Slashdot Mirror


Where Should Space Exploration Go From Here?

Lovejoy asks: "I have done extensive reading since the Columbia tragedy about what's next for human space exploration. Most of the punditry agrees that extending the shuttle program for many more years is a bad idea. So what are the practical alternatives? I've seen ideas for new spacecraft, a carbon nanotube space elevator, among other things. What are the best ideas you've seen? Will the best idea win, or the one with the most pork barrel contracts? Does space travel/exploration have to be THIS expensive? What are the best short term/long term solutions?"

Since Congress has been steadily cutting back on support for NASA, Nick suggests this idea: "I'm sure there are many taxpayers out there like me that would love to see NASA's budget doubled. The problem is there isn't enough support to get congress to increase the budget by that amount, and I really don't want people to pay that don't care to. I propose an opt-in, one-time contribution box added to tax returns. I would require that my money be used only to advance the space program with either a shuttle replacement, an extra crew compartment for the space station, or a launch vehicle for a manned trip to Mars. Would you support a bill that would allow taxpayers to voluntarily contribute money to NASA? Are you ready to put your coin where your Dreams are?"

794 of 987 comments (clear)

  1. The obvious answer by Exiler · · Score: 2, Funny

    Well, space.

    --
    Banaaaana!
    1. Re:The obvious answer by essreenim · · Score: 1

      Or possibly for a holliday to escape bad pres!!!! badabing

    2. Re:The obvious answer by illogical_simby · · Score: 2, Funny

      It should go somewhere useful and do useful things! For instance, what is the benefit of sending Australian spiders into space? I for one, would like to see useful science experiments get carried out. Example

      1) Urinating into your own mouth safely
      2) Spewing up and running away
      3) The possibility of having an "3000 mile high club"
      4) Checking which direction the toilet flushes

      and so forth. Call me insensitive (God bless their souls), but these are the answers NASA should be providing.

      --
      Apparently my appendage goes here
    3. Re:The obvious answer by essreenim · · Score: 1
    4. Re:The obvious answer by speleolinux · · Score: 3, Interesting

      The obvious answer? Space travel is expensive both in $ and resources and its so important that the only way forward is for all nations to have a single Space Agency where nations that wish to contribute to space travel do so to a common pool. They might specialise, some might develop launchers, others plasma drives (like at Australian National University and Rod Boswell) while others might just do theory calculations. But all could participate in the world wide challenge. This is the solution and the way up.

      --
      Fun=Linux, caving and anything technical.
    5. Re:The obvious answer by kfg · · Score: 1

      Your post my well have been a joke, but the joke is that it's snidely insightful as well. Quite a remarkable accomplishment for a first post. I salute you sir.

      Wouldn't it just be loverly if the space program went into *space* once in a while, just to be different?

      Viva Von Braun!

      I propose a permanent, selfsupporting base and launch facility on the backside of the moon, and from there, to infinity. . . and beyond!

      KFG

    6. Re:The obvious answer by kevin42 · · Score: 2, Insightful

      That might sound like a great idea in theory. The problem is that you cannot separate politics from a project that would be this big and involve this much money. The more nations that get involved, the slower and less effective it would become. All you have to do is look at the ISS, which is a mini version of what you suggest.

    7. Re:The obvious answer by Anonymous Coward · · Score: 1, Insightful

      One of the Ariane 5 rockets blew up bearly two months ago - but the press hardly blinked. Yet when the shuttle blows up - good god, what a fuss.

    8. Re:The obvious answer by Spamlent+Green · · Score: 1

      I suspect these topics and other related research will all be investigated in "Son of Jackass," coming to a holodeck near you in 2080...

    9. Re:The obvious answer by DJPenguin · · Score: 1

      I fear Mr, Jackass would have won the Darwin award by then, and thus be out of the gene pool... :)

    10. Re:The obvious answer by TooTallFourThinking · · Score: 1

      At least in press coverage, there is a difference between an unmanned rocket exploding and one of the Space Shuttles exploding. Anyway, the news sources I followed had articles about the unmanned rocket blowing up.

    11. Re:The obvious answer by The_K4 · · Score: 1

      The Real answer, The US government needs to aloow corporations to go into space. If space travel/explpration is privitized, then you will see industry finding a way to do it cheaply and safely. After all the possibilites of "vacations" in space (that don't cost $20 mill) of having companies put research facilities in space or on the moon and the HUGH range of other things that could be of benifit to industries (current and future). Also, if there is compition then these companies will find ways to make the trip cheaper (but they will always focus on safty because they (unlike the US gov.) can't afford have employees die (NOTE I AM NOT SAYING THAT NASA JUST "LET" THIS ACCIDENT HAPPEN....just that the gov't doesn't have the same finincial pressure to make sure that employees are safe taht most companies do)). The future of space exploration/travel/and experementation SHOULD be with the private sector, not the Gov't. Not to mention toat most corporations tend to work together better then most gov'ts.
      :)

    12. Re:The obvious answer by The_K4 · · Score: 1

      dude, obovously there would STILL be OSHA laws...
      However even those aside...ALSO companies are responsible financialy for any injuries that occur, so they would want as few injuries/deaths as possible. Also, if one company has a MUCH higher success rate then another, which would you book your space travel with? Remember Volvo has often by WAY ahead of any laws about safty, and they are not the cheapest cars, and they still sell VERY well. To companies the cost of an accident will be a driving force to prevent them, after all you have many and your company goes under.

    13. Re:The obvious answer by speleolinux · · Score: 1

      I just don't trust private coorporations anymore. Lets say it a payout for a worker killed is $5Million x 7 astonauts = 35 Mil = small compared to the cost of the entire program so they will not be worried at all by such 'financial responsibility'. OK OSHA laws will apply eh? Well if they were negigent with safety try to get the information out of the coorporations to prove it. With NASA you can impound data, private companies can quicky have a data centre failure instead or literally shred data like Authur Anderson and Enron. Oh and the companies wont go under as the US Govt will direct judges not to split up the company if they are found guilty - eg KPMG is now be found to have been doing lax auditing but govt cant really shut them down as that would leave only 3 international auditing firms left. Same with a few big private companies doing space transport. They would be so crucial to the US Govt that they would get the kid glove treatment in any court case involving safety. Am I too cynical :-)

      Yes I agree I am a little naive to think that nations could band together and have one space program but it's the only way. I think space transport is prob too expensive even for corporations. Who are the customers? What will they pay? Someone before raised the problem though that it would be like the ISS, a lack of direction could mean that it would be a floundering behemoth.

      --
      Fun=Linux, caving and anything technical.
  2. Red Planet by geoffrey+crawford · · Score: 1

    Mars is next!

    1. Re:Red Planet by hdparm · · Score: 1
      In Soviet Russia...

      All planets are red!!!

      Seriously, though, I'm not a tax payer in US, so can't help that way. But I'd go to Mars if that can help.

    2. Re:Red Planet by susano_otter · · Score: 1
      No, no, no!

      It's "... Mars explores you!".

      --

      Any sufficiently well-organized community is indistinguishable from Government.

  3. Easy Question by Anonymous Coward · · Score: 3, Funny

    It should go up.

    1. Re:Easy Question by efatapo · · Score: 2, Funny

      It should go up.

      I think the more important part is that it come back down....in one piece

    2. Re:Easy Question by essreenim · · Score: 1

      Fly my pretty,.fly...

    3. Re:Easy Question by IanBevan · · Score: 1

      Well I live in New Zealand, southern hemisphere, so I say it should go down.

    4. Re:Easy Question by pjt48108 · · Score: 1

      "It should go up."

      Well actually, in space there is no 'up'. So it'd have to do something else.

      --
      Mmmmmm... Bold, yet refreshing!
    5. Re:Easy Question by EatHam · · Score: 1

      That's not true. Fire one of these up.

    6. Re:Easy Question by JimFromJersey · · Score: 1

      The number of landings will always equal the number of take-offs ... the only question is, can you walk away from the last one?

      --
      between the greater and lesser infinities sleep the dreams undreamt
  4. Use Anti-Matter drive by johnty · · Score: 1
    I think we should look at space ships powered by anti-matter drive

    Hard to make you say? Just ask our Iraqi friends - it is well known that they have weapons of mass distruction /end lame punchline

    --
    I am unique, just like you, and you, and you...
    1. Re:Use Anti-Matter drive by jasonrocks · · Score: 2, Insightful

      At the present, Anti matter is impractical. There are no known power plants that use anti-matter. It takes a significant amount of energy to create Anti-matter. It also requires precise magnets to contain the anti-matter so it doesn't cause a reaction. If you would like anymore info, google anti-matter, and don't bother clicking on the numerous Trek links.

      --

      void
    2. Re:Use Anti-Matter drive by teasea · · Score: 1
      <sarcasm type=dry target=Bush>No. Actually Saddam is on the verge of creating an anti-matter device capable of destroying a large city. We cannot rely on him to be reasonable. He will try to destroy Butte, Montana. We have undeniable empiratical evidence. </sarcasm>
    3. Re:Use Anti-Matter drive by fenix+down · · Score: 2, Informative

      And now, to needlessly explain the stupid pun...

      For the purposes of weak humor, he interprets "mass destruction" as the destruction of mass, rather than destruction of an indeterminate, massive quantity. Since anti-matter destroys mass, he suggests that Iraq must posses anti-matter if they indeed have weapons of "mass destruction".

      Ironically, mass destruction is not even a word.

    4. Re:Use Anti-Matter drive by mikeophile · · Score: 1

      Mass destruction is two words.

    5. Re:Use Anti-Matter drive by Amon+Re · · Score: 1

      Yeah...ummm no shit.

  5. MONEY gets in the way by Clock+Nova · · Score: 5, Insightful

    We will never get much farther unless we find a more efficient, less expensive way of building vessels and machinery. And you can blame congress and their love of pork for most of it.

    --
    There they were, sitting in the van with all those dials, and the cat was dead. -V. Marchetti, CIA
    1. Re:MONEY gets in the way by Anonymous Coward · · Score: 1, Interesting

      One more post in this regard from TIME

      Also, it's interesting to look back at Feynman's analysis of the Challenger case.

      Concluding quote from the doc: "For a successful technology, reality must take precedence over public relations, for nature cannot be fooled"...

  6. Let NASA make the decision by MvdB · · Score: 5, Insightful

    Science is not democracy. You can't get to the best decision if you let voters decide. The people at NASA are being paid to be experts, so my vote goes to letting them chart the course. Some mistakes will be made, but I'd rather that they make the decision rather than me and my neighbour, who both have been watching to much Star Trek and Star Wars.

    1. Re:Let NASA make the decision by elmegil · · Score: 3, Insightful

      the Point is that NASA needs funding.

      --
      7 November 2006: The day Americans realized corruption and incompetence weren't addressing 11 September 2001
    2. Re:Let NASA make the decision by GeoNerd · · Score: 5, Insightful
      That'd be great, if NASA actually listened to its experts.

      Unfortunately, the decisions of what it's going to do in the future are not made by its experts, it is made by the politicians, which (at least indirectly) are influenced by our democracy.

      Why? It all comes down to funding, which comes from the government.

      For example, why do you think the shuttle is the way it is (part reusable, part disposable)? Politics. The fully reusable one was too expensive. This article outlines the compromises that were made, and is an overall interesting read.

      A quote from the article, "But you're in luck--the launch goes fine. Once you get into space, you check to see if any tiles are damaged. If enough are, you have a choice between Plan A and Plan B. Plan A is hope they can get a rescue shuttle up in time. Plan B is burn up coming back. "

      Note that this article was written in 1980.

    3. Re:Let NASA make the decision by eigenhead · · Score: 1

      Here, here, I second this motion (even though I'm on the outside looking in, as a Canadian). I always think of Freeman Dyson's book Eros to Gaia when it comes to politics and science; you can't try to fund just the "good" or "popular" science. Try and keep big politics out of science. Science has enough internal politics, it doesn't need any outside help!

    4. Re:Let NASA make the decision by frankthechicken · · Score: 5, Informative

      China is planning on becoming a lot more active in space shortly. I sort of feel this will give the US a huge incentive to give more funding to NASA, there's nothing like competition to get the money pumping in.

    5. Re:Let NASA make the decision by bcrowell · · Score: 2, Insightful
      That'd be great, if NASA actually listened to its experts.
      More specifically, Congress should instruct NASA to expose all its science programs to the normal process of peer review used to make funding decisions in the sciences. Congress should then abide by those decisions. This would have the effect of eliminating the manned space program, which has a ridiculously low ratio of scientific results to funding. Unmanned probes are the real workhorses of space science and planetary exploration.

      That's just science, of course. NASA shouldn't even be involved in commercial stuff, which can be handled more efficiently by private enterprise than by a government agency.

    6. Re:Let NASA make the decision by whereiswaldo · · Score: 1

      It all comes down to funding, which comes from the government.

      The other thing is that it's not large corporations pushing for more funding for NASA because there's nothing in it for them directly.

      What's left is a small percentage of the public pushing for more funding.

      "Next topic" says Mr. Speaker.

    7. Re:Let NASA make the decision by Moofie · · Score: 4, Insightful

      NASA isn't about doing science. NASA is about doing politics. That's why the only two major "space exploration" plans are more shuttle flights, and the ISS. NASA is making certain that they, and the shuttle, are the only American heavy-lift vehicle available.

      Do I think it sucks? You bet. Do I think the answer is to throw more money at NASA? No. I think NASA should be acting as a technology incubator. The X-plane program is really good, and getting much better since the aircraft no longer need to be man-rated to explore the flight envelope. I would like to see a private venture use NASA technology to build a rapidly serviceable, man-rated heavy launch vehicle, whether or not it is SSTO. (Me, I think that SSTO rocketry is not yet viable. I would prefer something like a reusable staged system, or else a cheap disposable booster pushing a reusable people capsule and/or a disposable payload section).

      Shuttle's "one size fits all" approach is not ideal.

      And yes, that is my professional opinion.

      --
      Why yes, I AM a rocket scientist!
    8. Re:Let NASA make the decision by rkent · · Score: 1

      Okay, but let's be informed about what the costs and (potential) benefits are, and let's not be naive about "letting NASA decide": their careers depend on NASA funding. They're going to start with the assumption that "what we're doing is great, but needs..." and at the end of the report is going to be a huge dollar sign.

      Manned space exploration has been a huge maw of inefficiency since it started. In this Washington Monthly article, from 1980, some of the Space Shuttle Program's problems are dissected; basically, even if it *had* been on budget, it would have been more expensive than other useful space technologies of the time (mostly satellite launchers), and would have had little to no added value.

      Basically, the only reason we send people into space is because "it's neat." I mean, I suppose I'm abstractly interested in how ants tunnel in zero G, and I'm sure it does get kids interested in science, but for tens of billions of dollars...?

      So, great. Sure, the whole effort shouldn't be cancelled because two shuttles were lost, but the thing is, that wouldn't even be a problem if we put it to a public vote, because people are convinced it's "too important." I'd like to know what that's founded on, maybe inform the debate a little bit, then decide.

    9. Re:Let NASA make the decision by Moirke · · Score: 1

      I would argue that you could extend your argument "You can't get to the best [science] decision if you let voters decide" to any field in the world. Economists can make much better decisions about economies than voters can. Engineers can make better decisions about what roads to build than voters can.

      If you believe in democracy then you have to expect your experts to explain options in a way that the average person can understand and then trust the voters (or their elected representatives) to make the right choice for everyone.

    10. Re:Let NASA make the decision by getitconnected · · Score: 1

      I have to agree. I think that NASA has to take a step back and look at what their current designs and protocols are. I spent an entire 1.5 hours today reading articles in 1 newspaper about all of the problems that can/did arise.

      It seems that when people tell NASA something is wrong, they try some type of half-ass fix and send the astronauts on their way. Don't get me wrong, I think Space Exploration and NASA are great things, but they need to spend another 10-15 years with some R&D before they try to "advance" some more.

    11. Re:Let NASA make the decision by halo8 · · Score: 2, Funny

      Mabey Nasa should change its name to Iraq.. lots of money beeing thrown there these days

      --
      The More Knowledge you have the Luckier you Get- J.R. Ewing
    12. Re:Let NASA make the decision by On+Lawn · · Score: 1


      I like your attitude, but perhaps it is all the more reason to bug the politicians about it. NASA is still a publically funded entity, caught at the whim of politicians and their quid-pro-quo favors. To leave the situation alone could put NASA even more at mercy to these forces.

      Supporting NASA, publicaly and politically would send a strong infusion of power to NASA if that is what you wish.

      --------------------
      Onroad:dB Drag Racing, now showing...

    13. Re:Let NASA make the decision by dWhisper · · Score: 4, Insightful

      One of the main problems with NASA being paid to be experts is that they are paid by our government. They come in there being experts on aerodynamics and astrophysics, and eventually become experts on proposal documentation and red-tape navigation instead. The glory days of the Apollo program had NASA leading with their hearts, doing what they loved. It was about achieving something, even if that was working on beating the Russians in space.

      Then, in the 80s, it became about military projects and defense initiatives. Putting up surveylance stations and communications arrays. They still have exploration, but they are essentially at the bidding of the military for a lot of things.

      NASA right now lacks a goal. The last (successful) big project they had was the unmanned Pathfinder mission. It was a great success for them, but was followed by two failures (Mars Global Surveyor and it's sister lander). The Galleleo showed that they could get over major technical hurdles (damage to main array and then an extra-long mission life), but these are not pushing how far man can go into space.

      What NASA needs is a dream to get going, something that won't be cut down by beuracracy and red-tape. A non-military initiative that can get both the world and the government behind it. There is not really a bigger government PR entity in our country (the Military only has PR for recruitment), and that is something that NASA hasn't been using effectivly lately.

      I think if the project was risky, but captured that same spirit as the Apollo and Early Space Shuttle missions, the people would step up to get it done, despite those risks.

    14. Re:Let NASA make the decision by __aatgod8309 · · Score: 1

      The problem with the people at NASA who are being paid to be experts, is that there are also people at NASA who'll likely know next to nothing about engineering or science, who have to interpret what the people what the experts tell them and pass on what they think the politicians will accept.

      When something has to make a profit (ie work in the private sector), they have to provide results. When something has to satisfy a politician, it just had to look good and come under budget.

      If the experts had been allowed to do what they were hired for, and were given the money to do it, we could have had *real* orbital stations, and outposts on the Moon and even Mars by now.

    15. Re:Let NASA make the decision by LMCBoy · · Score: 1

      The last (successful) big project they had was the unmanned Pathfinder mission. It was a great success for them, but was followed by two failures (Mars Global Surveyor and it's sister lander).

      By what measure was MGS a failure?!!

      --
      Liberal (adj.): Free from bigotry; open to progress; tolerant of others.
    16. Re:Let NASA make the decision by Dan+Crash · · Score: 2, Interesting

      As far as new goal for NASA for the 21st century, I would shoot for lunar solar power. From a long term perspective, lunar solar power is the only idea that makes sense. (It also has the virtue of being the only method we've yet discovered that would allow 1st world levels of energy consumption for everyone on Earth.)

      Space exploration has languished without a raison d'etre for decades now. What better motivation could there be than eliminating the largest source of pollution on Earth, providing for the energy needs of the entire planet in the process?

      --
      He who refuses to do arithmetic is doomed to talk nonsense.
    17. Re:Let NASA make the decision by Flamerule · · Score: 4, Insightful
      This article [washingtonmonthly.com] outlines the compromises that were made, and is an overall interesting read.
      Oh god, that was depressing. I knew the shuttle sucked, but I didn't know it sucked that much. We really have been dicking around, doing nothing, for the past 2 decades.

      So much money wasted on such a stupid, bureacratic-minded, committee-designed contraption. Well, now is the time to use all the badass technology the last 2 decades have brought us, and end the misguided shuttle program.

    18. Re:Let NASA make the decision by the+gnat · · Score: 1

      Partially correct. NASA's real value is in space missions of genuine scientific (but very little commercial) value- that is, the unmanned ones. There are cases where it may be valuable to send people into space, such as taking care of Hubble, but virtually all of the real innovation involves long-range probes and robots. They're simply not as popular because even though they're relatively inexpensive they still carry a hefty price tag that seems much worse because a) the shuttle costs aren't widely understood and b) they don't carry people.

      In reality, private ventures will not fund, say, an unmanned expedition to Europa (unless someone like Bill Gates or Ted Turner decides to fund it). It's nice to imagine that they might handle manned spaceflight, but the costs are so immense that I doubt anyone would reasonably expect to profit from it.

    19. Re:Let NASA make the decision by Anonymous Coward · · Score: 1, Interesting
      The last (successful) big project they had was the unmanned Pathfinder mission. It was a great success for them, but was followed by two failures (Mars Global Surveyor and it's sister lander).

      Skimming over the fact that MGS was not a failure, the Mars missions have actually been incredibly useful. Not content with disposable rockets, NASA has shown that there is a lot of value in disposable missions. Instead of spending $100M on one huge mission, you can now spend $10M each on eight small missions which do the same job, and you can even sustain a failure or two.

    20. Re:Let NASA make the decision by the+gnat · · Score: 3, Insightful

      Yup.

      It's amazing how many people I would have considered economic conservatives think it's a great idea to spend billions and billions of tax dollars on manned spaceflight because it's "cool." I'm happy with the government spending huge amounts of money on actualy research, but the space station and shuttle involve very little research. This is readily observable from the naked PR stunts like sending up the first Israeli/Saudi/schoolteacher/senior-citizen astronaut. (Of course the moon was a naked PR stunt too. . . I'm very conflicted about that. How do you reconcile the greatest scientific and technical acheivement in human history with the 30 barren years that followed?)

      Some people argue that we need to continue manned spaceflight because the technology will improve to make it easier. Um, no. The technology can improve plenty without risking lives and wasting money; nuclear propulsion sounds like a great idea, but can be tested with robots. Once we can reliably send a probe to Mars quickly, let it roll around and do research, and have it return safely, with relatively little expense, then we can send people.

    21. Re:Let NASA make the decision by Moofie · · Score: 1

      The unmanned science projects are superb, and absurdly cheap. I don't think they're in any danger. I'm worried about the high-ticket manned program, which as I've argued, is still very important regardless of its scientific value.

      NASA would, ideally, be responsible for R&D and exploration, leaving private industry to exploit opportunities in LEO. Once we get launch costs to something reasonable, it won't be a big deal to launch micro-gee experiment packages to a general purpose space station, but that station should also be supporting itself with industrial revenues.

      --
      Why yes, I AM a rocket scientist!
    22. Re:Let NASA make the decision by lirkbald · · Score: 1

      Maybe, but I think NASA presently has enough trouble with things blowing up. They don't need George W. Bush helping out.

    23. Re:Let NASA make the decision by Anonymous Coward · · Score: 1, Interesting
      This was an interested tidbit:
      The inch-thick tiles, made of pyrolized carbon, are amazing in two respects. They can be several hundred degrees hot on one side while remaining cool to the touch on the other. They do not boil away like the ablative heat shieldings of capsules and modules; they can be used indefinitely. But they're also a bit of a letdown in another respect--they're so fragile you can hardly touch them without shattering them.


      Instead of just accepting the lameness of the shuttle program, NASA will likely spend next year's budget trying to figure out what they already know. We're not going anywhere else anytime soon. Especially since Bush doesn't even remember if he has ever visited a NASA facility. Just great.


      But then again, maybe he did??

    24. Re:Let NASA make the decision by miu · · Score: 1
      That's just science, of course. NASA shouldn't even be involved in commercial stuff, which can be handled more efficiently by private enterprise than by a government agency.

      If Bush is going to ignore/break treaties he should start with The Convention On International Liability For Damage Caused By Space Objects.

      This prevents the US from allowing a free hand to private enterprise in space for US based companies, because according to the Convention the US government accepts full responsibility for damages caused.

      It was enacted in 1972 as a punishment for the US being so far ahead of everyone else in our space program. (Also goes to show that the current spate of anti-American sentiment is nothing new).

      --

      [Set Cain on fire and steal his lute.]
    25. Re:Let NASA make the decision by dWhisper · · Score: 2, Insightful

      See above, I meant the polar lander and weather surveyor mission in the same MGS project. Need to check what I type more often

      Disposable missions have been economically sound, and the space shuttle had proven that point well. One of the most interesting points of the pathfinder mission was the landing method that was chosen (take this thing and let gravity do the work. Kinda playing bouncy ball with a planet and our little rover).

      Any mission involving people will be a huge mission. Our way of life puts the value of human life higher than that of machines, so that is what complicates matters greatly. Unmanned missions are wonderful for scientific advancement and testing, but they have never held the interest of the public as long as the manned missions.

    26. Re:Let NASA make the decision by the+gnat · · Score: 1

      The point I've been trying to make, which a lot of people miss, is that making launch costs reasonable does not depend on manned flight. NASA should absolutely continue to research this, because even in the short term it'll make launching probes cheaper. We don't need to be throwing humans into LEO to figure out how to design a more efficient propulsion system.

      As an aside, there appears to be very little utility to micro-G experiments. People mistake the effect of zero-G on humans for an indication that it'd make a huge difference in unrelated fields. There's no reason to believe that any industrial application would be made cheap enough to offset the overhead.

    27. Re:Let NASA make the decision by Moofie · · Score: 1

      Agreed on both points, yes. I just think it's important to emphasize the human development benefits of space flight, which are at least as important as the science and engineering benefits.

      I do believe, however, that if we could build a compact device that grew monocrystalline lattices of, say, titanium, we'd be able to make shedloads of money. Much easier to do in microgravity than here on Earth.

      --
      Why yes, I AM a rocket scientist!
    28. Re:Let NASA make the decision by johnmark · · Score: 3, Insightful

      >> a rapidly serviceable, man-rated heavy launch vehicle
      How about a rapidly serviceable, man-rated _light_ launch vehicle? Its arguably a mistake to have combined the freight transport needs in the inappropriately named Shuttle with the passenger "shuttle" vehicle. So NASA would be better off having a separate human passenger vehicle solely for transporting humans, perhaps something that gets launched from an airborne platform, like the old X-nn concepts. Then NASA avoids the expense and demand of making a 140 ton vehicle man safe (a goal that apparently has not been met). What would we do with the current shuttle craft? Modify them to fly as un-personed freight transports.

      --
      so much uncertainty, so little time..
    29. Re:Let NASA make the decision by Jeremy+Erwin · · Score: 1

      It was enacted in 1972 as a punishment for the US being so far ahead of everyone else in our space program. (Also goes to show that the current spate of anti-American sentiment is nothing new).

      US Senate: Punish me like the dog I am, mistress.
      UN: Not until you sign and ratify this treaty.

      I mean, really. This treaty has been signed, and ratified on the advice and consent of the Senate. Surely it had other reasons than simple masochism for doing so.

    30. Re:Let NASA make the decision by Moofie · · Score: 2, Interesting

      You're right. I want the heavy, man-rated rocket for Dr. Robert Zubrin's Mars Direct mission plan.

      No building stuff in orbit. Just two big damn rockets and five people spend half a year on Mars. Now THAT, my friends, is space exploration.

      --
      Why yes, I AM a rocket scientist!
    31. Re:Let NASA make the decision by Minna+Kirai · · Score: 1

      A cool concept, but the nations of the earth would be too fearful of weaponization to allow any one group the chance to control something like that. "Harmless microwaves" they say- the spectre of GW Bush ordering lunar energy beams to raze North Korean nuculear sites will be on everyone's minds. The James Bond / Dr. Evil scenario come to life.

      (Aside from the ongoing dispute as to the feasibility of assembling a solar-panel whose total potential energy output will exceed that used to construct it.)

    32. Re:Let NASA make the decision by MrEd · · Score: 2, Informative
      This prevents the US from allowing a free hand to private enterprise in space for US based companies, because according to the Convention the US government accepts full responsibility for damages caused.


      And so it should. Listen. If some commerical launch goes wrong, do you honestly believe that any business will have the money to clean it all up? I mean if it hits a population center we're talking about some crazy cash. The government would have to bail them out, no question.


      The whole notion of a corporation is 'limited liability'. The idea was concieved to encourage exploration of the New World when the loss of a ship could completely bankrupt the financial backers. That's what the 'Ltd.' stands for. Limited liability means if something goes real bad then "Super Space, Ltd." pull a Chapter 11 and the people in the crater are SOL.

      --

      Wah!

    33. Re:Let NASA make the decision by DunbarTheInept · · Score: 1

      naked PR stunts like sending up the first Israeli/Saudi/schoolteacher/senior-citizen astronaut.

      That would depend on the motivation. If the Israeli was sent ONLY because he's Israeli, then yes it's a PR stunt. If the Israeli was sent because he was well qualified and he just so happened to be Israeli, and so NASA decided to make a PR issue out of that, then it's not a problem by me. The fact that NASA made a PR issue out of his Israeliness wouldn't be the problem. If they used that to influence their decision to pick him over someone else, THEN that would be a problem.
      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    34. Re:Let NASA make the decision by ender81b · · Score: 2, Interesting

      Wow. Just read that article. 23 years ago and we have this:

      "When Columbia's tiles started popping off in a stiff breeze, it occurred to engineers that ice chunks from the (external) tank would crash into the tiles during the sonic chaos of launch: Goodbye, Columbia. "

      Freakin' prophetic.

    35. Re:Let NASA make the decision by PD · · Score: 2, Insightful

      I had an argument with someone a couple years ago about what vehicle I'd rather ride to space and why. I said Soyuz because they are safer. He thought I was nuts. Shuttle missions have always scared the hell out of me. But when I hear some people are going up in a Soyuz I think "have a nice trip, ought to be fun."

    36. Re:Let NASA make the decision by miu · · Score: 1
      I mean, really. This treaty has been signed, and ratified on the advice and consent of the Senate. Surely it had other reasons than simple masochism for doing so.

      Sure in addition to the periodic resurgence of guilt over being America (simple masochism) there were probably short term gains from this act of appeasement.

      In 1972 there was no way that this act was aimed at any nation other than the US. The fact that we signed it was short-sighted and we should look at modifying or annuling it.

      Besides Bush has already put us in violation of the 1967 Treaty on Principles Governing the Activities of States in the Exploration and Use of Outer Space,including the Moon and Other Celestial Bodies , which disallows any space-based weapon systems.

      --

      [Set Cain on fire and steal his lute.]
    37. Re:Let NASA make the decision by fenix+down · · Score: 1

      And that brings us right back to education again. And unfortunately for science, half the country thinks John Edwards really talks to dead people.

      Maybe I don't give us enough credit, but try and explain why you can't make noise in space to the next 10 people who'll listen. It's not like they don't learn this stuff in school, they just don't give a shit afterwards. That's what our problem is. We've informed the populous, they just didn't pay attention.

      That said, I really think if we got a good heir to Carl Sagan on TV, it would do a lot of good. Especially now that we're dealing with clones and anthrax and shit that's got people trying to sieze babies and buying glove boxes to open their mail in.

      You listening MSNBC? I'm nerdy, telegenic* and willing to work for booze and rent money! You've already got Emo kid filling in for Nachman, what've you got to loose?
      *No, really, I swear.

    38. Re:Let NASA make the decision by egommer · · Score: 1

      Keep in mind, NASA engineers knew this was a major issue. They were only doing what they could to postpone the inevitable. If it wasn't for the brilliance and dedication of the NASA folks, this article from 23 years ago article would have been correct on the first launch in 1981. It has been long due that these shuttles were to be replaced. Like the article says. It was suppossed to only last 10 years. Budjets were cut in it's design and Budjet's were cut again during the span of it's existance. This machine was not designed to run on a small budget. It was built to save money in it's contruction not in it's upkeep.

      --
      Two Towers-Two Worlds.One seeks triumphs and freedom for man.The other deems man unworthy and wrecks them.
    39. Re:Let NASA make the decision by sql*kitten · · Score: 2, Insightful

      That'd be great, if NASA actually listened to its experts.

      You are so right. I'm currently reading The Case For Mars, written by an ex Martin Marietta engineer. They designed and priced a manned mission to Mars using technology available off-the-shelf in the 1990s - in fact, most of it was available in the 1960s. It would cost $20B to develop and $2B/mission, and made use of seemingly obvious common sense. For example, why cart all the fuel for the return trip with you, when you can send an automated device there years beforehand to manufacture rocket fuel (methane + oxygen) from the Martian atmosphere (carbon dioxide) using a process that's been around since the 1890s (not a typo)? And if you don't have to carry all that excess fuel, you don't need to assemble your craft in space, you don't need an orbiting shipyard, etc.

      And there was the problem. NASA wanted $450B for a project that did involve orbiting shipyards and fueling stations, in-orbit assembly, a stop off on the moon en route, etc. His proposal faced enormous opposition from all the little cliques and empires within NASA who accused him of "de-justifying" their projects, and who sought in inflate mission requirements in such a way that only their fiefdom could meet.

      Why? It all comes down to funding, which comes from the government.

      Right now, NASA (in its present form at least) is an obstacle to space exploration. The problems aren't technological any more, they are organizational! But there is a better way. If the governments responsible for funding NASA and ESA were instead to fund a (say) $40B prize for the first organization - private or public, it doesn't matter - to land a team on Mars, carry out a list of experiments or explorations and return safely, then the game changes radically - and we could see humans on Mars this decade.

    40. Re:Let NASA make the decision by banana+fiend · · Score: 1

      cheap disposable booster pushing a reusable people capsule

      cool! Reuseable people

      --
      Johns: Well, how does it look now? Riddick: Looks clear.
    41. Re:Let NASA make the decision by sql*kitten · · Score: 1

      This would have the effect of eliminating the manned space program, which has a ridiculously low ratio of scientific results to funding. Unmanned probes are the real workhorses of space science and planetary exploration.

      What is the point of planetary exploration if you don't intend to go there? Space science could be self-funding if space was industrially useful, i.e. mining, manufacturing, tourism, etc. If you can obtain your raw materials off-planet (Mars, the moon, the asteroid belt), carry out manufacturing off-planet too (Mars, moon or LEO) and dump the waste products into the Sun and send the goods back to Earth, then that's a win-win situation for the scientists, the explorers, the capitalists and the environmentalists.

