will statistically on average be men, thus men will outnumber women.

    Now, whether we want to increase the number of females in tech fields is a seperate issue. It depends on how far we want to social engineer people to do certain things because we want everything to be politically correct.

    The excuse that women don't want to go into tech jobs because of us geeks is true, but it is not the core reason why women don't go into the jobs. That's like saying most men don't want to go into daycare because they don't like taking care of little children. Anyways, biology is not really interested in what you want or don't want, that is subjective, and for psychology to interpret. Biology is only interested in action, what you ultimately end up doing.

  289. Re:some truth to it... by Brave+Little+Toaster · · Score: 1
    How many kids are there that don't care what other people think of them? ...The social pressures start early and don't let up.

    I agree with you that social pressures start early, and that they don't let up. However, not every kid attaches so much value to what other people think as to give up an interest they may have. Children can be brought up to be independant rather than groupthink oriented.

    By the way, I want to applaud your response to your daughter's concerns that she is stereotyped as a geek. That was good parenting in action.
    --
    brave little toaster

    --

    --

    --
    brave little toaster

    "Remember, don't try this at home until the statute of limitations has expired."

  290. The cause of gender imbalance . . . gender imbalan by Trollusk · · Score: 1
    It's like racial balances in neighborhoods. Integrated neighborhoods can roll along for years just fine, but if the balance tips too far one way or the other, people in the minority (in the neighborhood, that is) feel uncomfortable and move out, which tips the balance even further.

    It's the same deal with the balance in computers -- the field has been so male-dominated for so long that it's automatically an unpleasant choice for many women because they're so outnumbered.

  291. Re:looks like a chicken and egg thing by vagn · · Score: 1

    Dumbing it down is poison.

    I've got a part timer here, she took two semester's
    worth of C programming at a technical school that had a
    "business" orientation. I think most of us would rather
    commit hari-kari than sit through that. It's amazing she
    still has any interest at all.

    She wants to do unix sys admin. That's cool with me.
    I've had her build linux boxes, and do a few installs.
    She knows vi, gimp, ftp, telnet, web browsing, some HTML,
    rudimentary scripting, how to construct a simple make file,
    and some C. Getting the modem and printer to work was
    asking too much.

    About a month ago I handed her Stevens' "Advanced
    Programming in the Unix Environment". She hates this book!
    It scares her. "This guy was too smart" she keeps saying.
    "Do I have to learn everything in this book?", she asked.
    "No, just make sure you understand the code, and look
    up the system calls in the man pages," I answered. "And
    forget about reading ahead, take it page by page."
    So, she keeps going. I'm waiting for the bug to bite.
    I'm guessing that around chapter 8 she begins to get it.
    That's also about the time I expect her to get the
    modem and printer to work. Hmm, which means she will
    have evolved to sysadmin, JG. I'll have to think up an
    appropriate ceremony.

    Nature += nurture.

  292. Re:There are two genders, folks, not one. by WildBeast · · Score: 1

    Talking about cheerleading, cheerleaders sure do look nice and I love to look at them but what a waste of talent. Most of them are very talented and yet they do not so usefull jobs.

    Their's nothing wrong with the fact that females are different than the males. But they're not so different actually. Both tend to give a huge importance for material stuff (me included) guys go for computers, cars, etc. and girls go for makeup, clothes, etc.

  293. Intelligence has nothing to do with gender. by Anonymous Coward · · Score: 1

    I find myself just as involved in the entire industry as my male counterpart. I'm mainly a programmer, but also do networking, and Unix administration. I do these things because I find them -interesting-. I love to learn about different languages, protocols, networking equipment, and so on. It's exciting. I do not even feel "out-of-place" being a female. I know more than a lot of males in the industry. However, that's not to mean that gender plays any role in the industry. Just as with any other field, you must be sparked by the whole movement. It's just what tickles your fancy. I surely couldn't picture myself as a secretary anymore than Cox could.

  294. But why don't girls want to be geeks? by pjrc2 · · Score: 1

    I think we are socialized from a young age into gender roles. There has been a long held belief in our society that programming and "computer things" are "boy-things" and not okay for girls to do.

    I am a geek, and I am a girl. Well, make that geek light as I am not programmer.....yet. I have found that as an analyst for a big 5 accounting firm, it is my technical skills that are in the most demand, not my accountanting skills.

    I think that technology needs to be better integrated with more areas of interest to kids. The exposure to and the encouragement to get involved with technology needs to happen at a young age, and without gender bias (in a perfect world).

  295. Re:Whatever happened to beer? by crhodes · · Score: 1

    Guinness. Spell it right. For God's sake.

  296. because women are "intellectual aristocrats" by anonymous+cowerd · · Score: 2

    What men, in their imbecility, constantly mistake for a deficiency of intelligence in women is merely an incapacity for mastering small and trivial tricks. A man thinks that he is more intelligent than his wife because he can add up figures more accurately and because he understands the lingo of the stock market, and follows the doings of political mountebanks, and knows the minutiae of some sordid and degrading business or profession, any soap selling or the law. But these puerile talents are not really signs of intelligence; they are merely accomplishments, and the differ only in degree from the accomplishments of a trained chimpanzee.

    The truth is that the capacity for mastering them is the sign of a petty mind, and Havelock Ellis, in his great study of English genius, shows that men of genius almost invariably lack it. One could not think of Shakespeare or Goethe or Beethoven multiplying 3,456,754 by 79,999 without making a mistake, nor could one think of them remembering the price of this or that stock last July, or the number of beans in a pound, or the freight rate on steel beams from Akron, Ohio, to Newport News, or concerning themselves about the cost of producing a stick of chewing gum, or the pay of street car conductors, or the credit of some obscure shopkeepr in Memphis, Tenn, Such idiotic concerns are beneath the dignity of first-rate minds.

    That women always try to evade them - that they have little capacity for the childish complexity of tricks upon which men base their so-called business and professional skill and cunning - this is but one more proof of their intellectual aristocracy. They are not stumped by such enterprises because they are difficult, but because they are trivial.

    - from "Meditations on the Fair," H. L. Mencken, 1917

    Yours WDK - WKiernan@concentric.net

    1. Re:because women are "intellectual aristocrats" by alienmole · · Score: 1

      Actually, Einstein is a pretty good example of someone who focused on the bigger picture and was wildly successful for having done so. He was known for not remembering his own phone number. The stereotypical "absentmindedness" of geniuses comes from their focus on larger issues. Perhaps the poster you replied to has a point - perhaps geeks, with our obsessive focus on things like the minutiae of programming language syntax, are really the disadvantaged ones, imprisoned by a kind of obsessive-compulsive disorder that prevents us from living normal lives...

  297. Re:glass ceiling by FigWig · · Score: 2

    I work at HP which has a female CEO, and my manager is a woman. Of course that doesn't mean she's any better than the normal clueless managers ;) There has been a lot of press about the CEO though.

    --
    Scuttlemonkey is a troll
  298. female geeks by NexusIV · · Score: 1

    Yes, there are female geeks! Fewer than male, but there are. The crucial part is socialization. Many girls and later women are driven away from technical stuff and computers and cars and so on with such nice words from society like "this is mens work.." "girls should play with dolls". I could post a long list here. Thus it is a parents task: Encourage your girls on technology, help them, when society does its best to discourage them. And by the way, don't forget your boys. Teach them the right things, too. Gentleness and good behavior is not a girl thing, but a human one that everybody likes.

  299. Re:But... by levendis · · Score: 1

    .....and they'd all be buying tangerine imacs.

    --
    ---- I made the Kessel Run in under 11 parsecs.
  300. Geek Girl and proud of it! by antigone · · Score: 2

    I'm admittedly a geek girl.. I am 22 years old, work for an internet company, design web pages and graphics on the side, and in general live a life filled with a wierd blend of technology and nature. I make great wages with amazing benefits, at the exact same rate as my male co-workers. I also happen to be completely and utterly in love with a guy who is a total geek as well. We work together, and we live together with our 'babies'.. two windows machines, a novell server, a linux server, two commodore 64's, and various other technological toys... with all of this in mind, I'd have to say that no, not all women disdain the technology fields.. and we're not afraid of the 'geek guys'. That's just silly. I love working with other geeks. We get to turn off the lights in our office and decorate our cubes with christmas lights year round. We have LAN parties sponsored by our company. We have tons of fun at work. We volunteer for overtime so that we can spend more time together. We are a huge mixture of men, women, straight and gay, strange and 'normal' people from all races and all backgrounds imaginable.. believe it or not, I even work with 'jocks' (but not many).. I love working with these people. Admittedly, in high school and even in college, I was one of very few females interested in technology, and I was surrounded by mostly males, but I got the impression that it was because alot of females in our society are pressured to be perfect, dainty, and dumb. We are constantly bombarded with media images of women who are obsessed with lipstick, clothing, weight, popularity, perfect skin and hair.. and the list goes on and on. Under this constant pressure, and even for reasons completely unrelated to it, many women are indifferent or even contemptuous towards intellectual pursuits. The same is true for many men, who are pressured by society in different directions which prove just as damaging. I am fortunate: when you're lucky enough to have friends and family who value you for your mind and for your personality, you are actually free to develop both, and you needn't conform to the traditional gender roles our society still tries to impose on us. I believe that in the next 30 years, these constraints will largely disappear as people realize that they are outdated and only hurt us as a society. I think that the idea of women not wanting to work with technology is silly, and if you really believe that we think that way, then I've got a 1.8 billion Mhz processor to sell you CHEAP! ;)

    --
    "Leave no authority existing which does not answer to the people" --Thomas Jefferson
    1. Re:Geek Girl and proud of it! by Anonymous Coward · · Score: 1

      Hi, I too am a geek girl. I am still in school studying to eventually write systems software. I notice that in class there are very few Women who are knowlegeable in any technological field involving computers. There are more guys in my classes than Women but I also notice the Men are more self taught where as the women are more in it for the potential money they can earn in the field. So, I do notice the problem. However, there are two things I would like to point out one thing is that money as a motivator won't make these individuals high quality employees as much so as the true passion for the field will allow those of us who are self taught as well to accel. Secondly, I hope to see more Women and more schools take advantage of the chance for Women to become geeks because this is one area women face little to no predjudice from within the culture. I find most descrimination comes from outsiders of the culture who do unfortunately play a role in the end result of how many Women become techies. For example, schools, parents, managers executives (suits) etc. Luckily if a young girl can overcome these obsticles I find that from within the culture the general attitude is completely accepting, and in a world were we have a medium such as the internet wich trascends sex creed color age etc this attitude is amplified. I have never had anyone on the internet nor any techie face to face ever have a different attitude toward me as far as my skills and mutual respect is concerned due to the fact that I am a female. So, now it is our job to educate the outside world, as I think this is a wonderful community to work/live in because We base attitude and judgment toward someone of thoughts ideas and intellect rather than on these other external factors. We, just need to get girls to see the community as we do. For it is indeed one place they will be judged as an individual rather than on the lack of a penis and the size of their breasts.

    2. Re:Geek Girl and proud of it! by The+Rev · · Score: 1
      Well all I can say is that I (a bloke) was into electronics at 12, computers at 13 and now I'm 32 and programming for a living in London.

      My wife is a fully trained counsellor but works extensively with computers and can out-Word and out-Excel me in her sleep. (To the Americans in this forum let me point out that your interpretation of a counsellor is woefully wide. To the UK it mean a professionally trained and accredited psychological professional. Some are therapists others are not.)

      Furthermore she's got more letters after her name than she does in her name and she's been smarter than I am since the day we met and always will be so.

      She's also a complete babe and I love her to death. She's a strong, passionate and fiercely intelligent woman with a sense of humour and drips with class.

      My point is this: women needn't be stupid, for a male Geek to maintain their ego. Any women who practice this (by keeping themselves stupid) or anyone who fosters it (by prejudicing women who don't practice it) are doing all genders a huge disservice.

      Also: aren't these kinds of questions (why do women do this... why do black people do that... why do gays do the other?) inherently foster prejudice? Think about it.

  301. Sad but true.. by Dest · · Score: 1

    Well actually there have been many studies just showing that women do not have the apititude for these kind of careers. My sister does not know anything about computers and would never try to pursue a career in them, but she uses it very frequently. I am not implying that women lack the skills, but in our society women are almost chided if they try to do anything but power their cheeks and paint their nails. That is how the social society works. Then you have your goths, they are just completely out of style ]:P

  302. Re:some truth to it... by alleria · · Score: 1

    Not every person can deal with sexist attitudes that many women encounter in tech-related jobs, and so some women choose not to deal with it and persue other careers. While I think this is sad, I personally know two women who left the computer science field because of sexism and other social pressures they continually faced from their peers. It does happen.

    That's true. But the opposite is also true: guys would love to see more girls/women in the technology-related fields, and would go pretty far to help them out. (Far from discriminating against women). I have a female friend at MIT in the Intro CS program, and essentially, when she walks into the lab(s), there's this mental 'OMG, it's a GIRL! YAY!' thing that all the guys go through. From what she's told me, at least, everyone (all guys, as it were) have been extremely helpful, etc.

  303. High School Techies by cronik · · Score: 2

    As a member of the Palo Alto High School FIRST: For Inspiration and Recognition of Science and Technology team I can personaly attest to the fact that in the team the ratio of boys to girls is 5:1. We would be happy to have more famales on the team but they don't want to join.

    --
    Information wants to be free like speech wants to be free, not like we want beer to be free.
    1. Re:High School Techies by Dest · · Score: 1

      I wish my school had some recognition for intelligent people. Wait.....nobody at my school is smart! Oh Poop!

    2. Re:High School Techies by Kanter · · Score: 1

      Hmm, i think it's all about persuasion and your own sociality.... Ofcourse nobody wants to join if you are very scary and keep such profile like you were a geek. I think noone's a geek.... Everyone like their own stuff, some like calling other who are smarter names and some like calling others with c++ statements ... Anyway i think if i would start our schools Tech group, then it would be a success... Even with girls...

    3. Re:High School Techies by kurdraw · · Score: 2

      I am also involved with the FIRST program at my high school, and things are starting to even out more. It all depends upon the coaches. Our coach makes an active effort to get more females involved and on the team. Unfortunately, there are very few who gravitate towards the technical aspects, most do "everything but the robot."
      --------------------
      kurdraw

  304. There are two genders, folks, not one. by Eil · · Score: 3


    I think the problem here is that people aren't yet understanding that the two genders in our society are not the same. They have different behaviors (in general), and are interested in different things. Does this mean that one sex is obviously better or superior? Of course not. Does this mean that women aren't capable of some of things men are generally more proficient at (such as programming) or vice versa? Don't be absurd.

    My point is that females are just different than males. Just what is so wrong with *most* women not liking the same things as men? Trying to figure out *why* this is the case is irrelevant, and so far it's leading to a whole slew of stupid assumptions in this thread, since it's fairly obvious that it won't change a whole lot in the near future.

    I see nothing wrong with trying to introduce females (and maybe more males) to technology, computers, and programming. But specifically trying to recruit more women into computer technology fields simply because the male/female ratio isn't balanced is just plain ignorant. It's exactly the same as pushing more females to become NASCAR drivers or encouraging males to do cheerleading in highschool. And if I don't keep repeating this, some troll is going to flame me: This doesn't mean that [gender] can't do [activity], it just means that most [gender] aren't interested in [activity].