    42. Re:Let NASA make the decision by Bozovision · · Score: 1

      I think it was Buzz Aldrin who tells this story as an explanation for the moonshots and the drought: one day he was watching this small dog out his window. And a car came driving passed and the small dog barked wildly and ran off after the car. And a little way up the road the car parked so the dog caught up with it. The dog was surprised for a moment, then he peed on the wheel and came back, looking pleased with himself.

    43. Re:Let NASA make the decision by Kibo · · Score: 1

      I've got to know. Do you consider hubble a manned or unmanned program?

      Without men in spacesuits it would harldy have been the brilliant success it is.

      What happens if we let that expertise languish and die? Unlike Bush the senior, I do see a difference in the value of being able to make microchips as opposed to potato chips.

      --
      --Jimmy has fancy plans; and pants to match.
    44. Re:Let NASA make the decision by ratamacue · · Score: 1
      It all comes down to funding, which comes from the government.

      Correction: Funding comes from the taxpayers' wallets. By definition, government does not generate its own revenue. Government obtains revenue only by taking it from those who do generate their own revenue, i.e. the private sector.

    45. Re:Let NASA make the decision by mpe · · Score: 1

      I had an argument with someone a couple years ago about what vehicle I'd rather ride to space and why. I said Soyuz because they are safer.

      AFAIK only 4 people have died on Soyuz, 1 due to a parachute being installed upside down and 3 due to a preasure relief valve opening too high up.

      Shuttle missions have always scared the hell out of me. But when I hear some people are going up in a Soyuz I think "have a nice trip, ought to be fun."

      Soyuz comes with an escape system for the crew, which actually works too.

    46. Re:Let NASA make the decision by mpe · · Score: 1

      And so it should. Listen. If some commerical launch goes wrong, do you honestly believe that any business will have the money to clean it all up? I mean if it hits a population center we're talking about some crazy cash.

      An airliner will also make a nasty mess of a population centre if it hits one. Are you honestly claiming that airlines do not carry the appropriate level of insurance.

      The whole notion of a corporation is 'limited liability'. The idea was concieved to encourage exploration of the New World when the loss of a ship could completely bankrupt the financial backers. That's what the 'Ltd.' stands for. Limited liability means if something goes real bad then "Super Space, Ltd." pull a Chapter 11 and the people in the crater are SOL.

      Limited liability protects the investors. Whilst their certificates become worthless they cannot be persued by creditors. However the concept was never intended to protect the corporate entity itself from liability. The corporation itself and any assets it has are fair game.

    47. Re:Let NASA make the decision by sql*kitten · · Score: 1

      the Point is that NASA needs funding.

      NASA is a bottomless pit for money. Doubling their budget would only slow them down more, as it got soaked up in endless committees. NASA should be to the space industry as the FDA is to the pharmaceutical industry or the SEC is to the finance industry.

    48. Re:Let NASA make the decision by Rinikusu · · Score: 1

      Something to get behind..

      Let me think..

      I got it!

      We can rapidly deplete our ozone layer so that harmful radiation from the sun makes living on the surface of our planet untenable!

      Then, we can dump millions of tons of toxic waste into our fresh water supply!

      During this process, we can over-extend our natural resource consumption to levels that nature cannot replenish (in the case of renewables), or exhaust viable sources completely.

      On top of that, we can pass regulations that discourage the research of alternative fuels, materials, and erect a global bueracracy so inept at doing anything more than verbally chastizing it's children that the people get so mother-fucking SICK of this fucking planet that they realize that SPACE may hold the solutions to their problems.

      Hrm.

      --
      If you were me, you'd be good lookin'. - six string samurai
    49. Re:Let NASA make the decision by aengblom · · Score: 1

      For example, why do you think the shuttle is the way it is (part reusable, part disposable)? Politics. The fully reusable one was too expensive.

      Uhh, I call that money--not politics.

      --


      So close and yet so far from the world's perfect ID number
    50. Re:Let NASA make the decision by gorilla · · Score: 1

      The parachue was installed the right way up, but a sealant had leaked onto it, preventing it from deploying.

    51. Re:Let NASA make the decision by FatAlb3rt · · Score: 1

      We really have been dicking around, doing nothing, for the past 2 decades.

      Thanks for your opinion, but did you really even know there was a shuttle flying last Saturday before you saw it on the news? Bonus points: name 3 experiments that were onboard STS-107.

      Moral of the story: Don't say we have been doing anything if you don't know what we've been doing.

    52. Re:Let NASA make the decision by FatAlb3rt · · Score: 1

      Freakin' prophetic.

      Yeah, who'd have thought that it would only take 23 years and 113 missions for it to happen? Sorry, prophetic is when it happens in the first couple missions.

    53. Re:Let NASA make the decision by Salgak1 · · Score: 1

      So who needs Solar Panels ? Use mirrors to heat a working fluid, run the resultant gas through a turbine. Solar cells aren't the ONLY way to harness sunlight, and certainly aren't the most efficient. . .

    54. Re:Let NASA make the decision by FatAlb3rt · · Score: 1

      As an aside, there appears to be very little utility to micro-G experiments.

      The difference is the removal of the distored effect of gravity. It helps us better understand thousands of physical phenomena. Why is that of little utility?

    55. Re:Let NASA make the decision by bcrowell · · Score: 1

      I've got to know. Do you consider hubble a manned or unmanned program? Without men in spacesuits it would harldy have been the brilliant success it is.
      For a tiny fraction of the cost of the ISS or the shuttle program, they could have built a replacement for the Hubble when its optics turned out bad. For a similarly tiny amount of money, they could have designed it so that you didn't need humans in spacesuits to assemble, repair, and maintain it. The only reason it seemed like a good deal to design the Hubble the way they did was that they'd already made the irrational decision to support the shuttle program.

    56. Re:Let NASA make the decision by Minna+Kirai · · Score: 1

      Solar panels are what's being proposed. Did you read the article? The guy has written 200 papers about it... if there were a significantly better way, he might've thought of it already.

    57. Re:Let NASA make the decision by hackstraw · · Score: 1

      First off, let me remind people that space is not the majority of NASAs budget. They do plenty of aeronautics, as well as materials research, energy research, weather, etc. But everyone thinks NASA == space shuttle.

      To put things in perspective check out this url http://www.mariner.org/age/histexp.html. If it took us up to about the 1750's just to get boatrides across big oceans right (meaning that most if not all ppl died), and considering that this year marks the 100th anniversary of flight, I say keep on going.

      You never know until you look. Also, the trickle down of technology into everyday life alone is worth the investment into NASA.

    58. Re:Let NASA make the decision by Salgak1 · · Score: 1
      200 articles do not make one an expert. Otherwise, "Ed Anger" of the "Weekly World News" would be well-repected pundit.

      Solar cells have low efficiency of power generation, as opposed to turbogenerators. OTOH, they have no moving parts. I think that mirrors and a working fluid would require less capital maintenance in the long run.

    59. Re:Let NASA make the decision by JimFromJersey · · Score: 1

      That sounds like a really good idea and I would like to see more private, for-profit companies moving into the space technology arena, but I'm not sure that there is any profit in current space projects. What does the space program do now? It launches satellites and does basic research. While the concept of things like mining asteroids for resources and zero-g production facilities sounds great, neither will be practical any time soon. Not because we can't put facilities into orbit, but because the science, engineering, and technology (which is independent of putting them in orbit) hasn't been done or is in such an early stage that calling it a prototype is wishful thinking. In order for them to be practical, a lot of money losing research will have to be done and no company worth investing in is going to say "yes, we'll go bankrupt, but we'll be hero's". Companies are in the business of making money and without some ROI, private companies are not going into space. This isn't like building an e-commerce site for your brick-and-mortar store. Space flight is prohibitvely expensive. The start-up costs alone would bankrupt most companies. Sure some companies could join together and share the costs, but that is as bad (if not worse) then the government doing it itself. Besides if we combine accounting oversite of the SEC and the risk aversion of the FDA we'd get an organization that spent all of it's investors money and never went anywhere.

      --
      between the greater and lesser infinities sleep the dreams undreamt
    60. Re:Let NASA make the decision by tmortn · · Score: 1

      Micro G research is valuable but I agree the overhead of simply getting there much less reaping rewards from it is almost prohibitavely expensive. But that is something which is tied to launch costs which is directly tied to desire to get to space.

      Chicken and the egg... why would there be a serious push for cheap microgravity production facilities before you knew what you could get from micro gravity production facilities ? You have to put in the initial start up.. the catalyst effort to generate the sutainable drive.

      You want to know somethin ironic ??? The information slowly forming from crystiline growth formation when not influenced by the forces of gravity is a very likely source for the materials breakthrough we need for a real reduction in the cost to access space. Of course that creates a real cart before the horse problem if you have to get to space to make the materials which make that access cheaper, and will have to be done at a severe beating economically speaking until you reach critical mass in production and reduce the acess cost enough to reap the rewards.

      As for your first point... I agree that NASA shouldn't be the transit provider and that the trips they do take to orbit should be around experimentation instead of service providing whether they launch Humans or Probes. As far as propulsion goes, since shuttle came on line NASA is like Delta.. they want safe and reliable.. none of this new crap. They need to get back to research on how to get places as their primary task. Leave the rest up to people who want to get where they can go.

      --
      I don't ask you to be me. I only ask you not expect me to be you.
    61. Re:Let NASA make the decision by Mr.+Frilly · · Score: 1

      Can you even name 3 technological or exploratory advances that the shuttle program has made in the last 20 years?

      Or even 3 worthwhile scientific experiments that needed the shuttle to perform them?

      We would have been better off had the US cancelled the shuttle program following Challenger.

    62. Re:Let NASA make the decision by FatAlb3rt · · Score: 1

      Why, yes I can.

      Educate yourself on u-g and then I'll answer your second question.

    63. Re:Let NASA make the decision by rhyno23 · · Score: 1

      I fully agree with you on needing some inspiration. I think our focus should not be in manned deep space travel until we find a place to travel to. Which would have to be benificial monetarily or spirtually. Which turns to what I prupose to do. We need to invest our efforts towards putting tellescopes and radioscopes on the moon. We currently have the technology to tell whether a planet could havfe life. Who knows maybe some one is try to talk to us but we aren't listening where we should be.

      It would be an excellent place to begin setting up a remote terminal back to earth. On the moon the advantages of mapping the stars far out ways those of doing it on earth. We currretnly have Hubble which has been a great program but it only gets to see a sliver at a time. And placing more on earth would be no good due to atmospheric interferance. I envission fields of antennas all transmitting data back to earth for us to proccess and then have some where some reason to go. Put your eyes and ears to the stars my brohters, they are our past, our present and our future.......
      cr

    64. Re:Let NASA make the decision by Moirke · · Score: 1

      I think you are giving the average person more than enough credit. Still, this is the agruement against democracy, but until someone develops a better method, NASA must beg for its money from average citizens.

    65. Re:Let NASA make the decision by Mr.+Frilly · · Score: 1

      Dude,

      I said "in the last 20 years". Please try to pay attention. Nothing on that list was developed due to work done on the Shuttle program in the last 20 years. Most of it comes directly from the Apollo program.

    66. Re:Let NASA make the decision by Dan+Crash · · Score: 1

      A cool concept, but the nations of the earth would be too fearful of weaponization to allow any one group the chance to control something like that.

      We don't have to do it alone. We could just as well lead a partnership of world space agencies to accomplish the same goal. I'd prefer this, actually.

      Aside from the ongoing dispute as to the feasibility of assembling a solar-panel whose total potential energy output will exceed that used to construct it.

      In the 1970s that might have been the case, but it's demonstrably false today. From an energy payback perspective, most panels reach their break-even point in a little over three years, some in as short as 6 months. Photovoltaic modules have been shown in the real world to produce up to 17 times more energy during their lifetime then used in their construction, and that number is increasing rapidly. More info here and here. (The first is a PDF.)

      You should also keep in mind that lunar solar power would be significantly more efficient than terrestrial solar power because the Moon simply receives much more intense sunlight than we do on Earth. You can read more about it in an article Criswell wrote for The Industrial Physicist.

      --
      He who refuses to do arithmetic is doomed to talk nonsense.
    67. Re:Let NASA make the decision by Minna+Kirai · · Score: 1

      We don't have to do it alone. We could just as well lead a partnership of world space agencies to accomplish the same goal. I'd prefer this, actually.

      Even if it were to be a multinational effort, a moonbase facility would be difficult to secure. Whichever nation has the most personnel on the moon can seize control at will. (Or whoever first decides to smuggle up weapons- which is possible for whoever runs the launches).

      A moonbase with longterm habitation and electrical power (eventually more than several traditional nuculear plants!) would be a potent platform to assault anyplace on earth. Yeah, Heinlein's gravity-well bombardment might not work. But modifying the microwave beam to a tighter focus or a different bandwidth- or flat out replacing it with a laser- you could start to scorch the planet.

      (Or at minimum, melt off the antennas of any opposing satellites)

      A military moonstation would make an entertaining element for speculative fiction. You can imagine paranoid dictators synchronizing themselves to a lunar cycle- refusing to go outdoors when the moon is in the sky.

    68. Re:Let NASA make the decision by Dan+Crash · · Score: 1

      Even if it were to be a multinational effort, a moonbase facility would be difficult to secure.

      Actually, a multinational presence would tend to reduce and stabilize any military tensions. Each nation would be a minority; no one nation would have enough members to "seize control". This dynamic would also serve to eliminate the "weaponization" scenario you mentioned, although of course, there would be a thousand more elements to assure security, too. These astronauts would be among the most monitored and controlled people in history.

      As instruments of the largest humanitarian project mankind has ever undertaken, they would also be some of the most admired. The risk is minimal, but the rewards are fantastic. At the very least, lunar solar power deserves high level investigation by NASA.

      --
      He who refuses to do arithmetic is doomed to talk nonsense.
  7. oops by johnty · · Score: 1
    spelt destruction wrong... killed it...

    oh well... it's /.

    --
    I am unique, just like you, and you, and you...
  8. Where? Forward. by Kethinov · · Score: 3, Interesting

    Exploring space and developing new ways of traveling through space is the only way we can ensure that the human race survives the coming centuries or millennia. Some day Earth is going to be devastated by a meteor. Some day our sun will run out of helium to burn and expand into a red giant, boiling away our oceans. If we have colonies in other solar systems, humanity will survive.

    The only reason space isn't the top priority of all of the governments of the world today is because we humans as a majority don't really seem to care what happens to our great great great great (and so on) grandchildren. We only care about the here and now. The folks and NASA and the folks in other space programs across the world may be the only ones who care about the future of humanity.

    We (the United States) need to stop wasting our money on our already most-powerful military for the purpose of revenge against the middle east and start backing NASA more. Start researching new ways to travel in space, and make a colony in Alpha Century a priority. If we really are the evolved species we claim to be, we'll start caring less about squabbles on this blue marble and more about exploring the universe in which we live.

    But again, that's just my 2 cents (and a paper clip)

    --
    You're right, I wouldn't steal a car. But if it were possible, I sure as hell would download one!
    1. Re:Where? Forward. by Anonymous Coward · · Score: 2, Funny
      If we really are the evolved species we claim to be, we'll start caring less about squabbles on this blue marble and more about exploring the universe in which we live.
      Speak for yourself, buddy. I'm a creationist.
    2. Re:Where? Forward. by wing.app · · Score: 1

      actually, the sun converts hydrogen into helium. When all of the hydrogen in the sun has been converted, the sun tries to burn off of the helium, therefore inflating it into a red giant.

    3. Re:Where? Forward. by primenerd · · Score: 1

      1. The sun uses hydrogen as fuel. When the helium ignites, the sun will expand outward and cook Earth.

      2. We should confirm that there are, in fact, planets orbiting one of the stars in the Alpha Centauri group. Just because a cool strategy game postulates a planet (xenofungus!) does not mean one is there. It would suck for an astronaut to wake up after 100 years of cryosleep to find no planets (but he/she could at least get a multi-sun tan). I suggest we start with Mars.

      3. Revenge against the middle east?
      In the age of terrorism...
      Oderint, dum metuant.

      As for the future of the space program.
      Per ardua ad astra.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    4. Re:Where? Forward. by Eskarel · · Score: 1

      Is the survivial of the human race necessarily a good or necessary thing? Not to appear cynical or give the impression that I'm an environmentalist or some sort of hippie, but given that we started with what I have been lead to believe was once quite a nice planet, and have spend the last few millenia turning it into a somewhat less nice planet and an ever increasing rate(which I am as responsible as the next human), it's quite possible that we as a species aren't quite ready to play with other planets.I suppose in any even that we'll see what happens. I think that building a new space shuttle is probably a good idea, and that it might be good to design it in terms of longterm goals rather than being the cheapest thing available or some such. At the very least(even if this had nothing to do with tiles being lost before it took off), it would be a good idea to have the facilities/wherewithall to make repairs on the shuttle in space so that people who went up in it weren't pretty much doomed if things went wrong.

    5. Re:Where? Forward. by einer · · Score: 1

      The folks and NASA and the folks in other space programs across the world may be the only ones who care about the future of humanity.

      I'm sure the folks at the mayo clinic and in other medical programs across the world would disagree. It seems to me that there is a LONG list of priorities that need to be addressed before we start imposing our Manifest Destiny on the rest of the universe.

      Start researching new ways to travel in space, and make a colony in Alpha Century a priority.

      No one knows if habitable planets even exist around Alpha Centauri. Maybe we should wait for some confirmation before we evacuate the planet. The sun will be around for a few billion more years. And really, there isn't much anyone can do about a meteor. In my book, that's God's way of saying "Your number's up pal."

    6. Re:Where? Forward. by doubtless · · Score: 1

      Exploring space and developing new ways of traveling through space is the only way we can ensure that the human race survives the coming centuries or millennia. Some day Earth is going to be devastated by a meteor. Some day our sun will run out of helium to burn and expand into a red giant, boiling away our oceans. If we have colonies in other solar systems, humanity will survive.

      I am not so sure we will even survive that long considering the rate at which we are using the planet in such a non sustainable way. Most species would not survive more than a couple dozen million years. Modern human is a very young species, merely some 100 thousand years old (from the last mitochondrial eve). It remains to be seen if we can be mature enough to 'evolve' into a sustainable way of life.

      --
      geek page at KY speaks
    7. Re:Where? Forward. by Galvatron · · Score: 1
      Start researching new ways to travel in space, and make a colony in Alpha Century a priority.

      Assuming you mean Alpha Centauri, I think someone's been playing a little too much Civilization. I don't think there's any reason to believe that Alpha Centauri even has habitable planets. Most likely, we'd get there and realize that Mars, aside from being closer, is an all around more hospitable environment. Seriously, I'm curious, where did your idea that we must get to Alpha Centauri come from?

      --
      "The question of whether a computer can think is no more interesting than that of whether a submarine can swim" -EWD
    8. Re:Where? Forward. by Kethinov · · Score: 1

      Seriously, I'm curious, where did your idea that we must get to Alpha Centauri come from?

      Being the closest solar system to our's, (1 to 2 light years or something.. not sure) it is the next step in space exploration beyond our own solar system. I read somewhere, I don't remember where, that there is supposedly something big (planet sized) orbiting the sun in the "Goldilox Zone" which is the area far enough away from the sun, but close enough as well to have a planet able to support human life.

      Now, I could have been reading some BS, but the chances of us being the only intellegent life in this galaxy are pretty damn slim and I think there are things out there that we should see.

      Also, I never said anything about a colony on a human life-supporting planet. We could colonize a rocky moon of some random planet in that solar system just as easily as we could colonize the moon. The point is, the technology is there, but the initiative is not.

      --
      You're right, I wouldn't steal a car. But if it were possible, I sure as hell would download one!
    9. Re:Where? Forward. by Galvatron · · Score: 1
      4.22 light years if you're talking about Proxima, or 4.3 for Alpha Centari A and B. Probably the latter, because Proxima is very dim. I did a quick look, and couldn't find anything about planets around Alpha Centauri, but even if one has been discovered, it's almost certainly Jupiter sized or larger, which makes it unlikely to be inhabitable.

      Any potential colony that we would try to establish outside the solar system would have to be self sufficient. It costs millions to get into orbit. It would cost billions, even trillions, to try to get even a single ship to Alpha Centauri, so a constant supply of ships with food and water sent after the colonists is simply not an option. On top of that, we'd have to send decades worth of supplies along with them. If any parts that they needed broke, it'd be decades more to get a replacement. No, for the forseeable future, no extrasolar colonies could be established that would require any kind of ongoing support from Earth. I'm sorry to have to contradict your point, but initiative or not, the technology is very, very far from being there.

      --
      "The question of whether a computer can think is no more interesting than that of whether a submarine can swim" -EWD
    10. Re:Where? Forward. by Dingel · · Score: 1

      I think your post probably proves that humanity is not yet worthy of colonizing other planets or systems. What makes our species so great that its continued existence is such a valuable goal?

      --
      ---- Live for Music. Die for Trance.
    11. Re:Where? Forward. by kauttapiste · · Score: 1

      The only reason space isn't the top priority of all of the governments of the world today is because we humans as a majority don't really seem to care what happens to our great great great great (and so on) grandchildren.

      Well talking about caring for our planet's future and the future of our grandchildren, other governments are caring a lot more than the USA. This is a bit of a flame here, but I really think that the cause justifies it. To survive the coming decades (in a society as we know it) and hopefully keep the wheels of progress turning, we really need to care more about the environment. At the same time that America is heading East to fill their bottomless petrol tanks, we should concentrate on developing (and using) environmentally friendly energy sources. If a percent or two would be cut from every country's mil-budget and put to building solar plants and developing more efficient solar cells and putting emphasis on moving from oil-driven society to solar power/wind power/what-not power driven economy, we would be a lot happier in 10 to 20 years. Instead more money is spent to make killing more efficient and securing the destruction of this Planet by burning more and more oil (which by the way has been happy for some millions of years just where is is) and eventually bringing the world on its knees. I don't want that.

      Yeah, it's a bit off-topic..

  9. Next gen vehicles by crumbz · · Score: 4, Insightful

    If the Pentagon can spend $200B on the next generation jet fighter, surely the U.S. can spend and additional $20B over the next ten years doing the R&D and prototyping our next spaceplane. Oh wait, we have to build a missle shield first....

    1. Re:Next gen vehicles by the_2nd_coming · · Score: 1

      the X-30 space plane is the proof of concept for all the tech needed for a maned space plane....we will have a working machine in about 5 years.

      --



      I am the Alpha and the Omega-3
    2. Re:Next gen vehicles by loraksus · · Score: 1

      optimistic, aren't you?

      I really don't want to sound like an asshole, and I have nothing but support for the space program - but I think realistically budgets are going to get slashed in the next little while and nasa isn't going to fare too well. I think the most important question is whether the aerospace companies will take the incentive to continue projects that have little chance of getting funding in the forseeable future.

      --
      1q2w3e4r5t6y7u8i9o0pqawsedrftgthyjukilo;p'azsxdcfv gbhnjmk,l.;/
    3. Re:Next gen vehicles by Moofie · · Score: 4, Informative

      Uh, no. Nobody's figured out how to keep a scramjet lit. The Australians did it for about six seconds, which is a record for a free-flying vehicle.

      Last semester my classmates and I wrote a draft for the AIAA design paper competition for a reusable, air breathing single stage to orbit "rocket" plane.

      Bottom line? Unless we get a lot better fuels, or radically lighter structures, it's not going to work. That's even assuming that you can keep the scramjet lit. (which would get you a PhD, if not a Nobel prize)

      X-30 is not the way. Venture Star was much closer. A shuttle-oid with Boeing's fly-back boosters might be a really good short term solution.

      --
      Why yes, I AM a rocket scientist!
    4. Re:Next gen vehicles by the_2nd_coming · · Score: 1

      the working prototype has been developed and they have already commited to building it...5 years should be just about right for the first of 5...it is beiong developed by corperations in conjunction with NASA as a contributor...the space plane has duel abilitis..it can be used not only as a ground to orbit vehical but a ground to ground sub-orbital vehical...we will be able to get to australia in less than an hour and a half in flight. civilian flight companies will want to buy these as well as NASA...that is why this will be a reality sooner rather than later.

      --



      I am the Alpha and the Omega-3
    5. Re:Next gen vehicles by the_2nd_coming · · Score: 1

      who said anything about a scramjet? to get to orbit from the ground we will not need a scramjet we can use regular propultion to get to a max altitude then ignight the rocket enguine that will take us into orbit...a scramjet would be good for rentry as it would give us the power needed to have actual flight control and power.

      --



      I am the Alpha and the Omega-3
    6. Re:Next gen vehicles by Moofie · · Score: 3, Interesting

      You did, when you mentioned the X-30 NASP, which is powered by a scramjet.

      Your proposal to use "regular propulsion" to get to a max altitude has some merit, but not the way you think it does. A big, fast airplane powered by low-bypass turbofans or turbo-ramjets might be a good platform to launch a light rocket ship from, but it would take a lot of engineering to figure out if that would be more cost effective than using a small spaceplane (powered by rockets exclusively: Air breathing single stage rocketry is, I believe, not viable) coupled with a large semi-reusable heavy launch system.

      And what the heck do you need flight control and power for on reentry? Just pick your de-orbit point to land wherever you want. The last thing you need when coming down from space is more speed, so an engine is totally useless. The ideal spacecraft gets into orbit with only enough fuel to maneuver and de-orbit. Any excess fuel is a colossal waste because of the equations that govern orbital insertion.

      --
      Why yes, I AM a rocket scientist!
    7. Re:Next gen vehicles by the_2nd_coming · · Score: 1

      hmmm...good point.

      what is the theory of the scram jet? you get enough speed through conventional rockets and at the critical speed the scramjet kicks in? isn't there a problem of the lack of enough oxygen at the point where you would want it? and where there is enough power for it, you run into friction problems?

      what about a nuclear powered plasma system? it works in space (theoreticly) would it not work in the atmosphear?

      --



      I am the Alpha and the Omega-3
    8. Re:Next gen vehicles by Moofie · · Score: 4, Informative

      It gets a little hairier than that. : )

      A scramjet is a Supersonic Combusting Ramjet. Let's back up a step. A ramjet is an engine that uses shock waves, instead of fan-shaped compressors, to compress the air to mix with your jet fuel. If you don't grok why you need to compress air, go thou and Google search for a description of turbojets or any other internal combustion engine. This is going to be a long enough post as it is. : )

      As the ramjet passes air through the shock wave system in its inlet, the air a) heats up and b) slows down. The speed of sound increases with temperature, and the speed of the gas goes down (from the Mach 3 to Mach 6 where ramjets can typically be operated). At some point, the air is actually subsonic. At that point, fuel is introduced and ignited. Hot air go out back of motor, airplane go forward.

      Scramjet is basically the same idea, except without the slowing the air down to subsonic part. The entire combustion process happens in a supersonic airflow. While the physics of "low speed" combustion are pretty well understood, doing the same thing in a high speed flow is seriously non-trivial. In the paper we wrote, we adopted a technology called a "hyper-mixing injector" to dump fuel into the stream, and we actually let the high temperature air ignite the fuel all by itself. Keeping that fire going is, well, hard. Stick a Zippo out your sunroof. You get the idea.

      Scramjets are way tricky. If you don't manage the airflow very precisely by varying the geometry of the intake section and not maneuvering the aircraft EVER, you might get a condition called an "unstart". Basically, all the nice shock waves you've been using to compress your gas glom together into a big strong shock wave perpendicular to the gas flow directon in your inlet, and basically at that point the temperature and pressure in your combustion chamber go from really really improbably high (which is good, and you've designed for that) to freakin' nutty crazy blow-up-spaceship now high, and you start collecting pieces of the thing across three states.

      See recent Columbia accident for a much less violent example of what would happen. It would be far worse.

      Scramjets are scary. Yeah, they might work, but they're REALLY finicky, and I don't believe our flight control systems are sufficiently advanced to fly them reliably and safely.

      And forget about having a guy driving the plane. If you pitch the nose a few degrees off the trajectory, or roll the airplane at all, the shock system will change formation, and very likely you won't even know what hit you. No way to do it without computer control end-to-end.

      You might have observed that the low speed for a ramjet is Mach 3. In order to have the shock waves in the inlet, you already have to be going really fast. You might be interested to know that the SR-71 used a partial ramjet cycle at its Mach 3 cruise condition. It also had a turbojet engine core to accelerate it to ramjet operating speeds.

      Nuclear powered plasma would work great in an atmosphere...if you don't mind dumping a very highly radioactive plume all over Florida.

      Actually, even though the specific impulse of the nuclear rockets is really good (specific impulse is a good measure of the fuel efficiency of a rocket. It tells you the number of pounds of thrust you get per pound of fuel) the peak thrust values are not very high. In other words, it'll be a good interplanetary drive, but really not ideal for launch systems (bad environmental issues aside).

      --
      Why yes, I AM a rocket scientist!
    9. Re:Next gen vehicles by Christopher+Thomas · · Score: 3, Insightful

      what is the theory of the scram jet? you get enough speed through conventional rockets and at the critical speed the scramjet kicks in? isn't there a problem of the lack of enough oxygen at the point where you would want it? and where there is enough power for it, you run into friction problems?

      A scramjet is a ramjet that works above about Mach 5 (it's a ramjet with Supersonic Combustion; hence, the name). You use it _instead_ of a rocket for as much of your early launch as you can, because three quarters of the weight of rocket fuel is oxidizer. If you can get oxygen from the atmosphere instead, your specific impulse goes up by a very large amount (so you need less fuel per unit craft weight).

      As Moofie pointed out, though, nobody's been able to build one that works (yet).

      Friction is a problem, but it's a manageable one. If you can survive dropping back down into the atmosphere at orbital speeds, you can survive friction on the way out. It just slows you down (i.e. above a certain speed, drag will equal scramjet thrust, and further air-breathing boosting doesn't help you).

      To recap, the benefit of doing any of this is to use air as the oxidizer instead of carrying oxygen with you. Altitude isn't the issue (from orbital height you'll still fall like a rock if you aren't moving very, very fast *sideways*).

      what about a nuclear powered plasma system? it works in space (theoreticly) would it not work in the atmosphear?

      All electric propulsion drives studied to date (ion, and many plasma variants) have thrust far, far too low to use for launch. They're designed to work at moderate power and very low thrust for a very long time. Specific impulse is great (lots of delta-v for a small amount of mass), but thrust isn't (thousandths of a gravity).

      Other nuclear drives have been investigated for launch, but they have problems, and are very messy. NERVA style drives - where you feed gas through a reactor core to heat it instead of forming hot gas by burning fuel - work, but because of temperature limits specific impulse is at best about twice that of chemical fuels. You also have to lug a lot of very heavy shielding and other reactor material, so the effectiveness for launch starts looking questionable. You're *also* spraying radioactive crud out behind you, because the flowing gas is hot enough to etch the reactor away over time.

      In space, NERVA drives are a bit more practical, but you're better off using the nuclear plant to power an electric drive (better specific impulse).

      The other ground-to-orbit scheme proposed for launch was to detonate fission bombs beneath the craft and let the shock wave drag you along, but a) minimum craft size is _large_, and b) this is messy enough to not have a prayer of being used.

      In short, nuclear drives won't be useful for ground-to-orbit in the forseeable future. Wait a century, and we'll have a space elevator. Until then, chemical will be good enough (and very good if we get scramjets working).

    10. Re:Next gen vehicles by Moofie · · Score: 1

      If you wrote a thesis about a successful scramjet system, everybody would think you're a badass.

      I promise, you'll spend a hell of a lot more time making the 'jet work than writing the paper.

      But you feel free to be needlessly combative. Have fun.

      --
      Why yes, I AM a rocket scientist!
    11. Re:Next gen vehicles by WolfWithoutAClause · · Score: 1
      Actually the Australians say that keeping the scramjet lit is fairly trivial- by the time the air has been compressed by the inlet, the temperature is so high it lights the hydrogen with no problem.

      The true problem is stopping the whole lot flipping lot melting; and that's hard.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    12. Re:Next gen vehicles by the_2nd_coming · · Score: 1

      what is the mach level needed to reach orbit? could the SR-71 which I know could fly realy realy high be used as a base platform and when you get it to ram-jet speed use that and when the ramjet is spent turn on the rockt? say a newer light weight high output rocket. being so far off the earth's surface and in such a lowdensity atmosphear, getting to orbit would require less extra thrust....it would probably take about an hour to get to space in such a setup but that is what it is all about...same amount of force over a longer period of time makes it easier to get there.

      --



      I am the Alpha and the Omega-3
    13. Re:Next gen vehicles by Moofie · · Score: 1

      On short timescales and when you're not maneuvering, you're right. But, when you're trying to fly a trajectory, the changing environment in the combustion chamber makes it very difficult to keep the flame ignited. And having it not ignite is a very very very bad thing.

      And yes, aerodynamic heating even for a "low speed" scramjet is a silly big problem. Now we just need to figure out how to deal with five times as much as we accelerate to Mach 25 for orbital insertion. Easy. : )

      --
      Why yes, I AM a rocket scientist!
    14. Re:Next gen vehicles by Moofie · · Score: 4, Informative

      Orbital insertion? Equivalent speed is Mach 25. (of course, in orbit, there is no speed of sound, so Mach numbers don't apply, but for purposes of this discussion...)

      SR-71? Mach 3. Teeny payload. However, the design we worked out used upgraded J-58 engine cores from the SR-71 to get up to scramjet operating speeds. And yes, having to fly for a long time while you accelerate is a big problem. You're burning just incredible amounts of fuel the whole time, and burning fuel to accelerate the fuel you need to burn to accelerate fuel that you need to burn to accelerate. Ad nauseam.

      The other problem with air breathing rocketry is wave drag. In order to get the same thrust as a rocket, an airbreathing space craft's cross-sectional area has to be about 1.5 to 4 times as large as the rocket is to ingest enough air. Since wave drag (the primary drag force at high speeds) is very strongly dependant on cross sectional area, you swiftly get to a point of diminishing returns. Let's make up some numbers.

      Rocket A thrusts at 100lbs, and weighs 10 lbs, and has (say) 10lbs of drag acting on it. That gives it an excess thrust of 80lbs to do the force=mass*acceleration thing.

      Scramjet B thrusts at 100lbs, flys mostly horizontally so its weight isn't a factor (it's a lifting body), but has (say) 80lbs of drag on the airframe. So it only has a quarter of the thrust available to accelerate as our rocket, meaning it will take much longer to get to orbital insertion velocity.

      In a nutshell, that is the problem with air breathing rocketry.

      --
      Why yes, I AM a rocket scientist!
    15. Re:Next gen vehicles by ender81b · · Score: 1

      Absolute gem of a thread. Thanks for explaining how scramjets work and the inherent difficulties involved in them. While I had kindof understood (theoratically) how they worked none of the papers ever really mentioned the downsides... funny that. Heh.

    16. Re:Next gen vehicles by Moofie · · Score: 1

      Damn, I love it when my education comes in handy. Makes me almost forget how much debt I'm carrying. : )

      --
      Why yes, I AM a rocket scientist!
    17. Re:Next gen vehicles by XO · · Score: 1

      what is this "scramjet"? not familiar, would appreciate some linkages. sounds interesting.

      --
      "Champagne for my real friends - and real pain for my sham friends!" http://ericblade.postalboard.com/
    18. Re:Next gen vehicles by PD · · Score: 1

      Out of curiosity, do you know of anyone using genetic algorithms to develop scramjets? Has that approach worked or been a dead end?

      And how accurate are the computer simulations for testing? I can imagine that having a beowulf the size of the Titanic would be a great help, but that won't help much if the simulation isn't accurate.

      You seem to know what you're talking about, so that's why I ask you.

    19. Re:Next gen vehicles by Moofie · · Score: 1

      Sweet! I get to cite myself! I've posted this in another thread. Should give you a grounding. Here I explain the problem with air breathing rocketry, namely the fact that you have to make the ship big and draggy in order to ingest enough air.

      Man, I've been posting the CRAP out of this story...and it's all because of last semester's classwork. Almost makes me feel they're useful. : )

      --
      Why yes, I AM a rocket scientist!
    20. Re:Next gen vehicles by Moofie · · Score: 1

      I'm glad I sound like I know what I'm talking about. One thing I've learned, is that I definitely don't know what I'm talking about. But it's useful to be able to generate a convincing simulacrum of competence. : )

      No, I don't know beans about genetic algorithms in general, or their relation to hypersonics. Would you use them for modeling the flow, or designing the shape of the engine itself?

      I'd be interested in checking out the basics if you have a link handy.

      --
      Why yes, I AM a rocket scientist!
    21. Re:Next gen vehicles by Moofie · · Score: 1

      I don't pretend that my knowledge is comprehensive, but all the nuclear rocket proposals I've seen that look even remotely feasible involve dumping a working fluid through a hot pile. And that working fluid is now radioactive.

      Just as an aside, I'm not one of those nutbags that thinks that radioisotope generators are nuclear disasters waiting to happen. I like nuclear power. Just not when I have to breathe its byproducts.

      At any rate, I've never heard of a nuke rocket used as a launch system (unless you're talking about Project Orion, and if you are, you're a loony). They'll be good interplanetary drives, but they don't have the thrust for liftoff.

      If there is another system out there, I'd be interested to check it out. I'd appreciate a link if you've got one.

      --
      Why yes, I AM a rocket scientist!
    22. Re:Next gen vehicles by tony_gardner · · Score: 1

      I'm also working in the field.

      Wave drag is a problem with hypersonic vehicles, which is why you tailor your intake and exhaust to each other. See the Busemann biplane for the classic example (Google is your friend!).

      Viscous drag make up about half the drag of current designs, and most of this is in the combustion chamber. This is because the air is compressed in the combustion chamber, and drag is proportional to density. Therefore, viscous drag and peak heating loads can be reduced by reducing the compression ratio in the intake.

      A more accurate example of the idea of a scramjet using your numbers would be:

      Rocket A thrusts at 100lbs, weighs 10 lbs, and has a payload of 2 oz.

      Scramjet B thrusts at 100lbs, weighs 1 lb, and has a payload of 2oz. The thrust is only 1/5, but the total mass is 1/10, so it accelerates the payload twice as fast.

      Unfortunately, nobody has demonstrated any net thrust in a scramjet in net flight, or in flight conditions in a wind tunnel (as far as I'm aware), so the net thrust of scramjet B is actually zero, which makes the whole point moot at the present time.

    23. Re:Next gen vehicles by PD · · Score: 1

      They would design the shape of the engine. They are good for optimization problems. They are famous for being used for elevator control program design, turbine blade design, and other things like that.

      There's zillions of good links, Google is your friend.

      The reason that I asked about the accuracy of the simulations is that a genetic algorithm needs a selection mechanism. You have to be able to model the airflow and combustion accurately to discriminate finely between competing models in a population.

      It could be useful to you. Maybe not though. I even more definitely don't know what I'm talking about.

    24. Re:Next gen vehicles by Greeneland · · Score: 1

      I think perhaps an efficient idea for space access is to use a simpler vehicle for manned launches and a standard type rocket to lift cargo. Launching the manned craft could be done with a multi-stage approach, like using a jet aircraft (even a specially designed one) to bring the craft up to high altitude and then igniting the rocket engine. Now, descent is another story. I have some ideas about that. The most interesting one, would be to use some sort of magnetic field to shield the craft from the atmosphere. Like a reverse of the magnetic solar sail concept. Magneto-plasma dynamic drives don't seem to have gotten very far, but perhaps Magneto-plasma dynamic "brakes" could.

    25. Re:Next gen vehicles by tony_gardner · · Score: 1

      "Nobody's figured out how to keep a scramjet lit.."

      Think about this: That Australian free flight experiment was building on 15 years on research in Australia, and they launched it because they were 100% sure that they knew how to keep a scramjet lit in a ground test.

      There are atr least 4 commom methods which you can find in the literature. Cavity, step, shock induced combustion, high temp homogenous flow. and that's just off the top of my head.

      You can forget about getting a Nobel prize for a better cigarette lighter.

    26. Re:Next gen vehicles by tony_gardner · · Score: 2, Insightful

      If a scramjet has the shock pushed out the front, most designs simply spill the shock so that the pressure in the combustion chamber is the stagnation pressure of the flow, plus the additional pressure due to the equilibrium reaction of the fuel. You can design for this.

      Scramjets have been designed which will take pitch/yaw of +-4 degrees. That doesn't sound like much, but remember that you're going pretty danm fast.

      Nuclear rockets work by superheating steam. It's not radioactive. The problem is when a nuclear rocket explodes.

    27. Re:Next gen vehicles by tony_gardner · · Score: 1

      Are all the real rocket scientists just incompetant morons. Are the designers of the Space shuttle, CRV and Soyuz just idiots that they're attaching all this useless flight control and power stuff on re-entry?

    28. Re:Next gen vehicles by hcdejong · · Score: 1

      If you had flight control and power for reentry, you wouldn't have to rely on (potentially hazardous) atmospheric braking so much, making the design (and application) of the heat shielding simpler. IDK if those benefits would outweigh the extra cost in bringing up all that weight. Probably not, in view of current designs. Oh well...

    29. Re:Next gen vehicles by Moofie · · Score: 1

      All those concepts work well in wind tunnels, but have not proven themselves in long-duration flight. Yes, my rhetoric was perhaps running away with me, but the stability of the combustion system is still a huge issue with scram propulsion. I guess that would have been a better way to say it.

      --
      Why yes, I AM a rocket scientist!
    30. Re:Next gen vehicles by Moofie · · Score: 1

      Alright, alright, you got me. Again with the late-night rhetoric. My bad.

      Yes, you need flight controls and electricity. You do NOT need an engine.

      I stand corrected.

      --
      Why yes, I AM a rocket scientist!
    31. Re:Next gen vehicles by Moofie · · Score: 1

      Flight controls, yes. But power? You've got all the speed you could possibly want...engines are not helpful.

      Aerobraking is the simplest, lightest, most cost-effective way of returning to any planet with an atmosphere. Yes, it proved fatal to the Columbia astronauts, but I still believe it's the right solution.

      --
      Why yes, I AM a rocket scientist!
    32. Re:Next gen vehicles by ckaminski · · Score: 1

      The reason you want power on reentry is the ability to select another landing site in the event of bad weather or terrorist act or (Gods forbid) another plane crashed on you 10 minutes before you're scheduled to land, and the runway is wrecked.

      If the weather is bad in Florida, why can't you bleed off some extra speed and reroute to Atlanta instead? Granted, you don't want a LOT of extra fuel, but having enough to let you pick one or two extra air-ports is worth it. Particularly if you can get the rollout distance for landing under 6000 feet.

      Hell, if you want to do SSTO with relatively common fuels, you'll want this capability. There's nothing like being able to take off in New York, land in Hong Kong because the air over Taiwan got REALLY nasty, and then take off again to get back to New York.

      Oh we are so far away from this, it makes me sad...

      -Chris

    33. Re:Next gen vehicles by Moofie · · Score: 1

      If the weather is bad in Florida, you know that it's bad half an hour before you land when you do your de-orbit burn. Once you're in orbit, you're pretty much the same distance to anywhere. Why would you want to try to maneuver on your descent phase? Carrying a propulsion system to be used on descent is hideously expensive in terms of launch fuel to prepare for somebody changing their mind on where they want to land.

      And as far as SSTO, I don't believe it is the right way to go. Staged rocketry works good for a reason, and that reason is rooted deeply in the mathematics of orbital insertion. I don't care how good your design is, you're not going to be able to service an SSTO ship on a runway by throwing some more gas in it.

      Well, you could, but there's no way I'd get on board.

      --
      Why yes, I AM a rocket scientist!
    34. Re:Next gen vehicles by Tackhead · · Score: 1
      > the X-30 space plane is the proof of concept for all the tech needed for a maned space plane....we will have a working machine in about 5 years.

      No you won't. In 5 years, the X-30 will have been cancelled to free up the budget to build a replacement Shuttle.

      There's no market for 100 launches a year. Any technology that would cost less than Shuttle, means less dollars for the Congressional districts that hold the contractors who get the NASA p0rk. Therefore, any tech that would lower the cost of orbit and/or make the Shuttle pork obsolete, will be cancelled before it becomes a threat. Bank on it.

    35. Re:Next gen vehicles by tony_gardner · · Score: 1

      Look, That's what wind tunnels are _for_. If something you do in a wind tunnel is not the same as in free flight, then the wind tunnel tests are worthless.

      A typical time constant for hydrogen scramjet engines is 100 microseconds. That is to say, that if your test time is longer than that, say a few milliseconds, then you have long-duration flight.

      You're right to say that the stability of the combustion system is a problem in scramjets, but it's not as big a discovery as you'd think. Since the combustion system is the scramjet (There is effectively nothing else in a scramjet) then saying that there's a problem with the stability of the combustion system is not isolating your problem.

      Ignition is no problem. Fuel mixing is a problem. Intakes are a problem. Boundary layer separation is a problem. Stable operation at high equivalence ratios is a problem. Heat transfer in the combustion chanber is a problem.

      See what I'm getting at?

  10. Simplify.... by digitalamish · · Score: 5, Interesting

    The Russians were able to keep a space station in orbit for years, while only using 'capsule' technology. Until we get a new generation of reusable spaceship going, let's go back to that. It was good enough to get us to the moon and back 30+ years ago. Imagine what they could do now. Safer, cheaper, etc.
    --
    Bless the crews of the Columbia and Challenger. From your sacrifices will come greatness.

    1. Re:Simplify.... by Bicoid · · Score: 1

      The problem with capsules is you can't bring a lot of equipment with you. If you're doing science over an extended period of time, especially if you're working with biology as they are doing on the ISS, you need the capacity to bring that up. Space shuttle has that. Capsules don't.

      --
      If not all sentients are human, couldn't it be possible that not all humans are sentient either?
    2. Re:Simplify.... by dschl · · Score: 1

      There is a difference between a capsule and a rocket. An expendable rocket is only a delivery system. A capsule is what an astronaut rides in on an expendable rocket. Skylab and Mir were launched on rockets, and they were a lot more useful than the ISS. Commerical satellites are launched on rockets. Saturn V reportedly had a payload of 120 tons, which is about 6 shuttle launches. Of course, if you want to launch a single object weighing 30 tons or 80 tons, the shuttle is absolutely useless.

      One problem with shuttle is that it costs a lot more to operate than a rocket per ton of mass into orbit. The design was a poor compromise, with conflicting goals. Reusable launch vehicles appear to have some advantages over rockets, unfortunately, the shuttle shares few of these advantages. There are lots of people who appear more knowledgable than I do on this topic, such as, oh, say, Jerry Pournelle. Do a google search for others.

      --
      Slashdot - the place where you can look like a genius by restating the obvious
    3. Re:Simplify.... by Ancil · · Score: 1

      Better yet. Why not just pay the Russians to do it? At $10 million a head, they're a bargain. You could take 100 people to the ISS and back for the cost of one Space Shuttle disaster I MEAN launch.

    4. Re:Simplify.... by zurab · · Score: 1

      The Russians were able to keep a space station in orbit for years, while only using 'capsule' technology. Until we get a new generation of reusable spaceship going, let's go back to that. It was good enough to get us to the moon and back 30+ years ago. Imagine what they could do now. Safer, cheaper, etc.

      You actually hit on a very interesting point. As far as the reusable Shuttle Program was designed to make space travel more common and more efficient, I don't know (1) what was the end purpose of this, and (2) how well it achieved this efficiency.

      Some would argue that during 60s when Apollo program was being developed, it had a clear purpose of putting manned mission on the Moon. That mission was achieved, and very successfully at that, U.S. seemed to slam the Soviets back with "Aha! Take that!" answer to Soviets' first man in orbit.

      After that, it is my opinion, that NASA had a general lack of guidance towards such a specific goal as before. The Shuttle Program was being developed during 70s. Since the U.S. didn't at that time have or plan to operate a space station, why was there such a need to take extensive cargo and operate regularly in the orbit? Some would argue that, this happening during the heat of cold war, it was going to be used to easily lift heavier cargo into space, possibly with defense and military implications. Hence, Soviet response to the Shuttle Program was the development of their own reusable vehicles in the same period.

      A very interesting website describing this program, its achievements and failures is located here. Buran was the name of the first of several vehicles Soviets planned to make and operate. It was designed to take more cargo, more people into space, and operate in conjunction with the Mir space station, and future Mir2. They did manage to make and test Buran with the test flight in the orbit in 1988 before the cash-strapped program was cancelled in 1993; in addition, of course, to the break-up of the USSR and other major political events at that time.

      The interesting part are the differences between the U.S. Shuttles and Buran:

      - Buran is taken to space by the heavy lift system "Energyia", able to lift more weight into orbit than any existing system;
      - Buran does not have the main engine, like Shuttles. The main engine is part of Energyia system; this provides for a safer design while allowing the vehicle to lift more into space;
      - Energyia uses 4 (I believe) liquid rocket boosters, rather than NASA's solid rocket boosters, also providing for a safer method;
      - Most of Energyia system, other than the main tank (I believe), is reusable;
      - Buran is totally automatic, including re-entry and landing are controlled from the ground.

      In fact, Buran's only test flight in 1988, even in NASA's words, demonstrated much promise. The unmanned orbit flight, return and landing were a success. They say there were 5 tiles missing, but there were actually 6 missing on Buran. Russia can not operate Buran after its funding problems. They have stuck with Soyuz capsules.

      This raises some questions as well as opportunities. First questions:

      - Since both Shuttle Program and Buran(s) were designed during cold war for (at least) partly military purposes, are they still the best way to operate orbital flights and research?
      - Many argue Shuttles have an undefined purpose within the space program. What are space program's mid and long term goals?
      - Does ISS, or any such multi-national alliance provide NASA the tools with which it can achieve its goals?

      Depending on the answers above, I am wondering if it could be a possibility, at least in the short to mid-term to revive the Buran program and/or to use the heavy lift system like Energyia as a transition to a newer, safer, more efficient, and more reliable spacecraft like NASA has planned for future.

    5. Re:Simplify.... by mperrin · · Score: 1
      Until we get a new generation of reusable spaceship going, let's go back to that.

      The problem is, where do you expect that next generation of reusable spacecraft to come from? If you spend all your money developing a single-use capsule system, that leaves no funding left for developing the next generation. (And it would require developing the capsules, essentially from scratch. All of the Apollo toolsets are long since destroyed, the workers retired or deceased, and the vast majority of the components are no longer available. You can't go back to Apollo)

      You can't go forward by going backward.

    6. Re:Simplify.... by Greeneland · · Score: 1

      There are documents on the nasa site (somewhere) that mentioned that towards the end of the Saturn V program they estimated the launch capacity to be closer to 140 tons. 120 or 140 is equally impressive.

    7. Re:Simplify.... by hcdejong · · Score: 1

      Energia may originally have been planned as a reusable launcher, but by the time the design was finished, reuse was no longer a feature.

    8. Re:Simplify.... by hcdejong · · Score: 1

      Buran may be an interesting design, but by the time the program collapsed it cost even more than the Shuttle.

    9. Re:Simplify.... by gorilla · · Score: 1

      The ATV being built by ESA to restock the ISS can carry 9 tonnes of stuff. That's plenty of supplies.

    10. Re:Simplify.... by gorilla · · Score: 1
      how well it achieved this efficiency

      Very badly. The shuttle isn't really a reusable craft, it's a refurbishable craft. After each flight it's torn down and rebuilt.

    11. Re:Simplify.... by gorilla · · Score: 1

      You can if you're going in the wrong direction. Reusabilty is a mistake. It costs more money in the design phase. It costs more money in the build phase. It costs more money in the launch phase. It also forces you to design a system with less safety than the disposible systems.

    12. Re:Simplify.... by ckaminski · · Score: 1

      A couple good points. If we're not going to do SSTO, then you want to decouple the orbiter from the launcher. In the case of Energiya, you could strap (eventually, if the program had been completed) 8 auxiliary boosters onto the main rocket stack to theoretically launch 200 tons into LEO. Put a small 20ton cargo into a nose fairing and put it in a geostationary orbit (I'm clueless, but I imagine that would have been possible). Now take off two of the boosters, and mount the orbiter stack with 60 tons of experiments in it, or mount a cargo container with 110-140 tons of construction materiel. A flexible launch system, that can be incrementally improved (better engines on the boosters?) without having to redesign the entire stack.

      NASA sort of got it right. But the engines shouldn't have been in the orbiter. I seem to recall that the entire reason they were, was a future requirement for reboost capability in order to evade orbital based missiles.

      -Chris

    13. Re:Simplify.... by ckaminski · · Score: 1

      If that were true, we'd be throwing planes away after every flight. Let's face it, if you continue to throw away space vehicles, space travel will never get cheap. What we need is a comprehensive program for building a cheap spacecraft over 3-4 generations.

      If we designed a program like so:

      1. No cargo. This craft carries only humans. It's a two stage to orbit craft, sort of like Energiya/Buran|shuttle/SSME+tanks. In the initial phase, only the orbiter is 100% reusable. Goal to remate the orbiter to a new launch stage within 3-4 days, and put it back in orbit within 7.
      2. Develop reusable launcher stack.
      3. Scale launcher stack to be able to launch two orbiters at once. (one on each side perhaps?)
      4. Build bigger orbiter
      5. Build cargo module for launch stack
      6. ...
      7. Profit

      Here, the two very complex goals of building a multi-purpose spacecraft are eliminated. We have lots of heavy lift platforms available to us today. What we don't have is robust reusable human orbiters. 12 person crew to orbit. Another orbiter revision with a 3 or 4 person crew and 4-6 experiment pallets. And another completely empty with only an airlock for cargo.

      All using the same launch stack, reusable or not.

      SSTO is preferable, in my eyes, because the goal of being able to land anywhere, and take back off again is very useful. Well, in this case, it really is SSTO, but you could always add auxiliary boosters, again, like Energiya/Buran (I guess I'm obsessed with how the Russians designed their program. ;-) ).

    14. Re:Simplify.... by gorilla · · Score: 1

      Planes are very different to spacecraft. The ratio of fuel power/weight is good enough that we can carry all the fuel without throwing away tanks/boosters. The engines are good enough that they don't require huge amounts of maintence. Some things just work better as disposible - you could in theory make an alumnium can that could be refilled, but no-one does.

    15. Re:Simplify.... by ckaminski · · Score: 1

      Yes, but when you're talking about throwing away thousands of engines and launch vehicles in building what could be the biggest boondoggle of all time (the space elevator), you're talking about trillions of dollars in lost costs. Nevermind the pollution, the potential for loss of life from all the debris, the danger of in-orbit pollution.

      While the next generation of reusable launch systems should focus more on say, mating the X38 CRV to a an expendable Titan or atlas launcher, work should proceed on building engines that can burn for days, and on building robust launch structures to mate those engines and cargo to.

      If the capsules can be reused, and then engines are good enough, the rest is a relatively easy.

      -Chris

  11. On Southpark... by donnz · · Score: 2, Funny

    they just built a stairway to heaven. Can the same technology not be re-used? I think the Japanese were working on something similar.

    --
    -- Free software on every PC on every desk
    1. Re:On Southpark... by AntiNorm · · Score: 1

      And she's buying a stairway...to heaven...

      --

      I pledge allegiance to the flag...
      of the Corporate States of America...
    2. Re:On Southpark... by ShavenYak · · Score: 1

      Didn't you see the sign?

      "NO STAIRWAY TO HEAVEN!"

      Denied!

      --

      Hey kids, there's only 5 days left 'til Yak Shaving Day!
  12. maybe, just maybe by Squarewav · · Score: 1

    nasa will get the funding now to build that space shuttle that they have been talking about for the past 10 years that has the booster rockets built in that takes off more like a air craft then a rocket

    1. Re:maybe, just maybe by the_2nd_coming · · Score: 1

      it is scheduled for deployment over the next 8 years..hopefuly they can speed it up.

      --



      I am the Alpha and the Omega-3
  13. Money to NASA by DragonMagic · · Score: 2, Interesting

    In my state, you can buy special license plates for a bit more than normal, with a logo of the school, organization or recreation you want. The extra money is given to that organization, and you show your support.

    Why not do this with NASA, as well? Especially since my state has a NASA research center. I'd be happy to spend an extra $10 for my license plate to show that I support our NASA research.

    More info at http://www.oplates.com/

    --

    Human nature is the same everywhere; the modes only are different. -- Earl of Chesterfield
  14. A modest proposal or two by Tsar · · Score: 4, Funny
    Proposal A:
    1. Build a cheaper single-stage-to-orbit vehicle.
    2. ...
    3. Profit!
    Proposal B:
    1. Develop a self-replicating nanoscale device that eats air.
    2. Let its progeny digest the entire atmosphere and excrete it as solids.
    3. Ta-daaaaa, we're in space!
    Of course, further study may be advisable.
    1. Re:A modest proposal or two by HuguesT · · Score: 1

      > 3. Ta-daaaaa, we're in space!

      Not to be pedant or anything, but you're just in vacuum and you are still Earth-bound. Of course a vastly less interesting and more lethal Earth, but not quite what you wanted.

  15. We need to go to space so that we may.... by MrByte420 · · Score: 1

    So we can study the effects of weightlessness on tiny screws. Ant1: Save the Queen Ant2: Who's the Queen? Ant1: I'm the Queen Ant2: No your not! Horrible Horrible Freedom..

    --
    If religous zealots don't believe in Evolution, then why are they so worried about bird flu?
  16. Article in Time Magazine by njchick · · Score: 5, Informative
    Time Magazine published an article "The Space Shuttle Must Be Stopped" by Gregg Easterbrook.

    Although some of his arguments are not convincing or even insulting ("Did Israeli astronaut Ilan Ramon really have to be there to push a couple of buttons..."), the article makes several important points. Here's one of them:

    The emphasis now must be on designing an all-new system that is lower priced and reliable. And if human space flight stops for a decade while that happens, so be it. Once there is a cheaper and safer way to get people and cargo into orbit, talk of grand goals might become reality.
    1. Re:Article in Time Magazine by Xzzy · · Score: 3, Insightful

      The point your quote misses out on, however, is that there is is no "reliable" way of getting into space. It's dangerous like playing russian roulette, you go up there with several thousand pounds of explosives attached to your ass, and you come back down in the middle of a plasma fireball. Between those two events you're seperated from an intense vacuum by nothing more than a few inches of steel and some ceramic tiles.

      How many people have died trying to get into space? 14 from the challenger and columbia, shoot from the hip says no more than double that have died?

      That is only the start of it. Many many more brave men and women are going to die trying to turn us humans into a spacefaring race. This is hostile, hostile environment and we aren't supposed to be going there if evolution has anything to say about it. Playing a game of tortise and retreating into our shell "for a decade" every time there's a problem is defeatist, not going to make space a fluffy paradise where children run free, and will in the long run increase the costs of space exploration because we get so wrapped up in our politicaly correct bureaucracy that nothing revolutionary ever happens.

      Every man and woman who's died in space did it with the full knowledge this was one of the most dangerous jobs they could have picked. I see no reason to insult their sacrifice by scurrying under rocks, pretending like it's only a matter of time before a 100% safe route into space evolves.

    2. Re:Article in Time Magazine by WindBourne · · Score: 2, Informative

      14 from the challenger and columbia Please do not forget apollo 1. Grissum, chafe, and white. Technically, they were not in flight, but undergoing static ground tests. They gave their lives for the program.

      --
      I prefer the "u" in honour as it seems to be missing these days.
    3. Re:Article in Time Magazine by jasonrocks · · Score: 1

      along with technical issues, there is the dollar. I am honestly disgusted that there are many people who feel that the national debt does not affect them. The truth is it does. A substancial amount of your taxes goes to paying the INTEREST on the national debt. Politicians can't even balance the budget. All that interest is paid to rich investors who buy US bonds and other large entities. Honestly, I think that the space program should be limited to commercial endevors. (communication sattelites, GPS, etc.)

      --

      void
    4. Re:Article in Time Magazine by joebagodonuts · · Score: 4, Interesting

      Engage your brain.

      Eaterbrook's article is right on. The shuttle has killed the space program. I heard Walter Cronkite being interviewed right after the burn up. He spoke about the exploration of space. Made me sad. That was what NASA was about in the 60's when he was covering launches. Now it's a waste of time joyride that accomplishes nothing and everyone knows it. I hate to admit it because I'm a space nut. I want to see man in the stars. I want to see the human race out there. Right now all I see is us marking time.
      There are cheaper and more efficent ways that are available. Hell, there were better ways when the Mercury capsules were being shot around the world.
      Check out the x-13 project.

      NASA and Congress like the income generated from shuttle launches. That carries more weight than any dream of space.

      --
      "Give a woman two glasses of wine and some pad thai, and they'll agree to just about anything." the Sports Guy
    5. Re:Article in Time Magazine by flyingV · · Score: 1

      Interesting that you mention this article: Gregg Easterbrook also wrote an article for The Washington Monthly back in 1980, before the Columbia first flew, about various problems, delays, and money issues that NASA was encountering. He also seemed to have a rather negative tone, even back then.

    6. Re:Article in Time Magazine by Zalgon+26+McGee · · Score: 3, Informative
      It's also worth reading an article Easterbrook wrote in 1980 - prior to the first shuttle flight. It's almost eerily (sp?) prophetic in predicting the Challenger and Columbia catastrophic failures.

      See the 23 year old critique at:

      http://www.washingtonmonthly.com/features/2001/8 004.easterbrook-fulltext.html

      NASA now exists to support aerospace contractors. Jerry Pournelle, noted SF authour, proposes a simple system of rewards to encourage private ventures into space. Unfortuantely, the pork-barrel politics of NASA funding mean that the US will be tied to an incompetent bureaucracy for at least another generation...

      --

      ---

      Book(n): Utensil used to pass time while waiting for the TV repairman

    7. Re:Article in Time Magazine by the_2nd_coming · · Score: 1

      he then said "shootoing from the hip say double that" so he took those brave men into account.

      --



      I am the Alpha and the Omega-3
    8. Re:Article in Time Magazine by beakburke · · Score: 1

      Really, where are these big funding cuts that NASA has been taking?? So far as I can tell, NASA funding has increased over the past 20 years, maybe not as much as other things, but no one has seriously reduced NASA's budget. Its not as big a part of the Federal Budget because Social Spending has become the major component of the Federal Budget since the late 60s. Yeah we arent spending nearly as much (relatively speaking, in terms of % of GDP of in real dollars) as we did during the Apollo project, but we dont have a project of that scope at NASA right now. I guess im saying that NASA suffers from the same problems as any other mature agency. Its mostly sinkhole for science. Couldnt the NSF use that money much better, if we just wanted to do useful research? "It's a vision thing"

      --
      ----- Question authority, but not ours. Hate the man, but we're not him.
    9. Re:Article in Time Magazine by ender81b · · Score: 1

      Interesting that the thing that really, really got peoples interest back into space for a time was the pathfinder robot. The idea of a remote controlled robot exploring Mars captivated the public like nothing since the Apollo moon landings.

      ISS hasn't captured the imagine and I doubt it will. They aren't *Exploring* anything.

    10. Re:Article in Time Magazine by charstar · · Score: 1

      mod parent up!

      space is dangerous. war is more dangerous. war goes on every day on earth. millions have died for the cause of war. a couple dozen have died for the cause of getting humanity off this rock. I think a couple dozen casualties along the way is pretty damn good.

    11. Re:Article in Time Magazine by Jeremy+Erwin · · Score: 1

      Yes, space travel is dangerous, but that's no reason to continue spending billions of dollars on a program that has proven itself to be spectacularly unsafe.
      For instance, the space shuttle is not equiped with ejection seats. There is some speculation that the ejection seeats could hae proven useful in the Challenger type disaster, but because of the way the shuttle cabin is laid out (5 seats on upper deck, 2 on lower) the crew capacity would be reduced to 5.
      Ejection seats are not a panacea, and they probably would not have save the crew of the Columbia... But other safety features that wre proposed in the wake of the Challenger disaster, but not implemented due to engineering problems might well have.
      It is not an insult to design a vehicle with a higher margin of safety. Our astronauts are not sacrificial victims, and it behooves NASA to place a higher value on human life than the shuttle program evidently did.

    12. Re:Article in Time Magazine by PissedOffGuy · · Score: 1

      How many people have died trying to get into space? 14 from the challenger and columbia, shoot from the hip says no more than double that have died?

      you obviously don't watch enough history channel. :) the russians lost over 90 in one accident and over 50 in another, for the biggest space vehicle accident in history look up Nedelin launch deaths on google.

    13. Re:Article in Time Magazine by PD · · Score: 1

      Check out the x-13 project.

      The Harrier does vertical takeoff much better. What's the big deal?

    14. Re:Article in Time Magazine by btempleton · · Score: 1

      People have died, but the issue is not just the risk to life, but the bang for buck. People don't seem to be realizing this, but based on a number of estimates of the overall cost of the shuttle program and each shuttle (starting at 500M per launch) The destruction of the Columbia was considerably more expensive than the destruction of the World Trade Center.

      It's a boondoggle path into space, getting in the way of cheaper, safer, more reliable systems from low-pork teams or private industry.

      --
      Has it been over a year since you last donated to the Electronic Frontier Foundation
    15. Re:Article in Time Magazine by Clovert+Agent · · Score: 1
      How many people have died trying to get into space? 14 from the challenger and columbia, shoot from the hip says no more than double that have died?

      I hate these stats. No argument with the rest of your post, just that I hear these numbers thrown about all the time, and it's a PITA because it misses the point. Several points.

      It's like "fewer people have died in space than in airplanes, therefore flying from Seattle to New York is more dangerous than flying to the moon". Spare me.

      Try the numbers this way: 40% of NASA's space shuttles have exploded with complete loss of life to the crew. Doesn't look nearly as positive, does it?

      Granted, that's just as useless a statistic. Which, I hope, kinda makes the point.

    16. Re:Article in Time Magazine by ratamacue · · Score: 1
      NASA now exists to support aerospace contractors.

      It's hardly surprising, when you observe that government is nothing but a collection of individuals driven by self-interest, just as any individual is driven by self-interest. This, of course, is the fundamental flaw in the concept of government -- "government by the people, for the people" is logically impossible.

    17. Re:Article in Time Magazine by PissedOffGuy · · Score: 1

      The destruction of the Columbia was considerably more expensive than the destruction of the World Trade Center.

      no way. the only things comparing with the WTC are hurricanes, earthquakes and the like. we're talking about $83 billion.

    18. Re:Article in Time Magazine by alcmena · · Score: 1

      Ejection seats are worthless. If you ejected from the Challanger (assuming you even knew it would blow before it did), you would be burned alive by the exhaust flames from the rocket. If you ejected from the Columbia, again assuming you even knew anything was wrong before you were dead, you would have been torn to tiny pieces by wind drag across your body.

      I also think "spectacularly unsafe" is extremely unfair. NASA has lost two shuttles in 20 years. I would argue that statistic hardly says they are unsafe.

    19. Re:Article in Time Magazine by Jeremy+Erwin · · Score: 1

      I also think "spectacularly unsafe" is extremely unfair. NASA has lost two shuttles in 20 years. I would argue that statistic hardly says they are unsafe.

      Losing a shuttle-- that's nothing. Losing a shuttle crew-- that's important. The chance that a shuttle crew member will die on any particular mission is about 2%. That's several times higher than combat pilots.

    20. Re:Article in Time Magazine by Jeremy+Erwin · · Score: 1

      Beats me. If you want to read the original context for this tidbit, look in this Charles Krauthammer column

    21. Re:Article in Time Magazine by btempleton · · Score: 1

      That study derives a lot of the figure to damage to New York City, based on jobs and commerce departing the city, and the overall economic slowdown. At least in the case of jobs leaving NYC, that's just a move from one place to another, and not a net negative on the larger scale.

      However, I mean the actual damage to the property. The real estate values of the destroyed buildings and the loss from the temporary closures.

      Clearly the WTC was a worse disaster because of the people killed, and the fact it was deliberate, and the social, moral and political blows associated with it. I am just pointing out that these shuttles are so expensive they cost more than the real estate in the downtowns of all but the largest cities.