  305. the problem with this study... by Nitrozac · · Score: 2

    is that it doesn't show us a clear picture at all. It quotes a group of teenage girls who say they don't want to pursue *computer* careers. It negates to tell us exactly what careers these girls are pursuing. A few years ago female law students outnumbered male law students, and there have been increases in females entering the medical profession. Lawyers, doctors, scientists, and researchers are just as geeky as IT workers, IMHO. Frankly I don't think articles such as this one helps shed light on any of this.It offers little solutions to the problem of marketing IT to teenage girls.

    Here is an article that helps to illuminate who the majority of net user are.http://www.mercurycenter.com/svtech/computing/ docs/044660.htm

    I've been curious, we all know that slashdot itself it operated 100% by men, and the male commenters far outnumber the female commenters. I wonder what the ratio is for those with accounts here. Why are there so few female role models in the OpenSource community?

    --
    Nitrozac
  306. Re:99% of women are WHORES by WildBeast · · Score: 1

    Would love to disagree with you but unfortunately you're offering nothing but the truth.

  307. Well, at my school... by Eso · · Score: 1
    I am a good math student (and also come pretty close to exactly fitting that typical 'geek' stereotype), I headed the math club wherein I assisted people, jocks, nerds, whoever, male and female, that were less numerically inclined. I think most of them were willing to overlook the 'Coolness Factor' when they found out what their midterm math marks were.

    I'd rather be pepper-sprayed by a mountie,

  308. Who really cares? by Anonymous Coward · · Score: 2

    First of all, I am completely sick of these articles about women geeks. Geeks are geeks, shut up already.

    Before I get flamed for being anti-woman, I am a woman. I am a woman who went to grad school in pure math, fixes cars and now programs. When I started grad school, I was automatically enrolled in the university's woman association. You will never know how pissed I was. Then I became a mentor for new TA's (it was a cake job) and the female professor in charge of the mentor program and I got in a huge fight because she said that as TA's we were supposed to treat female students different than men students.

    Maybe if women like this would stop standing on soapboxes and start talking about their accomplishments, then there would be some respect. As there is, women in this position whine about how women are treated, but they don't do anything to justify being treated any better. There is one woman I know who kicks ass in math, in fact her husband got tenure because of her, and people don't fawn all over her because she is a woman in math. People fawn all over her because she is great in her field.

    If you quit making such a big deal about what fields women go into, then they -as individuals- will make the appropriate choice for themselves. Maybe there will be more women in computer science, maybe there won't. But, who cares??? There doesn't have to be the 50/50 split.

    BTW, the reason that most male geeks can't get dates is because you are so non-aggressive that we don't even notice that you like us. Stop sniveling in the corner and ask us out. I will guarantee you that if you ask out a bunch of women, some will say yes. -This is said from personal observation of my friends whose idea of flirting is to pay 5% more attention to the person that they are interested in.

    1. Re:Who really cares? by mpe · · Score: 1

      f you quit making such a big deal about what fields women go into, then they -as individuals- will make the appropriate choice for themselves. Maybe there will be more women in computer science, maybe there won't. But, who cares??? There doesn't have to be the 50/50 split.
      BTW, the reason that most male geeks can't get dates is because you are so non-aggressive that we don't even notice that you like us. Stop sniveling in the corner and ask us out. I will guarantee you that if you ask out a bunch of women, some will say yes


      Interesting how "asking out" is one traditionally "male role" which a great many women see no problem with. Including those who have no problem making noise about discrimination in employment, etc.
      Why is it such a big deal that the man must do the asking out?

  309. Miranda and Ki by Chiasmus_ · · Score: 3

    I've actually heard from guys who have pinups of Miranda (User Friendly) and Ki (GPF Comics) on their walls. In fact, many of us would like nothing more than a girlfriend who could actually code. Sadly, I know of only two females who can write anything more impressive than basic HTML. (Before I get angry responses, I openly acknowledge that I do not know everyone in the world.)

    I wonder why it is that girls don't go for guys in IT. Sure, the occasional one of us is a fat slob or turbo-nerd, but I don't think those subsets are in the majority. And, we tend to have more money than the average Joe Six Pack, which is supposed to be attractive (according to the Discovery Channel, because it signals the women that we're more apt to provide for their young).

    So, what's up? Why do the women keep flocking to the high-power lawyers (which is just as non-physical, academic a job as programmer), while neglecting us? What the hell is going on?

    --
    "Beware he who would deny you access to information, for in his heart he deems himself your master."
    1. Re:Miranda and Ki by titus-g · · Score: 2
      Darn I knew I was on website!

      I want a BMW 750 (and a EVO VI, hmm actually 2 of them, one with the traction control & stuff, and one of the ones that have the 0 -> 60 that means you can drive all day and arrive yesterday, oh and a Lotus Carlton, and an M5 err I digress). (ooh S500 as well, & another Series III SWB).

      I still have the same PC I had 3 years ago, same CPU/RAM/HD, you couldn't even buy it now, and my stereo is one I won about 8 years ago. If I had the money I would go for the car/s. I mean I HAVE a text editor, 3 years later it still works!

      And just for the record, the main reason I've noticed that girls are dissuaded from becoming geeks is because they are better at it and this unerves some people.

      --

      ~ppppppppö

    2. Re:Miranda and Ki by antigone · · Score: 1

      I wasn't trying to sound 'self righteous or arrogant'.. I'm sorry if you took it that way or if it sounded like that though. I was simply trying to point out that the type of people who choose their 'mates' based solely on income levels are probably not the type of people that you want to waste your time on. I'd like to think that we all deserve better than that! And as for the personal barb, you're perfectly entitled to your opinions. I'm very happy with my wonderful boyfriend of almost 5 years, and hope that everyone here finds a geek guy/girl of their own who is just as wonderful and as interesting as my guy is!

      --
      "Leave no authority existing which does not answer to the people" --Thomas Jefferson
    3. Re:Miranda and Ki by antigone · · Score: 1

      hehe.. I sympathize with you, but speaking from the perspective of a geek girl who is completely uninterested in perpetuating the human race, or in the size of a potential mate's pocketbook.. well, you get the picture. Those of us who do understand and work in the tech field are perfectly capable of supporting ourselves comfortably, and are also smart enough to know that our fate does not have to lie in marriage, children, and mortages. Which means that the kind of women you're looking for are probably in no big hurry to find that special someone, and they certainly don't care about the size of your wallet or their nonexistant young. The type of women who are still looking for potential mates based on these characteristics are probably not worth the time it takes to find them. Rest assured though, girls who can code and who adore computers and technology do exist, and they're probably wondering where all the intelligent men are. And when they find /. and other places like it, there will be much joy ;)

      --
      "Leave no authority existing which does not answer to the people" --Thomas Jefferson
    4. Re:Miranda and Ki by Ecyrd · · Score: 1

      Exactly as you said: high-power. There are a few key things that attract people, power being the most important one. Wealth is okay, and so is security, but in our primitive minds men with power are desirable. This applies to both men and women equally, methinks.

      This explains why physically strong men, soldiers, lawyers and doctors usually have no trouble getting themselves a date. They all have control over other peoples lives.

      Wealth can buy you power, too, but since wealth is just a means to acquire power, you can just cut the middle bit and go directly to the power. Women are smart that way ;-)

      Us geeks are not powerful. Who cares if we have the power to turn the TV off automatically from our Linux boxes, or that we can hack perl faster than any other living being in the galaxy? It's not a direct manifestation of power... However, if you go and hack into a NASA mainframe and make a shuttle crash, you'd probably have a number of (dubious) girls queuing at your door (along with FBI, of course).

    5. Re:Miranda and Ki by linuxonceleron · · Score: 3
      AFAIK, Most lawyers drive a BMW 750iL and socialize at a country club, wear designer clothes, have nice furniture. These are accepted as symbols of wealth. Your average geek is more likely to drive a reasonable car, and spend his money on computers/electronics and all. To a woman, the nice car and furniture is more appealing than a Sony ES home theatre system and a Dual PIII 933. But as far as women not becoming geeks themselves, I don't know, there probably are, we just don't notice them or something.

      --

      Shine on, you crazy diamond.
    6. Re:Miranda and Ki by _Quinn · · Score: 1

      Did anyone else initially think that "GPF comics" meant Gender Protection Fault?

      -_Quinn

      --
      Reality Maintenance Group, Silver City Construction Co., Ltd.
    7. Re:Miranda and Ki by infinite_twilight · · Score: 1

      Some of us appreciate you guys... We just are not always noticable.. Where I live, the 'geek guys' tend to go after the easy ditzes (sp?) and ignore anyone with smarts as they figure we're too hard to get. That's not true though. I think it's more a matter of their lack of knowledge of what a girl really wants... ;)

      It is not necessarily a power thing that interests all of us. Some of us want a guy with similar interests to our own, so that if we get married (an arcane institution, but never mind that right now..) we will be able to do stuffs together and hopefully not get too bored... Some of us want guys who know our interests and instead of buying us perfume (blech!) or flowers, they will buy us more RAM or the newest version of Quake or Myst!!

      What I mean is this: the guys I know have spent practically their whole lives with comps. They have no idea what is going on when we hit on them and try to be subtle about it... They have no idea how hot they are.. So along come a couple of well endowed popular girls who decided for a joke to pretend their interested.. And the guys believed them! So now they have a thing for that type and totally ignore, us, the geek girl contingent. It's not that we are ugly or anything, they just think of us 'some of the guys'... :(

      ~me

  310. Re:glass ceiling by BenLutgens · · Score: 1

    YOu have GOT to be kidding me. THis is the same old "someone else is to blame cause I suck" cop-out. Look here, it's not someone elses fault you aren't ceo, it's yours. Noone is keeping you from excelling in your line of work except you! Seek responsibility, and take responsibity for your actions. In other words, stop whining about it and do something. Show some ambition and you'll get somewhere. Isn't the CEO of napster female? I could be wrong. Sorry. Just my two cents. I just get tired of that argument.

    --
    "If you love someone, set them free. If they come home, set them on fire." - George Carlin
  311. Re:Slashdot as a reflection of the geek community by gpvillamil · · Score: 1

    Having worked in management consulting, telecommunications and law enforcement, I can assure you that those fields also have no shortage of sexist, insecure and socially incoherent people...

  312. So using their study... by kid_wonder · · Score: 1

    ...a Geek Stud(tm) calendar should do the trick and reverse the tide.

    Now, the question is, will i have a 12 month calendar or one of those single sheet calendars with Jeff Bezos on it?

    __________________________

    --

    "Oh, you hate your job? There's a support group for that, it's called everyone, they meet at the bar."
  313. it's society by Emi · · Score: 1

    I think that we don't expect girls, in general, to go into technology. @ my high school, the only "technology" class that girls generally take is word processing, and that's only because it's required. the guidance counselors would reccomend that you take creative writing rather than computer science, because that's what everybody thinks females are good at.

  314. looks like a chicken and egg thing by mikpos · · Score: 2

    There are few "feminine" activities available on computers, which is most certainly a result of few "feminine" people creating the activities (programs). Too bad. Chicken-and-egg problems are usually very sticky to get out of.

    1. Re:looks like a chicken and egg thing by Wench · · Score: 1

      But WTF is a "feminine" activity?

      If I see another pink Barbie "math is hard, let's go shopping and download pretty dresses!!!" I will puke.

      And I won't believe for a second that that sort of rubbish encourages girls to do tech stuff.

      --
      No matter how cynical you become, it's never enough to keep up.
    2. Re:looks like a chicken and egg thing by tahini · · Score: 1

      I hope you don't meen touchy-feely things like the crud Purple Moon puts out, trying to get girls to use computers by reinforcing sexual stereotypes and making them more relationshippy. There was an AP or Reuters story (can't find it now, sorry) a few weeks ago about a study that found women use the internet now as much as men, but for girly things like women.com--the same hoo-ha in women's magazines at the grocery store.
      Dumbing things down to "appeal to women" may get my mom looking at martha stewart online but it's not going to attract women to programming, diddling with hardware or playing with unix.

      If you mean there's a chicken-and-egg problem of support for women in IT you're right; people don't generally want to get involved in something no one they know does. That's why groups like Linux Chix and unix sluts are helpful, because they let women know they are not alone in their choice to go into techie things.

    3. Re:looks like a chicken and egg thing by mikpos · · Score: 1

      Well I never claimed I had a solution :). Somehow I doubt the high school junior they showcased in the article is very representative (guess what, most guys don't like computer science either), but most studies seem to suggest that females really do not like computer science (relative to males). The problem with Barbie games (specifically) is that they're created by company which prides itself on taking advantage of small girls.

      Perhaps all it will take is a group of girls to come up with something a little more interesting (i.e. a new field of computer science). Females don't seem to dislike computers, and they don't seem to dislike science, so it seems as though it's the current implementation of the union of the two that puts a lot of them off. Who knows.

  315. Re:If i was a girl.... by alleria · · Score: 1

    Waiting for the ./ effect on Peer 2 Peer right now.

  316. Geek - 1 / Suit-Wearing Stick - 0 by The+Ice+Queen · · Score: 2

    Personally, I think the author who created that theory is simply pressing forth with an archaic stereotype that women aren't interested in anything technical. I am a female who is very interested in the field, and frankly I find men who are quintessentially "manly" and can do things like shotgun a beer in .5 seconds boring; I'll take a Unix geek over some jock-boy any day, as I would rather work in an environment where the majority of folk have Intelligence and Wisdom scores of at least 15.

    Bollocks to the 18/% Strength rating.

    ..>Dana

  317. Why are all the high mod cmts written by MEN?????? by Ruthless_Advisorette · · Score: 1
    Just curious.

    I remember the first time I saw a comment written by a female slashdotter. Proved that there IS hope for my type.

    Honestly, I'm intimidated by technology. My husband certainly is not. Why the discrepancy, I'm not sure. Obviously I'm not the only girlgeek out there with some hesitations though. It's not like I didn't have a geeky role model. My mother's a electrial engineer!

    Fact is, GUYS society STILL teaches women to be both maleable and sensitive. As long as we're maleable, we're going to shun the definitive world of ones and zeros. As long as we're supposed to be so sensitive, most will choose not to be "different" (read: geeky).

  318. Trolling For Babes. by istartedi · · Score: 3

    Somebody had to say it.

    --
    For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
    1. Re:Trolling For Babes. by Silas · · Score: 2
      Naw, just trolling for intelligent conversation about an issue that, when brought up, too many people blow off with some comment about trolling for babes...

      C'mon, be funny AND insightful! :)

  319. Re:GIRLS WANT JUSTICE FOR OSM by red+syringe · · Score: 1

    I have been recently thinking about beer. Beer is the nectar of Gods. We're not talking Guiness or Cerveza here, we're talking the real shit, Steinlager, Heineken, Pete's Ale.

    The problem these days is that people can't appreciate good beer. Too many people just get wasted on cheap-ass Ice House, Coors, or even worse, Bud. And that is a shame.

    In the old days, things were different. Beer, that was a commodity. Good, aged beer was valuable. People treasured those moments of enjoying a pint of cold, tasty lager with plenty of head. Nobody would touch an aluminium can, let alone beer in plastic.

    Open up a can of MGD today, and you've set yourself up for some major disappointment. Firstly, aluminum leaves a nasty aftertaste in your beer. Secondly, MGD has absolutely no head. It looks like stale tea. Thirdly, it tastes like stale tea too.

    Henceforth, I urge you people, don't drink cheap shitty beer!