      --
      Has it been over a year since you last donated to the Electronic Frontier Foundation
    22. Re:Article in Time Magazine by nitehawk214 · · Score: 1

      I think he meant the X-15 project. Probally the most successful X project ever. It was a rocket powered aircraft that could fly into space (non-oribtal) and back. It had reaction menuvering systems for space and traditional systems for atmospheric flight. The final flight also carried a scramjet for high-speed research. It made it to mach 15, still to this day a world record for atmospheric flight. Much of the space shuttle is based on the data gathered by this project. All this, and before the Mercury project put the first american in space.

      The follow on project, an orbital version, was cancelled in favor of the manned rocked program.

      --
      I'm a good cook. I'm a fantastic eater. - Steven Brust
    23. Re:Article in Time Magazine by PD · · Score: 1

      OK, that makes a lot more sense. I hadn't heard about the scramjet on the X-15, so I looked it up. Turns out that they flew a dummy on some X-15's, but an operational scramjet never flew on the X-15.

      http://www.dfrc.nasa.gov/gallery/photo/X-15/HTML /E C88-0180-2.html is where I found the info.

  17. Mars! by ansible · · Score: 2, Interesting

    I would like to find out more about Mars.

    We don't need manned missions either, just some good robots.

    I'd like to see a couple sample return missions. One of the most intriguing ideas recently is the suggestion that there may have been life on Mars at one point.

    Finding out if there was (or wasn't) life on Mars could tell us a lot about how likely there is life on other planets. Let's get some probes on there, and roam around a bit, dig up some stuff, and bring it back!

    Until launch costs get much cheaper (and that's a whole 'nother rant), let's just do some good, meaningful science. We have the technology. NASA's existing budget (if we weren't building the ISS) is good for a dozen missions per year to the rest of the solar system, plus another spiffy space telescope.

    Now's the chance to take the money from something that isn't nearly as useful (the shuttle and ISS) and put it into answering some questions about life, the universe, and everything.

    Let's do it!

    1. Re:Mars! by the+gnat · · Score: 1

      Yes, and after doing this for a while, the technology will probably have improved immensely so that we can resume manned flight without it being a terrible risk and/or huge boondoggle.

      Personally, I think we ought to do a Europa expedition (unmanned, of course).

    2. Re:mars! by ScottForbes · · Score: 1
      What he said. If you haven't read Bob Zubrin's "The Case for Mars", get thee to a bookstore. Zubrin's proposal is stunningly elegant: It uses the Martian atmosphere and basic chemistry to produce on Mars the propellant, oxygen and water needed for exploration and the return trip.

      Zubrin's proposal would put astronauts on Mars within ten years, let them stay up to eighteen months per trip, and cost less than $40 billion. (...which sounds like a lot, except that NASA currently spends $15 billion a year, including $6-7 billion on manned space flight.) For the money we're spending today, we could be on Mars by 2012.

    3. Re:mars! by Moofie · · Score: 1

      Yeah. What you said. Zubrin is The Man.

      I say we just cut him a check for three years of NASA budget and turn the guy loose.

      --
      Why yes, I AM a rocket scientist!
    4. Re:Mars! by sql*kitten · · Score: 1

      Finding out if there was (or wasn't) life on Mars could tell us a lot about how likely there is life on other planets. Let's get some probes on there, and roam around a bit, dig up some stuff, and bring it back!

      They did do that, I don't remember the name of the mission offhand (might have been Viking). The probe contained 4 experiments for detecting life in Martian soil. Something like 2 experiments said "maybe" and 2 said "probably not". Unfortunately, those were the only 4 experiments that the probe was capable of. Nothing beats having a competent human on the ground able to use intelligence and improvise.

    5. Re:mars! by tmortn · · Score: 1

      Would love to see NASA make a real run at a mars Direct plan ala Zurbin. Hell I would be happy just to see the Ares booster concpet wringing out some heavy lift capacity from current spaceflight components to get us back in the serious planet exploring buisness isntead of these multibillion dollar R/C tonka toys that would fit on my desk and get stuck two feet from where they land.

      --
      I don't ask you to be me. I only ask you not expect me to be you.
    6. Re:mars! by macaddict · · Score: 1
      Also read Zubrin's Entering Space.

      It was in this book that he talked about the early plans for the space station. Dan Goldin assigned three teams to come up with a station design. These were voted on by a panel put together by MIT. The winner was a design that would be built on the ground and go up in one launch (like Skylab, which, BTW, had more living space than the ISS) and be ready for use immediately. We'd also get a new heavy launch vehicle out of the plan.

      But this idea was killed by VP Gore and the House Space Subcommitee Chair because 1) they wanted to have an "international" station where everyone contributed parts and 2) they wanted to create the need for shuttle launches.

      The Skylab-style design would have been cheaper, safer, more reliable and more capable. You could still have it be international--through lab designs and crew. You'd still need the shuttle (or maybe Zubrin's idea for a replacement) to ferry equipment and crew. Politics, not NASA, is to blame for the station we have now.

  18. Taxpayer Contributions to NASA by GuidoDEV · · Score: 1

    "Would you support a bill that would allow taxpayers to voluntarily contribute money to NASA?"

    Is this a joke? What would that accomplish? Does anyone really expect, come tax time, Americans to open their checkbooks and start shelling out the money for NASA, let alone at a rate which would add up to billions of dollars? You must be kidding me...

    1. Re:Taxpayer Contributions to NASA by Flamerule · · Score: 1
      Wow... You know, I have to thank you. Someone above mentioned a license plate donation scheme, someone else a check-box on tax forms, and I was just blindly nodding my head.

      Now I've just remembered how NASA is itself responsible for much (most?) of the trouble the U.S. space program finds itself in. Sadly, more money isn't going to fix that.

      It's just that I fucking care about space... I'd donate my own money in a heartbeat. I just wish there was someone more competent to take that money and do something productive with it.

    2. Re:Taxpayer Contributions to NASA by surprise_audit · · Score: 1

      What I'd expect to see would be Congress reducing NASA's budget by an amount equivalent to the expected income from taxpayers. The bill would have to include something to stop Congress from doing that.

  19. Simple way to move 10x faster by Reality+Master+101 · · Score: 3, Interesting

    First, take half of NASA's budget, and make it totally devoted to unmanned missions exclusively. NASA suddenly gets 10x more research done for half the money.

    Second, take the other half (billions of dollars, BTW) and make a series of prizes to be won by any group willing to take the risks. Prizes could include:

    $200M prize for first profitable 100 megawatt power plant space.

    $200M prize for first profitable factory that produces at least $1M in sales. $100M bonus if its a product that currently produces a lot of toxic waste.

    $500M prize for agriculture pod that produces 1000 tons of food per year. $250M bonus if it's a forest pod that produces wood.

    The key is that SPACE HAS TO PAY FOR ITSELF. Right now the risks are too high and expensive to get started.

    Note by the way that this is the ideal way to sell space to people. "Think about all the bad, bad stuff that we can put in orbit instead of polluting the earth. Cheap power. Cheap products. Great for the economy.

    Too bad this entirely logical, rational, practical and most importantly, extremely likely to succeed scenerio will never happen. NASA will never give up the control.

    --
    Sometimes it's best to just let stupid people be stupid.
    1. Re:Simple way to move 10x faster by ender81b · · Score: 1

      .... and nobody would do anything you suggest because it is not practical or affordable without.. DADA a new launch vehicle.

      Real quick. it costs $10,000/lb to put something in orbit. You weight 100 pounds? It's going to cost $1,000,000. $200 mil? Puh-lease. The shuttle costs darn near close to 450$ mil to launch. NOTHING IS PROFITABLE AT 10,000$/lb shipping COSTS!

      You need to lower shipping costs. You need something like a RAM or SCRAMjet that reduces that cost from 10,000/lb to 1,000/lb. Only then would it be practical or affordable to MAYBE do a tenth of what you suggest.

    2. Re:Simple way to move 10x faster by Planesdragon · · Score: 1

      Too bad this entirely logical, rational, practical and most importantly, extremely likely to succeed scenerio will never happen. NASA will never give up the control.

      If simply throwing money at the problems would solve them, they'd be solved by now.

      Science be damned, I don't give a flying fuck how many micro-experiments some fat scientist can do light-minutes away from the danger. I care about humanity, and human achievement.

      The ONLY way to get the money for good science in space is to make it either profitable in the reasonable future OR an element of human heroism.

      If YOU think that you have a way to make any of those three things happen, then by all means figure out a way to get there and do it, NASA or no NASA. I wager China, Eurpoe, or Russia would listen if you were willing to go and pitch your proposal to them.

    3. Re:Simple way to move 10x faster by Reality+Master+101 · · Score: 2, Insightful

      Real quick. it costs $10,000/lb to put something in orbit. You weight 100 pounds? It's going to cost $1,000,000. $200 mil? Puh-lease. The shuttle costs darn near close to 450$ mil to launch. NOTHING IS PROFITABLE AT 10,000$/lb shipping COSTS!

      No, it costs NASA -- a bloated, unbelievably inefficient organization that has absolutely no vision to radically reduce costs -- that much to launch payloads.

      The advantage of having a huge prize is that allows EVERYONE no matter how crackpot the idea to try a lot of different things. NASA will never, ever get us cheap access to space, much less profitable access to space. It simply is not in their mission.

      With all due respect, quoting NASA or any government figures as somehow carved on stone tablets is a sign of the problem, not any solutions.

      --
      Sometimes it's best to just let stupid people be stupid.
    4. Re:Simple way to move 10x faster by stefanlasiewski · · Score: 1

      No, it costs NASA -- a bloated, unbelievably inefficient organization that has absolutely no vision to radically reduce costs -- that much to launch payloads.

      Agreed. I think we should have companies such as Enron, Worldcom or Tyco perform the duties of NASA. They would be much more efficient.

      --
      "Can of worms? The can is open... the worms are everywhere."
    5. Re:Simple way to move 10x faster by Reality+Master+101 · · Score: 1

      Did you have a point to make, or are you seriously suggesting that all companies are like those? And of course, are you seriously suggesting that the government is more efficient and completely without corruption? Much less NASA?

      I think it would be mighty cool watching GM convert an assembly line into producing cheap rocket ships. Why not? How about launching 100 rockets each with 100 pounds of cargo for 10,000 pound lift capability. A solution like this would NEVER be done by NASA.

      --
      Sometimes it's best to just let stupid people be stupid.
    6. Re:Simple way to move 10x faster by Reality+Master+101 · · Score: 1

      That's because everyone is using the same solutions, rather than finding innovative, new solutions.

      --
      Sometimes it's best to just let stupid people be stupid.
    7. Re:Simple way to move 10x faster by rve · · Score: 1

      Is mannes space flight still really worth the trouble? We have excellent computers and communications technology now, cheap, small, replaceable computers, that do not need a life support system or atmosphere, does not need the extra expenses in redundancy and security that manned space flight needs, and if something goes wrong, only money is lost, no lives.

      Basically with unmanned space flight you get far more value for money at a far lower risk...

    8. Re:Simple way to move 10x faster by stefanlasiewski · · Score: 1

      How about launching 100 rockets each with 100 pounds of cargo for 10,000 pound lift capability. A solution like this would NEVER be done by NASA.

      With good reason. I think the economy of scale would prevent this from being anywhere close to a practical solution.

      Hey, if GM wants to go to space, nobody is stopping them. But I don't see private companies jumping at this opportunity, probably because going to space requires the budget of a large nation.

      --
      "Can of worms? The can is open... the worms are everywhere."
    9. Re:Simple way to move 10x faster by Reality+Master+101 · · Score: 1

      It does, dumbass.

      Oh? Exactly what was NASA's profit last year?

      You "business case" types never cease to amaze me. you wouldn't recognize a long-term benefit if one crawled out of your ass and sang "Auld Lang Syne."

      Oh, I see. You're pulling out the old saw about all the technologies that came out of the space program -- 30 years ago. First of all, that NASA does not exist anymore. Second of all, all those benefits cost an ENORMOUS amount of money, far, far, far more than it would have taken private industry to eventually come up with them. Yes, we got them faster than we otherwise would have, but woop-de-doo. It's very arguable whether it was really worth the money.

      --
      Sometimes it's best to just let stupid people be stupid.
    10. Re:Simple way to move 10x faster by Reality+Master+101 · · Score: 1

      Also the same folks who converted car assembly lines into fighter plane assembly lines in WW/II.

      --
      Sometimes it's best to just let stupid people be stupid.
    11. Re:Simple way to move 10x faster by Jeremy+Erwin · · Score: 1

      $500M prize for agriculture pod that produces 1000 tons of food per year. $250M bonus if it's a forest pod that produces wood.

      Forest Pod? Is this some kind of computer game?

      Why would you want to grow wood in in space? The water import costs would be prohibitive.

    12. Re:Simple way to move 10x faster by Reality+Master+101 · · Score: 1

      Why would you want to grow wood in in space?

      Have you priced wood lately? It's INCREDIBLY expensive because of all the restrictions on logging.

      The water import costs would be prohibitive.

      Excellent point, and of course this possibly applies to space-based agriculture in general. We don't really know how many ice asteroids are up there, though, so that's a possible solution.

      --
      Sometimes it's best to just let stupid people be stupid.
    13. Re:Simple way to move 10x faster by surprise_audit · · Score: 3, Insightful
      The advantage of having a huge prize is that allows EVERYONE no matter how crackpot the idea to try a lot of different things.

      The disadvantage of having every crackpot trying out his own favorite launch vehicle is that sooner or later, someone is going to drop his launch vehicle on a school or a neighborhood...

      There has to be some kind of space agency to regulate and review the crackpots, so that the inherently dangerous ideas are at least moderated. The space agency would also need to manage launch facilities for the better ideas, so that in case of failure there's a large body of water to drop the fireball into...

      It shouldn't necessarily be NASA, though.

    14. Re:Simple way to move 10x faster by Iron+Sun · · Score: 1

      Have you priced wood lately? It's INCREDIBLY expensive because of all the restrictions on logging.

      Umm... I think it would be a lot cheaper to just create plantations here on Earth. It's not like we're going to run out of space to do that next week (consider all the cleared areas, for a start). Ditto for growing orbital crops in order to feed people down here. Mining and so on might get a look in, but the overheads on growing large amounts of biomass in space for export are not likely to make that economically feasible for a very, very long time. Try again when the space elevator is built.

      On the other hand, using the biomass up there makes perfect sense. Saves having to haul it up the gravity well. I don't think we'll be seeing trees grown up there until we have enough infrastructure to enable us to start considering aesthetic factors, though.

    15. Re:Simple way to move 10x faster by haedesch · · Score: 1
    16. Re:Simple way to move 10x faster by shadowbearer · · Score: 1


      It's not the restrictions on logging that have made wood expensive, it's the huge demand for wood for building (flimsy) frame housing.

      In any case, agriculture in space for export to the ground is extraordinarily inefficient. A much better idea is to move our steel manufacturing industries and more polluting industries into orbit. We could mine the raw materials from Near Earth Asteroids, ship to high Earth orbit, and process it there. Free energy (sunlight) for smelting, pollution would cease to be a problem, and it would open up more arable land on Earth, not to mention helping eliminate some of our largest polluters - and also materials for space-based construction would be made MUCH cheaper as we wouldn't have to ship the majority of the high-mass items up the gravity well.

      Agriculture in orbit would only be efficient to feed the orbital construction crews....even though water would still be a problem.

      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
  20. Moon and mars, but not too fast by Vireo · · Score: 2, Insightful

    The moon has really been neglected in the past decades. I'm an engineer now, and like my fellow not-yet-30-years-old collegues, I wasn't even born the last time man has touched our natural satellite's ground. There is enormous potential for hi-tech research, science and even industrial exploitation on the moon, and it's not too far. The Earth-Moon system's Lagrange points have been largely unexploited also...

    As for Mars, our (I speak as a human being) succes rate at going there isn't very good yet. Almost one spaceship out of two that tries to enter Mars orbit is lost. We need a "welcome" infrastructure: communication and meteo satellites around Mars so that the following probes (and crews!) can safely reach destination.

    We also need something strong to cruise rapidly (I don't believe yet in 3-years-plus missions). Prometheus (nuclear propulsion) would facilitate the trip a lot...

    1. Re:Moon and mars, but not too fast by Moofie · · Score: 1

      I think any engineer that's interested in space travel should read Robert Zubrin's "The Case for Mars". He has an axe to grind, yes, but he's also got a kick-ass plan for exploring the solar system. I heartily recommend it.

      Buy it here, not at Amazon! You can also read some papers he's published that are the real meat of his proposal.

      --
      Why yes, I AM a rocket scientist!
  21. Choose with your taxes by MarcOiL · · Score: 3, Insightful

    Here in Barcelona, not long ago, a pacifist organization proposed adding a box in the tax forms that would disallow the government from spending your taxes on defense research or contracts.

    A lot of people signed in the campaign, but the government, of course, did not change anything.

    Now imagine if something like this could be done in the USofA, which spends on weapons as much as the 10 next most-spending countries put together!

    (All this data is taken out of UN reports, which I'm now too lazy to find...)

    With just one year of the DoD budget, famine could be erradicated forever in this planet, and you'd have enough spare change to build another shuttle and send a mission to Mars!

    Of course now the important thing is bombing Iraq because the stupid dictator there tried to kill someone's daddy *and* has huge amounts if oil...

    --
    If I have posted far, it is because I replied to giants.
    1. Re:Choose with your taxes by Shoden · · Score: 1

      With just one year of the DoD budget, famine could be erradicated forever in this planet

      And just how would you do this? There's already enough food produced for everyone in the world. The transportation infrastructure could probably be improved somewhat, but that's not the major problem either.

      The main cause of mass starvation and famine is corrupt governments! And how do you get rid of corrupt governments? Usually with military action. So are you proposing that the US go out and overthrow all the petty little dictators through out the world? Didn't think so...

    2. Re:Choose with your taxes by magarity · · Score: 1

      With just one year of the DoD budget, famine could be erradicated forever in this planet

      Famine happens because of bad governments in the affected nations. The leader of North Korea riding around Russia in a private train and eating with sterling silver chopsticks while half of his citizens face starvation is an excellent example. How exactly does lowering US defense spending help such situation? You want to donate more "aid" to such a person so he can resell it for more Rolls Royces?

    3. Re:Choose with your taxes by sql*kitten · · Score: 2, Informative

      A lot of people signed in the campaign, but the government, of course, did not change anything.

      Perhaps the government realized that if it did cut back on defense then ETA blew up a load of civilians, those same people would be howling for its dismissal?

      The problem with anti-war types is that they are generally perceived as being anti-war for the sake of being anti-war. The same cannot be said about the pro-war camp - after all, we are at peace most of the time!

      With just one year of the DoD budget, famine could be erradicated forever in this planet, and you'd have enough spare change to build another shuttle and send a mission to Mars!

      The food problem is nothing to do with food production, and it's nothing to do with money. The problem is political obstacles to distribution. Right now, for example, there is famine in Zimbabwe because their dictator Mugabe finds it easier to control the country if it's starving. The famines in Somalia and Ethiopia could be ended tomorrow if the local warlords could be persuaded to stop hijacking food shipments.

      This situation is particularly interesting because it catches pacifists on the horns of a dilemma: allow the people to starve, or use military intervention to feed them?

      Of course now the important thing is bombing Iraq because the stupid dictator there tried to kill someone's daddy *and* has huge amounts if oil...

      You do know that the USA gets 7% of its oil from Iraq and 15% from Venezuela? If the war was about oil, it wouldn't be in Iraq!

  22. Robotics by Katz_is_a_moron · · Score: 1

    While I think the space program will on, I don't think that the shuttle program will go on for long. This is a program that has claimed 14 lives so far and the technology is a bit outmoded.

    With the advances in robotics I wonder just how many of the experiments performed in space need a human presence. If half of the experiments could be done with robots, that would greatly reduce the number of manned flights. This would also result in a significant cost savings, since most of the cost of a manned spacecraft comes from the systems required to support human life.

    1. Re:Robotics by ckaminski · · Score: 1

      You, sir, are correct. Life has a 100% fatality rate, last time I looked up statistics on it. :-) Wish I had a mod point for you.

      Hell, many of us are even lucky to be born at all.
      -Chris

  23. bush's budget proposal... by jeffy124 · · Score: 1

    President bush's budget has already mentioned an increase in spending for NASA (which I think was there before last weekend).

    I think NASA should try and find the aliens referred to in that proposal.

    --
    The One Rule Of Chess You'll Ever Need: Don't play someone who carries a kit in their bookbag.
  24. First we need space mining by rossz · · Score: 2, Interesting

    Step 1. Build the basics for a permanent presence in space. The ISS might do the job. That's merely a place to hang on to for ...

    Step 2. Build an ore processing space station so we can mine the asteriods. This will provide most of the raw materials needed for everything else, such as ...

    Step 3. Large scale self-sufficient space station. This might not be a single station. There might be one station devoted to living quarters, recreation, etc. and another for manufacturing and science.

    It would probably be decades before this system reaches the break even point, and a few more decades before it pays for itself (financially). But that gives you...

    Step 4. Profit! (sorry, I couldn't help myself).

    That's my amateur class analysis. Feel free to blow huge holes into it.

    --
    -- Will program for bandwidth
    1. Re:First we need space mining by anubi · · Score: 1
      Mining - and Manufacturing....

      No Gravity! No Oxygen! Consider how hard it is on Earth to try to refine metals when we not only have to burn tremendous amounts of carbon-based fuels to get heat, and then use even more carbon-based materials (coke-not the stuff you drink) to keep air away from it while you try to process it.

      In space, just about any amount of heat you want can be provided by a parabolic reflector, aimed at the Sun. There is no air to contaminate your materials. There is no gravity trying to move your materials around... they will have a tendency to stay just where you put them.

      I forsee the day when things like very high grades of steel are fabricated in space, then formed into a sort of robotic glider. The gliders make a one-way trip to Earth, landing wherever you want, where their materials are then stripped to construct buildings or whatever else you may want the steels for.

      Think of all the pollution that would never have been generated because the sun, not the burning of fossil fuels, provided the energy to refine the metals.

      The one thing I am concerned with is the pollution of space though. Maybe its no big deal, but its not the existence of the objects that scare me, it is the velocity of the objects. Imagine being hit by the proverbial tossed beer-bottle travelling at 16,000 miles per hour.

      --
      "Prove all things; hold fast that which is good." [KJV: I Thessalonians 5:21]

    2. Re:First we need space mining by the_2nd_coming · · Score: 1

      we need a machine that can make food out of other matter fisrt.

      --



      I am the Alpha and the Omega-3
    3. Re:First we need space mining by lommer · · Score: 1

      Feel free to blow huge holes into it.
      All right, I'll take my best shot.

      Firstly The ore processing station can be broken down into two parts: the mining and the processing.
      a) The mining: exactly what 'ore' will you mine? I can't say for sure but I don't believe that there are very valuable mineral deposits confirmed on the moon or the asteroid belt. As well, transporting the ore from the moon or the asteroid belt will costs $$ and the efficiency of your system. We already have a very effective and efficient mining industry here on earth that is nowhere near depleting useful construction resources. If you are mining precious metals in space, you will have to bring them down to earth in order to convert them into useful construction materials which will only be brought up again. A nice way of paying for the entire venture, but again, efficiency would be paramount.
      b) If you are mining titanium or aluminium in space, fine - I can't comment on how those are processed b/c I don't know anything about it. But I would venture to guess that these are fairly complicated processes requiring many chemicals and machines which would, again, have to be lifted into space - when we already have these processing facilities here on earth. However, if you are mining Iron for the purpose of turning it into structural steel, you are SOL in space. Steel production requires tons of coal, as well as air (It's quite an interesting process actually). These are two things you will definitely NOT find in space.

      So really, the mining prospects in space doesn't look too good or profitable. Why bother developing a huge, complicated, risky system when we have equivalent capabilities here on earth? It would actually be cheaper to pay to lift stuff up in the short term (next 20 years) - Even with our current lifting systems.

      Now proposition 3: the space station.
      One word: why? Your entire argument seems to be that we need to make space economically self-sustaining in order for space development to occur. In truth, there aren't many manufacturing processes that require or would benifit from zero-G or a vacuum (which are the only economic benifits of space). The only real benifit comes from preventing environmental damage. However, our current society still thinks that raping the planet is an acceptable buisiness model, and it continues to be profitable. For manufacturing, unless you stay with basic refining, you're going to need to haul materials up only to - you guessed it - haul them back down. The simple economics of it just don't make sense.

      So now that I've stated why I don't believe your proposition would work, want to hear mine?
      Government agencies such as NASA should NOT be concentrating on what we do in space (except for purely scientific missions like mechanical probes), but on how we get there. If the government can develop a launch vehicle (not neccesarily rockets, think ground-based linear induction motors (rail guns), gauss launching systems, or airplane launched payloads) that costs only a few $/kilo, then you are in buisiness. If you make space venture-capitalism low risk then you will get all kinds of investment. The best part? the launch system is controlled by the government, so you can still regulate to what goes up. When you (as a human) can catch a ride to LEO for ~$1000, then space development will take off.

    4. Re:First we need space mining by perfessor+multigeek · · Score: 1

      Small, slow, ion-engine craft robots go out and bring asteroids back. When asteroids get near earth, the robots ferry the rocks to the station and use the remaining velocity to swing back out for the next round.
      Robots are small, cheap, and built by the hundreds, designed to work by the same navigational rules as a school of fish so that the processing power of each is minimal and stable.
      Metals processing is done initially on a small scale with a solar furnace melting the rock to plasma and shooting it past a set of magnets none too different from those in your CRT. The magnets separate the elements by mass and charge as decribed here.
      Maybe in some cases, we should go to the rocks, as described here instead of bringing the rocks to us.
      He bit, you bit, I bit, and little by little we eat away at the problem, neh?

      Rustin

      --
      Data is the lever, rigor the fulcrum, brains the force that drives it all.
  25. We all enjoy and desire space travel by sstory · · Score: 3, Informative

    But the space shuttle has not lived up to promises, and there are no current technologies which will get space travel to a reasonable cost. Plus, there's really a lack of a mission. I'd say the hubble and other satellites are the only worthwhile things it's done. Given finite resources, what else could we do with those billions? A fusion manhattan project? Thousands more grants to scientists? The end of oil dependence? These are all more valuable things than going to space right now. I hate to say it, but rationally I believe we're better off shuttering nasa and diverting the money to other science endeavors. And if you consider all the possible uses for the money, it becomes more attractive to shutter nasa. Think of the millions in jeapordy from AIDS, and the horrors of Africa and parts of Asia.

    1. Re:We all enjoy and desire space travel by ender81b · · Score: 1

      Scram and Ramjets would get you to space at 1/10 the cost of the shuttle - and that is being conservative. NERVA or Orion would get you to space at 1/1000 the cost of the shuttle.

      NASA gets 14.5$ billion a year from the federal budget of 1.2 TRILLION dollars. less than a percent.

      I'm not going to go into a debate about whether to finance NASA or finance AIDS development. All I will say is this - humans have exceeded the maximum carrying capacity of the enviroment (see table below). We need space, without space and cheap energy we are doomed one way or another.

      Table 1.
      Calories Gained to Spent. How much each culture spends to gain a calorie over how much they spend to get said calorie.

      Source: Professor of Anthropology R. Hames, University of Nebraska-Lincoln.

      Calories Gained/Spent
      Foragers 9.6/1
      Dry Horticulturists 11.2/1
      Tropical Horticulurists 18.0/1
      Agriculture 53.5/1
      Modern Agriculture 6000.0/1
      Modern Agriculture (2) .125/1

      That last modern agriculture figure takes into account the *total* cost of modern agricutural. The cost to Build, manufacture, fuel the combines/tractors/etc. The cost to build, manufacutre, fuel the transporation. The research costs for the seeds, etc, etc. nearly all of that energy comes from petroleum which we are slowly running out of. Without a new form of energy we will eventually be... starving to death. Space my friend.. fusion, solar power, colonization, whatever is possible to reduce the strain on Mother Earth.

      Sorry about the table being unformatted, the lameness filter was being fucking retarded.

    2. Re:We all enjoy and desire space travel by dammy · · Score: 1

      Actually, we need to shut down NASA from doing any more space transportation. Let private industry do it with their own money. If this would have happened a few years ago, RotaryRocket may have found enough VC funding to complete their project of a cheap SSTO vehicle. Let's just make it the technology that is actually created for and used in space transportation tax free for a given amount of years as an incentive to private industry.

      It's quiet clear that NASA isn't going to do something wonderful any time soon, even if they had an unlimited budget. Just too many beurocrats attempting to keep their own little empire in funding.

      Dammy

    3. Re:We all enjoy and desire space travel by Moofie · · Score: 1

      Ramjets won't get us close to space, period. They top out about Mach 8.

      Scramjets are a really draggy way to drive payloads at high speeds. The size of the compression ramps is huge relative to their thrust output (which is totally theoretical to begin with...the Australians kept their scramjet lit for, what? Six seconds? And that was a world class effort)

      Next generation fuel-oxidizer rocketry is the way to go. The vehicles are smaller in cross section and can get out of the atmosphere faster.

      Single stage air-breathing rocketry doesn't work. Multi-stage air breathing coupled with conventional rocketry has promise. With a single stage aircraft, you need at least three (and probably four) separate engine cycles to get to orbit. You need a turbojet to get to ramjet operating speeds, which will get you to scramjet operating speeds, which will get you to an altitude where you have to light a rocket to get any higher 'cuz there's no damn air. You might be able to use a rocket-ramjet in place of the turbojet, but you've still got three separate combustors with very different geometric properties.

      I promise. My team and I tried to design one last semester. Looked good on paper, but our conclusion was that it wouldn't work in practice.

      --
      Why yes, I AM a rocket scientist!
    4. Re:We all enjoy and desire space travel by ckaminski · · Score: 1

      Excuse me, but Columbia was barely a 1/3 of it's way through it's design lifetime. The major *PROBLEM* of the space shuttle, was that we were using what is inarguably a research prototype as if it were a production model. There was never a followon evolution to the Shuttle to make it an order of magnitude safer. No bottom-up redesign of the SSME's to increase reliability. Granted, the tank got lighter, the airframes of it's successor craft got lighter, and it got minor incremental improvements, but the parts that required such heavy maintenance never got redesigned so that you didn't have to completely revalidate the entire system for launch.

      Sorry about your job, buddy. But let's face it, the X-33 needed cancelling. If the X-33 was so good, the contractor should have continued to a demonstration model of a flight-test article. Fact was, it was entirely too high a risk to attempt to manufacture.

  26. Only a space elevator makes sense. by drinkypoo · · Score: 4, Insightful
    I don't know how feasible it would be to build a carbon-nanotube space elevator today. I'm not sure we have the technology if we do build one; You'd have to have a massive no-fly zone around it, and the security would be intense. It has to be planted someplace equatorial; Methods for doing this have been discussed at length in Kim Stanley Robinson's Mars series. (Red Mars, Blue Mars, Green Mars, Purple Horseshoes...)

    While it's nice to think that we'll be pulling some cowboy bebop style shit and just pulling back the throttle on our Swordfish II and going orbital, we need at least an order of magnitude more efficient power generation, power storage, or drive technology, or some combination thereof. The bottom line is that it takes a huge load of energy to build an orbital craft, and it takes quite a bit to launch it. Piggyback designs have thus far not proved to be a solution though there is hope there, I will admit; Still, I don't think it's worth making craft capable of launching from a planet until materials technology improves considerably.

    A space elevator would make it downright inexpensive to put things in orbit. If you reserve space, when it becomes cost-effective you can run a superconducting strip down its length (That's a long-ass strip of superconductor! But eventually it will become worth it) and plant nuclear power generation at the other end of the tether where you can simply eject the core if it fissions out of control. (Mount it on a rocket; If the pile goes bad, fire it at the sun.) You could also just put a gigantic solar array there; It should be affordable if it is cheap to put into orbit and has obvious advantages in terms of required maintenance.

    In any case, the first step towards building a space elevator is building the massive structure which will have to sit at the other end. If we are going to accomplish this, we need to be working on ways to mine asteroids, smelt ore, form steel, and build structures in space. In other words, we need to be thinking about supporting mining engineers, steel workers, steel fabricators, and so on. It just doesn't make sense for us to be mucking around in space too much (more on this in a second) when it costs us so much, and it costs so much because of the fuel required to lift a given mass. Reduce the amount of mass you lift, this reduces the amount of fuel you have to spend, and the whole thing gets cheaper. Build a space elevator, and you don't even have to use fuel any more; The direct cost and the long-term environmental cost (Putting that much energy into a system always has some effect, and some of the stuff we're putting into the atmosphere is nasty) of a space elevator is essentially nothing when you consider how much traffic you will have if you make it cheaper, and how much less energy must be expended.

    Here comes the later: It still makes sense for us to be sending out probes, and testing new technologies for space. But it doesn't make sense to spend a lot of money on that. We should be spending our money on technologies which will bring us the space elevator.

    --
    "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    1. Re:Only a space elevator makes sense. by Anonymous Coward · · Score: 1, Insightful

      I don't know about that space elevator.

      If it broke (accident, engineering miscalculation, stress) -- or worse yet, was deliberately destroyed by terrorists (9/11), wouldn't it leave a LONG, LONG trail of absolute destruction in its wake?

    2. Re:Only a space elevator makes sense. by Moofie · · Score: 1

      if it were broken low in the atmosphere, no. It'd just go away, probably in a very unstable manner. Forget about getting it back.

      If it were broken close to the counterweight asteroid? *shudder* Bad news. The thing would wrap around the Earth three times, and cause unspeakable destruction.

      Read the last 100 pages of Kim Stanley's Red Mars. Even if you don't like the rest of the book...man, that space elevator scene is cool.

      --
      Why yes, I AM a rocket scientist!
  27. Give me an oxygen mask and a parachute by 1nv4d3r · · Score: 1

    I can lift 175 pounds, but I only weigh 150 pounds. If NASA will just build me a ten pound 'space chair,' and I pull up on it as hard as I can, I should still be able to maintain a steady speed of 15 lbs.