    _, . '__ .
    '_(_0o),(__)o().
    ,o(__),_)o(_)O,(__)o
    o(_,-o(_ )(),(__(_)oO)_
    .O(__)o,__).(_ )o(_)Oo_)
    .----|......|......|......|......|......|_)0
    /^^^.--|......|......|......|......|......|,_)
    |^^/.........|......|......|......|......|...... |o(_)
    |^^|.........|......|......|......|......|...... |_/`)
    |^^|.........|......|......|......|......|...... |O_)
    |^^|.........|......|......|......|......|...... |
    |^^\.........|......|......|......|......|...... |
    \^^'---|.....|......|......|......|......|
    '----|......|......|......|......|......|
    |......|......|......|......|......|
    \......\......\....../....../....../
    `"""""""""""""""""`

    Enjoy life, drink beer.

  320. Another reason to DO computer stuff by shaldannon · · Score: 1

    whether coding, web design, exploring the kernel, whatever: You actually think! I like mindless computer games, but after a while, I get this urge to actually *DO* something....which playing video/computer games does *NOT* qualify as...I imagine you have a similar urge...


    if ($user =~ m/shaldannon/i) {
    print "\n-- $user :)\n"
    }

    --


    What is your Slash Rating?
  321. Re:GIRLS WANT ... OSM by anonymous+cowerd · · Score: 2

    Now, now, let's not get all serious and start blathering off about the First Amendment. 'Cause it can't possibly be happening for real. Let's talk instead about literary art.

    Go read some of osm's light short fiction, this for example, and then after I dare you to tell me straightfaced that a mind so disorganized as this could ever in any way deliberately inflict meaningful, effective damage against anything bigger, meaner, or better armored than a clothes-moth.

    A fan, WDK - WKiernan@concentric.net

    ...every pusillanimous creature that crawls on the earth or slinks through the slimy seas has genitalia... - our auteur

  322. Geeks GET Girls, Though. by dbirchall · · Score: 1
    I'm a geek. I married a girl who by all indications is smarter than me (she comes up with the classical theories of philosophy on her own without studying philosophy). She's also athletic, has a degree in a performing art, has done modeling for a company with the initials C.K., uses vi as her editor-of-choice on her Linux laptop, and gave birth to a really cute baby girl who we named (in proper geek fashion) Tera (nickname Terabit).

    And I'm not even a fabulously-rich-on-paper dot-com geek.

    Linus is also a good example. Everything I've read and seen indicates that Tove's a cutie, kicks butt (literally, as a multi-time national martial arts champions) and is no dumb bunny. Kids there, too.

    Hmmm. Maybe the girls are getting tired of the dumb jocks? Maybe? Or am I too hopeful?


    --

    1. Re:Geeks GET Girls, Though. by cronik · · Score: 1

      Yup, way to hopeful.

      --
      Information wants to be free like speech wants to be free, not like we want beer to be free.
    2. Re:Geeks GET Girls, Though. by mttlg · · Score: 1

      Yes, there is something wrong with them. Like many males, they suffer from a condition commonly known as "being a dumbass." Unfortunately, this is a highly contagious disease. Affected males commonly spread it to other males through peer pressure and intimidation while also creating a similar disorder in females through self-esteem reduction and a lowering of expectations. Unaffected males are less visible in the population but do exist. They tend to be reclusive, creative, and in many cases sensitive. However, the nature of those affected by the dumbass condition is to spread the disease as much as possible. This causes unaffected males to hide their non-dumbass characteristics and also causes unaffected females to become very frustrated. Currently, the only short-term treatment for males stricken with this malady is a swift knee to the groin; there is no cure.

    3. Re:Geeks GET Girls, Though. by nomadic · · Score: 1

      I think he's just gloating.

    4. Re:Geeks GET Girls, Though. by mortenal · · Score: 1

      Supposedly, guys compete to prove who's dick is bigger. Girls, lacking dicks, are hard to compete against, because if you are better than them, it doesn't prove anything, because they don't have dicks, and if they are better than you, it is extremely shameful, because even they don't have a dick, it is bigger than yours.
      On the other hand, there are some of us that don't give a damn, and go at our own pace, and do whatever we want. I personally compete with everyone, not to prove anything, but to improve myself. My competition, in the end, is mostly with myself. Other people are just a point of reference. Others don't compete at all. I have a few good friends that, instead of competing, they have friends that are worlds ahead of them, and leach information off of them. They don't care about competing, they just want to learn.
      Also, the kind of guy that most geek chicks are "in the market for" are generally smart and sensitive. Which means that the guys either have girlfriends already, or are gay (and probably have boyfriends). If they are straight and single, they are probably excessively shy, and will never let onto the fact that they have pictures of you on their walls, know your mother's birthday, your dog's name (who died 12 years ago), etc., etc.
      Well, that's only if they stalk... and chicks -- if you find a guy that's stalking you, don't be afraid of him!!! I think that stalking (to a mild extent) is very sweet, and often times, the only way a guy can subtly show that he cares... Now, if he's sitting in your bushes at midnight, that's a bit much...
      Basically, there are guys out there that probably worship you, because you know more than them. My girlfriend is heavily into genetics, and I get her to teach me as much as she will (even tho I rarely understand any of it).
      Hmm... reading over that, i said all i meant to say, but i'm not sure if it's very clear... to sum it all up -- Guys are stupid jackasses. Become a lesbian.
      oops, i mean, Guys are stupid jackasses, you just have to learn to find the few that aren't, and be forward (but not slutty) towards them.
      Yeah. that's what i meant to say...


      Think that was flamebait? You've obviously never met me in person...

      --
      Think that was flamebait? You've obviously never met me in person...
      $email=~tr/.@/ /d;
    5. Re:Geeks GET Girls, Though. by infinite_twilight · · Score: 1

      I have a curious question to pose:

      Where I live, the geek guys have girlfriends out of their fantasies, the geek girls do not any boyfriends... Why is this? Are we repulsive or something? It is so frustrating to go to school and into the server room and hear them gloating to each other about what she did for him this weekend and be miserable 'cause you want that particular guy so bad.... :(

      And also, when any of them do ask you out, they just want sex... I have no problem with f***ing, but I would like for it to be a meaningful relationship, not just the-ditz-left-me-in-the-middle-of-the-theatre-and- i-am-really-horny type relationship... Is there something wrong with them, because I so do not understand: they want meaningful relationship with hoochie who just wants sex and they just want sex with girl who wants meaningful relationship... URGH!!

      ~me

    6. Re:Geeks GET Girls, Though. by infinite_twilight · · Score: 1

      I tried that... didn't work.

      The thing that annoys me almost as much as them having girlfriends and me no boyfriend is that they don't believe what I do.. They think that it is just some fluke when I fix the comps in the one lab at school or that I get other people to do work for me... :(

      Perhaps you are right about the good geek guys hiding, but I can't find any :(

      ~me

  323. How about this ! by datadictator · · Score: 1

    Qouting an e-mail discussion I had with hemos:

    "Thanks for proving that Linux guys can get girls too"

    "And we can get the best girls !"

    The defence rests !

    PS. Any of you single geek girls happen to be looking for a geek who works out studies martial arts and writes gothic poetry, mail me :-)



  324. Oh no, not the tired old "liberal whites" thing by jsm · · Score: 2
    Why is it that people always feel that everything has to fit according to statistics or all is not well. Gender imbalance reminds me a lot of the so called Digital Divide...lots of liberal middle class whites who feel that the poor underclass must be forced to be as technically inclined as they are. Frankly, I'm black and I have lived amongst and known black people all my life, and being computer savvy is not high on the average black person's to-do list. No amount of government intervention is going to turn the average poor black person into some cybersurfing, net junkie simply to balance some statistic chart.

    Uh, dude... I know some black folks think it's hip to whine about "liberal middle class whites", but geez, that sounds dumb and gets old. Those "liberal whites" are usually supporting issues first brought up by black activists like Jesse Jackson, Mumia, Al Sharpton, Chuck D, King, Malcolm, .... You don't have to like all those guys, but they sure think these are important issues, even if you don't. (Usually their issues are as much about rich/poor as they are about black/white, including the "digital divide".)

    What, you'd rather white people be "conservative whites"? You think that's better? Time to start figuring out who your friends are.

    Computer savvy is now a major source of power in this world, not to mention money. Hell yes, I want everyone to have access if they want it-- rich or poor, black or white or latino, man or woman. If they don't want it, OK, but I want them to have the choice. If someone chooses against it, don't blame me if they can't get a job because they don't have computer skills. I'm not against changing things so that other jobs pay better, I'm just talkin' about how it is now.

    Maybe you're totally misunderstanding those "self-righteous" people you're so tired of. Maybe they're not trying to mold anyone in any image or force anyone to do anything they don't want to. Maybe they're trying to help people who ask for it. If you're not gonna help, then at least get off their backs.

  325. Well, girls and guys are different but... by alenm · · Score: 1

    I think it is healthy with a balanced environment at work. I have seen that male dominated environments often are not as healthy as more balanced environments. With balanced I don't mean 50-50 but let's say 70-30. The mix makes the workplace a better place to work in because girls usually are not that geeky and they maintain the contact with normality when it comes to working hours and behaviour. Because of that people at least try to behave in a normal manner. And they see that it is possible to actually have a life. It can be very fun to work in a totaly geeky workplace, but I don't think it either good or fun in the long run (well, at least if you mind ending up as divorced at 40). So all you guys try to be nice to girls and treat them as buddies (-dirty jokes -farting) and maybe they will stay with us. You have to admit it: it is very frustating looking at just men the whole day.

  326. flack for being of the geekly nature by jaxon6 · · Score: 1

    i don't know about all other computer geeks, but some, like me, had to be a 'non-typical-geek'. meaning, partying with the football guys when they showed up at parties. also, being 6' tall with an attitude to match helped. didn't anyone else think "ya, i like computers, you got a problem with it?" not out to make trouble, but not going to be pushed around. there are others out there, right? or is the typical computer geek true to the stereotype?

    --
    Do you see the sig? Do you have it in your sights? Why yes, Miss Moneypenny...
  327. Technology for women? by skurken · · Score: 1

    I got the notion that maybe women are not so interested in the technology designed by men. Possibly women would find technology more interesting if more of it was designed by women.

  328. A new level of shunning by Gorimek · · Score: 1

    So what I hear here is that girls forsake highly paid careers in fields they are well suited for, just to avoid being around me and my likes?

    I see. At least we now have a use for nanotechnology: Examining my self esteem!

  329. Ummm...we got some things backwards here by shaldannon · · Score: 1

    most of the girls i knew growing up couldn't study or concentrate for long periods of time. that's a killer for any analytical career.

    These girls must have been the exception rather than the rule. My experience is that by and large the girls I knew in gradeschool and college were far more studious than their male counterparts. Most of the guys I've known would rather play (games/sports/...) rather than study.


    if ($user =~ m/shaldannon/i) {
    print "\n-- $user :)\n"
    }

    --


    What is your Slash Rating?
  330. Re:Girls don't watch the Man Show or play Football by tahini · · Score: 1

    Some other posters have made mention of the girl who demands acceptance because she knows a little HTML. Whether this is as common as it seems or not, there is a burden on women in IT and other technical fields (physics, math) to be better than average just to justify their presence that does not fall upon the geeky male.
    Like Miranda from UF and Ki from GPF,we not only have to fit in , we have to be really damn good just to be acceptable. Or, as Pitr demonstrates, our abilities are ignored.

    This is not about "making everything 50%/50%", it is about not losing the potential contributions people have to offer fields because they feel pressured to go into something else. If, given equality to begin with, men and women really did choose to go in different directions, there would be no problem. But to assume that the field is level just because you or your friend Mathilda had no problems, and then chasitize women for not getting off their duffs and interested in technical fields, is extremely pompous and ignores the sexism and misogyny still common in American (Western?) society.

  331. I think you miss the point . . . by White+Shadow · · Score: 1

    Back to the topic at hand, why is it that people feel the need to try to push girls into technical careers?

    No one said anything about pushing girls into tech careers. The whole point of the gender (or racial or age or whatever) divide is that assuming people are in fact equal, why is there this huge difference in the percentage of men in tech fields vs women in tech files? Since we assume that people are equal, we expect the percentages to be the same, and if they aren't, then we say, something is "wrong." Now, this mind set obviously is partially flawed since not all human groups are the same especially when it comes to interests. But unless someone shows that in women don't want to be in tech fields due to a genetic difference, then it is some form of social influence causing them to not want to have a tech job. And if society is the cause of women not wanting to get tech jobs, then that is definitely a weakness of society.

    It's this kind of rationalization that lead to discrimination.

    Please don't moderate down, someone has to stand up to discrimination.

  332. dbirchall by Redking · · Score: 1

    more can be found about dbirchall here

    Hey Dan, I'm glad you're a geek enjoying life. You have beautiful wife and best of luck to you.

    See, there are geeks who are fairly normal.

    --
    Rangers Lead the Way!
  333. girls by tail.man · · Score: 1

    I am in network security and my girl is a UNIX sysadmin. Many times she has problems with the geeky guys and their big dick contests. Many geek s really are imature little shits.. threatend by women that know their shit.. It is not that girls can't do it, many don't want to put up with you little worms... ha ha...

    --
    http://tinyurl.com/globalwarmingisascam
    1. Re:girls by Anonymous Coward · · Score: 1

      "The am in network security and my girl is to UNIX sysadmin. Many times she has problems with the geeky guys and their big dick contests. Many geek s really to are imature little shits.. threatend by women that know their shit.. It is not that girls can' t I give it, many don' t want to put up with you little worms... it has has...
      "

      if you *ARE* an admin, you should know, it's the SCRIPT KIDS that don't get chicks ;)

  334. Give them a shot and turn into geeks eventually! by Clarissa · · Score: 2
    I am a female geek, and I am one of the best computer professionals I know.

    Now, if I had not been turned on to computers in junior high, and then been introduced to the "geek" society and local BBSes by a good friend in high school (thank you Justin Scott!), I would not have the chance to contribute. I would likely not be in this field at all.

    What we can take from this article is that, in order for any child to be comfortable with a computer, they must have regular access to one to experiment with it.

    In the article, one person mentioned that when the students are given access to the computer, the girls in that particular class hang back and let the boys take the helm. It's not that they don't want to use the computers, but that they are not getting the regular access to them.

    I know this is true because I experienced it myself. In a group where there is a limited number of computers and where there are many boys, the boys tend to be more aggressive and get "dibs" on the computers first. Just watch a middle or high school computer lab and see!

    If you take the knee-jerk anti-"liberal social movement" view of this and say, "Girls will go into what they are interested in, we shouldn't push them into it," you're missing the point.

    If you give a kid access to a computer, they will play with it. If they play with it, they'll break something, and if you expect them to fix it or make it difficult to get it fixed, they'll learn to do it themselves.

    If a kid does not have access to a computer, they will never learn to do this. Then, when they grow out of the "Eww - computer geeks are gross" stage, they will have the background to be able to jump in to a good career (and a great social group! My husband, brother, and friends are all computer geeks, and I'm one happy geek chick!)

    The point we can take from this article? We need more computers in schools, a one-to-one ratio, in order to make sure every kid has the opportunity to use one.

    --------------------------

    "Everything I'm telling you tonight is true - except for the part where the banana *sticks* to the wall." - Spalding Gray

  335. Re:The lack of chicks isn't the problem.. by antigone · · Score: 1

    It's not the 'hot chicks vs ugly hags' thing that's in dispute.. it's just that women tend to be turned off by men and people in general whose one and only train of thought seems to be "I can't even associate with someone without checking out their ass". Which is what the previous post was implying. And believe it or not, there are quite a few people out there who are more into personality and intelligence than bust size. I for one would rather date my cute but slightly balding boyfriend who is witty, smart as hell, and tons of fun than some guy with washboard abs and an IQ of -10 who never could figure out how to tie his shoelaces or pronounce his own name. Unfortunately for me, when I was single, I tended to find none of the former and all of the latter.