    Right?

    I have ideas about how to steer also (thank god no one can smell space).

    1. Re:Give me an oxygen mask and a parachute by Moofie · · Score: 1

      OK, that was funny as hell. Full marks. Go to the head of the class.

      I'm so stealing that for my .sig file.

      --
      Why yes, I AM a rocket scientist!
  28. game on! by pi_rules · · Score: 4, Interesting

    Are you ready to put your coin where your Dreams are?

    Giddy up - I'm all for it. Maybe we can get a tax exempt charity status for NASA donations. Maybe one already exists, I dunno. If it was on my 1040 though I'd like that -- more people would see it at least. It'd put it on the forefront of my mind come Tax time.

    Personally, I have two uses for the federal government. My military and my space exploration. Beyond that, they're pushing into things that I think my state should handle. I'll spare y'all that ramble though.

    I like the idea of space exploration. I sure wasn't around in 1969 when man landed on the moon, but I still get a little lump in my throat when I see things about that era. It makes me proud, not only to be an American but just to be a human being. Hell, I'm filled with awe when I read little tidbits about the early Russian space program, and I was raised in the '80's when the Russians were "bad bad peopole."

    I think it's about time we set a real goal for space exploration again, although I'm certainly no expert on this subject. It just seems like it's time to me. We need somebody to step up like JFK did and say "We're going to point X by date Y, and there's no stopping us."

    What will we do when we get to Mars, or a station on the moon? I don't know. We'll get something out of the deal though as a society as a whole though I think. Necessity is the mother of all inventions, right?

    As it sits, over 50% of my money goes away in taxes right now -- I'd much rather it go to things that I really had an interest in is all.

    1. Re:game on! by Incon · · Score: 1

      It's not exactly JFK stepping up, but it is a point X by date Y

    2. Re:game on! by Skyshadow · · Score: 2, Insightful
      As it sits, over 50% of my money goes away in taxes right now

      You seriously need a new accountant.

      JFK got away with going to X by Y because we were trying to beat the commies there. That, in the particular time and place, warrented nearly unlimited funding and risk-taking. It wasn't just national will to get to the moon and see something different -- it was about getting to the moon and seeing something different first. And yes, we did get a lot of cool inventions and innovations out of the space race, but it was at a pretty considerable cost.

      Since then, NASA's been lucky to get funding to endlessly circle the globe; there's no opponent, you see, and no real overriding fiscal incentive for anyone in particular. The only way the space program is ever going to pick up again is if (a) we get into another space race (the Chinese, maybe?) or (b) we find a really good reason to go out and get what's out there, and by "good" I mean "lucrative".

      That said, I've never seen a man walk on the moon. I don't know if I'll ever see a man walk on Mars. I feel like the middle child of American history, like I'm coming along only after all the cool stuff has been done already but before we move to the next thing, and I would like to see that change.

      I watch the Daily Show pretty regularly, and the other night John Stewart said that he'd like, for a change, to experience a national emotion that wasn't sadness. I'm with him on that. I just fear that we as a nation are not visionary or daring enough to make it so.

      --
      Every year during my review, I just pray the words "slashdot.org" aren't mentioned.
    3. Re:game on! by DopeRider · · Score: 1
      We need somebody to step up like JFK did and say "We're going to point X by date Y, and there's no stopping us."

      Why JFK?. We have plenty PHB's to say it.

    4. Re:game on! by the+gnat · · Score: 1

      Personally, I have two uses for the federal government. My military and my space exploration. Beyond that, they're pushing into things that I think my state should handle.

      I guarantee you'll benefit far more from the $20 billion NIH budget than from the $15 billion NASA budget. But I guess curing cancer and AIDS just isn't "cool."

    5. Re:game on! by ashitaka · · Score: 1

      ...I've never seen a man walk on the moon..

      I hope everyone here realizes how sad that is.

      How many Slashdotters can say the same thing?

      --
      If you don't want to repeat the past, stop living in it.
  29. NASA needs more money. by Quaoar · · Score: 1

    That's what this boils down to...they have a TON of possible plans they could be running right now, but hardly any of them get off the ground because their budget is only about 13 billion. Considering that the U.S. was ponying up 60% of the ISS, this leaves little room for much else. Citizens need to speak up and show that America still wants a robust space program, and that we'll be willing to foot a larger bill to accomplish that goal.

    --
    I'll form my OWN solar system! With blackjack! And hookers!
  30. Someone show George Bush "Moonraker" by Chuck+Chunder · · Score: 1

    All those laser equipped shuttles and space commandos are bound to get his cheque writing hand nice and warmed up :)

    --
    Boffoonery - downloadable Comedy Benefit for Bletchley Park
  31. is this a shetorical question? by larry+bagina · · Score: 2, Insightful
    Would you support a bill that would allow taxpayers to voluntarily contribute money to NASA? Are you ready to put your coin where your Dreams are?"

    Guess what... it doesn't require an act of congress for you to donate money. Instead of supporting a bill, just send your damn money to NASA.

    --
    Do you even lift?

    These aren't the 'roids you're looking for.

    1. Re:is this a shetorical question? by pmorrison · · Score: 1

      Tell you what... give me an address (at NASA) that's received checks that were cashed, and I'll send $100 myself. And ask others to do the same. Pretty soon we'd have a revolution.

  32. Aha! by ajuda · · Score: 1

    You know why the advanced alien races never landed on Earth? They decided to save billions of dollars, scrap the space program, and put the money into programs to eliminate poverty and hunger. Seriously, what do people expect to find up there? If you're just going to use the "exploration and adventure" argument, you might as well look to the oceans - they're closer and full of unknown life.

  33. Space Elevator? by quantaman · · Score: 1

    a carbon nanotube space elevator
    Yeah just wait until terrorists detach the astroid it's anchored too and it flattens the equator and they start breaking all the tent cities and burning all the rebels to death and knock the moon out of the sky!!!

    Sigh I'm getting into the Mars trilogy way too much...

    --
    I stole this Sig
  34. Up is easy; down is harder by Twirlip+of+the+Mists · · Score: 4, Interesting

    Getting people into orbit is a fairly easy proposition, if you can keep the lifting hardware from exploding. Getting people back down again safely is the much harder engineering problem. I'm personally kind of amazed that the shuttle was able to make as many successful and safe re-entries and landings as it did. When you think about the forces involved in re-entry... well, it just boggles the mind.

    It was at this point that I started thinking. Ever read Starship Troopers? In that book, Heinlein advanced the idea of mobile infantry troopers being dropped from orbit to ground in their own individual little re-entry pods. I started thinking about this.

    Picture an astronaut in his spacesuit. He's enclosed in an egg-shaped structure made of aluminum and ablative materials, just barely big enough to hold him. Maybe the structure has a small solid-fuel booster attached that's sufficient to execute a de-orbit burn. With nothing more than the mass of the astronaut and the shell to push around, you wouldn't need much energy to execute such a manuver in low Earth orbit. After the burn, the spent booster falls away (to burn up harmlessly in the atmosphere) and the shell, with astronaut inside, descends through the upper atmosphere, shedding heat through ablation. (In other words, the heat shield boils away on the way down.) At a reasonable altitude, say 100,000 feet or so, the shell opens via explosive bolts and the astronaut free-falls, Kittinger-style. At a suitable altitude, the parachute opens automatically and the astronaut touches down safely.

    The advantages of such an orbit-to-Earth system seem kinda obvious to me. We know all about ablative heat shields, having used them for the Mercury, Gemini, and Apollo programs as well as every ICBM ever built. A small, symmetrical re-entry structure would be relatively immune to the kind of atmospheric forces that may have destroyed Columbia. Finally, not to seem morbid, in the event of a failure, only one life would be lost instead of the lives of an entire crew.

    I don't know. It's just an idea.

    --

    I write in my journal
    1. Re:Up is easy; down is harder by zenith744 · · Score: 1

      I wish I had points to mod you up; I'm no physicist, but that seems an intersting idea!

    2. Re:Up is easy; down is harder by Linguica · · Score: 2, Funny

      Such a personal reentry vehicle has already been considered. In the 1960's General Electric drew up plans for just such a device, entitled MOOSE (Man Out of Space Easiest), which would have required an astronaut to slip inside a big, foam-filled plastic bag, float out of the spacecraft and fire thrusters attached to the bag to push it out of orbit.

      Then, the astronaut would rely on a built-in heat shield to survive the fiery plunge through Earth's atmosphere and wait for a parachute to automatically deploy for a safe landing.

      You can check out this out-there but admittedly cool idea at Space.com. I'm still waiting for it to be used in a major motion picture...

    3. Re:Up is easy; down is harder by nhavar · · Score: 1

      Heinlein also pointed out how cheap life was considered especially the life of a soldier. To me that's one thing that stuck out in the book each soldier was individually disposable, with another able to come in right along behind and fill the void. The drop capsules were like nice shrinkwrapped little coffins, dropping thousands on a planet hoping just enough would make it through to accomplish the mission.

      --
      "Do not be swept up in the momentum of mediocrity." - anon
    4. Re:Up is easy; down is harder by dzym · · Score: 1
      Just some examples of personal re-entry vehicles, something like this, that I can think of from science fiction.

      A re-entry vehicle somewhat like that was presented as infiltration equipment in a couple of recent Star Wars New Jedi Order novels (the Enemy Lines duology) by Aaron Allston.

      Robert Heinlein used disposable launch capsules for his soldiers in Starship Troopers.

      Quake 2 had personal dropships.

    5. Re:Up is easy; down is harder by sheddd · · Score: 1
      Up easy, down hard?

      Down's easy; down safe requires protection.

      Since you're talking about re-entry pods, I assume you're against reusable craft. I agree.

      The capsules were pretty damn simple; no guidance required (after initial vector/velocity was met); Their only necessary function: deploy parachute. Contrast with the bulk/complexity/re-tooling time of the shuttle.

      Reuseable != Cheaper

    6. Re:Up is easy; down is harder by Moofie · · Score: 2, Interesting

      The air force thought about this in the 60's. The idea was to stick a guy in a space-suit into an egg shaped reinforced mylar bag, with a heatshield/aerobrake on the bottom. Our intrepid astronaut has in his lap and under his seat two containers of "bang foam", you know, the stuff you get at the post office where you put 'em in your box and you pull the string or whatever and they go BANG! and you have conformal packing material. Same deal, only lots more of it. Think Demolition Man car crash mode. So he de-orbits in his foam egg, pops a 'chute, and hopefully doesn't die of claustrphobia on the way down.

      Can't find a link, but this was seriously considered. Might not be a bad emergency way to get out of space...but I don't want to be the first. : )

      --
      Why yes, I AM a rocket scientist!
    7. Re:Up is easy; down is harder by PD · · Score: 1

      Don't worry, there will come a day when instead of base-jumping people will be space-diving. It'll be the sport of choice for the Darwin challenged. But, like parachutes, the space-diving equipment will eventually be perfected so that it's reasonably safe.

    8. Re:Up is easy; down is harder by tony_gardner · · Score: 1

      There's only one problem with your argument. We don't know all about ablative shields. Basically, the programs you mention had a factor 10 uncertainty in the recession rate of the ablative system. That's fine, but it means that for every 1kg of ablative you need, you have to carry 9kg with you to be safe.

      That's inefficient.

      Research into ablatives is continuing, but it would be a bad idea to assume that the Engineers at NASA are incompetent.

    9. Re:Up is easy; down is harder by perfessor+multigeek · · Score: 1

      Interesting thought. The problem is (for now) that astronauts experience such rapid atrophying of muscles and damage to bones that they can't even stand up, let alone drive a paraglider or equivalent.
      My question becomes, how near are we to having an RPV, let alone autonomous vehicle that can handle its own landings? Once we've got that, then the astronaut can just be a passenger in the pod while happy little solenoids drive the wing.
      On the other hand, we could get Thinkgeek to develop a super-Bawls mixed with amphetimines and they'll be so hyped up they'll be strong enough to run the lines themselves.
      All joking aside, I'm not sure that you're that far off base. Five more years of Moore's law with concurrent materials advancement and we're there.

      Rustin

      --
      Data is the lever, rigor the fulcrum, brains the force that drives it all.
    10. Re:Up is easy; down is harder by machine+of+god · · Score: 1

      how did he keep the marine from spinning on the way down?

    11. Re:Up is easy; down is harder by orim · · Score: 2, Funny

      Just attach some fins to the vehicle... like a dart. That would probably work.

      --
      "If you could only see what I've seen with your eyes..." - Roy Batty
    12. Re:Up is easy; down is harder by Twirlip+of+the+Mists · · Score: 1

      I don't think that point of view is unique to Heinlein. The function of a soldier is to exert force and, if necessary, absorb retaliatory force. An army is, in a sense, an ablative shield.

      --

      I write in my journal
    13. Re:Up is easy; down is harder by Twirlip+of+the+Mists · · Score: 1

      Since you're talking about re-entry pods, I assume you're against reusable craft. I agree.

      No, no! I'm most definitely enamored with the idea of reusable spacecraft. I'd love to reach a point where getting from Earth to orbit and back again would be only slightly more dramatic than taking a ride in a 747. I'd love to reach a point where we can go to space not a dozen at once, but hundreds at a time. I'd love to reach a point where Howard Johnson has hotels in orbit, a la 2001.

      I'm just brainstorming is all.

      --

      I write in my journal
    14. Re:Up is easy; down is harder by Twirlip+of+the+Mists · · Score: 1

      The key is to find a stable configuration. The space shuttle orbiter is inherently unstable as it descends into the atmosphere; computer-controlled control surfaces (ugh; you know what I mean) are required to keep the orbiter's attitude correct. Personally I wouldn't be surprised if we ultimately conclude that the primary cause of Columbia's break-up was an attitude problem, possibly caused by increased drag on the left side of the airframe. The orientation of the orbiter got outside of the envelope, and the aerodynamic forces tore her apart.

      But consider something like the Apollo capsule. Due to its shape, it was aerodynamically stable on the way down. It required no control surfaces to maintain its attitude. If something happened-- increased drag, or a shift in the cabin load, or something-- to throw the capsule out of the proper attitude, the aerodynamic forces would tend to push it back into the right attitude again. This is in contrast to the space shuttle, or in fact to any aircraft. If a lifting body or lifting wing aircraft gets out of the proper attitude, it will tend to fall further out of the envelope, either breaking apart due to aerodynamic forces or losing all lift and becoming an expensive brick.

      That's why I suggested a rigid, egg-shaped enclosing structure, as opposed to the simple mylar bag that some other people have mentioned. A rigid structure could be build in a form that is aerodynamically stable on the way down, making the ride much more pleasant-- well, I don't know if "pleasant" is the word, exactly-- for the astronaut.

      --

      I write in my journal
  35. Why aren't his arguments convincing? by dachshund · · Score: 1
    Although some of his arguments are not convincing or even insulting ("Did Israeli astronaut Ilan Ramon really have to be there to push a couple of buttons...")

    Perhaps this is a little bit insulting, but he makes some good points about Space Shuttle Science. Particularly with regards to the types of experiment that can be performed in the short time-frame available to Shuttle astronauts, and also regarding the need for human involvement in many of these experiments.

    Can anyone provide a convincing rebuttal to Mr. Easterbrook's contentions?

    1. Re:Why aren't his arguments convincing? by dachshund · · Score: 1
      Without the physiology data coming from shuttle experiments, we can't make it to Mars with functioning humans.

      Why can't this data come from the ISS, which has a long-term crew? Is the Shuttle critical to operating ISS, or can it be done via less expensive disposable rockets?

    2. Re:Why aren't his arguments convincing? by Moofie · · Score: 4, Insightful

      Well, I can't, since most of his points are absolutely accurate.

      Exceptions:

      Buran was a 3/4 scale duplicate of Shuttle, not the same size. It also never carried a crew...its one mission was unmanned. Read more here.

      A crew escape section (a jettisonable cockpit, for instance) is a good idea for launch related problems. Howevet, on reentry, it would be absolutely impossible to get the capsule a) protected from the reentry heat and b) away from the Mach 20 reentering shuttle. It would also be absurdly heavy as a retrofit. I do believe that it should be considered for next-generation reusable spacecraft.

      The reason that the Challenger problems were left up to the "old boy" network is the same reason the same engineers that crashed Mars Pathfinder builts its successors: There just aren't a hell of a lot of people who know how to do this stuff. It's horrifically complicated, and the stakes are impossibly high. You don't just let a recent graduate (like I will be soon! Yay!) design a new Shuttle. Or even a system on the shuttle. You use experienced, seasoned engineers, checking and cross-checking each other. And you still have fatal mistakes.

      He's also wrong about his (rhetorical) contention that throttling up Challenger's engines was fatal. The solid rocket boosters were already burning (fatally), and they are not throttled. As soon as those things were lit (that is, before it left the ground), the fix was in. That ship was going to die.

      I do disagree with a lot of his conclusions. This fellow doesn't seem to be committed to manned space exploration. His discussions about going to the Moon (which is a dead end: Been there, done that) are red herring arguments.

      My personal feelings on the future of the space program are very ambiguous. I use that word in the sense that I have very strong, opposing opinions on the topic.

      I believe passionately in /manned/ space exploration. I think it feeds the human soul and imagination. You don't have to look much past the story of Dr. Kalpana Chawla (an alumnus of the UTA, where i'm graduating in May) to see how the challenge of space can motivate and inspire people.

      However, I think NASA is doing a very bad job of stewarding our resources. They're given a budget (although I certainly wouldn't call it lavish), with the understanding that that budget will be returned to the communities around major NASA installations, and the contractors that supply them. Good engineering or no, that is the only way you can get any sort of large-scale project done in this country: Spread the wealth to as many congresscritters' pork barrels as possible. I don't like it either, but I don't know how to change it.

      So, I want people in space. But I don't think that going over and over to LEO accomplishes anything. If I thought it would be possible to say "OK, we're not going to fly any people for five years, but then by God we'll start flight testing our Mars hardware!" I'd be a happy guy. However, I believe that if we don't keep in the habit (if you will) of putting people in space, we will lose the political will to do it. I think that would be Bad, because we (America and its partners) would cede to somebody else (China?) primacy in solar exploration. I think that's a Baad Idea.

      --
      Why yes, I AM a rocket scientist!
    3. Re:Why aren't his arguments convincing? by ghutchis · · Score: 1
      Why can't this data come from the ISS, which has a long-term crew? Is the Shuttle critical to operating ISS

      The Shuttle is pretty critical to the ISS. Yes, you can get people, fuel and supplies up with other means (i.e. Russian rockets) and we'll probably be doing this for some time now.

      But the shuttles were used to do assembly (i.e. spacewalks), bring up the various new ISS modules, and to lift the ISS. Remember that the ISS is a huge beast and slowly sinks due to the small amount of air resistance. The shuttles are the easiest/best way to lift the ISS up to its normal orbit.

      Bottom line--if you think the ISS is a good idea then you'll need to use the shuttles to keep it up.

    4. Re:Why aren't his arguments convincing? by dachshund · · Score: 1

      From what I understand, our older rockets could deliver larger payloads at much lower costs. I suppose we've gotten rid of those, but doesn't Russia have something similar?

    5. Re:Why aren't his arguments convincing? by dachshund · · Score: 1
      This fellow doesn't seem to be committed to manned space exploration

      ...

      I don't think that going over and over to LEO accomplishes anything. If I thought it would be possible to say "OK, we're not going to fly any people for five years, but then by God we'll start flight testing our Mars hardware!" I'd be a happy guy.

      Prior to reading his articles (there's an older one from the early 80s that makes a lot of the same points), I would have agreed that manned exploration is a worthwhile endeavor simply to keep momentum. However, I'm becoming concerned that the constant fiscal drag of the shuttle program, combined with the utter pointlessness of much of the work, is ultimately more damaging to our long-term goals.

      We need to devote more funds to unmanned planetary exploration, because there's so much out to learn out there that we'll never learn by bouncing up and down from LEO. We need to develop more economical ways to get into space. We might also want to encourage private space ventures; though they may not be a replacement for NASA, such ventures have a much greater incentive to seek out economical solutions than pork-driven government projects.

      Easterbrook also makes a good point that we need a larger goal; simply operating the Shuttle for its own purposes is so expensive that it prevents us from coming up with a long-term plan.

    6. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      I'd be happy to scrap Shuttle and ISS, if it came with a hard budgetary commitment to explore the solar system with people. (they'll follow unmanned survey missions, of course)

      Shuttle is a waste. On that, Mr. Easterbrook and I are in total agreement.

      --
      Why yes, I AM a rocket scientist!
    7. Re:Why aren't his arguments convincing? by surprise_audit · · Score: 1
      As you're the one self-confessed rocket scientist posting here, can I just ask what your thoughts are on the possibility of the shuttle dragging its main tank into orbit instead of dropping it and letting it burn up?

      I first saw this in "Descent of Anansi" by Niven & Barnes, and it kind of makes sense, but I don't know enough physics to know if it would really work. The idea is that the main tank is a pressure-vessel that could maybe be converted to living quarters or other uses. It might also carry some amount (several tons?) of hydrogen and oxygen that could be used in life-support, fuel cells, thrusters, or whatever.

      Would that work, or are there very good reasons not to risk it? Even if the tank was bent out of shape during the flight, could it be usefully mined for materials?

    8. Re:Why aren't his arguments convincing? by simong_oz · · Score: 1

      My personal feelings on the future of the space program are ...

      A really interesting read, mostly because my views and feelings of space exploration match yours very closely. But I have a different perspective on this, being (a) from a country that has never, nor will ever, show any interest at all in space, and (b) being just a plain mechanical engineer trying to redirect a career towards building rockets, not a real rocket scientist!

      I've been lucky enough to meet and speak with Andy Thomas, the Australian astronaut employed by NASA, and I understand exactly what you mean by "feeding the human soul and imagination". The guy is an inspiration.

      Not being from the US, I don't have any real understanding of how NASA/congress funding works, but I thought your final comments were really interesting.

      One thing I have always thought NASA have done badly is not promoting the idea that ISS (and hence missions to LEO) is a first step in going to Mars. NASA (the US government) has always publicly given the impression that sending people to Mars is not a goal of the space program, even for the distant future. If NASA had actively stated (at every opportunity) that the long-term goal of the manned space program was to either return to the moon, or (longer term) go to Mars, and that the ISS was a first - and necessary - step toward realising this, do you think this would have changed your (or public) perception of the ISS/LEO program?

      --
      "Because it's there." - George Mallory, when asked why he wanted to climb Mt Everest, March 18, 1923 (New York Times)
    9. Re:Why aren't his arguments convincing? by hcdejong · · Score: 1

      Everything you mention can be done with expendable rockets. Including getting a rocket pack (for maintaining ISS' orbit) up.

    10. Re:Why aren't his arguments convincing? by overunderunderdone · · Score: 1

      So, I want people in space. But I don't think that going over and over to LEO accomplishes anything. If I thought it would be possible to say "OK, we're not going to fly any people for five years, but then by God we'll start flight testing our Mars hardware!" I'd be a happy guy. However, I believe that if we don't keep in the habit (if you will) of putting people in space, we will lose the political will to do it.

      I think our focus right now should be on whatever gives us the most knowledge and understanding for the buck - either manned or unmanned. I think in the long run that will lead us towards our goals the quickest - including manned exploration or even colonization. I think at this point manned space flight has lost it's power to inspire - it's seen as routine and we don't have the knowledge to attempt a mission that would inspire (like a mission to mars). But we could gain the knowledge and expertise we need to attempt something really significant more efficiently (and thus more quickly) with unmanned exploration and tests. Even as PR the shuttle program seems to be a failure - When it comes for bang for the PR buck in inspiring people which has more impact: a shuttle run to the ISS? or color pictures back from Mars? Sadly shuttle flights only have any value in inspiring people when it does something dramatic - like blow-up - not exactly an ideal way to achieve the goal of inspiring people. If the money we have been spending on the shuttle and ISS had instead been put into unmanned exploration of Mars we would know a LOT more about the object of our study and about how to send stuff there reliably. We would also have some REALLY cool photos of awe inspiring martian canyons & mountains that would make a LOT more people say "I want to go there, and I'm willing for more of my tax $$$ to be spent making that possible." In terms of inspiring the next generation of scientists and willingness to fund I think a photo of the sunrise from the slopes of Olumpus Mons or a video of the winding passages of Valles Marineris is worth a hundred milk runs to the ISS, at far less cost.

    11. Re:Why aren't his arguments convincing? by mpe · · Score: 1

      Buran was a 3/4 scale duplicate of Shuttle, not the same size. It also never carried a crew...its one mission was unmanned.

      It isn't so much a clone as a second generation version of the same concept. Being able to make an unmanned flight is probably more of a plus than a minus. It means that test flights can take place without risking lives of a crew.

    12. Re:Why aren't his arguments convincing? by mpe · · Score: 1

      The Shuttle is pretty critical to the ISS. Yes, you can get people, fuel and supplies up with other means (i.e. Russian rockets) and we'll probably be doing this for some time now.

      You could get quite a bit into orbit with a Saturn 5...

      But the shuttles were used to do assembly (i.e. spacewalks), bring up the various new ISS modules, and to lift the ISS.

      Thus the problem is that you need to get the parts into orbit. No need for parts and the construction crews to take their ride to orbit on the same vehicle.

      Remember that the ISS is a huge beast and slowly sinks due to the small amount of air resistance. The shuttles are the easiest/best way to lift the ISS up to its normal orbit.

      Actually the best way is to fit the ISS with thrusters in several places. Trying to push a fragile structure from one place is a bad idea.

    13. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      As Iron Sun posts below, it's not without dangers, but I think it'd be worth looking into.

      I think it would be better to re-design the internal tank to make it more suitable, once we have a proven on-orbit assembly and manufacturing facility. Right now, we don't have the expertise for major construction (precision welding stuff, installing airlocks, etc) in space, so I don't think they'd be useful right now.

      And by the time we have developed that capacity, I really hope we've got something a little more clever than Shuttle. : )

      --
      Why yes, I AM a rocket scientist!
    14. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      Don't sell your country short, friend. Those fellows at University of Queensland have as much or more expertise flying scramjets as anybody else in the world.

      Me, I'm an aerospace engineer who's a lot more interested in the aero part than the space part. Maybe when we both get jobs, we can trade. : )

      I think the ISS is cool for its gee-whiz factor, but I've come to view it as a) too expensive for what it does and b) not useful to get us to Mars, which I believe should be our A-1 short term goal. The book that crystallized my thinking on this is called The Case for Mars, and I never let a discussion about space travel go by without harping on how really really clever this plan is.

      NASA has stated that ISS is necessary for, and will be used for, space exploration. I just no longer believe them. It's not necessary to get us to Mars, and I believe it's soaking up the funding that WOULD get us there. That, in a nutshell, is why I don't support the ISS program.

      --
      Why yes, I AM a rocket scientist!
    15. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      See, I just don't see the scientific take as a compelling argument for continuing space flight. Space is a place where people should go to do stuff. I believe our species is programmed to be inquisitive and exploratory, and when we can scratch those itches (even vicariously through the courage of others) we are better off as a people.

      So, which is better? Another Shuttle launch or color pictures from a Mars rover? For me, it's a wash. Now PEOPLE on Mars, that's something to get excited about.

      We do need to do some preparatory work before going to Mars, but I don't believe we need to do much.

      http://www.nw.net/mars/

      Obligatory reference to Mars Direct plan I like a lot. : )

      --
      Why yes, I AM a rocket scientist!
    16. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      Agreed.

      Note that it also didn't have engines. The main engines were not reusable, and were located on the bottom of the external tank. Buran carried only a de-orbit burn system and orbital maneuvering thrusters. Its engines burned up on the way back into the atmosphere.

      Second generation? I don't think that the addition of teleoperation is a big deal, even though it's a good idea. There wasn't a lot of innovation on Buran.

      Which, by the way, is how the Soviets developed their early fighter aircraft program. Their first jets were direct copies of English designs they used to learn about how the things work. Then they started doing their own designs, and by the Korean War, they had world-class jet fighters. Their airframes have always been absolutely superb designs. Unfortunately (or fortunately, depending on your perspective, I guess), their propulsion and avionics have always been a long step behind the West.

      --
      Why yes, I AM a rocket scientist!
    17. Re:Why aren't his arguments convincing? by ckaminski · · Score: 1

      Excuse me, but didn't Boeing go with Russian engines for the Sealaunch program simply because they were the best engines for the job? Granted, I've heard nothing but bad things about their avionics systems, but I've come across several documents proclaiming their propulsion systems to be top notch. Now I *HAVE* heard that their manufacturing techniques were extremely inferior to their western counterparts (titanium, turbine blades and the like).

      -Chris
      PS: Yes, I am one of those desk jockey rocket scientists, I plainly admit it. But this has been a thoroughly interesting thread, and your contributions have been most intriguing... :-)

    18. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      The major issue with Russia's (jet, very different from rocket) engines was reliability and serviceability. The precision required to manufacture high-performance jet engines just didn't often happen in Soviet factories.

      Rocket engines, by contrast, are a) simpler in terms of part count, b) produced in much smaller numbers, so QA can be better, and c) are disposable, so you don't worry about serviceability concerns.

      Make sense?

      I've been having a blast posting on this thread. Glad I'm not just entertaining myself. : )

      --
      Why yes, I AM a rocket scientist!
    19. Re:Why aren't his arguments convincing? by ckaminski · · Score: 1

      Which echoes what I've heard about the state of Russian propulsion technology pretty closely.

      Yes, I've been having a blast too. I guess I don't make much of a secret that I really liked what the USSR was doing with Energiya. :-)

    20. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      What, blowing 'em up on the launch pad?

      : )

      OK, OK, that was uncalled for. Energiya's a great design. Hope they can get the glitches ironed out. It'll be a great heavy lifter.

      --
      Why yes, I AM a rocket scientist!
    21. Re:Why aren't his arguments convincing? by ckaminski · · Score: 1

      Have they revived Energiya? Last I heard it was being contemplated, and some private firm was thinking of refurbishing the Buran, but I've heard nothing for a year or so...

      You'd think we could do something similar built around the SSME's, right? Aren't they still the most powerful engines in thrust to weight ratio?

    22. Re:Why aren't his arguments convincing? by overunderunderdone · · Score: 1

      See, I just don't see the scientific take as a compelling argument for continuing space flight. Space is a place where people should go to do stuff. I believe our species is programmed to be inquisitive and exploratory, and when we can scratch those itches (even vicariously through the courage of others) we are better off as a people.

      I actually agree with this... BUT, I think at the moment we need more knowledge to reach the point where we can send people on to the next Big Thing(tm). IMO the fastest way to get to that next Big Thing is to acquire that knowledge as quickly and effeciently as possible. I think we should have been sending increasing numbers of ever larger and more sophisticated probes to Mars. Eventually we would reach the point where we would be routinely sending payloads to Mars of equivelent size & complexity to a manned mission - at that point we would be in a position to do just that. The only way the ISS advances us towards Mars is in studying the prolonged health effects of weightlessness - an important problem to consider but one we already know a fair amount about, and only one of dozens, all the others of which we could have been solving with unmanned missions.

      So, which is better? Another Shuttle launch or color pictures from a Mars rover? For me, it's a wash.

      Considering that pictures from Mars are cheaper, advance our knowledge further, and generate far more interest (baring a tragedy) my money is on the pictures from Mars. People were at least interested in the pictures from Pathfinder and they were of a featureless plain that looked like the most boring section of Arizona. If you want to spend $$$ to inspire people instead of glorified milk runs to the ISS that nobody pays attention to anymore how about video from a flying probe as it cruises along a canyon with walls 8km high? I think THAT could capture the imagination in a way the ISS doesn't.

      Now PEOPLE on Mars, that's something to get excited about.

      I agree, but I think for the moment unmanned exploration is the fastest way to get there. We are spending heaps of $$$ on manned flights that aren't really advancing our knowledge or expertise by that much. Learning how to *reliably* send stuff to Mars (probes now, people later), learning where (and if) there is water, learning what other natural resources may be available - all these are things we are NOT learning because we are spending *enormous* sums of money on the Shuttle and ISS.

    23. Re:Why aren't his arguments convincing? by Moofie · · Score: 1

      There's been an idea around to take a Shuttle stack, withot the orbiter, and bolt three or four Shuttle main engines to the bottom of the external tank. Put a payload fairing on the top of the stack, and you've got yourself one big ass rocket.

      Don't know if you could make it so the SSMEs could be recovered and re-used, but that sure would be cool.

      SSMEs are really good motors, but I think the Russians have some bigger ones. As far as weight of the engine itself goes, I'm just not sure.

      --
      Why yes, I AM a rocket scientist!
  36. Plans layed out bu von Braun by olafo · · Score: 2, Interesting

    Werner von Braun had a series of articles and drawings that appeared in the Saturday Evening Post indicating the steps mankind should take in space. We have been following the steps which eventually lead to Mars. The only question is WHEN (during which generation) and who (U.S., China,...).

  37. Duh by bloodylupins · · Score: 1

    How about move the launch site to a less humid location so great bloody chunks of ice don't fall off all the time

    1. Re:Duh by Minna+Kirai · · Score: 1

      Even so, a site in southern Texas, along the coast, would share all of those qualities, or be even better.

      And the humidity would be less. Not like it really matters though. When you've got thousands of liters of liquid oxygen sitting there, condensation will happen from any kind of air.

  38. Cutbacks?! FALSE! by GMontag · · Score: 2, Informative
    Since Congress has been steadily cutting back on support for NASA

    Ahem, I point you to the most recent story on my website you will find this link with a pretty graph
    The data show a clear downward trend under Clinton and an upward trend under Bush. They also shed light on today's spin cycle, and allegations that President Bush's announced $470 million increase for NASA in next year's budget is somehow unprecedented and therefore "political." As shown above, George W. Bush increased funding for NASA by roughly $900 million over a two-year period. By this standard a $470 million boost is right on target, and actually smaller than the increase of 2001 into 2002.
    So, enough with the "cuts" talk, the budget has risen $900 million in the past 2 years and is slotted for another $470 million. If you want to debate whether this is "enough" then fine, but it had been in decline for a while before Bush RAISED it two years i a row and proposed raising it again BEFORE the Columbia re-entry.
  39. Not where but .....how!! by essreenim · · Score: 1

    http://www.uforc.com/research/page42.html

  40. Time for a change by Performer+Guy · · Score: 1

    NASA has struck out more than once trying to design space vehicles. They go over budget and don't deliver then congress pulls funding. They need less beaurocracy and more risk taking, less obtuse human factors (etc) experiments and more direct application of ideas to manned missons. It's unfortunate but Space is dangerous and the price of safety is becomming inability to explore, not increased expenditure.