    --
    "Leave no authority existing which does not answer to the people" --Thomas Jefferson
  336. Our Sad Technical Frat by drs · · Score: 4
    I think the attitudes of the people in this discussion show us exactly why the "ladies" and "girls" often don't start into technical careers. Its a system that feeds on itself.

    And the salary ceiling that women hit in technical fields if they don't move into project management or sales isn't much of a positive incentive either.

    It's unfortunate because when your whole company is made of 25-35 year old straight white males (like mine), you are naturally going to have a limited number of approaches to a given problem. Divesity is a real benefit. Too bad we don't get more of it.

    1. Re:Our Sad Technical Frat by Frymaster · · Score: 1
      What?!?! Where do you work at?

      I must admit that my employment history isn't very diversified, but I know a lot of folks in the industry in my city and it is overwhelmingly swm's out there. This strikes home even more today... our new hire showed up for shift one. White, male... straight? Well, a 90% chance.

    2. Re:Our Sad Technical Frat by SpryGuy · · Score: 1

      Yeah... I remember working at a place that seemed overwhelmingly Straight-White-Male. Only after working there a while did I realize there were several not-so-straight people there :-) It's not always obvious.

      - Spryguy

      --

      - Spryguy
      There are three kinds of people in this world: those that can count and those that can't
    3. Re:Our Sad Technical Frat by mpe · · Score: 1

      And the salary ceiling that women hit in technical fields if they don't move into project management or sales isn't much of a positive incentive either.

      And men don't hit exactly the same "ceiling"?

  337. As a lifelong geek girl... by OvisSum · · Score: 1
    I tend to think that, given more exposure to technology, most girls would pick it up as often as men do.

    I've been doing various "geeky" things all my life -- good at math, had a Commodore 64 in 2nd grade, and so on. On the other hand, more than one of my male friends has introduced his girlfriend to our heavily-geeky crowd, and it *always* results in her taking a much stronger interest in technology, sometimes to the level of wanting to program herself.

    And I don't know if it's just me, but having dated one geek man, I found that other men -- of any sort -- didn't measure up. I'm marrying a geek.

    --
    Carpe Ovis. Veni, Vidi, Ovisi!
  338. Re:Girls don't watch the Man Show or play Football by Dyolf+Knip · · Score: 1

    You'll love this. A girl in one of my CS classes last semester declared that she would love to do the trampoline bit once or twice on The Man Show.

    --

    --
    Dyolf Knip
  339. glass ceiling by purefizz · · Score: 2

    Another thing that it doesn't seem to mention is that there is a glass ceiling. Even if a female is smart, or adept at their job, they are held to a limit. How many women CEOs do you see out there? You don't see it because the business is run off of a good ol' boys network. Either you're part of the network or you're not. Advancement isn't really based on merit. I mean how many managers have you met that know what the hell they're talking about?
    if you have, please refer to Dilbert to have your brain washed.

    CAD, kicked, good

    1. Re:glass ceiling by infinite_twilight · · Score: 1

      In regards to female CEO's, the newly formed Hydro One has a female CEO, Eleanor R. Clitheroe. My dad has had to deal with her and she's pretty decent. I also read some where that more small businesses are managed by women than men...

      ~me

  340. So? by DansDad · · Score: 1

    My comment has nothing to do with gender. This article along with a few others I've read recently , some on Digital Devide for example, got me thinking:

    Why is it we hear more and more about differences, perceived as inequities, which must be the result of some gender / race / age / religion / political / genetic / discrimination, a wrong to be righted by some government sponsored TLA which will only fsck things up more than they already are?

    Why is it that industrious people tend to make more money than lazy people? A more clear case of social injustice could not exist. Our indoctrination into the culture of achievement == reward begins the moment we exit the womb and continues throughout our lives, denying half of all citizens a better than an even chance of achieving their rightful share of the Non Cultural or National Specific Utopian Dream.

    Our educational system is but one example where we as a society have failed miserably to prepare and provide for the non motivated. One could almost understand an environment of benign indifference but such is not the case. Test are administered and 'graded' based on the percentage of 'correct' responses. It is no secret that the callous lackeys of the establishment consider those individuals who do their homework, pay attention in class, study and subsequently are able to provide a higher percentage of 'correct' responses to somehow be 'better' students.

    The rewards and advantages presented by the establishment to these so called 'better' students are considerable. So is the damage done to the psyche of those considered 'average' and especially 'poor' students. Similar practices in business and industry, and yes even within government, prevail and are obvious to anyone with the courage to remove the social blinders and look. This madness must end. Please join and contribute to:

    The Society United to Remove Criteria from Decision Making
    %United Nations
    2000 Socialist Way
    Clinton, Arkansas
    ru2b1

  341. Different Kinds of Girls by i-Chaos · · Score: 1

    I'm speaking from a personal point of view as a 19 year old guy fresh out of highschool who was once a complete geek but now is much more sociable than before. My personal prejudices are my genuine opinions and not to be considered as troll or flame bait.
    Personally, I believe that a sense of "geekness" is cultivated at an early age (as are most things). At a young age (I'm thinking grade 6-8), girls are most popular if they start trying on make-up and bras, while the girls who sit under a tree and read novels are picked on and teased. Of course, attraction of boys is "addictive," and once you know that you can get a boy's attention, or the attention of your fellow classmates (the good kind of attention), you'll want more. Though, keep in mind, I'm no psychologist. Either way, there will be girls who act to please (and be popular), and there will be girls who don't feel the need to attract TOO much attention to themselves (and therefore become nice girls who read in their spare time).
    Now, I would say that even with that simple split, 75% of the girls have already headed down the early non-techie road to become prom-queens and wanna-be's in highschool (and thus, will never have time to cultivate "geekness"). What of the 25%, the secluded girls? Wouldn't they become geeks?
    The answer is, very unlikely. Those girls have been picked on from gradeschool, and will either want to become more sociable in highschool, or become more immersed in their books, hopefully using their smarts or their kindness of heart to win guys over (by highschool, almost every girl starts wanting to attract, just in different ways). Now, why not immerse themselves in computer books and the internet? Because it doesn't "change the world" the way they might want to. In a way, they want to fight for a different status quo and either become rich or famous (and show those prom-queens in high-school a thing or two). Think about the movie "Never Been Kissed" where Drew Barrymore tells the prom-queens that they'll never be much in life - she was right. The better-educated girls will be better off in life, having better, nicer, and guys to walk into a restaurant with, being driven to cocktails and balls in fancier cars and better dresses, or maybe one day changing the role of women in society or killing discrimination in itself. Now, what does this have to do with not being a geek? Simple. Who do you think gets more guys chasing after her, a coder girl whose job is staring at the code for Windows 2010 all day, or the banker woman/business woman/lawyer who will see people, meet people, talk with people, and deal with people everyday? Chances are, if I meet 10 people a day I will get someone faster than another person who meets 10 people a month or year. Just think about it. And besides, after reading the .plan files of people like Steve Gediken (sp?) and certain sentences which show how devoted geeks are to their work (read: "Slept at the office last night again") well... now you know that they don't let the llamas out much :) No offense, Steve, if you're reading this. Anyway, although slashdotters would probably love geekchics more than others, keep remembering that most people, and especially most businessmen and the like still pine for Cindy Crawford who has been seen on covers of enough magazines. Think about a song that is on the radio once, and a song that is on the radio about 10 times a day. You might not like the song to begin with, but you'll learn to tolerate it and even like it.
    Now, I must say that, being the semi-geek that I am, I would probably love a semi-geek-chic. Currently, my girlfriend is not very technically inclined, but likes to be very argumentative. Of course, being the "man" that I am, I might be a little over-bearing, also, so we argue. For instance, I would say that one can't buy a "decent" digital camera for less than $600 (you guys know what I mean by a decent digi-cam... I mean, anything under 1 megapixel isn't that great at all, and won't work for most purposes). Now, she would argue this and say that the $300 camera they have at school works fine and works really nicely. Of course, when the argument gets out of hand, she complains that I always have to throw my knowledge in her face and offer my opinion on why she's wrong when her opinion is supposed just as valid as mine. Then again, being more technically inclined, I'd like to think that my opinion on digi-cams and other technical equipment would be more valid than hers. Think about it, does David Grossman's opinion of the ever popular debate of Q3 vs UT vs HL:CS matter as much as, say, the staff of the OGL? Think deep, and thanks for reading :)

    i-Chaos
    http://ichaos.tripod.com

    --
    ...I am proof that intelligent beings are not always intelligent...
  342. Flame the beerhead! by datadictator · · Score: 1

    Would somebody please flame the damn beerspammer !

    EVERYBODY KNOWS THAT THE NECTAR OF THE GODS IS VODKA !
    Ask James Bond !

  343. Re:some truth to it... by merchoc · · Score: 1

    Well... ...social pressure does start early I guess. I "blame" one of the facts that I am now what is commonly termed a female geek on going to a highschool where there was a total of two other girls! If anything the 3 of us would have had a miserable life if we _weren't into tinkering with things and taking them apart! Of course we also had plenty of access to computers and when I think of highschool these days coding bad Pascal and playing Kings Quest3 jumps to mind rather than worrying about dates. Just my 2 cents... Btw I prefer being termed a nerd than a geek though :)

    --
    "Any sufficiently advanced technology is regarded as magic! - I'm a magician
  344. Girls don't... by jkirby · · Score: 1

    Again, Why this abundance of ignorace on SlashDot this week? This makes me want to puke!

    --
    Jamey Kirby
  345. *you* have a problem with logic by Nicolas+MONNET · · Score: 1

    Your post does'nt make any sense.

  346. Make programs and systems that women can enjoy! by fugu23 · · Score: 1

    Sheesh people. Its not that hard. Look- at age 12 or so (yes, Virginia, there are surveys that back this up, do your own damn research), girls lose interest in computers. Up to about that point, girls and boys regularly enjoy computers. After that, nothing. Why? What sort of computer programs are there to attract the attention of girls? Do you really think a 13 year old girl is interested in playing the latest blood-bath game? Do you really think that a smart teenage girl is really going to get interested in a career in computers by playing 'Barbies Make-Up CD Kit'? Read this, software designers: There Is Nothing For Girls To Do On Computers. If You Make Something For Girls To Do On Computers, Then More Girls Will Learn To Enjoy And Use Computers. If You Make Software That Is Easier For Girls And Women To Navigate, More Girls And Women Will Use That Software. You Will Make More Money. Now, was that so damn hard?

    --
    r. (Do not deny not by denying)
  347. Don't give me that.. by knghtbrd · · Score: 3
    Arguably I have little room to talk given that the last time I looked I was male, but this so-called gender gap in technology is a joke. YES there are men in this field, there are men in lots of fields. Yes (especially places like irc) anyone known to be female joining an irc channel is going to get a bit of crap from a few of the males there who are young, hormonal, and can't seem to behave themselves. That sort of thing is going to happen anywhere and it doesn't just happen to women because they're women. It happens to people in general because they're not the same. This is a very sad thing, but it happens in every field and everyone is going to face some form of social discrimination at some point, usually over something as pointless as their sex. The same applies for age, nationality, school or experience background, appearance, social class...

    While it is true that discrimination happens, this has the feel of someone feeling that someone set out to prove there's inequality for the sexes in technology. Look hard enough for something and you'll find it. This story doesn't deal with schools being harder on female students or employers disregarding apps because of the sex of the applicant.. No, this is a study saying that because there aren't enough females in technology, there aren't enough females in technology. Give me a break! I don't believe in effects causing themselves - especially when it comes to people. As a species, humanity is more stubborn than that. And the half a dozen female geeks I know seem to indicate this to be true. They don't care if the industry is populated by men - geeks are what they are and the "geek lifestyle"(?) is the one they've chosen.

    I encourage any woman who wants to go into technology and has even a shred of self-respect to do it. If they meet resistance, keep fighting. I feel I was just about born a geek and I wouldn't let anyone in the world take that away from me - they shouldn't either.

  348. Re:Geek chic(k). by Vanders · · Score: 1

    Where does this idea that Geeks somehow have poor personal hygiene come from? It's a poor myth. Of all the Geeks i know, they all keep themselves clean and smart.

    Of course, after a 48 hour hacking run, you'll probably need a shower, but then, who wouldn't?

    Damnit, Geeks think they don't Stink! Sorry for the rant :)

  349. This is depressing. by Satsuki+Yatoji · · Score: 1

    Kinda funny how most other areas of life and society, girls are raving for equality, myself included. But I personally would rather be seen as a bit geeky, and also be seen as intelligent, not to have my information or viewpoints discredited because I'm a girl and am therefore assumed to not know a damn thing about technology. I know I'm not the greatest, but I'm learning.

    Girls might also be a little weird about it threatening their 'girlness'. Like guys they like or female friends might think them less 'girl' because of their Linux obsession or skill with HTML. Sounds weird, but it happens to guys all the time, when they like art, or don't show an interest in sports, or something equally silly.


    --

    -You're wearing...A bag? I have misplaced my pants.
  350. Girls don't watch the Man Show or play Football by AtariDatacenter · · Score: 3

    So the majority of girls don't want to watch the Man Show, or to play Football. (Yes, there are exceptions.) The reason probably isn't so much that they are male dominated. Perhaps women aren't as interested in computers because the male domination has steered everything in a direction that they are really not interested in. Ever thought how modern computing would be different if it was women dominated by the start?

    1. Re:Girls don't watch the Man Show or play Football by Dest · · Score: 1

      What kind of exceptions? :P

  351. The Real Problem(s)? by cnj · · Score: 1
    "Girls have other priorities. Guys are more computer-type people."

    "I don't want to take computer science. ... Just looking at it, all the programming and these funny-looking things on the paper. It (takes) so much stuff to do one thing on the computer."

    "The reason why you see more men doing computer stuff is that girls are more ambitious than that. My parents always say, 'Do something with computers,' because it is stable and stuff, but a lot (of people) don't want to be at a desk from 9 to 5."

    The problem is that people still have there stereotypical views of life and professions. I know many males that are certainly not "computer-type people" and at the same time, I know many women that are. In my most recent programming course, the problem was not that the women couldn't handle the class, or even that they didn't find it interesting, it was that there were only a few there! One of the female students in the class actually ended up getting one of the higher grades there.

    Another problem is, though this may make me sound like a misogynist, is that many females (and of course many males too) do not have the dedication to learn "these funny-looking things" and just want to point and click. This certainly isn't true in every case, of course. My younger sister was able to learn VB (of course, most wouldn't even call that language, but) well before a fellow male classmate of mine (currently pursuing a computer engineering degree . . .).

    I don't get that bit about being more ambitious though .. .

    --

    --
    Never trust anyone over 90000.
  352. Re:Slashdot as a reflection of the geek community by g33kch1ck · · Score: 1

    Yeah, that must be why you're an Anonymous Coward. Fucker. "Taking it like a man" would mean having the balls to use your name when you're baiting flame. Ask your mother what being a woman and having an asshole for a son is like; ask your mother about being a woman. Or did your mother not love you enough and that's why you're so bitter and pathetic?

  353. Shut Up You Politically Correct Loser by Nicolas+MONNET · · Score: 1

    Ah, I see we're resorting to 19th-century stereotypes to explain gender differences again. "Women derive their logic from emotions"? Come on, be realistic. How hard can it be to realize that people's emotional lives and their professional lives are not the same thing, and frequently are not even related?

    The guy you're repying to talks from experience, and you're talking out of your ass. Yes, I'm flaming you, because what he's saying is COMPLETELY on par with MY experience of women.

    Answer this: why are so many women into new age bullshit like ASTROLOGY?

    Astrology is not logical, it's completely irrational, most men don't give a fuck about it, a lot of women crave it ... even smart women do, though they just claim to just read their horscop for fun.

    And even dumb men generally don't give a fuck a bout it.

    So there you go. I hate PCness.

  354. some truth to it... by Brave+Little+Toaster · · Score: 5
    'Girls have the ability to learn and use computers, but they are turned off by technical careers that they view as full of geeky guys'.

    This really does depend on which girls you talk to. If it's teeny-boppers who love Britteny Spears and who care lots about what other people think, then yes, they will be concerned about working with 'geeky guys.'

    If, however, you talk to a more independently minded young woman, she is more likely to give real reasons besides cooties for not wanting to persue a tech-related field.

    The study blames the general sentiment on a gender imbalance in access to computers, and on social pressures that steer girls away from technology.

    Now, this I buy. Generally speaking, schools do not do a good job of encouraging our girls to get into science and technology. This has improved in recent times, but there is still a long way to go. Parents also don't always do a good job of encouraging girls to try out computers. In fact, some unwittingly discourage them. (I continually thank my mother for giving me legos instead of an easy bake oven when I was a kid.)

    And never underestimate the social pressures women face in the workplace. Not every person can deal with sexist attitudes that many women encounter in tech-related jobs, and so some women choose not to deal with it and persue other careers. While I think this is sad, I personally know two women who left the computer science field because of sexism and other social pressures they continually faced from their peers. It does happen.

    Nevertheless, there are many women such as myself who love computers, technology and science, and who thrive on working with geeky people. In fact, for me it's a requirement...

    --
    brave little toaster

    --

    --

    --
    brave little toaster

    "Remember, don't try this at home until the statute of limitations has expired."

    1. Re:some truth to it... by Sir+Joltalot · · Score: 1

      "teeny-boppers who love Britteny Spears"
      Nice touch spelling it wrong.. make sure you aren't identified as said teeny-bopper yerself huh?

      --
      "Caffeine is not an option. Caffeine is a way of life."
    2. Re:some truth to it... by mpe · · Score: 1

      from what I remember from my University courses that happened because most the guys there were sad types who spent most of their time on MUDs, and sitting in small circles muttering Trek-talk (when they deigned to leave the terminal), wondering why females weren't interested

      The interesting question is why is this considered "sad" when other activities which involve just as much dedication/obsession are considered differently.
      There was an intersting example in a consumer programme recently which treated reports on two groups of fans who had both been ripped off very differently.

    3. Re:some truth to it... by tomknight · · Score: 1
      But the opposite is also true: guys would love to see more girls/women in the technology-related fields, and would go pretty far to help them out. (Far from discriminating against women). I have a female friend at MIT in the Intro CS program, and essentially, when she walks into the lab(s), there's this mental 'OMG, it's a GIRL! YAY!' thing that all the guys go through. From what she's told me, at least, everyone (all guys, as it were) have been extremely helpful, etc.

      Umm... from what I remember from my University courses that happened because most the guys there were sad types who spent most of their time on MUDs, and sitting in small circles muttering Trek-talk (when they deigned to leave the terminal), wondering why females weren't interested. This is sadly true - maybe my place was unique in its quotient of that type of guy?

      Tom.

      --
      Oh arse
    4. Re:some truth to it... by jawtheshark · · Score: 1

      This reminds me of something happened during my CS studies: I had to see the sysadmin for my account and only had the persons name "Chris *whatever*". So I want to the persons office and there only sat a rather attractive girl and I asked if "Is chris *whatever* here? I need *him* to fix my account" - Reply: "I am *chris"....I think I was never more embarrassed!
      Probably just says how stupid I am.

      --
      Ahhh...the great dumpster continuum. Many a free computer will be found there. -- sowth (748135)
  355. Grrls don't wanna be geeks. by small_dick · · Score: 4

    [to the tune of Cyndi Lauper's "Girls Just Want To Have Fun"]

    she won't stare at the monitor's light
    society says "don't you wanna hack all night?"
    we just don't care about zeros and ones
    and grrls, don't wanna be geeks
    no, grrls don't wanna be geeks.

    lasted three days in a programming class
    those "for loops" and "call stacks" really kicked my teen ass
    just can't log into those x-terminals
    and grrls don't wanna be geeks
    no, grrls don't wanna be geeks.

    not what they want, not a geek,
    let the boys balance red-black trees,
    cuz grrls don't wanna be geeks.
    no, grrls, don't wanna be geeks.

    they don't wanna, they don't wanna,
    they don't wanna, they don't wanna,
    grrls, oh, grrls, don't wanna be geeks.

    --


    Treatment, not tyranny. End the drug war and free our American POWs.
    See my user info for links.
  356. Here's my view by DeltaStorm · · Score: 1

    Fresh man year in high scool I actully heard one girl ask "When are we ever ging to use computers?". I suppressed my laughter and petted the mouse in front of me knowing it would bring me lots of nice green paper. I don't know one girl who likes computers to any extent, are we going to be seeing a resurection of the early 1900's where the computer literate man goes to work, and the wife stays home?

    --
    .sdrawkcab si gis siht
  357. discrimination . . . by White+Shadow · · Score: 1

    I keep reading people saying "Well maybe girls just don't want to be geeks." Well, then the quesion is why don't girls want to be geeks? I see two possible answers to this, either there is a genetic disposition to not want to be a geek, or society is telling them not to be a geek. Since I doubt there is a genetic cause (because there is no evolutionary advantage to it), the causes is most likely a societal force. If society is telling girls not to be geeks and girls are just as good at being geeks as guys are, then this is discrimination. Perhaps we just don't see it because it is a whole societal influence that is generally accepted, but that doesn't mean it's not discrimination. Unless society stops deciding girls shouldn't be geeks, how will we ever break the gender divide in the workplace or elsewhere?

    (btw, I'm a guy, but someone has to stand up to invoke change)

  358. I took a LOT of flak for being a geek in school by knghtbrd · · Score: 3

    I think 2/3 of the geeks here can attest similar results. In fact, every time someone tries to ask a young woman if she really wants to go into technology, there's someone beating the crap out of a young man for being a geek. I won't speculate which is worse, but the fact is that schools---at least American schools---favor athletics over intellectuals. As I noted in another message, there's no gender gap or sexism there - just different measures to discourage the intelligent from being so.

    1. Re:I took a LOT of flak for being a geek in school by corarc · · Score: 1

      Sort of explains the Americain society doesn't it! Keep them fit and healthy, able to shoot a gun, but don't give them too much information. That way they can't undermine the state and they can be used as shields when needed. c0rarc

  359. Liberal Sociologists at work! by Fringe · · Score: 1
    The survey is believable, but the pablum they pass for "reasons" aren't.

    For example, this line: "A lot of our socialization has steered girls away from technology", according to Scherr (her mother), about her 10-year old. Gee, she's 10! If she's screwed up, it's her mother's fault! Any bets on whether she accepts the blame?

    If young girls aren't getting involved, perhaps the better solution is to take away their telephones. Build a language that lets them model societies (or introduce them to programming through SimCity.) But don't blame the system, and fer cryin' out loud, don't screw up the boys to equalize the stats.

  360. If girls don't want to be geeks... by meckardt · · Score: 2

    then they shouldn't whine when they don't get the techie geek jobs and the bucks that go with them. Its a shame that women accept the stereotype of geekhood as being unfeminine.

    Don't get me wrong! I think that there is definitely a place in geek-dom for women. I married a geek gal, and in a lot of ways she's sharper than me.


    Gonzo
  361. Re:FIRST RAPE by g33kch1ck · · Score: 1

    This is exactly the kind of idiotic drivel that makes me question the validity of the First Amendment. I hope you're sterile.

  362. Watch what they do, not what they say by Nicolas+MONNET · · Score: 2

    Common myths you should forget: Women love to hear about other conquests

    Really? Where do you get that from?

    I know two really good players. They get LOTS of women. One lives in my area. He keeps talking about:

    • How big is dick is (but in a playful manner)
    • How he has had so many girl and that she (the one he's talking to) just does'nt compare.

    For having seen him fuck girls (all types, beautiful, ugly, skinny, fat, intelligent, stupid, white, black ...) in less than 2 hours of meeting them ... well see where I'm getting

    The other one always carry pictures of his ex girlfriends and show them to the girl he wants to pick up at some point in the conversation, basically implying that they looked better than her. I'm talking about a guy who picks up strippers, actresses, and who's fucked a girl who had just been engaged, who's had sex with two beautiful sisters at the same time, and countless others. No bullshit too, I've seen the pictures.

    Sorry guys and girls, life is not like PC advocates would like you to believe. Life is not really fair.

    And remember: women are not the pure and virginal innocent beings

    some want you to believe.
  363. It's not always easy... by matria · · Score: 2

    My father wouldn't hear of it (he tended to enforce his opinions by bloodying my nose). After arguing with my reluctant husband for years, I finally dove in. The shop where I bought parts for my first self-built computer told me to go home and knit booties for my grandchildren.(I am not kidding...these are his words!) It took me 4 days, by myself, to get it to work, an AMD 386 DX40. Still works great. A few years later a tech at the University of Miami told me that all the "lady techs" that he knew were dykes (again, his words exactly). Maybe this sort of thing could be a bit discouraging? I have my own shop now, by the way!

    1. Re:It's not always easy... by g33kch1ck · · Score: 1

      You rock.

  364. GrrlGeeks in High School by Traxton1 · · Score: 1
    I'm a geek, nerd whatever. I decided to take a computer class in High School (which I'm still in). I knew all the material but wanted to take it so I wouldn't have to in college. Oddly enough there were quite a few attractive girls in the class. I didn't expect there to be because they tend to not be as techically literate. Well, I guess I was right because there were no

    technically literate girls there. I had hoped that at least a few would have been because a girl who knows anything about computers is quite...interesting to me. I would appreciate it if there were more girl geeks. I personally try to encourage that sort of behavior but I ended up having to coach many of the girls in the class on basic material. May of the other intelligent girls I meet would prefer to become lawyers. I guess that correlates more with the "social behavior" that girls apparently tend to favor over technical jobs (Arguing in court, technically social). Also, I notice that many of the girls who get high grades in math, as I do, aren't even nearly intersested in the things I am. They have no drive to be astrophysicists or engineers. It is too much to ask for maybe just one girl to even know what number theory is?

  365. Re:definition of geek. by mazur · · Score: 1
    I've always preferred the term nerd myself...

    "That which we call a nerd, by any other name, would smell as sweet; so geek girl would, were she not geek girl call'd, retain that dear perfection which she owes without that title; - geek girl, doff thy name; and for that name, which is not part of thee, take all myself."

    (Free after: Romeo and Juliet, by W. Shakespeare.)

    Stefan.
    It takes a lot of brains to enjoy satire, humor and wit-

    --
    The truth shall make you fret. (Ankh-Morpork tImes motto)
  366. What the problem is by Com2Kid · · Score: 1

    Geeks, hah, try nerds.

    I have a very low opinion of geeks, they can go shove it for all I care.

    Quick refresher: Diffrence between a geek and a Nerd:

    geeks get drunk, Nerds read technical manuals.

    geeks goto parties, Nerds continue to learn.

    geeks waste their lives, Nerds dedicate their lives to knowledge.

    Ok, nuff said on that.

    The problem is that society has brainwashed the female population so that a very small percentage of them (even fewer then the male population, which is already has a very small ratio of Nerds:jocks) want to abandon any hopes of a social life in order to devote themselves to the completly unselfish goal of obtaining more knowledge to aid the human race.

    In addition, society has also brainwashed the female population so that they believe in emotions even more so then males. Emotions are the leading deteriunt to a person being able to completly switch over to a life of acedemic and scholerly acomplishment.

    In other words, the day that females don't give a rats ass about how they look or who they know, is the day that females over-take the male population in computer literacy.

    Of course, considering what small percentage of the male population is computer literate (oh, about 1% of Slashdot readers sounds about right) you only really need a few dozens females to actualy accomlish said goal. ::smirks in an evil fashion::

  367. Males and females don't like the same kind of game by Nicolas+MONNET · · Score: 2

    So how come it's a surprise they don't like the same kind of jobs .... ?

    Maybe they just don't like the competitive aspect of most games. How does that translate to that job thing? Now, on the internet, no one knows you're a fucking dog. Right? So don't give me that stupid bullshit about peer pressure refraining girls from playing diablo 2. It's utter bollock.

  368. Most boys "play with dolls" too.. by knghtbrd · · Score: 2

    Boys' dolls just have guns and camo clothing is all.. =p

  369. Re:I want to be a geek... wait i *am* one. :) by nickelxc · · Score: 1

    it's not that one should aspire to be a geek.. one should just *be*.. so you might not be the best coder right now.. if you're geeky, you're geeky.. other people can deal..

    as far as being a woman in a "geeky" field.. i don't think i've really noticed that.. i'll go to meetings of the local chapter of the ACM and IEEE, and if there are other women there, they will comment on being the only woman present -- i won't have noticed that attendance is 2 females 20 guys.. (i find it more interesting that i was not included in the female count.. when i ask them about that, they say that "i belong there and they don't".. when i ask them why, they flounder and say they aren't sure...) well, all i see are a bunch of geeks/scholars/people working to accomplish things.. (or not depending on the temperment of the group ;) ).

    sure, i could spout a good deal about gender inequality studies, psychological research, and the like (cs doesn't always get all my cpu time) yes there is a long history in the united states of women having the "motherly" role.. while feeling unable to function in other circles of their environment.. hopefully in time less women will be hung up on the stigma of being accepted by the majority (somehow i have a feeling with recent events, that this may take longer and more difficult journey that i had previously thought) and try different things. i have.. and enjoyed myself tremendously the entire time..

    Why do people care so much about this? as i enter my final year of study for my AB degree in CS (yes i know, don't ask-- long strange story), i have never felt that i wasn't included into a geeky group on basis of my gender.. i always have, yes there are jokes and debates that one morning i'll wake up with a tux tatooed on my shoulder like miranda in the userfriendly "got linux" cartoon.. but hey.. they [the guys] are jealous. ;) (they want tux permanently drawn on their body).. but the female portion of my cohort doesn't feel the same as i do.. they always point out that they are the only girl, this is difficult material, etc.. i listen to them and ask myself (i have long since given up fighting with them) why they focus on that, and not the material/task/problem at hand.. and why is it such a hinderance to their solving problems? i don't see it as a difficulty for me.

    probably the nicest thing about being one of the few women is that there finially isn't a line for the bathroom at the expos. ;)

    well, that's my spout.. i wish everyone sucess in their quest to fulfill their aspiration of geekness..

    /n

  370. Cheers. Don't mind if I do. by Wench · · Score: 1

    Have some Australian beer back. I recommend avoiding Foster's; it's pissweak stuff for tourists and export only.

    James Squires Amber Ale is a nice drop.

    --
    No matter how cynical you become, it's never enough to keep up.
  371. At least there are lots of geek guys! by Clarissa · · Score: 1
    If you are a computer geek guy, at least there are multitudes of other computer geek guys to hang out with if the jocks reject you.

    There are not many computer geek girls (at least not that congregate in the computer lab before school), therefore it's more difficult to learn about computers, and fewer girls turn geek. It's a vicious cycle.