    Their overheads and procedures cripple most efforts to do anything innovative.

  41. Goals by Yiddishkite · · Score: 1

    I'd like to hear what NASA's goals are for the future first. Are we looking to colonize other planets ? Communicate with other beings ? Better understand the effects of zero gravity ? Most every shuttle mission so far has run a battery of scientific experiments, totalling hundreds over the years. What have we learned from these experiements ? Who have they benefitted ? What more do we have to learn ? We went to the moon a few times. We stopped going. Why ? Did we stop learning ? Will the same be true about orbitting the Earth ?

    --
    "Time flies like an arrow. Fruit flies like a banana." - Marx
  42. It should go on. Period. by dWhisper · · Score: 4, Insightful

    True, NASA has a long history of being a money hog, but it wasn't an issue until they were proposed a budget that was outlandish for anything (The $400 Billion Mars budget proposed by Former President Bush). But the benefits that they have given our economy in the years that they have been around have been huge, not to mention the lift that they have given the research and scientific communities. Without them, there would be nothing like cell phones, satallite communications, large-scale stellar observation (think of the pictures of the hydrogen clouds that have been in every Sci-Fi movie since the Hubble ST took the picture).

    Beyond that, the overall economic contribution that the space program contributes is not just in scientific advancement. People often overlook the fact that while NASA takes billions of dollars in tax revenue, they also provide thousands of jobs. Not just to astronaughts like the heroes (yes, heroes) we lost with the columbia, but people from console operators, to sysadmins, to ground keepers.

    Nothing in the history of the US has been a symbol to peaceful cooperation like the space program has. At the height of the cold war, we were able to work with our biggest enemy on a joint Apollo-Soyuez (sp?) mission. It represents triumph and advancement against odds, from the story of Apollo 11 and 13, to the tragedies of Apollo 1 and Challenger. It's given kids something to dream about, and actually tells us more about the universe we live in.

    The answer is not where it should go, but rather how it should go on. Personally, I would like to see some privatization in the Space Industry, because that would greatly lower the costs of development and space travel. We also need more exploration missions like the Galleleo and Pathfinder projects, which brought a great deal of positive public spotlight to NASA.

    The Pathfinder mission showed that NASA could get something done using economic constraints. However, there is a legitimate need for money just to get some of the basic maintinence done (such as the housing facilities for our remaining shuttles). We need to press farther out than the distance that our shuttles and the space station hit.

    As a personal recommendation, I'd like to suggest a little reading that I found years ago. The Case for Mars by Dr. Robert Zubrin is an excellent book that shows both the feasibility, need, and purpose on manned exploration beyond our local little planet. It shows, realistically, how we could get the project done without an outlandish budget. While the project talked about at the end is no longer around, the MarsDirect project still exists. http://www.nw.net/mars/ Give it a look.

    Remember, NASA is not just about Space Shuttles, but also about exploration and education. Things like those great space picture backgrounds would not be possible without them.

  43. heres what i think by LuckyJ · · Score: 1

    Usually things that are mechanically simple are the ones to be the most reliable. Since space travel needs to become more reliable, I think the shuttle or other spaceplanes are not the answer since we currently have no engine technology to alow us to do it without creating some crazy mess of a solution. I mean, how crazy is strapping yourself to millions of pounds of liquid hydrogen and oxygen and two solid rocket boosters full of volatile chemicals? Just seems like a bit of a hack, albeit the best hack going for now.

    So, step in space tethers. I first read about something like this in Arthur C. Clarke's novels. Quite a simple concept (although by no means simple to contruct). A super strong cable stretches from the Earth's surface out into space. Simple mechanical devices climb the cable to bring a payload into orbit. Hopefully they will make space travel reliable and affordable so that we can get a bigger space presence going. I think we need to sink money into this concept instead of how to more efficiently burn chemicals to rocket ourselfs into orbit.

    1. Re:heres what i think by ckaminski · · Score: 1

      I don't know. 100 years ago, everyone in the world would have thought you a fuel for stepping into a steel can carrying 40,000 pounds of jet fuel.

      And wrt your space tether plan, let it get severed at 300 miles, and it's coming back to earth. And if it's made of a strong material, it's not going to burn up. It's going to make a big hole.

      Neither solution is perfect. The best solution is a combination of both. Getting a space tether to throw things into polar orbits or into planar orbits that aren't in line with Earth's equator will require rocket technology. Might as well have the best rocket technology we can, right?

      Since every bit of material that makes a good space tether a good space tether also would make a lightweight spacecraft and (possibly) a good engine, why not continue building rockets and better engines while we wait for the magic bullet to arrive in the form of 20,000 mile per day carbon nanotube production lines?

      -Chris

    2. Re:heres what i think by ckaminski · · Score: 1

      One other thing: I feel bad about that busload of kids that gets disconnected by a break in the line from a passing (impacting) meteoroid, and who find themselves stranded in a decaying orbit.

  44. 3 prongs are needed by WindBourne · · Score: 1

    1) Umanned missions should continue with a slight change. When sending satallites to a planet, do not send 1. Send several first that are used for support. These should provide computer speed, general planet view, GPS, and most importantly, communication.
    2) W. needs to bring back the X-33 under the civilian umbrella. the X-33 was better than 90 % done. The engines were a great design with minimal moving parts. Likewise, they passed the stennis testing with flying color (yea, I know, they had more to go, but the preliminaries showed great results). The shell was reay for static drop tests. The only real issues were the tanks. The solutions was to use aluminum until the new composite tanks were better. The X-33 would have greatly lowered the cost of flying. Sadly, this was one of W's first action to kill the X-33.A total lack of foresight
    3) We really need to do another "low-cost" shot at the moon or mars. While, I like going to mars, it may make political sense to start colinizeing the southern pole of the moon: water, 24x7 darkness and 24x7 sun. This makes possible life support, on-going energy, and on-going astronomy. Finally, if we do not start a realistic program now, then we will do a crash program when China shows that the current space craft is actually made for the moon (check the size, it was designed for the moon shot, not just orbiting).

    --
    I prefer the "u" in honour as it seems to be missing these days.
  45. Space Elevator by eyeball · · Score: 2, Funny

    I wonder how large a no-fly zone would be required to protect a space elevator from terrorists.

    --

    _______
    2B1ASK1
    1. Re:Space Elevator by Elwood+P+Dowd · · Score: 1

      I wonder how large a no-fly zone would be required to protect a space elevator from terrorists.

      Good point. We should put the space elevator in the middle of Iraq.

      (Yes, I know it has to be on the equator. I'm joking.)

      --

      There are no trails. There are no trees out here.
    2. Re:Space Elevator by surprise_audit · · Score: 1
      Not so much a no-fly zone, as deterrent-by-placement. Suppose the space elevator were placed somewhere like North Africa, such that Iraq would be ground-zero for deorbiting fragments in the event of it being bombed.

      Do you think Saddam would have a word with his boys and ask them to please not bomb it? (Yes, I'm assuming it would fall eastward. No, I have no clue if that's accurate. East, west, whatever - just park it uprange of the terrorist supporting regimes)

    3. Re:Space elevator by Bob+Munck · · Score: 1
      Let's say the anchor asteroid gets disconnected at the top end. The elevator will fall down and wrap itself around the whole of Earth's equator!

      The current plans don't involve an asteroid; you've probably read Green Mars. The space elevator that will almost certainly be feasible in the next two decades will be approximately the width of a sheet of paper, and much thinner.

      Can you imagine the consequences

      If it is somehow severed at GEO, the point of highest tension (and some 22,000 miles from Earth, hard for terrorists to get to), only the lowest fraction will enter the atmosphere slowly enough so as not to burn up. Possibly as much as 3000 kg of cable will make it down to the surface, spread over 500-1000 km. The "consequences" will border on the undetectable.

      If the Space Elevator is severed in the atmosphere or Low Earth Orbit, where terrorists could get to it with airplanes or missles, lightning could strike, etc, not much will happen; the remainder will just move into a slightly higher orbit over a period of days. Just move the counterweight a bit farther out or unreel a bit more cable and the cut end will float down to the surface and can be re-attached. For that reason, the elevator won't be much of a target for terrorists; no huge, spectacular effect like buildings falling or hundreds of people dying.

    4. Re:Space Elevator by ckaminski · · Score: 1

      Well, as the earth rotates East to West, then I presume it would fall into the ocean. Unless it were like a rubber band, in which case all bets are off! :-P

      -Chris

    5. Re:Space Elevator by surprise_audit · · Score: 1
      Like I said, east, west, whatever, just place it uprange, so it would fall onto Saddam (or whoever)

      Would the space elevator reach geosynch orbit? 22,000 miles out, I think... That's a substantial fraction of the Earth's circumference, so it would probably hit several oceans.

    6. Re:Space Elevator by ckaminski · · Score: 1

      I'd rather just drop a whole bunch of 2 ton ball bearings on him. :-)

  46. Why not Antarctica or Sahara first? by targo · · Score: 1

    First, let me say that I'm a big fan of space exploration, and there's nothing in my life that I'd want to see more than mankind spreading out to other planets.
    I see some issues though.
    Throughout the ages, the main power behind any exploration has been greed. Columbus or Magellan would never have got any funding if their superiors wouldn't have been hoping to get enormous profits from these enterprises. In spite of huge losses (Magellan lost ~90% of his men), the profits were even bigger, and the cost to benefit ratio was very low.
    So it is important to observe that nothing significant will really happen unless there is profit involved, be it from mining or something else.
    Now, to put this into a perspective - what can we find on other planets that we couldn't find in Antarctica or Sahara with a fraction of the cost? These two are incredibly more hospitable than Mars or Venus and the cost/benefit ratio of acquiring either materials, energy or any other resources would be thousands of times better.
    But still nobody wants to create any permanent settlements or industry there.
    So why would anybody be interested in going to other planets if we don't even want to get to every corner of the Earth?
    Taking all this into account, I think that the only sensible thing we could do about space exploration is to research ways of terraforming other planets, bringing life to them, creating a more hospitable atmosphere etc. Without this the costs would always remain prohibitive.
    And of course, this would be something that the mankind could actually be proud of - turning a dead rock into a live garden would be much more noble and noteworthy than anything humans have done during their existence so far.

  47. Jet fighters and Missle Defense by Brian_Ellenberger · · Score: 4, Insightful

    Actually, I'm willing to bet we will learn much more from those Jet fighters and that Missle Defense system than we will ever get out of the mostly political Internation Space Station. The F22 will be able to hit supersonic without afterburners. The Missle Defense system is pushing the limits in a bunch of different technologies, including advanced laser research.

    Before you poo-poo Defense Spending remember that you have an Internet because of a certain DARPA project started in the late 60's. The Moon Walk was cool and all but how did it change your daily life? I would argue that the Internet has had a much greater impact on mankind than the moon walk.

    Brian Ellenberger

    1. Re:Jet fighters and Missle Defense by athakur999 · · Score: 4, Funny

      The space program gave us Tang. Don't you forget that.

      --
      "People that quote themselves in their signatures bother me" - athakur999
    2. Re:Jet fighters and Missle Defense by Maeryk · · Score: 3, Informative

      ya think? I dont think the INternet has had all that great an impact on mankind. The moon walk, however, has. Possibly not the action.. but the technology behind it..

      Soles designed for moon boots are used in tennis shoes.. sports bras, portable coolers that run on your cigarette lighter, scratch and fog resistant coatings for your glasses, teflon, composite golf clubs, quartz timing technology, compact hi-yeild batteries.. these are ALL the result of NASA research for things necessary for space flight.

      Digital Imaging Breast Biopsy system, and Laser Angioplasty.. also both spinoffs...
      Im not saying the experimental military stuff is useless.. but damn dude.. NASA has invented or necessitated the invention of a hell of a lot of stuff we all take for granted these days!

      Maeryk

      http://www.thespaceplace.com/nasa/spinoffs.html# To p

      --
      Feminine Protection? What is that? A chartreuse flame thrower?
    3. Re:Jet fighters and Missle Defense by Exiler · · Score: 1

      It's much easier to "pushing the limits in a bunch of different technologies" when you have literally over 10 times the ammount of funding.

      --
      Banaaaana!
    4. Re:Jet fighters and Missle Defense by Virtex · · Score: 1

      It appears to me that NASA is the agency that tests the waters in the name of science. They're the ones who learn about what it takes to make space travel possible, then it's other groups (defense, commercial, etc) that put that knowledge to use. I believe it was NASA that made such things as satellites possible (communication satellites, weather satellites, spy satellites). I also believe it was a former incarnation of NASA that made supersonic flight a reality. The defense department took the knowledge gained from these early test flights to make supersonic jets commonplace today.

      So basically NASA is there to further our understanding of space without a need for profit. With the excessive costs involved in space flight, commercial endeavers will be slow to arrive. Until then, we have NASA. I believe the world is a better place because of them.

      --
      For every post, there is an equal and opposite re-post.
    5. Re:Jet fighters and Missle Defense by WindBourne · · Score: 1

      The Moon Walk was cool and all but how did it change your daily life? Most of our Synthetic insulations the goal of higher energy efficiency the lower costs of flying not just to the moon, but locally as well. DARPA is in many ways the military equivilent of all of nasa's research labs. They have a great deal more money with the majority being black. DARPA also uses a great deal of NASA research. The moon walk changed not only daily life, but our history as well. It made space obtainable, it is just that politics, starting with nixon, has killed it here. It will almost certainly take the chinese shot for the south pole of the moon that will get us past all the politics.

      --
      I prefer the "u" in honour as it seems to be missing these days.
    6. Re:Jet fighters and Missle Defense by stefanlasiewski · · Score: 4, Insightful

      When I say "Christopher Columbus" do you think "European who discovered America"[1], or do you think "New sail technology"?

      Walking on the new world was cool, but how did it change your daily life?

      [1] Or "European who led to a massive wave of immigration" or some other explanation.

      --
      "Can of worms? The can is open... the worms are everywhere."
    7. Re:Jet fighters and Missle Defense by Jus+ad+Bellum · · Score: 1

      Missle Defense???

      Please it's just going to be the Maginot Line with jet power.

    8. Re:Jet fighters and Missle Defense by commodoresloat · · Score: 1

      Not to mention teflon!!

    9. Re:Jet fighters and Missle Defense by Galvatron · · Score: 1
      How much of that was really invented by NASA? Of the stuff that was, how much would have been developed anyway? Example: they list improved aerodynamics for golf balls (it employs "NASA aerodynamics technology," whatever that means). Although they're vague about what NASA's involvement is, I'm sure that golf ball makers could figure out all that aerodynamic stuff today with computer simulations pretty easily. Just because NASA claims credit for it, doesn't mean NASA was the sole, or even a major, contributor. Nor does it mean that the same technology wouldn't have been developed two years later for less money by a company working in that field.

      As for the Internet, we know what the Internet would have looked like without the government. Just look at the AOL/Compuserve/Prodigy services of the early 90's. We would have had dozens of incompatible formats, and all the content would have come from corporate advertisers. I'm a dyed in the wool libertarian, but I give the government a tremendous amount of credit for having created the open framework of the Internet.

      --
      "The question of whether a computer can think is no more interesting than that of whether a submarine can swim" -EWD
    10. Re:Jet fighters and Missle Defense by the_2nd_coming · · Score: 1

      teh excesive costs are there becasue NASA has been lobbied to not move to the next gen space planes.

      --



      I am the Alpha and the Omega-3
    11. Re:Jet fighters and Missle Defense by Moofie · · Score: 1

      OK, trust me. There is NOTHING simple about aerodynamic simulations on computers. NOTHING.

      And as far as justifying NASA's existence, the annual tax revenues from comm satellite-based business pay a significant amount of NASA's funding back to, say, 1950.

      Let us eggheads have some money. We usually figure out how to do some wild cool (profitable!) stuff with it.

      --
      Why yes, I AM a rocket scientist!
    12. Re:Jet fighters and Missle Defense by RedDevilCG · · Score: 1

      Uh, if I am not mistaken are not all the "micro computers" that we all enjoy, and use today largely a result of the pressure that space program put on for faster computers to aid in the flight of rockets/the shuttle?

      If you ask me that is bigger then a jet engine, or an application for laser technology, after all the computer affects almost all aspects of our lives. The Raptors engine does not.

    13. Re:Jet fighters and Missle Defense by XO · · Score: 1

      The government had virtually zero internet presence by the time I got here - about 1986.

      They built the initial pieces of it, and then gave it to the Universities. MIT and UC Berkeley, and a handful of other colleges are responsible for the open framework of the Internet. Ever see an implementation of TCP/IP that WASN'T "Based on Berkeley sockets"? I don't think I have either, except for Berkeley's.

      Don't try to tell me that the people behind BSD and Richard Stallman and his cronies didn't make the largest contributions to the Internet.

      --
      "Champagne for my real friends - and real pain for my sham friends!" http://ericblade.postalboard.com/
    14. Re:Jet fighters and Missle Defense by Ninja+Programmer · · Score: 1
      • [1] Or "European who led to a massive wave of immigration" or some other explanation.
      How about "European who led a genocidal occupation of America".
    15. Re:Jet fighters and Missle Defense by bdan · · Score: 1

      Last time I checked, we DO use some vegetables specific to America. Don't forget about side-effects , we had quite a few of these with space exploration (medical/materials and so on).

    16. Re:Jet fighters and Missle Defense by mpe · · Score: 1

      The Missle Defense system is pushing the limits in a bunch of different technologies, including advanced laser research.

      What are the real chances of anyone attacking the US using a long range missile system? Building a working missile system is hard quite possibly harder than building a working nuclear weapon. Missiles are also not in the least bit stealty, even at the testing stage.

    17. Re:Jet fighters and Missle Defense by fredrik70 · · Score: 1

      Possible, space research isn't only about getting new and exiting product from though. It's also about learning how to move on from this planet before it's too late. As they say, don't put all egg in one basket. We *need* to colonize other places part from earth. Well, in my opinion at least.

      --
      if (!signature) { throw std::runtime_error("No sig!"); }
    18. Re:Jet fighters and Missle Defense by afniv · · Score: 1

      NASA did not invent Tang. General Foods marketed it to NASA which they used for the astronauts. Add water, and you have a nice drink.

      However, there are plenty of other space technology "spinoffs". I believe WD-40 was.

      To learn more check out NASA Spinoffs. There is also a link to examples of spinoffs from Space Shuttle technology. The first link has many back issues.

      --
      ~afniv
      "Man könnte froh sein, wenn die Luft so rein wäre wie das Bier"
      Richard von Weizs
    19. Re:Jet fighters and Missle Defense by tchapin · · Score: 1

      And don't forget Tempurpedic foam!

      --
      -- !todd erases a red dot! I steal music on the internet.
    20. Re:Jet fighters and Missle Defense by orcrist · · Score: 1

      They built the initial pieces of it, and then gave it to the Universities. MIT and UC Berkeley, and a handful of other colleges are responsible for the open framework of the Internet. Ever see an implementation of TCP/IP that WASN'T "Based on Berkeley sockets"? I don't think I have either, except for Berkeley's.

      Psssst. I'll tell you a little secret: U.C. Berkeley is a public university, which means.... you got it! It's the government!

      -chris

      --
      San Francisco values: compassion, tolerance, respect, intelligence
    21. Re:Jet fighters and Missle Defense by Kuad · · Score: 1

      The F22 will be able to hit supersonic without afterburners.

      I'm sorry, were you under the delusion that that is something that hasn't been done before? I will grant that the non-AB cruising speed of M1.6 is impressive, but it's hardly earth-shattering science.

      As for missile defence, the laser-based systems on airborne platforms are really cool and cutting edge. But I think people are referring to the ABM-based system, which is something out of the 60's with updated technology. How is that advancing science?

    22. Re:Jet fighters and Missle Defense by XO · · Score: 1

      Hmm. I suppose that's true. I try not to equate government and universities in my mind, because they really don't seem to have any relation to each other - we occasionally have people with brains that show up in universities - does that ever happen in government?

      --
      "Champagne for my real friends - and real pain for my sham friends!" http://ericblade.postalboard.com/
    23. Re:Jet fighters and Missle Defense by ralphclark · · Score: 1

      I read somewhere that teflon (PolyTetraFluoroEthylene?) is necessary in building spacecraft where it is used to lubricate bearing surfaces, because normal oil-based lubricants evaporate away too quickly in vacuum.

    24. Re:Jet fighters and Missle Defense by ralphclark · · Score: 1

      ...and velcro.

  48. Not so fast by jaymzter · · Score: 1

    Haven't we already discussed here some of the shortfalls of NASA? It seems that the trouble isn't so much a case of money, or the Shuttle program, but a lack of institutional innovation. The Space Shuttle was hot back in the late 70's/early 80's, but what has transpired since then? Not one other lick of innovation as far as getting people into space. It reminds me of when America was working on a version of the SST (think Concorde here), which was pretty hot, then it fizzled. The Space Shuttle is like the American SST, only it got built and then fizzled. NASA earned its street cred, but I'm thinking they've been sitting on it too long. Too many cute inexpensive robots that make the cover of USA Today, with no thought to real plans for replacing the Shuttle. Hell, they made TANG, can't they think of something new in the 30 years since they designed the Shuttle?

    --
    If thou see a fair woman pay court to her, for thus thou wilt obtain love
    1. Re:Not so fast by Flamerule · · Score: 1
      Hell, they made TANG, can't they think of something new in the 30 years since they designed the Shuttle?
      Sure; NASA has funded craploads of advanced projects over the years... it's just that they've cancelled literally all of the programs to design new space vehicles. Most recently, the X-33 and X-34 were canned. Many (most?) of the projects saw promise, but NASA killed them at the first sign of straying outside budget. Yeah, admirable goal, whatever, except it's been 25 FUCKING YEARS since the shuttle and there is NOTHING NEW in the pipeline.
  49. first, a plan, Stan by Tumbleweed · · Score: 1

    Before anything, the entire administration section of NASA should probably be gutted. Or, at the very least, the bozos at the top who have really screwed up things the last several years. The whole "cheaper, faster, better" thing has been a colossal failure. You know you've got serious problems when a simple measurement conversion problem loses an entire mission!

    So, first step, fix the personnel problem at NASA.

    Next, define the goals. Are we going to concentrate on a manned mission to Mars? More probes? More LEO (low Earth orbit) stuff like ISS, etc.? These all have vastly different requirements and budgets, and the manned stuff is much, much more expensive. Unless you can get funding for all of it (not gonna happen, especially with a Republican government and in this economy), then something's gonna hafta give. Until the priorities are set, it's silly to assign budgets, because you don't know what you need.

    For my personal preferences, I'd say cut down on the probes for now and concentrate on a shuttle replacement (DC-X anyone? A craft that can have a fuel tank explode and still make a controlled landing is okay in my book!), and a manned Mars mission. An addition to the ISS to house astronauts until a rescue could be attempted would be nice. (I've been wondering lately - if they HAD been able to verify that there was tile damage done to the Columbia, could they have stayed on the ISS until a rescue craft could be sent?)

  50. "reliability concerns" ? by 19Buck · · Score: 1
    From the nationalreview.com article:
    "Rather than a solution to the fulfillment of these needs, the shuttle has become an awkward legacy. It will never deliver the cheap access its proponents had promised, and after Columbia's loss, lingering doubts will remain regarding the system's reliability no matter what the result of the investigation may be."

    "lingering doubts about reliability"?

    Isn't NASA's lifetime record proof enough?

    a scant 3 major space accidents over a 30-some odd year span.....how many people went up and back down safely in proportion to those lost?

    How many vessels have gone up and back down safely in contrast to those lost?

    "Reliability concerns" my ass.. this is just an excuse for the conservatives to tuck their tails in between their legs, run back into the caves and hide.

  51. Only a space elevator makes true sense by MQBS · · Score: 1

    A space elevator is fast, cheap, affordable, can be created with technology avaible in the next two to there years, and will allow a huge bom in space exploration and be a giant bonus to the worldwide economy, and all for less than the price of developing a new fighter-jet fleet or space shuttle system ($16B each). NASA, make space exploration a reality! Booyah!

    --
    The dream reveals the reality which conception lags behind. That is the horror of life- the terror of art. -Franz Kafka
    1. Re:Only a space elevator makes true sense by Flamerule · · Score: 1
      Are you insane? Or trolling? Or what?

      Alright, let's begin:

      • "fast"? Um, to construct, or in use? Because a space elevator will take a long, long time to construct, and payload on an elevator actually would take several days to come up or down.
      • "cheap"? ROFL. It would be by far the largest and most expensive engineering project ever undertaken. The biggest project, period. Trillions and trillions of dollars over many years.
      • "can be created with technology avaible [sic] in the next two to there [sic] years"? We don't even know if it's possible with current materials science. At the very least, years of research and engineering in nanotech would be required before we knew if we could build it.
      • "will allow a huge bom in space exploration and be a giant bonus to the worldwide economy"? Yes.
      • "and all for less than the price of developing a new fighter-jet fleet or space shuttle system ($16B each)"? No, as I said above, it would cost TRILLIONS AND TRILLIONS OF DOLLARS.
      I like the idea of a space elevator, BTW, and think we should build one as soon as we can... which won't be for another few years.
    2. Re:Only a space elevator makes true sense by Bob+Munck · · Score: 1
      "fast"? Um, to construct, or in use? Because a space elevator will take a long, long time to construct, and payload on an elevator actually would take several days to come up or down.

      Current estimate is two years after construction starts. Payloads take a week to get to GEO, but start up at four-day intervals. That's 12,000 kg to geosynchronous orbit every four days, a thousand tons a year. Compare to current launch rates.

      "cheap"? ROFL. It would be by far the largest and most expensive engineering project ever undertaken. The biggest project, period. Trillions and trillions of dollars over many years.

      Current estimate: $15 billion. Bill Gates could do it himself from his checking account.

      "can be created with technology avaible [sic] in the next two to there [sic] years"? We don't even know if it's possible with current materials science.

      Yes, we do. Tests show that carbon nanotubes should be able to reach strengths in the 150-200 GPa range. We don't need quite that much. Actual working cables in the 10 GPa range have been created.

      There's a huge and somewhat surprising amount of ignorance about space elevators on slashdot. Some, but not all, of it is due to the way they have been portrayed in science fiction. The massive, million-ton constructs of Red Mars and The Fountains of Paradise just aren't the way things are really going to happen.

      The future arrives sooner than you expect, and in a different order.

    3. Re:Only a space elevator makes true sense by MQBS · · Score: 1

      Bob Munck makes all the points I was going to make, so I'm not going to rehash them, but check out this site for the first chapter or the complete, 15 MB NASA report, telling you just how fast, cheap, easy to build it would be. Trillions of dollars my arse, get better informed before you try and pick apart someone's arguments.

      --
      The dream reveals the reality which conception lags behind. That is the horror of life- the terror of art. -Franz Kafka
    4. Re:Only a space elevator makes true sense by ckaminski · · Score: 1

      Actually he couldn't. Bill Gates doesn't have 15 Billion in cash. He's got lots of cash, and lots of stock, most of which is tied up in Microsoft. MICROSOFT could cut the check for it though.

      Where do you get your estimates? How are you going to build it? Space shuttle? What launch vehicle? How many launches? With what materials? How strong do our nanotubes need to be?

      Do you have a source for your plan? How many millions of miles of nanotubes are we going to need? Who is going to produce these nanotubes? How are they getting to orbit?

      So let's be honest here, without a reliable CHEMICAL rocket system, your space elevator/tether is never going to get built. This planet launches what, 20-30 rockets a year, if that? 10% of them fail. That's a LOT of rockets exploding, and lots of nanotubes careening back to earth. How well do nanotubes survive reentry? How nasty will it be if a 10mile long nanotube unspools it's way across Florida or some other country? Now how about a 100 10mile long nanotubes? And how are we going to assemble that giant counterweight?

      We are far from a space tether/elevator. 20 years, possibly more. Let's face it, anything over 20,000 miles long is going to weight a LOT. Asking for 50 tons per mile, probably a good bet.

      I'm not really attacking your idea. What I'm attacking is the idea that somehow a space elevator is a panacea. It's not. We *WILL* need reliable rocket transportation to make it a reality. All those workers building that elevator will need transportation to and from the construction site. You won't want a robot doing it, because it might just let the tethers go, and leave you with a really nasty problem years down the road when the cable rips your beautiful tether to pieces (granted, humans can do this too). That material will need a way up into orbit, it's not going to get there itself. And you'll need to clean up LEO and GEO as well to ensure your tethers/elevators don't get destroyed. Investing in better rocket transportation systems now makes building your tether that much easier.

  52. Increase the budget by falsification · · Score: 1
    The first step is to increase the budget. Bush proposes to give NASA about $14 billion next year. Yet, that is only 0.6% of his proposed $2.2 trillion federal budget. It's just enough for the creaky space shuttle program and little else.

    We should double NASA's budget to at least the $30 billion level per year. Give NASA the mission of establishing a lunar base and a journey to Mars. Tell them to get both done within 10 years. Attract the very best scientists and engineers to NASA.

    That provides the parameters. Only then can you decide what intermediate technology do you need to get there. The obvious missing link is a reliable, cheap replacement for the space shuttle. I personally think the space plane will be the superior alternative, but all the options should be studied. Then you look at whether the ISS would be useful.

    China will put a man in space this year. If China is putting men into space while we're sitting on our hands, the USA will cease to be the only superpower. China will be in position to spread its influence, and thus totalitarianism, across the globe. This is about whether the world, and space, will be free, or will be dominated by ruthless dictators.

    1. Re:Increase the budget by Jeremy+Erwin · · Score: 1

      What is it about China conquering space that induces paronoia? It's a bit of an SF cliché.

  53. Teleportation by WesG · · Score: 1

    While many think this is a long way off, I believe teleportation will change how we view not only space exploration but everyday travel on Earth itself.

    Those crazy physicists are trying a bottom up solution to teleportation - trying to create/destroy little bits of matter, the whole Alice-Bob deal. I say NOOOOOO! and suggest a top-down approach.

    Lets figure out how an object moves in space - I bet the answer to teleportation is much simplier than many think.

  54. Unmanned Craft/exploration by Keithel · · Score: 1

    The smartest thing to do IMHO would be to just phase out the manned portion of space exploration for a while... it's *much* cheaper to send unmanned probes/sattelites rather than manned craft.

    OTOH, we cannot forget about the space station, which currently needs constant human attention to keep up. What should be done in the lab down here is to design new systems or extend the current systems aboard the ISS, such that it can be extended soas to keep itself in a constant, usable or ready-to-use state without human intervention. The minimum requirements would be to keep the station automated and self sufficient when no crew was aboard. This could be extended to being automated while crew was aboard, but is not necessarily a requirement.

    Once the ISS is fitted with these automated systems, manned spaceflight could be stopped or postponed at any time, leaving us to focus on unmanned exploration. Heck, why not work on building an unmanned lunar-station builder? Once the station is built, *then* we could send people up there.

    1. Re:Unmanned Craft/exploration by ckaminski · · Score: 1

      I'd be willing to bet that the next few years will bring us more Deep Space 1 type ion engines to affix to points on the ISS to keep it boosting. Low thrust velocity to keep from destroying the station, extremely good fuel capacity. The problem is, will they work at the ISS orbital altitude?

      I'm not a big fan of stopping progress anytime, because once you stop, it's too easy to stay stopped. I'm all for scaling back in the interests of safety, as long as a positive plan of action is in place. As much as I hate the pork that is the ISS, I don't want to see it just discarded. I want it finished and doing the job it was meant to do.

  55. Manned Spaceflight is important. by Chanc_Gorkon · · Score: 4, Insightful

    Humans can do the things that robots cannot do. Humans can see the sights and be able to tell when a sight would take a good picture. Humans can make course corrections and such to avoid their craft crashing down. Humans can do science that is impossible for a robot to do. The shuttle needs to fly again and we cannot wait 2 years or more like we did when Challenger was destroyed. Remember, there are two American's and a Russian in space and a good chunk of American hardware up there. The Shuttle is needed because it's the only way the station has for maintaining a orbit. Boosts given by a docked shuttle using the OMS since the budget was cut to eliminate the module that would give the station inhabitants the ability to maintain the orbit on thier own. Single Stage to orbit and other alternatives need to be studied now. Not 10 years from now. The shuttle could make another 20 years, but in that 20 or before that 20 is up a alternative needs to be developed. Mars could be a destination for humans, but we need the station for this. Right now, I would be willing to increase my tax burden to make this possible if I had to. I would also rather there not be a stipulation that it would be used for the mars project. NASA Knows what they are doing. Safety concerns were raised recently due to the decreased budget NASA has. That tells me NASA knows that they were flying on a wing and a prayer, but could not do anything about it. Parking the shuttle in the interim for longer then about 6 months is not acceptable. Of course now it's ok, but sooner than later it will have to fly. Right now, there is no other alternative.

    --

    Gorkman

    1. Re:Manned Spaceflight is important. by NeuroManson · · Score: 4, Insightful

      Additionally, humans have one thing robots cannot: Imagination.

      They have the ability to, in a pinch, come up with solutions to problems that no machine technically can. When they had to build a CO2 scrubber from spare parts on Apollo 13, do you think a robot with the same computational power available in those days could have done the same? Of course not.

      Additionally, humans seeing an anomalous phenomena would be immediately intrigued by it (such as nebulae, et al), and would set to studying it about as quickly, possibly even discovering something otherwise completely unknown. A robot would see known gasses, shrug because it's known, and ignore it, going on its way (forget about human intervention, when you're talking outside the solar system. By the time we find out it found something, it's long flown by).