  372. Well.. by Fittysix · · Score: 1

    THere is Miranda from User Friendly
    ----------------------------------------------

    --
    *.sig
  373. If i was a girl.... by Duncan3 · · Score: 1

    ...the LAST thing in the universe I can think of wanting to do is spend 8 hours a day around geek guys.

    Geeks are the wrong end of the gene pool to be hanging around if you're female after all. Not to mention the little things like the caffeene/alchohol addictions, bad fashion sense, complete lack of social skills...

    Geeks usually grow out of these problems, but well after girls would decide and stereotype all geeks as icky and decide they want nothing to do with them. Heck _I_ can barely stand younger geeks for the same reasons.

    --
    - Adam L. Beberg - The Cosm Project - http://www.mithral.com/
    1. Re:If i was a girl.... by stuart_farnan · · Score: 1

      I'm convinced, fancy going to the movies on Saturday? Perhaps you can fiddle with my joystick when we get home !?

    2. Re:If i was a girl.... by nomadic · · Score: 2

      ...bad fashion sense

      Hey, plaid is always in style. Kind of like O'Reilly t-shirts.

  374. Re:99% of women are WHORES by g33kch1ck · · Score: 1

    You got "no action" because you're a creepy fucking asshole, not because you were poorer. Why would you want to be with someone who's only interested in your bottom line? Why don't you look for other types of women? Because the only ones who will have anything to do with you are the ones you pay. Don't advertise your portfolio and you won't get money-grubbing women. You must fall into that 99 % of men who are dickheads.

  375. Girls can't do math... by g33kch1ck · · Score: 3

    The article seems inherently flawed to me. For one, it's statistical fact that not many people are entering computer science programs, no matter their gender. The biggest flaw, however, seems to be that the University Chicks were asking high school kids what they wanted to do with their lives. Now that's fucking brilliant. I'm going to be 27 this year, and I've only recently figured out in which ball park my career will reside, much less nailed down the specifics... I've gone from a dual major in English and Journalism, right out of high school, to Computer and Information Sciences and Information Design. There is a difference between the two. Asking an 18-year-old child what she wants to do With The Rest of Her Life is the stupidest of grounds upon which to found a study, in my opinion. The fact is simply that being a geek is a life style, not a career choice. It takes a special breed of HUMAN, male or female, to be a geek. If the University Chicks are upset by their stats, the realization should follow that more people should be recruited for technology careers, not just more women. As for the statement, "they are turned off by technical careers that they view as full of geeky guys," I can only retort that I wouldn't want to date anyone with whom I couldn't discuss the things that interest me. At the risk of practicing age discrimination, I'll ask how many high school aged girls know what the hell they're looking for in partners? I know when I was 18, I dated a drastically different kind of boy than the man I am with now. Incidentally, he's a hell of a lot prettier than the non-geeky guys I dated then, too. Frankly, most of the quotes in the article seem to come from girls who are probably great until they open their mouths and ruin the effect. "I don't want to take computer science. ... Just looking at it, all the programming and these funny-looking things on the paper. It (takes) so much stuff to do one thing on the computer." This girl is, in effect, saying, "Math is hard." I'd like to know how well this female did in school over all. The socialization issue warrants further study. Female children are not taught they may manipulate their environments, and some studies link this rearing style to female difficulties in math. If little Jimmy is running through the house and breaks something, boys will be boys. If little Jenny does it, she's being unlady-ish. Still, this issue speaks to a larger socialization issue, and only reflects on the technology industry in the same way it would reflect on any other industry: all PEOPLE should be raised equally. But what do I know? I'm just a poor, helpless girl.

    1. Re:Girls can't do math... by Nicolas+MONNET · · Score: 2

      Asking an 18-year-old child what she wants to do With The Rest of Her Life is the stupidest of grounds upon which to found a study, in my opinion.

      It's actually a very good question. Not many people might have an answer, but if they don't ask this question themselves, they're in trouble.

  376. Breeding by euroderf · · Score: 1
    I think that it takes a special breed of person to be attracted to this line of work, not nessarily a specific gender.

    Exqueeze me ?! What are we breeding ? THX-1138 ? Something even weirder ?

    When I hear "best of breed", I reach for my Eugenics 101

    Gender is for nouns, sex is for people.

  377. definition of geek. by the_v · · Score: 5

    When I was younger geek seemed to be a word that was used to describe people with an extreme interest in anything (ex. soccer geek)...

    but now it seems that definition has been applied to guys who like computers.. emphasis on _guys_..

    It seems that if a girl has an interest in computers, she's singled out as a _geek girl_

    girls don't seem to be included in the new definition of geek...

    For a while I had a problem with this.. being a member of the female population with a major interest in computer engineering I felt a little put off...

    The last thing I wanted was feel excluded from my feild of interest because of my gender... I didn't want to be singled out either..

    So I decided to forget about the whole thing until I realized that there was no good reason for it...

    Now that I've gotten passed the initial batch of "girls can't be geeks" guys and I've met some really cool people, male and female, who don't have these prejudices and now I get to work on some neat stuff.

    1. Re:definition of geek. by Omnifarious · · Score: 1

      When I was in college, I did a lot to try to encourage female people to like computers. Mostly because (since I've been working them since I was a little kid) I wanted more women I could relate to easily. Sadly, very, very few women were interested in technology. Most of them were interested in decent paying jobs and good careers. They were kind of disheartening to talk to. *sigh*

      It's very difficult to have done something all your life and not be able to talk about it with the person you're with.

      Not only that, but I discovered that it was hard to find women outside of the computer field who were interested in 'deep' ideas, and liked talking about them. I have a strong interest in various branches of philosophy, especially with regards questions involving the nature of consciousness, and I've hard a very hard time finding women with any interest in that kind of thing either. It's quite depressing.

      I think my luck may have changed recently though. :-)

  378. This is kinda awkward... by grammar+nazi · · Score: 1

    ugh. Since so many grrls are going to be reading this, would any like to go on a date with me? I'm kinda geeky, but I also like to go to Goth/Industrial bars, camp, bicycle. I'm from the Detroit vicinity. Reply if interested, we could meet up at City Club.

    Please don't moderate this as off-topic until at least a few people have replied. Help me out here!

    ;-)

    --

    Keeping /. free of grammatical errors for ~5 years.
    1. Re:This is kinda awkward... by Rohith · · Score: 1

      grrls Personally I would expect a grammar nazi to be able to spell five letter words, but maybe that is just me :)

      --
      Beep! :)
  379. Mathematics. by Cliffton+Watermore · · Score: 1

    I'll go a step further with this issue. "Girls not being able to math", that is. When I was a lad, my parents used to move from country to country, we literally didn't stay in one country for more than 3 years.

    My school years were plagued with ignorant teachers. In Grade 3, for instance, I was told that I was extremely bad at mathematics, and needed "remedial" help. In Grade 2, I was told that I needed "special help" for dealing with b's and d's. Yes, I got the two confused during writing classes up until Grade 3. But the teachers failed to realize that I'd already started *reading* before I started school.

    Another example is with my mathematics. In Grades 4-7, I scored quite low, mostly D's. In Grade 8 and 9, I scored C's, but in Grade 10 everything fell apart (mainly due to my betting on horse races, in Grade 6-10 my main thing was playing cards with other kids, for cash), I scored an F for mathematics.

    In Grade 11, I scored one of hte lowest scores around, but mainly because I wasn't writing the tests. My teacher told me that unfortunately, I'd have to be dropped into the "stupid math" class. First term of grade 12, I scored 100%. They put me back up to the normal math class level, and I scored an "A" for my high school final.

    And yet just a year before, a "teacher" told me I would never be able to get into any technical field, at all. So what do I say about education "tradition"? It stinks, it's actually nearly useless. Teachers in some places complain about low salaries, but perhaps we should actually look at what they're doing. They aren't the saints they're made out to be, and until education undergoes a major paradigm shift, we should look at issues like this. "Girls can't do math." "Cliff Watermore will never get into a technical field." "%Insert your own Bullshit statement here%". I'm sorry if that sounds harsh, but I speak from experience. I've been to more than 14 schools around the world, and they've all led me to this conclusion: Western Education is sorely lacking. Admittedly, I've not been to any "non-Western traditional schools" or alternative education institutions, but perhaps looking at alternative teaching methods in Western World schools is the way to go.

    --
    "A few atoms won't even light a match" - Dr Jones, 1933
  380. Other types of women ... LOL by Nicolas+MONNET · · Score: 2

    There is no 'other type of women'. Or if there is, it does'nt matter. We all (besides the genetically abnormal amongts us, like gays for instance) want a good, healthy looking woman. We can't do anything about it, we're programmed to do it genetically.

  381. Not so fast by unrecognized · · Score: 2

    Over the last decade, the American Association of University Women has frequently been guilty of sowing politically motivated disinformation of this type based on fishy "research." Check out this recent article by Christina Hoff Summers: http://www.theatlantic.com/issues/2000/05/sommers. htm I have yet to read her latest book, but can highly recommend "Who Stole Feminism?" [http://www.amazon.com/exec/obidos/ASIN/0684801566 /qid=962722496/sr=1-1/102-7334716-147452 9]

  382. Re:Uh... Duh? by g33kch1ck · · Score: 1

    I wish I worked for /. in a "Reply to Idiots" capacity. I'm replying to you.

  383. "Geek" - a seriously misused term by Lemm · · Score: 1
    There's that term again. "Geek". And, as usual, everyone assumes it means "tech geek" or "computer geek" or "coding geek".

    I have an alternative definition. "Geek" is a reference to a very strong (ie beyond the norm... whatever encompasses that hackneyed term) interest in a particular field. This definition is used more than you'd think.

    How many times have you heard someone referred to as a "sports geek"? (I believe the phrase has even been used in this discussion a few times.)

    I am, personally, proud to be geeky. All that means is I have strong interests in one field of interest or more. That's all it takes, after all, to be a geek.

    I'm a bit more than that, tho... I consider myself to be:
    • sci-fi geek (I watch Stargate, ST:TNG/DS9/Voy, The X Files - I even used to watch Sliders and Quantum Leap)
    • music geek (I analyse music; I look at the percussive flow, the chord structure, the bassline, the melody, the harmonies...)
    • Slashdot geek :) (I have an account, I take part in the discussions, I've moderated (don't shoot! Don't shoot!@#)... I've got 575's user info page and the CYOA page in my bookmarks... :) )
    • Net geek (I freely admit I spend too much time on the net. I really must remember to go shopping for groceries tonight...)
    To horribly misquote Larry Wall (ooh, does that make me a Perl geek too?) - "there's more than one way to be a geek". =) It's just a question of how geeks are viewed. Personally, I wear my geekhood like a badge. I'm considering printing myself a "Glad To Be Geek" t-shirt. :)

    I don't suppose anyone fancies organising a Geek Pride rally? ;)
    --
    No boom today. Boom tomorrow. Always boom tomorrow. BOOM!
  384. Re:i think they missed the point completely by de+Selby · · Score: 1

    "and being smart just means you get to see how being popular is more important"

    please tell me that's a typo...

  385. A skirted, perfumed type thing in computing? by faye · · Score: 1

    I'm often amazed & saddened by the difference gender makes in computing. As "Dr. Mitchell", most people - students and fellow academics alike - assume that I'm male until it's proven otherwise. When they do find out that I'm female there is very often a change in their attitude, often a "dumbing down" of explanations (which is really amusing coming from a student!). Or if they do see me before hearing my name, they assume that I'm one of the secretaries. Go out into the "real world" and it is even worse (On one occassion an employee of a certain national UK computer store spent 20 min trying to persuade me in a very patronising way that Office would run on my Linux box and that as a man with his vast amount of training he knew better than a mere woman)

    The sad thing is, this occurs in both women and men, and most people are unaware that they are doing it. When you point it out to them they are often mortified and try and change their behaviour (which tends to work for about 48hrs)

    The solution? Well, I'm not sure if there is one for computing alone - it's a society wide problem. Sure more woman in computing would help, but we're not going to get more woman in the technical subjects until peoples (both men and women) attitude's change and we become less hung up on what a person's gender is.

    TTFN

    Faye

    1. Re:A skirted, perfumed type thing in computing? by swordgeek · · Score: 2

      "That's nice dear... (pat pat)"

      Seriously, you're quite right--it's endemic to society. Unfortunately, it comes with some degree
      of truth (wait, hear me out!), as part of a
      vicious circle.

      1) Women are underrepresented in computing (and
      other fields, of course). Thus...
      2) Not as many women vs. men know computers
      intimately. Thus...
      3) Assuming women are technologically less savvy
      is likely correct. (not fair, not justifiable,
      but likely correct)
      4) Given this behaviour, it's less likely that
      women will enter into said technical fields.
      5) Repeat.

      The real problem with this is that after a while,
      you create a groove of unconscious behaviour
      patterns. "Oh, a woman-she's not too bright about
      (x)." As you say, this is just as true for other
      women. I've overheard groups of women talking, and
      am appalled to hear things like, "oh those
      computers--I just don't understand them! Aren't
      they the worst?" If another woman mentions being
      a computer professional, the general attitude is,
      "ooooh, you must be INCREDIBLY smart!" Note that
      _male_ computer professionals don't have to be as
      smart (in the eyes of these women) as women do.

      It's tragic and destructive--we're just not
      working effectively as a society, and I wish I
      knew how to change it.

      (a man)

      --

      "People who do stupid things with hazardous materials often die." -- Jim Davidson on alt.folklore.urban
  386. Define geek by cyber-vandal · · Score: 1

    Well I'm sitting in an office which is about 60/40 men/women. But then all the men in the office wash at least every 2 days, don't wear sandals, don't have a beard you could hide a continent in, and generally have a life outside of coding. But then we're mainly mainframe dinosaurs, so you wouldn't be interested anyway.
    (I'm joking - spare me the flames)

  387. Environment is important by Giordana · · Score: 1

    I got interested in computers in college. However, my college computer group nearly drove me away from the field.

    In the beginning, I could barely use windows. I was fine with being treated as a "newbie" when I actually was a newbie. But when idea after idea was ignored (then approved whenever sonmeone else made the same suggestion), when I was excluded from meetings and officer's functions (I was an officer), when help sessions with the TA included his best friend, I realized I would always be a second-class citizen.

    I left the computer club after three years. Last I heard, it was in shambles, which doesn't surprise me. I run linux now, I go to local lug meetings, and I'm planning to go back to school and study technical writing.

    Girls are definetly discouraged from studing technical stuff. Being treated like a token, or a novelty, doesn't help. Like anyone else pursuing a "nontraditional" career path, I've had to do a lot of stuff on my own.

    My point? Female geeks need support from male geeks! Don't treat us like perpetual newbies. Invite us to play Quake sometime. Don't assume we're in it for the guys.
    --

    Put my clarinet beneath your bed 'till I get back in town.
  388. Time Isn't On Their Side by CalamityJones · · Score: 2

    Based on the women I've spoken with about this topic, it seems that a lot of it has to do with the time involved. Even to middle school kids, C/S careers have a mythos of requiring 80 hour weeks plus "personal time" to keep up with the technologies. Most of these women were more interested in "having a life" outside work than to put up with those sorts of loads, even if they are more of a stereotype than a reality (depending on where you work). These women also tended to be more focused on interpersonal relationship building, both in their private and public lives, and felt that with these loads they would end up with a life less satisfying than they want. Obviously, this isn't scientific, just what I've noticed over quite a few years of talking to people about stuff like this.

  389. Women In The Workplace by pwhysall · · Score: 1
    3) Having people from diverse backgrounds working on design and problem solving often yields better results.

    Can't argue with that. Good point. Although, arguably, removing immigration barriers accomplishes this too. Perhaps even moreso.