      And one other critical factor: Humans have a survival instinct. Robots do not. Humans, when threatened, can respond almost immediately. Robots cannot.

      --
      Just because you can mod me down, doesn't mean you're right. Shoes for industry!
    2. Re:Manned Spaceflight is important. by sheddd · · Score: 1

      Humans can do the things that robots cannot do.

      Robots can do more per volume & weight (especially if you count food, water, air (yup flammable)).

      Humans can see the sights and be able to tell when a sight would take a good picture

      If the space program is about pretty pictures (i.e. not scientifically useful) I'd rather spend my tax dollars elsewhere.

      Humans can make course corrections and such to avoid their craft crashing down

      Not as well as a computer.

      Humans can do science that is impossible for a robot to do

      So do it. If you need to perform an experiment in space program or control a computer/robot.

      If you think it's a smart move to keep the ISS going, keep it going with something cheap and reliable like rockets; the space shuttle was a flawed concept from the beginning; we could have accomplished all we have so far in space much cheaper without manned flight.

      I say junk the shuttle and get some charismatic person to put the fire in the populace (so they'll pay for it) to accomplish a real goal in space. All we're doing now is providing public entertainment.

      I don't have the awnser; we need to do something to stimulate innovation in space travel rather than boring TV (sometimes tragic TV). Perhaps a moon colony?

    3. Re:Manned Spaceflight is important. by sheddd · · Score: 2, Insightful
      I agree what the folks on the ground and in the air did during the Apollo 13 mission is flat out amazing... but they wouldnt've needed scrubbers if they didn't send up humans.

      Let the humans on the ground be imaginative and send commands to the vehicle. Then we can afford to send 10 vehicles instead of one.

    4. Re:Manned Spaceflight is important. by the+gnat · · Score: 1

      Humans can do the things that robots cannot do.

      Yeah, like, die. And at many times the financial (as well as moral) cost.

    5. Re:Manned Spaceflight is important. by Elwood+P+Dowd · · Score: 1

      And one other critical factor: Humans have a survival instinct. Robots do not. Humans, when threatened, can respond almost immediately. Robots cannot.

      So what? For the money you save by sending up a robot... let the robot be destroyed. Since you'd get to do ten times as many missions, you'd have many many more successes. And no one dies this way, either.

      Also, your arguments based on critical thinking capabilities completely miss the mark. The advantage to humans is their physical abilities. We have very sophisticated sensory and motor abilities that are difficult to duplicate with mechanics. However, everything that requires critical thinking (determining how to build scrubbers, for example), is done by humans on the ground. This is whether or not there are humans in the craft.

      As far as ability to determine items of interest outside of the solar system... that is the least relevant complaint I've ever heard. We can worry about that in 100 years. And I think that a relatively simple expert system *could* solve that problem.

      Wait a second... have I been trolled?

      --

      There are no trails. There are no trees out here.
    6. Re:Manned Spaceflight is important. by DunbarTheInept · · Score: 1

      The fact that the shuttle is a waste has nothing to do with it being manned. It has to do with it being a half-assed compramise between reusable and expendable that used the worst features of each. The Russian Soyuz is manned, and very very cheap. Abandon the shuttle? Absolutely. Abandon manned flight forever? Hell No! Getting *us* off this rock should be the first motivation. All space research should be toward the goal of making a better means of getting into space so the cost of sending people isn't that big of a deal anymore. If you can carry more kilograms, that benefits the future of BOTH manned and unmanned spaceflight.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    7. Re:Manned Spaceflight is important. by tony_gardner · · Score: 1

      Explain to me again why a robot would need to build an oxygen scrubber?

      One of the factors which argues for using robots is simplicity. Not of the robot itself, but all of that stuff which breaks, and is heavy:
      Pressure shell
      Oxygen system
      water system
      room to move
      exercise equipment
      Is not needed for a robot.

      Let me do a thought experiment. Take those 7 astronauts. Say they have a (conservative) combined weight of 560kg. Say in addition that all the life support stuff weighs about the same.

      Those astronauts (7 people) plus trainers (say, 20 people) have trained for (say) 1 year to get on that mission.

      You can substitute your own numbers.

      Take then those 27 people, and give them 1 year, and 1 tonne to build a robot. Could it do 90% of what those astronauts could do?

      I think so.

    8. Re:Manned Spaceflight is important. by IamTheRealMike · · Score: 1
      Additionally, humans have one thing robots cannot: Imagination.

      So? For most stuff we do in space imagination is a curse, not a blessing. It's extremely boring, and there are millions of possible threats, that could kill you at any moment. Imagining them just makes it worse.

      They have the ability to, in a pinch, come up with solutions to problems that no machine technically can. When they had to build a CO2 scrubber from spare parts on Apollo 13, do you think a robot with the same computational power available in those days could have done the same? Of course not.

      Ignoring the fact that robots are a) expendable and b) much simpler to keep alive than humans, so such a scrubber would have been unnecessary, I think this is more an argument for improving AI than sending humans into space.

      Obviously in "those days" robots couldn't have done it, but these days they probably could have done. And in terms of applications here on Earth, advances in robotics would probably pay for themselves.

      Additionally, humans seeing an anomalous phenomena would be immediately intrigued by it

      You're assuming they would see it and know it's anomalous. Humans can't process anywhere near the amount of raw data machines can - an anomalous nebulae would probably be more obvious to the computers than the pilots.

      A robot would see known gasses, shrug because it's known, and ignore it, going on its way

      If it's known, then presumably it's not anomalous.

      And one other critical factor: Humans have a survival instinct. Robots do not. Humans, when threatened, can respond almost immediately. Robots cannot.

      How does that work? Robots are expendable anyway, so it's not like they need highly tuned survival instincts, but the latencies for machines to react are so much better than humans that all things where human life may be at risk, especially in flight, are nowadays computer controlled (autopilots etc).

    9. Re:Manned Spaceflight is important. by Chanc_Gorkon · · Score: 1

      Of course we can die. You mean to tell me that if you had the skills and the offer to train to go up in these and actually do it that you would not? Shame on you! Going in space is an experience any astronaut never forgets. They love it. It's what they do. If it was not for Columbus and others going off in boats to the unknown America itself would not even be here. Sure it's risky. But if we always stuck with the tried and true, would we have anything that we have today? Would we have TV? Would we have computers? Would we have electricity? If we send robots out, we deny ourselves the experience. We be sheltering shelter ourselves. I am not saying that Robotic science is not valuable. It is. But so is being there. So is being at the location and actually doing this work. Driving around in a rover. Walking on the moon. Picking up interesting looking rocks. Robots would not look at a rock and say it's pretty and pick it up and study it more. Robots could also only detect what is at the surface and what is slightly below the surface of that rock. Sensors on the robot can only detect so much. Bringing that interesting rock home lets us be able to truely spend time and analyze and study the rock and find out what a robot can't tell us. Also, exploring with robots also has the downside of only being able to explore what you can with the energy you bring or can produce on the spot. Sure an astronaut gets tired, but an astronaut can sleep and be just as good the next day. An astronaut can also push the envelope. Machines can too, but with less reliability. If a machine gets pushed too far, it just breaks. If a man gets pushed too far, he can rest. A driven human being can achieve so much more then a robot. Robots may peform better then a human sometimes, but a robot has no heart to guide him. He has no ambition and no emotion. Some say human emotion is a frailty, but I say it's a strength. In order for a machine to do something it has to be designed to do it. Machines sometimes can do more then it is designed for, but not too often. A human can do anything he puts his mind too. Is their risk? Yes. But that does not stop people from lining up to be astronauts. If my son wants to be an astronaut and can do it, he has my full support. Oh and this is not really a moral issue. It would be if we just launched people who did not want to do it. These astronauts wanted to be there. They were not forced to do it. There was no gun at their head saying you must go. They wanted to be there. They were excited about going.

      --

      Gorkman

    10. Re:Manned Spaceflight is important. by Steve+Hamlin · · Score: 1

      Human have the ability to, in a pinch, come up with solutions to problems that no machine technically can. When they had to build a CO2 scrubber from spare parts on Apollo 13, do you think a robot with the same computational power available in those days could have done the same? Of course not

      ===== =====

      Well, had humans not been required to be on the craft in the first place, there wouldn't have been CO2 scrubbers that needed fixing. Right?

      While there are roles for manned space missions, the problem is that we've gotten ourselves conditioned to think that most missions require human presence. That simply isn't true these days.

      At distances that impart time-delays on radio transmissions, humans might need to be present more often. But in Earth orbit? Why? We can currently build extremely robust and independent robotic systems, and we could always choose to manually direct actions from the ground if problems crop up.

      Get rid of humans, and the complexity of launch systems goes down by large factors. Complexity = cost. No humans = disposable. The Easterbrook article everyone is mentioning asks "who cared when we lost several satellite launchs in the past year? No one except the insurance carriers."

      10x as many missions on the same budget, failures cost smaller $ and no lives. More frequent and cost effective R&D paves the way for good results on the few human missions where human presence is required.

      It makes sense to me....

    11. Re:Manned Spaceflight is important. by Magius_AR · · Score: 1
      Additionally, humans have one thing robots cannot: Imagination.

      They have the ability to, in a pinch, come up with solutions to problems that no machine technically can. When they had to build a CO2 scrubber from spare parts on Apollo 13, do you think a robot with the same computational power available in those days could have done the same? Of course not.

      A machine wouldn't have needed the CO2 scrubber in the first place :)

  56. Where Should Space Exploration Go From Here? by arcadum · · Score: 1

    UP!

  57. A better way to explore the cosmos by eyefish · · Score: 1

    Most anyone I know is of the opinion that manned space exploration should go on, and although my adventurous romantic side wants the same, my rational side begs to differ.

    Most costs associated with space travel have to do with the fact that space ships are manned. Take humans away and all of a sudden the costs plummet.

    A good accountant not familiar with the space industry would say that that's not the case, but once you realize that a huge amount of money actually goes to researchers and engineers whose sole purpose is to make the astronauts safe and to provide for all their needs (and space-taking) in space, you'd quickly realize that the money should go somewhere else.

    But where should the money go? I suggest to better autonomous robots, to research in remote virtual environments, to better artificial intelligence. Research in these areas would lead to smaller vehicles (or the same size but with bigger payload, cheaper vehicles (since the human safety aspect could be discarded), longer missions (a robot can live in space for as long as we can supply an energy source to it), more complex missions (a robot-based mission to mars is way less complicated than a human one), and probably get more research done (a robot never needs sleep and can do several things simultaneously and with a low error percentage).

    Of course, for the time being a robot will never get close to human intuition when it comes to improvising or noticing "funny but interesting things" that could be of crucial importance but that a robot would never notice. This is why we need to invest heavily on new and novel ways to think about artificial intelligence.

    Who knows, maybe in the future once we have mastered the heavens with robots it'd be safer, cheaper, and more practical to flight humans again. But in any case, the long range future of space exploration belongs to intelligent machines who will be our direct descendants as they succeed us by the pure laws of evolution.

    And on a side note, I'm pretty much certain that such machines will have feelings just as we do (or maybe even more so), and in a sense they truly will be humans, just not flesh-based, and they will be better than us in every way. I wish they could read this sometime in the future, so that they know there many of us alive who would feel very proud to be alive and experience the time when such events will happen.

    1. Re:A better way to explore the cosmos by ShooterNeo · · Score: 2, Insightful

      Right on. You see the truth here. As for "funny stuff a human might notice" : well, in the short term before anything resembling real AI is built, human operators would analyze the output from the robots. The probes would drive around exploring on their own perhaps, and be ordered to investigate interesting phenomena by their human masters when they see it. And if you are just exploring the moon, the speed of light lag is low enough that direct remote control operation is practical. You'd have about good a senses through the probe's high res cameras and senors as you'd get inside a bulky, armored spacesuit and have more time to explore to boot. Also, without all the "overhead" supporting humans most of our space program's resources would go to its stated purpose....developing and trying new techology and learning about our universe, not blasting test pilots into space.

    2. Re:A better way to explore the cosmos by dputzter82 · · Score: 1

      Your use of the word 'better' is questionable. Just like Star Trek I, I highly doubt these creations will be able to have their own sense of purpose, other than self preservation, or possibly some exploratory sense we give them.

  58. Couple things by Grieveq · · Score: 1

    1) Finish the ISS and follow the original plans to be a 7 man station. The amount of research from a permanent outpost in space is well worth the amount of money.

    2) Replace the shuttle program. The shuttle has served its purpose as a reusable space vehicle. But it's design is 30 years old and needs to be replaced.

    The upfront costs would be steep, but it will save you billions in the long run. A fleet of four (Now 3) 2 billion dollar shuttles that launch at max 6 times a year for 500 million a shot IS NOT the way to go. We need something that can launch us into space for less then 50 million, carry more cargo, and have a turn around of at least once a month. This is even worse then the shuttles initial promises, but it's something that could easily be obtainable with today's technology.

    3) The private sector needs to get involved. Space elevators and the like would be a tremendous boom to really entering the next frontier. What if your University only had to pay 10k to send up into space their newest experiement? Think of the boon to technology then.

  59. Here's an idea. by sweetooth · · Score: 1

    Cut the defense budget by half and give that money to NASA. That's an idea I would support. Though I seriously doubt my representatives would go for it at all.

  60. Manned Space Exploration: by Maeryk · · Score: 2, Interesting

    Options for vehicles:
    The "flying box-car" we have now.. either in current config, or structurally refigured to a more current design.. (this design was finalized in the seventies, remember). The Shuttle is a great idea.. but its _old_.

    ram-driver/mass-lifter.. bung a ruddy great magnetic impulse tube up the side of Kilimonjaro or something, and use that to hurl crap into space. use small gadabouts to retrieve said stuff to the station/s. All we need then is a relatively small (read: 3 crew, small) craft to get people up there to service, position, etc.

    Re-useable self launching vehicle.. Delta Clipper style. Though Buzz Aldrin seems to think it is a step backwards, the videos of the tests at White Sands are quite impressive. (Even if it _did_ fall over and blow up on the second test). Extremely "Flash Gordon" and evoked mental images of the "bounce rockets" that Heinlein usually had laying about.

    I personally think a shuttle-type craft is the way to go. its not a bad idea, its just an old idea that could do with some updating.

    As far as funding goes, let NASA patent its inventions, for a change, and let them charge for spaceflight. Citizens in space? No problem.. sign that fat juicy check and you can ride shotgun, Mr Billionaire! Just sign this D/D waiver.. have a nice trip!

    Its time to stop treating NASA as the bastard stepchild of the US.GOV and begin viewing it as the scientific testbed it is. NASA's only vehicle, at the moment, is the Shuttle. All the other rockets (Titan, ESA stuff, etc) are owned by other countries or by the Armed Forces.

    Unfortunately, NASA is the first one to get their budget slashed whenever belts get tightened, and five minutes after vehicle blows up people who control said budgets promise to "spend whatever it takes" for safety. Then they slash the budget some more. How else do you explain a 20+ year old spacecraft still flying routine missions?

    (And no, ejection seats wouldnt have helped.. even if the pressure suits could have kept them alive at 40 miles up, I think the mach-18 or so speeds would have presented an issue the instant the canopy popped).

    I love NASA, I love spaceflight.. im tired of it being viewed as a joke until something (experimental and dangerous) goes wrong, and then CNN is glowering at me, accusing me of not even knowing the orbiter was coming home today, or who was on it. (The press is 2/3 of the problem, I suspect. The minute a launch gets scrubbed, they get pissed, and 10 minutes after an accident, they are demanding accountability and raking up stories about "fired" directors (who actually just ended their tenure, according to o'keefe).

    Maeryk

    --
    Feminine Protection? What is that? A chartreuse flame thrower?
  61. Restructure or stagnate by God+of+Lemmings · · Score: 1

    I am seriously beginning to believe that for any reasonable progress, NASA would have to be restructured, or dismantled so a new organization could be formed. (Simply go to google and look for 'NASA > corruption' to see what I'm talking about.) Any new paths in space exploration won't be fruitful without both affordable practicality of designs and something to get around the present bureaucratic nightmare. Otherwise we are just going to sit and do the same old tired thing.

    --
    Non sequitur: Your facts are uncoordinated.
  62. It's Them! With a capital "T"! by Shouichi · · Score: 1
    The main problems with space technology and development of said technology today are politics and money.

    Why do we have dangerous manned-spaceshuttles? Because it impresses people! That's politics!

    Why don't we just develop a good space ship? We have the resources! Because it costs money! And politicians (see problem 1) don't like losing money to practicality!

    Yes, I know I sound cynical, but it IS that simple. Now if only a solution were present..

    --
    "I see Windows users..."
  63. I worry about future of space exploration by bigberk · · Score: 1

    There's more than one reason NASA is in trouble. It looks like the current government might not be interested in spending so much on science and research (big surprise?). A foolish mistake for the short-sighted, IMHO.

    The following is quoted from IEEE Spectrum, January 2002. "New NASA Administrator is Bush Insider"

    Appointment meets with cautious optimism

    Sean O'Keefe, the deputy director of the U.S. Office of Management and Budget (OMB), was named the next NASA administrator by the White House on 14 November. The nomination has met with cautious optimism in Washington and, despite his lack of technical experience, in the aerospace community as well.

    . . . A spokesperson for Senator Ron Wyden (D.-Ore.), chairman of the Senate Science, Technology, and Space committee, agreed, saying that the senator believed O'Keefe's background "will be very useful in solving some of NASA's long-term management problems." . . .

    O'Keefe's management history indicates not only great financial experience but also close ties with members of George W. Bush's government. During the previous Bush administration, he worked with Dick Cheney in the Department of Defense as comptroller and chief financial officer before being appointed Secretary of the Navy in 1992 . . .

    . . . while NASA employees "have an interest in having their credibility increased," surely they also feel some trepidation at the arrival of such a cost-conscious administrator. "They're frightened to death," agreed Christopher C. Kraft Jr., who was NASA's first flight directory an director of the Johnson Space Center in Houston from 1972 to 1982.

    . . . Echoing a NASA task force report in his testimony, O'Keefe said that "technical excellence at any cost is not an acceptable approach." . . .

    O'Keefe said that NASA should be freed "from the burden of operating infrastructure," and recommended the "continued privatization of the space shuttle" and the creation of "a non-governmental organization to manage [space station] research."

    . . .

  64. Here's what NASA Wants by Fished · · Score: 1
    This article details NASA's budget proposal. Short form? Shuttle upgrades, nuclear deep space propulsion, and maybe a jupiter mission.

    For what it's worth, I feel rather strongly that we need to solve the cost-to-orbit problem first - which will then make all the other science cheaper. The beanstalk idea is a good one, but I don't know if it will be viable in the next ten years, so one might also look at the old "National AeroSpace Plane" concept. The concept will work - if congress will fund it. Reducing the complexity of getting to orbit is the ONLY thing that will prevent another shuttle disaster. Its a 30 year old design now; we can do better.

    --
    "He who would learn astronomy, and other recondite arts, let him go elsewhere. " -- John Calvin, commenting on Genesis 1
  65. Tax Proposal. by Psyko · · Score: 1

    This discussion has been brought up before, (the opt-in tax option) and I still think it would be a good idea. I don't think that you could justify all of your tax dollars to go to space related R&D but you should definitely be able to push a fixed percentage and/or a portion of your refund into this type of fund.

    Does Nasa currently have any facilities set up to accept donations??

    --
    01:36AM up 426 days, 2:46, 1 user, load average: 0.14, 0.11, 0.05
  66. A better question by stendec · · Score: 1
    The pundits have asked alot of important questions regarding America's space program in the wake of Saturday's tragedy. There's been alot of speculation and I guess there is going to continue to be alot of speculation until the speculation ends. But there is one question that none of the talking heads have addressed, and I feel it is finally time to address this critical issue:

    Should the space program be replaced by interpretive dance?

  67. With no Aim, how can the current program miss? by Dr.+Transparent · · Score: 1

    A huge issue with NASA and our space program at this point is the lack of a long term vision for space.

    Yes we have accomplished a lot. We have a reusable (though not as reliable as one would like) orbiter, a space station that continues to grow. In fact, it has been a matter of years since there were no humans in space at some point. All of this is great and grand, and I appreciate all that we have accomplished. Looking at the achievments of humans in the past 50 years is astounding.

    However, we are at a point (and in my opinion we have been here for quite some time!) where we have no unified aim within our space program. We don't have a goal. i.e. "Let's get to Mars within the next 15 years" or "Let's establish a livable habitat on the moon within the next decade", etc. We are doing great research in space, and learning a great many things because of that. But without a vision that people can be rallied behind we can expect nothing less than the stagnancy that we are currently experiencing.

    The space station is a great stepping stone to greater things. Let's set a vision of what those greater things are and move in that direction. And pray for a President and NASA leadership willing to spend money on that vision.

  68. porn by farnsworth · · Score: 2, Funny
    Space travel, like all technology, will not become cost effective until the pornography industry adapts it as a sales channel.

    That, and it really *is* silly that we send up so much oxygen and water with a lot of missions. Remote control is the future.

    --

    There aint no pancake so thin it doesn't have two sides.

  69. get your a$$ to mars by lycaeum23 · · Score: 1

    Screw it. Let's build the Nuclear Rocket we've been teased about lately and explore the solar system already. The annual cash involved can't be more than the rounding error for Medicaid or Social Security. Better than seeing the money wasted on new union concessions for federal workers or funding a new exit ramp in Mississippi... Besides, whose going to do it, Belize? Uganda? USA all the way, baby!

    No, how do we sell this to 'W'?

  70. quite honestly by Adler · · Score: 1
    Though I do believe it's far past time for a new space vehicle, if NASA called me right now and asked me to go tomorrow, I wouldn't even have to think about it, so if you're reading this guys, I can have a bag packed in 20 seconds *wink wink*. Accidents will happen, they have before and they will again, even when it's as bad as loosing a crew, good can come from them if you choose to learn from them. If the news media and the law makers don't screw them over, they will NASA, always has.

    The only thing the space programme lacks is new, better, cheaper ways of doing what they do, because they're stuck with their old tools to do the job with. Thats where the programme needs to go, the money people need to stop making get by using a screw driver to drill a hole and just let them spend the extra cash on a drill already.

    --

    Everybody denies I am a genius--but nobody ever called me one!

  71. Tether by Anonymous Coward · · Score: 1, Insightful

    1. give NASA a little more tax money
    2. put a $1 deduction checkbox for NASA on the tax forms
    3. build a tethered space elevator with carbon nanotubes or whatever
    4. use the elevator to build a REAL space station like the one in 2001 with "gravity"
    5. build ships at the station for Mars, Europa, etc..
    6. start commercial operations for mining asteroids and collecting orbiting debris and stuff
    7. use the ISS to store crap that won't fit on a real space station or deorbit it into the Pacific

  72. Power Generation by HorrorIsland · · Score: 1
    This is kinda off-topic, but why isn't there more focus on space-based power generation? The earth only captures the tiniest fraction of the Sun's total energy output - there must be a good way to collect a few of those unused rays and deliver them to the earth's surface, safely and economically.

    Slightly more on-topic, that sort of mission might be enough to justify significantly more dollars for space exploration.

    1. Re:Power Generation by ShooterNeo · · Score: 1

      Do you understand the concept of "if it takes more resources to gather a resource than said resource provides, you lose resources". For instance, if it takes more energy to dig the oil out of shale than you get from burning this oil, you are getting nowhere. Current technology would require expending far more energy to construct orbital power stations than the station could ever gather.

    2. Re:Power Generation by HorrorIsland · · Score: 1
      Do I understand the concept? Hmmm. It's a strain, but I think I've got a slight glimmer.

      You say, "Current technology would require expending far more energy to construct orbital power stations than the station could ever gather."

      I say that's a pretty sweeping statement. Who has done the sums? And have they truly considered every possiblity available to current and near-term technology? Do you have links?

  73. Find USEFUL short-term goals America supports... by veddermatic · · Score: 1

    Like finding the planet Bush comes from and then taking him back ASAP.

    But seriously like, in our instant gratification society, NASA needs to say "we're going to do 'this' which will provide 'this benefit' to YOU the taxpayer, and we're gonna do it in less than 3 years."

    If they don't, NASA is screwed... hell, those SUV driving folks in the 'burbs can't even handle slight tax increases for the schools thier KIDS go to....

    --
    Department of Homeland Security: Removing the rights real patriots fought and died for since 2001
  74. Yes, Space Travel Has to be Expensive. by blair1q · · Score: 1

    You don't just load a big tube with dynamite and barcaloungers and expect to land on the moon.

  75. The Budget Sucks by Read+Icculus · · Score: 4, Informative

    Money certainly is the problem. NASA, and space exploration needs to be a higher priority than some of the garbage we pour money into. Here's some numbers -

    NASA's budget for 2003 - now $15.5 billion after the Columbia tragedy

    Military budget for 2003 - $396 billion

    Now of course I think the military needs a massive amount of money, but they spend it like water, and on things that we do not need.

    Here's an example of new weapons we are buying that are included in the 2003 budget -

    the Army's RAH-66 Comanche helicopter (Boeing and the Sikorsky Aircraft Division of United Technologies, $941 million); the Air Force's F-22 Raptor (Lockheed Martin, Boeing, and the Pratt and Whitney Division of United Technologies, $5.2 billion); the Navy's F-18E/F fighter plane (Boeing, General Electric, and Northrop Grumman, $3.3 billion); Joint Strike Fighter/F-35 (Lockheed Martin and Northrop Grumman, $3.5 billion); the V-22 Osprey (Boeing Vertol and the Bell Helicopter Division of Textron, $2 billion) the DDG-51 destroyer (Bath Iron Works and the Ingalls Shipbuilding Division of Northrop Grumman, $2.7 billion); the Virginia class attack submarine (Electric Boat Division of General Dynamics and the Newport News Shipbuilding division of Northrop Grumman, $2.5 billion); the Trident II Submarine-Launched Ballistic Missile (Lockheed Martin Missiles and Space, $626 million); and the Crusader artillery system (Carlyle Group/United Defense, $475 million).

    Total - $21.2 billion

    These are known as "cold-war relic" programs. In fact, many of these systems were mentioned as candidates for major reductions or cancellation during the Bush campaign and during the early months of Secretary of Defense Donald Rumsfeld's defense review. In addition they have been criticized in the past by Bush advisors or independent advocates of military reform as being too heavy (the Crusader), redundant (the three new fighter plane programs), or otherwise out of step with our current situation.

    If our space shuttles could bomb Iraq we would be getting new ones all the time.

    --
    Anti-social? My code is just platform-specific.
    1. Re:The Budget Sucks by Vadim+the+Conqueror · · Score: 1

      If our space shuttles could bomb Iraq we would be getting new ones all the time

      i dont see why they cant.

    2. Re:The Budget Sucks by Read+Icculus · · Score: 1

      Just read my own post... the "they spend it, (money) like water, and on things that we do not need." part works for NASA too, (ISS, inefficent shuttles, etc.). But damn it I want a space elevator! Plus if there's some money left over, a shuttle with photon torpedoes.

      --
      Anti-social? My code is just platform-specific.
    3. Re:The Budget Sucks by HMC+CS+Major · · Score: 2

      The upshot of all this spending is a few thousand jobs for engineers, programmers, and others in the tech field.

    4. Re:The Budget Sucks by Anonymous Coward · · Score: 4, Insightful

      the Army's RAH-66 Comanche helicopter (Boeing and the Sikorsky Aircraft Division of United Technologies, $941 million); the Air Force's F-22 Raptor (Lockheed Martin, Boeing, and the Pratt and Whitney Division of United Technologies, $5.2 billion); the Navy's F-18E/F fighter plane (Boeing, General Electric, and Northrop Grumman, $3.3 billion); Joint Strike Fighter/F-35 (Lockheed Martin and Northrop Grumman, $3.5 billion); the V-22 Osprey (Boeing Vertol and the Bell Helicopter Division of Textron, $2 billion) the DDG-51 destroyer (Bath Iron Works and the Ingalls Shipbuilding Division of Northrop Grumman, $2.7 billion); the Virginia class attack submarine (Electric Boat Division of General Dynamics and the Newport News Shipbuilding division of Northrop Grumman, $2.5 billion); the Trident II Submarine-Launched Ballistic Missile (Lockheed Martin Missiles and Space, $626 million); and the Crusader artillery system (Carlyle Group/United Defense, $475 million).

      I'm familiar with all these programs, and unfortunately for those opposed to military spending, a good argument can be made for all of them. Military spending suffered massively in the last 10 years under the Bush and Clinton administrations, and the result has been a lot of insufficiently maintained and obsolete equipment. About the only program that you mention that probably should be abandoned is the F/A-18E/F purchase (and possibly the Trident II if you're convinced that we've found "peace in our time" and no longer need a nuclear triad) and maybe Crusader.

      These are known as "cold-war relic" programs

      No, they're not. They're necessary purchases if the US is going to have an effective military. The DDG-51 and Virginia programs are vital for the Navy (we've already gone from Reagan's "600 ship Navy" to barely 100 combatants). The Air Force needs the F-22 in order to replace planes that are probably older than most of the people reading this (1970s technology).

      We could probably lose the Crusader (in fact, we probably already have in the FY2003 budget) and the F/A-18, but the rest of these programs are sufficiently vital that cancelling them would just result in having the money spend elsewhere on similar programs (for example, cancelling the F/A-18E/F would just mean a purchase of its follow-on aircraft unless you expect carriers to go to sea without any aircraft). There are lots of places where the budget could be cut (for example, Bush's proposal for an extra $25 billion for AIDS assistance to Africa would more than double the budget of NASA), but there really isn't that much pork left in the military budget.

    5. Re:The Budget Sucks by mc6809e · · Score: 1

      If our space shuttles could bomb Iraq we would be getting new ones all the time.

      You're not too far off. I think the idea of the shuttle goes back to the Nixon administration -- they were looking for a low-orbit nuclear bomber.

    6. Re:The Budget Sucks by Read+Icculus · · Score: 2, Interesting

      I'm not the one who came up with the word "cold-war relics" to describe these programs, hence the quotations. That line is straight from Rumsfeld. Like I said in my post, Bush said on the campaign trail that not all of these new programs were necessary. Now I want the USA to have the best weapons in the world. I also want us to have the best space program. I think we can do both. We obviously needed something "better" than the Columbia. The whole world now knows that. Do we "need" all of the weapons I mentioned in my post? Do we need all of them now? Probably not. The aim of my post is not to say we should divert money away from the military, but to bring attention to how our money is being spent. You can decide for yourself what is more important.

      --
      Anti-social? My code is just platform-specific.
    7. Re:The Budget Sucks by Anonymous Coward · · Score: 3, Insightful

      Like I said in my post, Bush said on the campaign trail that not all of these new programs were necessary

      Unfortunately for Bush, he was mostly wrong. Yes, some of the systems could be cancelled, but they would just have to be replaced with something else because there is a necessary role for each of these programs.

      Now I want the USA to have the best weapons in the world. I also want us to have the best space program. I think we can do both.

      I agree. Unfortunately, over the last 10 years both the military and the NASA budget have both been cut; the place spending is out of control is on social spending, and that is a situation that doesn't seem to be changing under Bush (although, to his credit, at least he's increased military spending enough so that some vital programs are going to finally be funded).

      Do we "need" all of the weapons I mentioned in my post? Do we need all of them now? Probably not

      That's the problem with modern warfare; and NASA is suffering from the same mentality. National defense is a "come as you are" environment; if you don't "need" them now and thus don't spend money on them, you won't have them when you do need them. The same is true with NASA. We didn't "need" an improved orbiter in the 1990s, so Clinton cut the space budget back and killed off all the many, many promising programs that could have provided alternatives (Delta Clipper, etc) now that we do need them. The result of such policies is the tragedy we've just witnessed.

      Clearly, we need to spend more money on space development (although perhaps, not necessarily NASA, who hasn't shown a willingness to embrace the state of the art technology as it did in its infancy). But we can't do it by cutting the military budget, because there simply isn't enough money there to cut. However, there ARE a lot of places in the social spending sector where money could be spent without such a risk. Bush's $25 billion for Africa/AIDS is one such place. Medicare/Medicaid is another. Considering that the long-term payoff for space (new pharmaceuticals, geriatric research, etc) development is more likely to solve these issues than direct funding would be in any case, it is simply more logical to spend money from these sources than to risk national security.

    8. Re:The Budget Sucks by snStarter · · Score: 1

      Who did your research for you?

      The VIRGINIA class submarines are examples of completely modern, state-of-the-art systems and are leading the way in the implimentation of modern commercial-off-the-shelf technology. Designed for operations in the "littoral" regions of the ocean these boats are designed for the kind of operations we can envision in the future rather than the blue-water cold-war requirements of the past.

      We are desperate for submarines - no carrier task force leaves without a pair to cover them - and the CNO has said that the failure of a single fast attack submarine to deploy on schedule will have a substantial impact on the national security because there is no backup for the missions that boat would be required to support.

      So please, get your facts at least remotely correct.

    9. Re:The Budget Sucks by fucksl4shd0t · · Score: 4, Insightful

      The upshot of all this spending is a few thousand jobs for engineers, programmers, and others in the tech field.

      Just think of the millions of job openings for these same people if space were to become an industry rather than a curiosity.

      If you want something to achieve commercial success, don't let the churches or the government dictate how to do it. Give it to some greedy, money-grubbing parasitic corporation (like MS, or IBM) and they'll find a way to bring it to us (and then jack up the prices).

      For the record, I'm *not* suggesting we entrust future shuttle missions to Microsoft. Keep in mind, I want this to *succeed* with a *minimal loss of life*.

      --
      Like what I said? You might like my music
    10. Re:The Budget Sucks by Oriumpor · · Score: 1

      It's too bad our government doesn't really want to kill anyone *cough* cause if we could get expendable orbit vehicles they could drop bombs anywhere in the world in minutes

    11. Re:The Budget Sucks by tsa · · Score: 2, Funny

      A billion a day keeps tha bad guys away.

      --

      -- Cheers!