    4) People already in the industry (both male and female) would, all other things being equal, enjoy having some more women in the office.

    This is hardly a good reason to push girls into science and engineering. So that it's easier to put together a co-ed office softball team? =)

    From my 4-year experience at the coalface, there is one big skill that women have more of: management.

    Women seem to make better managers than men: less confrontational, more willing to take advice, less territorial, more approachable, more willing to listen to underlings and so on and so forth. Of course there are exceptions. But I can safely say that I've preferred working for female managers over working for male managers.
    --

    --
    Peter
  390. Football takes alot of shit. by primenerd · · Score: 1

    Guess what, I am a typical geek... I enjoy my computer and video games... C++ is my second language. But guess what... I also played varsity football in high school. My friends complain about being judged, but we do it too. Granted however, my SAT scores were about 500pts higher than the rest of the team, football is actually quite fun, you get to beat the crap out of a total stranger. Not like it was wasy or anything, I got shit from the team about being a geek, and I got shit from the geeks about playing ball. You think you have it bad, try having it from both sides!

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    1. Re:Football takes alot of shit. by DB+Lackey · · Score: 1

      What I always hated about football is that your a pawn in the coaches hands, practically everything you do is dictated by the coach. Give me a sport with more freedom. I hear you on beating the crap out of stranger tho thats one of the reasons I like hockey so much.

  391. what else do you expect? by Fulcrum · · Score: 1

    What else do you expect? They won't let us get l**d! What else are we supposed to do? They are scared of careers filled with geeky guys but are attracted to all the wealth that this industry brings to the geeky guys! There is something to be said about the other side, as well!

  392. Ignore? by eshaft · · Score: 1

    I don't know if ignore is the right word... more likely they take one look get scared, or the BO keeps them at bay (nothing like 4am BO after a long, strenous marathon of Quake 3)... lol

    --
    lf.o
  393. I don't get this. by de+Selby · · Score: 1

    The line is: "If we were explosed to computers when we were younger, more of us would be Geeks."

    I agree--but what's wrong with it right now?

    If I were exposed to aircraft when I was younger, I might be a pilot right now. If I were exposed to atheletics I might be an ethelete. If I was put in the kitchen more often, I might be a chef. I'm not crying about it.

    I don't care about what might have been. I'm happy with what I'm doing--and if I wasn't, I'd find something I <i>am</i> happy with. I could be the president, a scientist, a lawyer, a teacher if my past was different, but I had fair opportunity to *find* my interest on my own--I didn't need each career spoon-fed to me so I could pick and choose. I have the ability to seek out my interests.

    Women are not prevented from getting involved with computers. And as long as everyone has the opportunity to find and do what they like, it's fair.

  394. Social Bias by DustyHodges · · Score: 2

    In my opinion, as a feminist male, one of the main reasons is social bias. Society still has a bit of a push for women to become nurses and such, and, as a result, are pushed away from technological carrers. Most of them just aren't exposed to technology, as a result. If you asked most men who weren't exposed to computers at an early age the same question, you'd probably get similar results. (As defense... How many of the geeks here had a computer before puberty? Most, from what I seem to hear...)

    However, the other major barrier is simple psychology. It has been shown in many studies that women tend to think more in terms of emotion and social interaction. While this is not true for all women, it is for the majority. Men, on the other hand, tend to think in terms of logic, black and white. While both have their place in the world at large, in the land of computer programming, you can't very well program in emotions. You have to use logic, which is something that the male brain is wired for more so than the female./ This is not to say that women are not capable of thinking logically. It's just that, on the average, it isn't something that appeals on a day to day basis.

    -Dusty Hodges

  395. Gilrs Just Wanna Have Fun? by AcidBurn · · Score: 1

    Hey, how do we know their "poll" is accurate? Have they spanned all classes and income levels? If they sent out a survey with women's Cosmo bills, no wonder the bad results! And hey, I've had more luck with geek guys than your average Joe. Why would you want some pretty boy with no brains when you can have a gentleman with a brain and looks? Hey, look around, the geeks of today aren't the geeks of our fathers ladies. They're cooler. So raise your cramped and carpal-tunneled fists high and be proud to be geeks ladies!

    Remember, someday, everyone will work for a geek.

    --
    "Spandex, it's a privelege, not a right." -Cereal Killer, Hackers
  396. It's time to refactor geekdom. by copito · · Score: 2

    One problem I see with IT industry guys is that, since we tend to study in male dominated schools (or at least classes) and work in male dominated departments, most of us never got comfortable working with women. This comes out most strongly in social interactions, but social interactions have a strong effect on work, especially in startups and other small companies since they affect job assignments and determine how comfortable individuals are in asking their co-workers for help.

    My wife, who is the first and only woman in the Network Operations Center of a major ISP, was shocked to find that the tech who had used her computer the shift before had left porn as the default desktop image and even more shocked that her co-workers (who she got along with well and had not felt particularily discriminated against by) found this humerous. Such a thing would not have occurred in a department with more women in it, or among men who had spent more time dealing with women.

    In and of it self the situation is negative, perhaps even actionable in our litigious society, but it is more troubling as a symptom of an insular male dominated sub-class which doesn't yet know how to deal with women. It is not surprising that such gender biases exist, they are or were the same in medicine, armed forces, law and other male dominated fields.

    I suspect that as the number of women in IT fields and that this in and of itself will change the geek culture to be more inclusive and welcoming of women. Until then some women who are strong technically will be turned away by the culture, even if they are attracted by the problems.

    Until then, be aware of (and stop) your actions that might make a woman uncomfortable, even when there is _not_ a woman present, and make an active effort to give the same encouragement, help, and respect to your female colleagues as male. We're smart, savvy and anti-bullshit. Let us see male-centric part of geekdom for the dumb, old cruft is and get rid of it.
    --

    --
    "L'IT c'est moi!"
  397. It takes all types to make the world go round by Builder · · Score: 1

    I've read the article. And now I've read the comments. But so what? So girls don't wanna be geeks for the most part? And this is bad, why?

    It takes all types of people doing all kinds of things to make the world go round. These days, so many school leaving males wan't to rush out and be an MSCE, that there need to be people pursuing other things. Women often offer us a 'sanity mirror' that we can look into and see just how mental we're being about things. They have good perspective as a rule. Men lack this. That is why Windows exists :-)

    So if women want to do other things, I say go for it. If women want to be geeks too, I'm all for that. Just don't complain if you date a geek and you find out she doesn't have time for you when you want it, because she's working on a cool hack. Been there. Didn't enjoy it. Find a woman who understands and supports what you do, but has her own life as well!

    Too tired to be coherent.
    /* Wayne Pascoe

  398. My wife works with us geeks by Major+Kong · · Score: 2

    From my Wife:)
    The authors of the article are sadly mistaken. I work with Geeks and have not been more understood, treated with respect, or laughed so hard than in this setting with these superior beings. These guys not only invite you to the meeting, but proudly introduce you and make it clear that it was your great idea and you did all the work. There is just something about "that big old brain"! Timothy Leary said it best " Intelligence is the ultimate aphrodisiac". Girls, its nobody's fault but your own for missing out on the best of all work worlds.

    --
    Those who give up freedom for security deserve neither.-Ben Franklin
  399. Re:Geeky boys ...? by infinite_twilight · · Score: 1

    not all of us go for the jocks... some of go after the 'geeks'..

  400. Re:tail.man, grow some testes or stfu. by tail.man · · Score: 1

    Mmmm yea, anonymous coward your insightful psychological assesment makes me want to cry.. Must have cut close to a nerve to get an anonymous coward to jump out on the limb with that verbose sewer output.. Been awhile since you had any female attention? Must be one of those worms I was talking about..

    --
    http://tinyurl.com/globalwarmingisascam
  401. Maybe you've watched to much Discovery Channel.... by pug23 · · Score: 1

    Perhaps the reason girls don't go for geek guys is because we use the Discovery channel as a guide to appropriate mating signals?

    :-)

    Actually, there are plenty of girls out there who go for geek guys. I've dated several of them. OK, maybe not "plenty". Probably not enough to, er, "supply" all the geek guys of the world with a girlfriend. Keep in mind also, that there is a marked difference between "girls who go for geek guys" and "girl geeks". Most of the girls I have dated have not been "geeks", at least not in the IT sense of the word.

  402. Geekgirls put the uterus into Computer Use! by Nailer · · Score: 1

    Moderators do your worse...

  403. uhm.. actually women dominated from the start by the_v · · Score: 1

    Hello, ever hear of lady Ada Lovelace?

  404. Do ya REALLY want a girl just like you? by John_Booty · · Score: 1

    Maybe one thing that turns girls off is that a lot of male geeks make the mistake of becoming geek missionaries and sort of try to ram geekish things down everyone else's throats.

    I think it's because deep down inside a lot of geeks just want to be accepted, but without giving up their geekish ideals. So they wish and hope for a girl that they can shape and mold into uber-geek-girl-love-slave who will of course worship them, their Geek Daddy and mentor.

    Having a geek girlfriend really sounds like a good idea. I always wanted a girl who was into the things I was into. Finally, I found one! She wasn't a coder, but she was into lots of other geekish things like science fiction, anime, video games, owning swords, etc that I was also into.

    I dunno, it was fun, but wasn't really all that great. I mean, after staring at code for 12 hours a day, do you really want to come home and discuss it while you and your similarly-obsessed significant other make dinner/go to bed/etc?

    I have a much better relationship with my current girlfriend, who's hardly into any of the stuff I'm into. But we really dig eachother and like eachother so it's fun! I think I'd rather date someone a lot different than me who digs me and has an open mind.

    OK, I kind of went off on a tangent there. But I think "geek missionaries" are one turn-off for women when they think of technology...

    --

    OtakuBooty.com: Smart, funny, sexy nerds.
  405. The natural gender gap. by -=[+SYRiNX+]=- · · Score: 2

    People who claim that men and women naturally have identical mental tendencies, and that any aparent differences are due only to societal pressures, are way off the mark.

    Humans and other animals are an advanced result of evolution. We have behaviors and tendencies which have guided and resulted from our survival, and these ingrained behaviors are more predominant in us than we would like to admit. Most people like to think that they have severely advanced intellects compared to cats and dogs, and that this intellect allows us to live our lives rationally instead of being bound to silly evolved behavior patterns and tendencies. People who think that are fooling themselves.

    That said, women are by nature more caring, affectionate, and emotional. Not ALL women, just MOST. (Statistics demonstrate this time and time again, and this natural gender difference is just as evident in numerous non-human species on this planet that don't have mainstream media affecting their lives.)

    As a result, most women either (1) can't understand and/or (2) strongly dislike people who take a logical, problem-solving approach to everything in life.

    I've experienced this with my current girlfriend. We love and respect each other, but she can't understand my approach to things, I can't understand hers. This leads to mutual frustration and annoyance.

    For example, when she is having an emotional crisis over some kind of problem, my solution is to suggest concrete steps she could take to tackle the problematic scenario and solve it, but what she wants is for me to hold her and tell her everything will be okay, without suggesting anything to actually solve the problem. She can't understand why I always approach things logically, while I can't understand why she won't.

    Most men tend to have analytical and problem-solving minds as a result of evolution. Women are equally capable of analytical thought, but most of them simply dislike doing it by nature.

    Most women don't dislike geek guys because of appearances or an affinity for computers. Most women dislike them because they are analytical problem-solvers in everything they do. It drives most women crazy that guys try to spread jam on their toast as evenly as possible to maximize the flavor potential. It drives most women crazy that guys try to maximize their savings over time by limiting their entertainment expenses. It drives most women crazy that guys think solving a difficult mental puzzle is more important than dressing attractively. It drives most women crazy that guys would rather fix something themselves than get someone else to deal with it.

    And it drives most women crazy to think that they might have to put forth the effort to learn something incredibly difficult, such as a scientific or engineering discipline, or deal with anything in an analytical way. Their thinking is "Why should we do that icky stuff when there are other people (i.e. geek guys) to take care of it for us?"

    Seeing the trend?

    --
    - "It's just a matter of opinion!" - PRIMUS
  406. "Girl" Geeks by Ninjacam · · Score: 1

    Just look at all the prejudices and gender-bashing going on here. It's no different here than in society as a whole.

    Give me a break, folks! Don't judge people solely on their gender/color/whatever. Judge people by what they can achieve. If it weren't for a WOMAN, the COBOL language would have never been developed.

    Yes, there are differences between the genders, but that doesn't mean that women are incapable of doing traditionally "male" things (get your minds out of the gutter!) just as well, if not better than men. It also doesn't mean that men are incapable of donig traditionally "female" things just as well, if not better than women. Biological limits notwithstanding, of course - men can't give birth for instance.

    So, folks, next time you need directions on how to get somewhere don't automatically assume a woman can't help you (or the next time you need a technical question answered). At the same time, next time you need something for a bake sale, don't assume the guys can't/won't bring something (and don't assume us gals WILL bring something 'cause I don't bake ).

    --
    -- Some people live life in the fast lane. I live life in oncoming traffic.
    1. Re:"Girl" Geeks by mortenal · · Score: 1

      Tell it like it is, sistah!

      In various programming classes I've taken, they've been typically around 50% female. If I ever don't get anything, I ask the nearest person who knows what they're talking about, regardless of sex, age, race, etc. Many of the guys in my classes find smart women intimidating, and won't approach them. The chicks in my classes tend to do better, because it isn't a competition to them, and they help eachother up... I do better than most people, because I've got the drive for competition (tho that competition is generally internal), and I'm willing to admit that I don't know something, or that I'm unable to do something. I'm also willing, even eager, to help other people, because teaching helps you learn more...

      I won't say that you're doing this, but I see lots of smart chicks saying things like "I don't bake", and not learning how to cook, just to prove that they are different. Learning to cook isn't following a stereotype, its just a good idea. That's why I know how to cook. That's why I know how to work on cars. That's why I know how to sew by hand, and with a sewing machine. That's why I know how to lay foundation, frame, and finish a house. That's why I know how to program, and how to fix/build/upgrade computers. Many of the things that I know how to do are "stereotypical guy things" to do. Things that I don't do that aren't useful are play football, basketball, etc., etc... Though I do study martial arts, because that's useful.
      If you're wondering, no, just because I can cook, sew, etc., doesn't mean I'm gay.

      Think that was flamebait? You've obviously never met me in person...

      --
      Think that was flamebait? You've obviously never met me in person...
      $email=~tr/.@/ /d;
  407. the stupid poll... by kodekitten · · Score: 1

    I agree with the polls findings in respect to women maybe being pushed away from a career in technology, preferring them to stick to more traditionally female roles. HOWEVER, I do not believe that this has stopped ME, OR ANY OTHER GEEK GIRL from pursuing what makes them happy and whole, whether it be for the purpose of competiting with males, and showing them that ANYTHING YOU CAN DO I CAN DO BETTER or just simply for the pleasure. And I'm sure that my parents would rather that I play with dolls, and not Debian, but I am what I am :) And very proud.

  408. Guilty, as charged. by corarc · · Score: 1
    Now don't flame me until you have read everything...

    I am a guy geek (boo hiss)that finds many women unable and unwilling to listen when trying to explain something to them about computers. This ISN'T their fault though, many of them have been steered away from technology and even science (although the latter is changing rapidly, thankfully), prefering to go down the roots of languages. This is what happened to my girlfriend, who has just finished her degree in translation (French, English, German). The question now is who is more intelligent? I personally don't like labeling people better than someone else, no matter what they do, whether farmer or director because:

    No farmer=no food=no director.

    If I were to answer the question, I would say that she is more intelligent. Reasons? I know C++, C, Pascal, VC++ etc. I can program quite happily in them. Learning a computer language has a lot of similarities with learning languages, but she can go from one to the other, mid-sentence. She translates one to the other on-the-fly. Not many geeks can say that they can convert a C++ code into Pascal on-the-fly. We have to examine the code, she just spits it out as though it is completely natural.

    Women are very adept to languages because they have been forced to progress and specialise in that direction more than technological. I have no doubt that a women with the same education and years of experience of a computer language would probably out-code a lot of males.

    What a lot of teachers and males don't realise is that by introducing more women into the field of computers not only re-balances the subject, but gives a different approach to the subject, thereby increasing the possibility of finding unthought of possibilities. For proof just look at some of the work that women have brought to the medical and scientific community. Amazing. I can't say that I haven't had my fair share of digs at women for following computing in my early years, but now that I have experienced working with female colleages, I have nothing but respect for them, they have had to work twice as hard to get to the same position as me, and I truly believe that that is wrong.

    c0rarc

  409. Let me tell you... by 187 · · Score: 1

    I'm going to be flamed to hell for this, but oh well...

    Few girls want to be viewed as intellegent.

    You heard me.

    I was just at a club. I hooked up with a girl who came across as a total idiot ("I like stuff! And shopping at the Gap and driving my Neon!!!"). Until I started rambling about astrophysics (long story)... and SHE CORRECTED ME (*SCHWING!*). She then appoligized for being right and I feel that proves my point.

    9 out of 10 guys (not /. readers) are afraid of women with common sense or a modicum of intelligence. This and women's behavioral adaptations have to do with simple biology and instictive patterns. If you don't get it, have someone draw you a picture.

    Of course, I say she came off as a total idiot, yet I'm posting on /. at 3:30am. Who's the idiot here? =) (Yet again, a long story..)

  410. Geek chic(k). by swerdloff · · Score: 1

    Maybe it's that I live in New York, where the dot com revolution was happening up until about this past Thursday.

    Girls I know code more than just HTML. My girlfriend codes about as much Perl as I do, and she is doing CS come fall. Several of my close friends do more than "pretty html" and make a ton of money doing it.

    I see very few female sysadmins, but ummm, no offense guys, I'd feel uncomfortable too if I were in a setting where all days guys spoke about the size of their drive, the build that they did last night, and had poor personal hygene. That last one, to me, is the clincher.

    Geeks! Unite! Smarten your image up! You can afford it, while the dot com thing is in its death throws, vest your options! Join a gym! Get a nice wardrobe! Brush your teeth!

    And, umm, tell your younger brothers to do the same. Then, you'll start to see girl geeks.

    That's not scientific, though. Just a guess.

  411. Re-Re:Miranda and Ki by jawtheshark · · Score: 1

    Hey, I am a geek...well I think I am. And I love to keep my good old P120 running instead of buying (every two months) the latest Thunderbird/Pentium4/Transmeta/whatever.

    What you say about cars and women is not true: I drive an Audi TT which is considered a sports car (well where I live) and it didn't help me getting a woman in no way.

    Oh, and (I know it is not on this post), what is everyone bitching about personal hygiene of geeks? I shower everyday...the only thing I loathe is shaving.

    --
    Ahhh...the great dumpster continuum. Many a free computer will be found there. -- sowth (748135)
  412. You think you have problems... by Puma · · Score: 1

    As a Girl Geek, I have the exact opposite problem - I can't get a technical job. 6 Years as a technician, and most of the men don't seem to want to hire a girl who's better at it than they are... Is it me or are they short d!cked losers? Puma "Why did you put our DNS & DHCP & Intranet on a 386?" "Because I could!"

  413. Anecdotal evidence by Cally · · Score: 2

    1: My aunt got her BSc degree in math and CompSci at Imperial College, London, in the late 60s - an incredible achievement. She then got into teaching, and for the last 20 years has been working in the west (== very rural) of Ireland, at a Tertiary level college, teaching IT and CS. I remember her saying that twenty years ago, the classes would be full of women. Now thanks to the internet "as soon as the 14 year old boys get near a computer they cluster around it and start pulling down porn."

    2: I've known several women in tech careers professionally. All of them were as good as (or better than) their male peers, and all of them (as far as I could see) were consistently patronised, marginalised, shunted into "female orientated" roles (guess who gets to handle telecoms ?) and generally treated like shit.

    3: Someone recently posted a brief announcement on the NANOG list about a "women in technology" mailing list starting up. The general tone of the responses seemed to be to be amused superiority; a couple of people got /really worked up/ and came out with some embarrassingly reactionary, MCP-type sexist garbage - confirming the stereotype of male tech workers as poorly socialised, arrogant, and ignorant outside their narrow field of expertise (in which they become obsessively knowledgable.)

    4: Only last week a similar discussion happened where I work; apparently intelligent, sensible programmers were seriously advancing the notion that women are genetically unable to code owing to some chromosomal imbalance.

    Draw your own conclusions. Oh, you already have ;)


    Camaron de la Isla 'When I sing with pleasure, my

    --
    "None are more hopelessly enslaved than those who falsely believe they are free." -- Goethe
  414. Focus by tarka69 · · Score: 3
    My girlfriend and I had a discussion about this last week. It got a bit heated (wine was involved :), but in the end there was one main thing we agreed on: while men and women may be capable of the same things, men often go further because of focus.

    It's one thing to have a talent for something. But to to truly master a field requires a certain amount of mono-mania. This is what makes true masters of their art what they are. It's also what makes many geeks insufferable people to deal with.

    --
    The comfort you demanded is now mandatory - Jello Biafra
  415. Terrible recruiting to blame... by ccoakley · · Score: 1
    I remember when I was in high school trying to decide what schools to apply to and what major to apply under. A number of my friends were doing the same. College recruiters (especially student reps) seemed to, by and large, approach male students with questions about econ or engineering, and female students with comm, soc, and lit questions. When you've got negative reinforcement comming from the system, why bother looking for other reasons for the imbalance?

    My sister is a geek (Aeronautical Engineering), but she made that decision on her own, and never spoke to a councellor or a recruiter. She only applied to a single college, and didn't list any alternative major choices in her application. Most of the geek girls I know fit the same profile. Many of the geek guys I know applied to college under history or literature majors and got recruited into their fields.

    --
    Network Security: It always comes down to a big guy with a gun.
  416. Slashdot as a reflection of the geek community by zorba · · Score: 4

    The people trolling this story are the same ones that cause females to turn away from technical careers. Even if a female is inclined to technical pursuits, she has a powerful reason not to, when the technical field is filled with sexist, insecure, and socially incoherent people.
    A male has to deal with social pressure from outside the geek community, but within the community, there is support and like minded people. I'm generalising here, but a female has to deal with harrassment from both inside the community and without, and for most of them, it just isn't worth it. I have a tremendous respect for females in technical fields, because they have to deal with social difficulties on two fronts.
    In other words, don't treat female geeks as aberrations, prospective geek wives, or otherworldly creatures... treat them as fellow geeks.

  417. How badly do you want to be a geek? by Lips · · Score: 1
    From 14 (1981), I knew what I wanted to do. I forced my way into senior maths classes where they did a tiny bit of basic programming. I wrote programs on mark sense cards and submited them. I did anything I could to get computer access.

    My parents being unskilled labourer migrants to Austrlia, didn't really understand my choice of career. In fact they hated it. I started my comp. sci. degree against their wishes and with all sorts of nastiness in my family at the time. They wanted me to become a lawyer, doctor or architect, something "decent" like that.

    Now, they are so glad I didn't listen to them. I'm in a job I really like and I get paid pretty well. I don't ever see myself being umemployed.

    My point is, if the silicon is in your blood, nothing will stop you.

    As for all the other guys and grrrrls saying, "yes, there should be more female geeks". I agree and disagree with you. I disagree in that, I don't give a shit what the gender of the geek is. Geekdom transcends race, age, gender, species (on the Internet nobody knows you are a dog) and time (Ada was a geek in a computerless world). On the other hand, I also agree, because I believe that women solve problems in a different way to men and it's a great thing to have different problem solving approaches in a dev team.

  418. Forgot a comment... by PD · · Score: 2

    I forgot to add this to my other comment...

    You seem to think that it's wrong to laugh at stupid people? I do not share that opinion. As I wrote above, we did indeed explain what a vector was to N****. You wrongly assumed that we didn't.

    She NEVER FIGURED OUT WHAT WE WERE TALKING ABOUT. You think it was difficult for N**** to admit her ignorance in front of us. Well, that was standard for her. She found it easy to admit ignorance, constantly.

    I think you're pissed off because we were laughing at a female. If we were laughing at a dumb guy, you'd be right there laughing right along. Well, I've got news for you. I don't care what sex a person is. I laugh at stupidity wherever it is found. You on the other hand have some kind of sexism problem.

    You want more proof? You hope that N**** found someone with decency. Well, that might be because you assume that a woman is incomplete on her own. Why should she have to find anyone at all? She may very well have found someone, but I have no idea. It's been 11 years since I last talked to her. Maybe you should find her a good man before she wastes her life as an old maid?

    That's sarchasm for the clueless.

  419. Re:Geeky Girls by cordelia_vega · · Score: 1

    I bet that napkin came in hand later on that night

    --
    Don't jerk me off, I've already come
  420. I'm a high school girl... by kwallace · · Score: 1

    I am a high school quasi-geek-girl. I went to the computer lab to do some programming after school a few times, and found that the chess club was meeting. They were all guys. So that 5:1 ratio isn't even accurate at my school. ;-) I won't go to any chess club meetings. I haven't been to math team meetings, but the people I know on the team are also all male. It's always a bit uncomfortable to be the only girl. The same applies to programming jobs, to some extent.

    I think the poster idea would be very amusing, Chaosnymph. :) Bet the math team and the chess club wouldn't object...;)
    ~kwallace

  421. Baloney by Robert+Link · · Score: 2
    These stereotypes arise more out of need to believe that people are created with some sort of rpg-esque "point balance". Geniuses must pay for their intellect with personal shortcomings; gifted athletes must pay for their skills with a lack of intelligence, and so on. With Einstein it's hard to separate the reality from the myth, but I wouldn't be surprised if his absentminded professor traits have been greatly exaggerated in the popular consciousness. In any case, scientific genius is not always accompanied by being a social misfit or an absent minded fool (e.g. Richard Feynman was neither), and excellence in computers and technology does not necessarily preclude one from living a "normal" life (however you care to define that.) In fact, I'd wager that computer geeks that aren't obsessed with striking it rich in an IPO in general lead lives that are every bit as normal as anyone else's (I know I do.)


    Regarding the original quote that spawned this debate, it sounds like so much apologism to me. If you read between the lines what it's saying is, "Don't worry your pretty little head about all this trivia; it's just chimpanzee work. You have a `higher' intelligence." Feh.


    -JACS (Just Another Chimpanzee Scientist)

  422. I don't understand these... by BruiserBlanton · · Score: 1

    classifications.

    At my school, there were a few girls novices that did the typical computer users stuff (email, chat, etc), but only four or five guys were serious computer users and none of them were 'geeks.'

    I've always said that I broke the classification of being a geek because I played football, I lifted weights, I ran track, I took calculus, and I could do a little programming.

    But then I think about the other major computer user, my best friend in fact, wasn't a typical geek either. Sure, he didn't do any sports but he partied like a wildman.

    The girl closest to being a geek at my school was in my calc class(amazingly it was 3 girls, 4 guys)
    and she breezed through. The girl is a computer novice and can't get through a word processor by herself. And she was a star athlete.

    I don't know if I've answer the questioned but all of this seemed OT.

  423. missing the point? by mcdade · · Score: 1
    I think everyone is missing the point, they are saying how they have personally experianced this or that but this isn't about the individual. This is about a society as a whole, you are all a very small part of a demographic group!

    This forum is so overly bias in the tech area, ask the average person what 'slashdot' is and they will give you a blank stare like you are speaking another language. Go to a nite club and try and pick up a girl with a line like "I was just reading on how they overclock the K7's up to 1GHZ..." The girl will run to get away from you (not that i have tried this). Females place certian things higher on a priority list, maslov's 7 requirements seem to slip by most geeks as computer prowless drops to the bottom rung being first over food and shelter.

    Get with the program, males and females are different, not just at the chromosome level but in every aspect, would we really want everyone to be the same? how lame would that be, a society full of blandness, we should rejoice in the differences. Long live the hotties.

  424. Re:I want to be a geek... wait i *am* one. :) by Anonymous+Psychopath · · Score: 1
    LOL, I was just at Cisco Networkers and heard that about the bathroom lines over and over.

    The bottom line is I don't believe there is a gender bias at work here. Right or not, traditionally men have been more attracted to building things, whether that be buildings, roads, cars, networks or web sites. It's not about physical labor so much as loving to put things together.

    And oh yeah, we love to blow things up too. ;-)

    --

    Eagles may soar, but weasels don't get sucked into jet engines.

  425. Re:Obviously, all technology was created by males. by felis_panthera · · Score: 1

    I like to think of it another way. All technology has been created by men. Why? Well, using a simiar list of examples as above...

    Fire - Make meat taste better
    Club - Hitting mamoths hurts my hand
    Printing Press - Writing it down takes too long
    TV - Can sit down and still know what's going on
    VCR - can sleep while finding out what's going on
    Internet - Don't have to adress letters anymore

    And there you have it, it all comes down to lazyness. Men are lazy, shiftless people, not unlike cats in that aspect. All technology has been created in order to make our lives easier and allow us males to be even more lazy. Gods bless all those who have made it possible. *G*

    --

    The chains are broken
    Loki is free
    Ragnarok is at hand...
  426. Almost no male mothers! by kreyg · · Score: 1

    I recently discovered this startling statistic:

    Approximately 0% of men become mothers!

    This enormous segment of the male population (including me) will never know the wonders of giving birth!

    Personally, I blame sex education for imposing these roles.

    I also discovered one other interesting statistic:

    Approxmiately 99% of all people who try to prove things with statistics are fscking idiots.

    I AM KREYGHOLIO!

    --
    sig fault
  427. It's about power, not politics by Troutgirl · · Score: 1

    Your dramatic oratory to the contrary, no one around here is saying society has to be 50/50 in everything. That argument is a straw man. This is about understanding power: who has it, who don't, and why. Who are the subjects of their own destiny, who are the objects of another's. Who makes the big money, who subsists on scraps. If those aren't interesting questions to you, they are to me -- and I'm neither white nor a liberal, if that matters. You can't game a complex system until you understand it.

    Looking at it systemically rather than anecdotally, it's clear that the more technological a society becomes, the more power adheres to the technocracy. I'm surprised more Slashdot readers don't mention this -- it's a big theme of SF, of Jon Katz's book, of ESR's writing, etc.. Anyone who won't step up and learn tech is increasingly at the mercy of those who will. That's what a technocracy means, right?: if the geeks walk out, the whole society grinds to a halt. In a sense, everyone else in society functions as support staff to the geeks -- burger flippers to make their food, maids to clean their houses, teachers to educate them, doctors to keep them healthy, IRS agents to redistribute their wealth, wives to raise their kids. This historical progression hasn't happened completely yet, but it's not that far off.

    I personally intend to be among the technocrats, not the burger-flippers -- and despite your rhetoric about male nannies, I think you do too. That's why it's an interesting question to me. The social responsibility thing is tangential -- it's your right to say "so what?" to the social status quo if you choose. But to me, this topic is about knowledge == power, not about self-righteous liberalism.