    12. Re:The Budget Sucks by Associate · · Score: 1

      Give it to IBM? Are you crazy? They'll just outsource the work, slap a logo on it and say look what we did. Give us our money. NOW.
      Oh, and Fuck Lou Gestner.

      --
      Someone hates these cans.
    13. Re:The Budget Sucks by mpe · · Score: 1

      NASA's budget for 2003 - now $15.5 billion after the Columbia tragedy
      Military budget for 2003 - $396 billion
      Now of course I think the military needs a massive amount of money, but they spend it like water, and on things that we do not need.


      That's before considering the costs of fighting a war in Iraq (or wherever else), 400 cruise missiles a day comes with a rather large price tag. Also quite a bit of "black" money is most likely additional military budget.

    14. Re:The Budget Sucks by mpe · · Score: 1

      They're necessary purchases if the US is going to have an effective military. The DDG-51 and Virginia programs are vital for the Navy (we've already gone from Reagan's "600 ship Navy" to barely 100 combatants). The Air Force needs the F-22 in order to replace planes that are probably older than most of the people reading this (1970s technology).

      The USAF flys plenty of old aircraft, such as the B52 (early 1950's) also the E3 AWACS, KC135, RC135 all derived from the Boeing 707. IIRC no civilian airline has flown 707's in years.

    15. Re:The Budget Sucks by gilmet · · Score: 1

      If our space shuttles could bomb Iraq we would be getting new ones all the time.

      You've hit the nail right on the head - except the part about seeing them.

      --

      Every time you read this, I am going against my principles.
    16. Re:The Budget Sucks by jamesangel · · Score: 1
      There are lots of places where the budget could be cut (for example, Bush's proposal for an extra $25 billion for AIDS assistance to Africa would more than double the budget of NASA), but there really isn't that much pork left in the military budget.

      Of course! Why spend money to save millions of lives when you could spend it to take thousands...

    17. Re:The Budget Sucks by costas · · Score: 1

      I actually agree that most of these programs are pork these days... The US needs a more flexible, easily deployable army (air transports, attack helictopters, drones, etc). There's still enough strategic weaponry to take out the rest of the world multiple times...

      But, I do want to play devil's advocate here: at least these programs do provide the US with strategic superiority (i.e. world power) and Americans themselves with a feeling of safety. What does the manned space program provide?

      If the only answer available (which is what every pundit is basically saying) is adventure and a sense of higher purpose, then I don't buy it. The Salon article parallelizes the space program with the Cook expeditions --meaning that the space program should provide us with scientific results (it doesn't, at least not the manned part) and mapping out new territories (which the Hubble does better than the STS ever could, and the Hubble could've ridden a rocket to space). It doesn't add up. Not for $15 Billion (I don't know what percentage of that is the Shuttle, but I bet it's large).

      This is not about safety; Columbia was a tragedy, but the crew knew the risks, as much as the Special Ops guys who sign up to be dropped behind enemy lines know the risks. The question is why are we paying for a program that provides no real gain, either monetarily or scientifically?

      Now, having said all that, lemme add a small detail: I am actually an (ex) rocket scientist. I am all for space travel, in the same sense that I would have been all for Columbus to cross the Atlantic: do it because it will be fun, but also do it because something should come out of it. Encourage private operators to fly into space. Give them NASA technology and backing if need be. If there's anything to be gained, they'll find it, otherwise they'll drop out. Sending a 30-year old space truck up for hundreds of millions of dollars a pop isn't exploration or innovation. It's pork.

    18. Re:The Budget Sucks by Nursie · · Score: 4, Insightful

      there really isn't that much pork left in the military budget.

      I'd like to argue with that. Not in terms of cutting military development programs, but in terms of efficiency. A good friend of mine works for a large defense firm (baesystems), and by all reports they LOVE the US military. Why?
      It seems that when they score a big contract from most countries, they have set delivery dates and tightly controlled budgets, as one would expect in a contract a modern, state-funded institution. Get value for money for the tax payers and try not to let things run over. It's just common sense. Under this system companies start to lose money if they go over time or over budget.

      The U.S. military works differently. Defense firms love contracts from the US military because they just keep on paying and don't seem to care much about deadlines. The reasoning behind this seems to be "We want the best, we don't care if it costs the earth and takes until the end of time", which is all very grand and powerful sounding but ends up wasting money and time, all at the taxpayers expense.

      Surely money could be saved by tightening controls on defense contracts and could then be diverted to other ventures such as space?

    19. Re:The Budget Sucks by hcdejong · · Score: 2, Insightful

      Yes, the USAF fields plenty of old aircraft. The problem is, these aircraft are costing more and more to keep running. There comes a point where it's more cost effective to buy new ones.

      Once production of an aircraft ceases, most its production tools are destroyed, leaving you with a limited number of spare parts, and making it very hard to produce more of that model of aircraft.

      Also, you can't compare the B-52 and KC-135 to fighters. The stresses on a fighter are much higher (especially for 'planes that operate from a carrier) than for these transports, which results in a shorter life.

    20. Re:The Budget Sucks by fredrik70 · · Score: 2, Insightful

      They're necessary purchases if the US is going to have an effective military.

      Jesus, you already spend 40% of the worlds total spending on arms. and you want more? Look, pretty much all other countries got even older equipment than the stuff you're phasing out. Calm down over there for christ sake, noone can touch you anyway if it comes to a conventional war.

      --
      if (!signature) { throw std::runtime_error("No sig!"); }
    21. Re:The Budget Sucks by TGK · · Score: 1

      I think Columbus and the Atlantic is an excelent paralell. In the 1960s the space program was about one thing, demonstrating american technological and military prowess to the world.

      Today, it's about putting satelites in orbit with a government subsidized program. Sure, there are experiments, and those are at least interesting, but the value of those experiments is limited by what they are working with.

      So we can grow insulin in space. Great... now if we could just put an insulin production facility in space. See my point?

      I want to see NASA get back to its roots. Expanding the scientific horizons, challenging the idea of what's possible. Frankly I think my tax money should pay these people to take enormous risks. That's what the Apollo crews did.

      So here's what it boils down to. Space Elevator? All for it. And if it costs me an extra hundred or so on my taxes by all means take it. Catapult launch system? Sounds like fun, just don't lease the land. We should learn a lesson from Panama. Moon outposts? Combine with one of the other technologies and it'll pay for itself in tourism.

      I want to see NASA do things that make me proud of what my country can do. I want to turn on the news and be awed and amazed. If we can re-capture the feeling of seeing Earthrise on the moon for the first time, than there is no cost too high. The rewards will far outweigh it.

      --
      Killfile(TGK)
      No trees were killed in the creation of this post. However, many electrons were inconvenienced.
    22. Re:The Budget Sucks by hammy · · Score: 2

      for example, Bush's proposal for an extra $25 billion for AIDS assistance to Africa would more than double the budget of NASA

      I'd hardly call this pork. This funding is necessary to save millions of lives and stop Africa from descending into chaos. The huge tax cuts for the rich might however be a better place to look for bacon

    23. Re:The Budget Sucks by smetnoc · · Score: 1

      Why continue supporting the space program?

      Because if you don't, other nations will take charge. The Chinese are planning a manned space mission and they have been talking about going to the moon. The Russians want to go to Mars. The EU and Japan have solid space programs. Countries like India, South Korea, and Brazil could start getting competitive within the decade.

      You say America needs the military to remain the dominant world power. I say America needs the space program because of SPACE power, which complements world power and is increasingly important.

      The Earth isn't the only place in the universe. The rest of the solar system will slowly start becoming the next strategic playground and if you don't keep up with the rest of the world your importance on the planet will slowly deteriorate.

    24. Re:The Budget Sucks by nicodaemos · · Score: 3, Insightful

      How about spending billions to save millions from AIDS ... only to have them die anyway of famine, civil war or another infectious disease? Africa has many problems which can't be solved with 30 second sound bites promising to throw money at the problem.

    25. Re:The Budget Sucks by hughk · · Score: 1
      The military procurement process is closed. This means that it is often corrupt and inefficient. Money spent on open research programmes is likely to be spent more efficiently as there is better oversight. If the ESA would allow US companies to bid on components for their program, NASA should open up for the equivalent level bids in their program. The wider spread development is, then the faster it will happen.

      Space research is pretty open, or at least it should be as long as the programme remains in public hands. As work becomes routine, then private industry should take it over. For example, sattelite launch should be privatised. All of it. If the US military can use commercial transportation for logistics, they should be able to do the same for sattelite launch.

      The result would be a massive increase in the space industry, not just a few thousand jobs.

      --
      See my journal, I write things there
    26. Re:The Budget Sucks by YrWrstNtmr · · Score: 2, Interesting

      Look, pretty much all other countries got even older equipment than the stuff you're phasing out.

      Where do you think they GOT all that older stuff?

      ...noone can touch you anyway if it comes to a conventional war.

      And we aim to keep it that way. The only way to stay ahead is to keep moving forward.

      And the real way to waste money on the military is to do it half assed. Spend some, so it looks like you're doing something. But not enough to actually run (and win) a campaign in the unfortunate event it is needed. Then your investment (and manpower) IS completely wasted.

      "Fair" in warfare means "We win, and all my guys come home."

    27. Re:The Budget Sucks by yog · · Score: 1

      I'd like to hear an explanation of how a bomb can be dropped from orbit. Would it not burn up or at least be damaged when it hits the atmosphere?
      Furthermore, would it not be much more expensive and a lot easier to detect than a stealth cruise missile?
      Just wondering.

      --
      it's = "it is"; its = possessive. E.g., it's flapping its wings.
    28. Re:The Budget Sucks by Rinikusu · · Score: 1

      BAH!

      And people wonder why the .com era bombed so badly.

      Yeah yeah, all you fucking techie whiners whine and whine about the military spending without realizing that all that will be made back and MORE once we get our hands on Iraqi oil. Think about it as an investment in the future! ...Goddamn, did I just say that? I really need to stop reading indy-media.

      --
      If you were me, you'd be good lookin'. - six string samurai
    29. Re:The Budget Sucks by fredrik70 · · Score: 1

      Can think of quite a few different sellers of military equipment, but a large chunk comes from the US, yes, but this is mostly sold to other NATO countries, am I wrong?
      What I wonder is *why* you feel such a need to have such an enormous army that you can pretty much obliterate *any* other like nothing, why so paranoid, why the need to 'stay ahead'?

      --
      if (!signature) { throw std::runtime_error("No sig!"); }
    30. Re:The Budget Sucks by ShavenYak · · Score: 1

      For the record, I'm *not* suggesting we entrust future shuttle missions to Microsoft.

      Judging from my experience with Windows, that would mean that when a disaster does happen, there'd be no way to investigate and find out the cause - you'd just have to build another shuttle and start over ("reinstall").

      A BSoD at 200,000 feet would suck, too.

      --

      Hey kids, there's only 5 days left 'til Yak Shaving Day!
    31. Re:The Budget Sucks by ShavenYak · · Score: 1

      And you need someone to say, "Gentlemen, you can't fight in here! This is the War Room!"

      --

      Hey kids, there's only 5 days left 'til Yak Shaving Day!
    32. Re:The Budget Sucks by CutterDeke · · Score: 2, Informative
      Bush's proposal for an extra $25 billion for AIDS assistance to Africa
      My understanding is that the money (I thought it was $15-18B) is actually being diverted from other foreign aid and relief programs -- it is not, in fact, "new money". The promise made in the State of the Union address was political grandstanding. This is something Bush can point to when he tries to get reelected.
    33. Re:The Budget Sucks by Salgak1 · · Score: 1

      Uh, how do you think an ICBM works ? The weapons have heat shields, just like the old Apollo/Gemini/Mercury capsules, or like the Shuttle Tiles. . . Of course, from orbit, you COULD just drop rocks, and do some heavy damage. . .kinetic energy of a 5-ton rock, from a hundred or so miles up, is literally astronomical. I also remember a concept called "Thor": basically smart crowbars of high-strenghth alloy, with a sensor on the front end, and guidance fins on the back. . . drop a canister or two of these on a tank division, watch it go boom VERY quickly. . .

    34. Re:The Budget Sucks by j-turkey · · Score: 1
      ...and mapping out new territories (which the Hubble does better than the STS ever could, and the Hubble could've ridden a rocket to space)...

      Actually, I believe that the Hubble Space Telescope is an excellent argument for manned space travel/exploration. (I'm sure you remember) due to the engineering failures of HST's lense(s), the telescope was literally crippled and was essentially a multi-billion dollar turd travelling at extremely high speed around our planet. It would have stayed that way, had it not been for manned space travel. NASA spent many, many man hours making repairs to HST, essentially saving the program.

      Let's also not forget about the Apollo program (not trying to pat the red white and blue on the back for a 30-year-old accomplishment). The Apollo program was arguably the peak of American space exploration. Without sending human to the moon, we never would have left with such a wealth of data. Apollo arguably put the world's eyes on America -- and I believe that its success may have led to the ISS, which really has brought countries together in a form of mutual respect.

      Fast forward to Mars. Think about what we could learn about our solar system, planet, and potentially origin from a manned mission to mars. Remember that most robots cannot collect data the way a human can -- and robots are simply not as "interactive" (for lack of a better term).

      Now, I know that you were simply playing devil's advocate -- but your HST example stuck out as a very soft argument. Further, I believe that the highlights of the American space program speak for themselves.

      --Turkey
      --

      -Turkey

    35. Re:The Budget Sucks by Anonymous+Custard · · Score: 1

      ...whine and whine about the military spending without realizing that all that will be made back and MORE once we get our hands on [their] oil. Think about it as an investment in the future!

      That's probably exactly what Saddam thought when he invaded Kuwait...

      We're not mercenaries...USA doesn't go to war with profit in mind; not officially anyways. Well, at least we didn't before we got a CEO President with an oil addiction.

      In nearly every near future sci-fi book I've read, space is the next major industrial/ technological revolution that the earth experiences.

    36. Re:The Budget Sucks by dzurn · · Score: 1

      I know that facts can be stubborn things. Let's see what the actual budget for NASA is.

      http://ifmp.nasa.gov/codeb/budget2003/03-Multi-Y ea r_Budget.pdf

      NATIONAL AERONAUTICS AND SPACE ADMINISTRATION
      FISCAL YEAR 2003 ESTIMATES
      (IN MILLIONS OF REAL YEAR DOLLARS)
      For display purposes only ? appropriated budgets for FY 2001 and FY 2002 are different

      TOTAL EXCLUDING FEDERAL RETIREES COST
      2001 [restructured $14,253.2]
      2002 [restructured $14,901.7]
      2003: $15,000.0
      2004: $15,573.4
      2005: $15,869.4
      2006: $16,275.0
      2007: $16,789.0

      -------
      Going up? How can that be?

    37. Re:The Budget Sucks by Izmunuti · · Score: 1

      "Actually, I believe that the Hubble Space Telescope is an excellent argument for manned space travel/exploration."

      Actually, for the cost of the various shuttle missions to repair and maintain the Hubble we could have launched a whole series of similar telescopes.

    38. Re:The Budget Sucks by A55M0NKEY · · Score: 1
      I don't know squat about what the military needs or doesn't need so I can't comment on that.

      However AIDS is real and the sooner it can be controlled the better. 25 billion seems a reasonable number for AIDS.

      But 15 billion is a freaken LOT of MONEY!. I think that 15 billion is a reasonable number for space exploration.

      • Nasa spends:
      • Space Science ( probes/telescopes etc ) : 3.414 billion
      • Space Flight ( Shuttle + ISS ) : 6.130 billion ( 3.208 shuttle, 1.492 ISS ) the remainder is 'overhead' for the shuttle and ISS not directly attributed to either one.
      • Astrobiology etc: 360 million
      • Earth science: 1.628 billion
      • Aerospace Technology ( R&D for new ways to get to space and enhance air travel ) : 2.815 billion

      more details here
      The sum of the above numbers equals 14.3 billion. That's close enough to 15 billion to be fairly complete. Cancelling the space station and space shuttle would almost double NASA's budget.
      --

      Eat at Joe's.

    39. Re:The Budget Sucks by j-turkey · · Score: 1

      I stand corrected.

      How about some $ figures?

      -Turkey
      --

      -Turkey

    40. Re:The Budget Sucks by drxenos · · Score: 1

      Your friend is full of crap. I, too, work for a defense contractor (Lockheed), and the US military (all braches) is one of our most demanding customers. They regulary audit our schedules, documentation, development process, CM (configuration managament), SDFs (software development folders), testing, etc.

      --


      Anonymous Cowards suck.
    41. Re:The Budget Sucks by ckaminski · · Score: 1

      I don't want a space elevator. Space elevators have inherent weaknesses in their design, including:

      1. Fixed location to the earth.
      2. Vulnerable to terrorist act
      3. Vulnerable to weather and storms.
      4. Monopolistic control of elevator time

      What I do want are spaceports in every state in the union, in every country in the world, with reliable launch systems that can get me into space from 100 different places on earth, from untold numbers of vendors.

    42. Re:The Budget Sucks by Nursie · · Score: 1

      Oh I'm well aware that they require top quality documentation, a well audited development process, extreme amounts of thorough testing, etc. etc. And as for Configuration management, it's hard to get my friend to shut up about the matter. They are very careful and they want top quality reliable systems. That's not in dispute.
      It's the budget and timescales that aren't kept in tight reign as far as I can tell.

    43. Re:The Budget Sucks by orim · · Score: 1

      Of course, then they would have to change their name to NAA.

      --
      "If you could only see what I've seen with your eyes..." - Roy Batty
    44. Re:The Budget Sucks by Mike1024 · · Score: 1

      Hey,

      No, they're not. They're necessary purchases if the US is going to have an effective military.

      If I may say so, America's military isn't exactly weak at the moment.

      There aren't many countries that have more or better weapons than America. Assuming we don't plan war with, say, the entire of Europe, I'd say we're pretty well stocked.

      Just my $0.02,

      Michael

      --
      "Goodness me, how unlike the FBI to abuse the trust of the American public." -- The Onion
    45. Re:The Budget Sucks by Firethorn · · Score: 1

      And the only reason we can afford to keep flying them is because our fighter cover is so effective in suppressing defenses. Many countries are catching up with the effectivness of the F-15/F-16 which are the primary combat aircraft for the USAF.
      Add in that many of these aircraft, which suffer far higher stresses than the B-52, are older than their pilots, and you start having problems.

      --
      I don't read AC A human right
    46. Re:The Budget Sucks by MessiahXI · · Score: 2
      Cancelling the space station and space shuttle would almost double NASA's budget.

      wow, that is a *really* back-asswards way of looking at it. how about, "Cancelling the ISS and shuttle would cut NASA's expenditures by almost half." Your logic is kinda like saying that tax-cuts are a "cost", which is stupid.

      In reality, cutting those 2 huge programs would most likely result in NASA's budget getting a $6B cut (according to your numbers).

    47. Re:The Budget Sucks by Jeremy+Erwin · · Score: 2

      How about spending billions to save millions from AIDS ... only to have them die anyway of famine, civil war or another infectious disease?

      Or of old age?

      AIDS disables a lot of otherwise productive members of society. If the farmers die of AIDS, famine results. The elderly and children, largely incapable of sustaining efficient agriculture, tend to cut corners-- such as resorting to slash and burn techniques, which further reduces long term productivity.
      In some African countries, 40-60 percent of the armed forces are infected with HIV, making those countries vulnerable to insurgencies, invasion, and terrorism.
      And of course, AIDS overwhelms already strained medical facilities--making death from "another infectious" disease all the more common.

      That's the "AIDS is a national security problem" argument in a nutshell. It may be possible to treat AIDS therapy as a luxury in a country where less than one percent of the population is infected, but incidences of 10-20% require different solutions.

    48. Re:The Budget Sucks by drxenos · · Score: 1

      Our award amount is directly related to how on schedule the project is, along with other aspects such as techological achievement and budget overrun. All these items are rated and a percentage generated from this rating (by the military). This is the percentage of the total contract award we actually get. Maybe "crap" was a bit harsh, for I will admit a few years ago, this system of award by level of effort (I forget its offical name) was not used and things were more "loosey-goosey." But you should talk of how things are in the present tense without actually knowing.

      --


      Anonymous Cowards suck.
    49. Re:The Budget Sucks by ChrisMaple · · Score: 1

      Yes, we are lucky you're not president. We'd all be dead soon.

      --
      Contribute to civilization: ari.aynrand.org/donate
    50. Re:The Budget Sucks by Izmunuti · · Score: 1

      OK.

      NASA Hubble FAQ states the Hubble cost $1.5 B to build and launch. $0.5B was for launching it. NASA claims it cost $0.795B for one of the servicing missions (FS-96(11)-023-GSFC) including launch costs. There have been three servicing missions (1993, 1997, and 1999) and was to be one more in 2003 before decomissioning the Hubble and returning it to Earth in a Shuttle in 2010. That's five trips to the Hubble for roughly $4.0B. Grand total of $5.5 B.

      Now, say one built several telescopes and launched them without servicing them or bringing them back. Use a Titan-III for launch, big enough for a 11,000 kg Hubble, costing about $245 M each launch (http://www.jsc.nasa.gov/bu2/ELV_US.html). Even assuming no cost savings from building more than one telescope, each would cost $1.245 B and one could launch four of them for $5.0 B. You could probably build five or six by including the per-unit savings of building more than one.

      So even though there would have been problems and failures, there would probably have been more than one operational at any given time so we would have gotten 2-3 times (or more) the science for the same cost without risking any lives.

      Iz

    51. Re:The Budget Sucks by Nursie · · Score: 1

      Fair enough, my evidence is, as I say, from a friend at a UK firm and his experience of how US military contracts are regarded there. These are perhaps ongoing projects that have already been running for a few years.

    52. Re:The Budget Sucks by A55M0NKEY · · Score: 1

      Since the Space Shuttle and the ISS are useless wastes of money. Spending the money on other non-space oriented but useful things would be better. However I think the money saved from cancelling the shuttle and the space station should go into sending more probes/sattelites and developing cheaper access to space.

      --

      Eat at Joe's.

    53. Re:The Budget Sucks by j-turkey · · Score: 1

      OK, I see where you're coming from.

      I'm still not sure that it would have made good financial sense to send four up at once -- only because you make some assumptions that may not be 100% reliable.

      Given the ~15-year lifespan of the HST, there may be a chance that regardless of use, the telescope(s) may deteriorate in space (see this semi-related article) and require regular service as part of the design. This, however, is speculation -- there's a good chance that you know far more about this than I do.

      Your argument is very compelling, but I'm not totally convinced. But it does raise some very interesting questions for me.

      Why would NASA use the Shuttle to deploy the HST if it wasn't necessary? Was it done just to draw more attention to the project? Would it have been cost effective to have built another (in lieu of reparing the original) and launch it via an unmanned rocket? right after the reiaprs, the HST began making new scientific discoveries. After weighing in the time necessary for a redesign/rebuild/unmanned-launch against the scientific findings that happened in the (potential) time saved by the manned repair mission, did we benefit or lose in the end?

      Just some stuff that's left in the back of my mind...thanks for the info...very intriguing.

      --Turkey
      --

      -Turkey

    54. Re:The Budget Sucks by Oriumpor · · Score: 1

      I was speaking of ICBMS and the space race. If you could not see that connection perhaps /sarcasm is in order.

    55. Re:The Budget Sucks by Tupper · · Score: 1
      You like all these programs (except the F18E)?!?! Ok. Lets do a blow by blow.

      First the context: we spend more than the next, what, 6 nations combined. No other nation has a navy to speak of. We already have the best fighter planes and nobody else is making a better one. (The Eurofighter ain't). There is no threat to US superiority in the blue sky or the blue sea.

      • RAH-66 Comanche ($.9B). Recon helocopter. Drones do recon more effectively and more safely at lower cost.
      • F-22 Raptor ($5.2) There is no reason to build this plane. There are no Mig-33s for it to fight. The F-16 is as good as any non-Nato fighter, we have more of them, better coordination and our pilots are better. And the F-16 isn't our best existing interceptor. We just don't need a new interceptor.
      • Navy's F-18E/F ($3.3) Should they wait for the JSF? Yes.
      • Strike Fighter/F-35 ($3.5) If $50m/plane is the best they can do now before the invitable cost overruns and purchase reductions, the drone will likely have them beat for most missions by 2008.
      • V-22 Osprey ($2) Nice idea. Too bad it doesn't work.
      • the DDG-51 ($2.7B) Why they don't call them crusiers, I have no idea.
      • Virginia class attack submarine ($2.5B) Who, exactly, are they going to attack? No other nation has a navy in the ballpark as our surface ships and sureface ships are dual purpose. Besides, batteries powered subs are better in the littorals-- where commandos want to be. We are sending the excellent Los Angeles class to early retirement to make room for these guys. We should be sending the Los Angeles class into retirement 'cause they don't have a freakin mission.
      • the Trident II Submarine-Launched Ballistic Missile ($.6B) Um guys, the cold war? its over.
      • the Crusader artillery system ($.4B) Many think this is obsoleted by the end of the cold war.
      No pork in the military budget? Nope, nothing here but us pigs.

      Sheesh.

    56. Re:The Budget Sucks by oddKryses · · Score: 1

      There are millions of people starving all over the world. So what? Do you honestly think that other countries really give a shit? Governments are too caught up in their own affairs to do anything more than toss a bundle of cash at the starving countries--and then what would that country do with the cash? It'd probably go to the only ones who are NOT suffering and in power. The ones who really need it won't get it. If anyone is absolutely serious about stopping world hunger/suffering, the first thing they'd want to do is take over the country and rule it their way. These starving countries lay idle because they have no real economic contributions to make--first they have to figure out how to rule themselves.

      In the meantime the world powers are striving just to keep on top of the world themselves. They make half-ass attempts to "push humanity forward" with small cures for illnesses and space programs but anything done by the government is just to get good press so that they stay in power.

      I don't understand why people keep saying we shouldn't eat so much when in fact it doesn't make a single difference to people on the other side of the globe. Those people don't need food or money--they need to change the way they exist, starting with the people ruling them.

      --

      No one can put you down without your full cooperation.
    57. Re:The Budget Sucks by Syre · · Score: 1

      You can't find a weapons program you don't like, apparently (even the V22 Osprey, which keeps crashing?).

      The fact is, the US weapons industry is very big business, and it stays in business not merely by filling orders for the US government, but by selling lots and lots of arms overseas.

      This is one of the main reasons the budgets stay so high and that new systems continue to be pushed out to replace old ones -- the weapons makers want to sell the older weapons overseas, and so the US needs newer weapons to counteract the threat posed by these weapons.

      It's a vicious cycle, requiring the continual replacement of systems which would be perfectly adequate for their intended uses, but for the fact that they've been sold to nations we don't fully trust (or which might become unstable, allowing the weapons to fall into un-trustworthy hands).

      So we have weapons systems which really do have superiority to other things out there becoming outmoded because suddenly they aren't superior -- to themselves!

      One solution for significantly reducing costs would be to disallow these massive weapons sales, thus extending the lifetimes of systems by decades, allowing for incremental improvements.

      But this is a solution that will not be allowed, because the US military budget isn't really for the benefit of the people, but for the benefit of the military/industrial complex, which Eisenhower warned us all about in his famous speech.

      Rather than just being gung-ho America-first, think about the economics at work here. It's all about economics, in the end.

    58. Re:The Budget Sucks by Read+Icculus · · Score: 1

      The term "cold-war relic" is not something I came up with. Relic does not mean that the submarines are tow-tech 70's era boats. Quite the opposite is the case, they are indeed state of the art. But the thing is that what are we going to do with $2.5 billion worth of all new super submarines? The cold war is over, we have new enemies who fight a different way than the USSR. Do a search for what Rumsfeld has said about the modernizing our military.

      --
      Anti-social? My code is just platform-specific.
    59. Re:The Budget Sucks by jamesangel · · Score: 2
      I find your comment shows little knowledge of the situation in Africa. It is a big place; most of the countries there are not in the grip of famines or civil wars.

      AIDS poses the threat of both of these, however; it has been said that the AIDS epidemic threatens to destroy any progress made in the last thirty years on terms of development.

      I have just returned from Uganda, where there are international programs which are making a difference. There is no famine, no civil war, but an AIDS infection rate of around 10%.

      How about spending billions to save society from famine, civil war and other infectious diseases... only to have them die of AIDS and see all these problems return.

      True, 'promising to throw money' is not a magic bullet. But doing nothing certainly will not help.

  76. Where do you want to go today... by Pollux · · Score: 3, Insightful

    Listen, it's this simple: you can throw a trillion dollars at the NASA budget, but it will never make space travel 100% safe. NASA knows that. Astronauts know that. I would venture to guess that the majority of /. readers know that as well. But Congress only appears to see NASA as either pass or fail. People live: pass. People die: fail.

    if (!deadAstronauts)
    nasaMoney += moreMoney; // Personal note -- yes, moreMoney can be a negative value
    else
    nasaMoney = 0;

    But, looking at the situation, it's about as logical as having Congress make air travel illegal after 9-11.

    But no, instead Congress desides to throw gobs of money at national security to prevent terrorism, and yet they think that it's wise to pull funding from a program which does a much better job of uniting the word together.

    What Congress should do is pay NASA $20 million dollars (I think their current budget is about that much) to paste a big warning sticker on the entrance door of each shuttle saying "You fly at your own risk." That way, they state their beliefs, the world has a chance to unite people from around the globe once again, and NASA gets extra funding. Problem solved.

  77. space station by incom · · Score: 1

    They should've built the space station at the L1 point, so it could serve the dual purpose of being a mars/deep space lauch and prep point.

    --
    True genius is grasping a situation like a peice of fruit, and peircing it just right so that it drains dry.
    1. Re:Space station by sheddd · · Score: 1
      Space station worries: I'd hate to sit in a tin can up there for long when a pebble going 22kmph might decide to make my day interesting (or short).

      You could cheaply create a bunker on the moon (compared to a hardened space station) and it might be possible to use raw materials there to save on costs (I don't know, though).

      Thoughts?

    2. Re:Space station by burns210 · · Score: 1

      I would add to that the following: 1a. Keep the ISS as a close, scientific outpost, for easy testing of 0g and science experiments. 1b. Then, make a second station, this is the fatory, longterm, station. (there was a slashdot on this i think) This would be the station deeper into space, somewhere around the halfway point from here to the moon. This is the launch pad for deep space missions. 2. A new, sleek, cool looking shuttle (just because). 3. A cheaper way to get materials into space.

    3. Re:Space station by EvilTwinSkippy · · Score: 1
      Learn from the Russians. What do they use to get people into orbit: A cheap expendible rocket.

      How do they get payloads into orbit: A cheap expendible rocket.

      How do they repair satellites in space: They don't. They launch a new on with a cheap expendible rocket.

      --
      "Learning is not compulsory... neither is survival."
      --Dr.W.Edwards Deming
  78. the timeline of flight by lunartik · · Score: 5, Insightful

    As someone on Fox News pointed out the other day (paraphrasing here):

    "It took man 66 years to go from Kitty Hawk to the moon, and in the 34 years since were have gone absolutely nowhere."

    That was a pretty good summation of the problem with the Shuttle. It is a proof of concept, but hasn't expanded man's horizons.

    I say that the tribute to Columbia's astronauts should be a man stepping on Mars.

    1. Re:the timeline of flight by PD · · Score: 1

      That should be "It took man 100,000 years to get to Kitty Hawk, and 100,066 years to get to the moon. Flying is hard, getting to the moon is easy."

      The space shuttle was a bigger achievement than going to the moon, even with all its shortcomings. The next big achievement in space will be to abandon the shuttle, and take up the next big challenge. And I don't see a silly space station anywhere in the picture.

    2. Re:the timeline of flight by Winterblink · · Score: 1
      That was a pretty good summation of the problem with the Shuttle

      Problem with the shuttle, or a problem with us? Technology isn't an issue, it's the willingness to apply it properly. I'm sure if NASA had the funding when it needed it we might be looking at a newer vehicle system, or an entirely overhauled shuttle system by now, one that's safe(r) then the aging things we're launching up today. Hell, we'd probably already have at the very LEAST final stage plans to put people on Mars.

      The quote you give above is a great one. It also indicates what I think is a fundamental shift in human thinking. The decades it encompasses are a time of great inspired acts and forward thinking, towards aerodynamics and space exploration. At the moment, we're all engrossed with cloning, genetic research, and killing ourselves. Don't kid yourself, we're making as big strides in those area as the first airplane and manned spaceflight back then.

      --
      "I'm a leaf on the wind. Watch how I soar."
      -Hoban Washburn
    3. Re:the timeline of flight by SparklesMalone · · Score: 1

      Yes we have... We've gone to a world where Fox News can bounce useless jabber off satellites.

  79. Where Should Space Exploration Go From Here? by hermango · · Score: 2, Interesting

    First, as to the current Space Shuttle, the only trip it should make is atop the 747 on it's way to a museum. Any engineer (I'm one, BTW) can look at the Space Shuttle and tell that the thing is just an accident looking for a place to happen. The amazing thing is that they've managed to launch it 107 times and only have it self-destruct on two occasions. Anything that is dropping pieces off it, either intentionally or or accidently, is not something that defines the word "Reliable." And the fact that it takes $500M to launch it is way beyond the pale. Right now they keep throwing money at something new, only to decide it won't work for some reason, and then they go off on something else new. I think that the reason this keeps getting shot down is that it is getting rolled over by the Perpetual Pork Barrel of the current Space Shuttle contractors. After all, $500M/launch is nothing to sneeze at, unless you're paying the bill. If it were my decision I would stop all manned launching, mothball the Space Station and go balls to the wall developing the second generation space vehicle. The first criteria for it is that it not drop pieces along the way. And where is the real breakthrough propulsion system? Something totally revolutionary, something like the "impulse drive" of Star Trek? It's bound to be out there somewhere, so where is the money to spend on it? The stuff we're using now isn't any more advanced than a gunpowder rocket. And here's an interesting point: What if you invented the "impulse drive?" What happens when you go to patent it? Does it get classified "Top Secret" because of it's military applications? I wonder if someone has actually invented something revolutionary but is afraid to attempt to patent it? Considering the current climate in Washington it's something that I would seriously consider! And I suspect that I'd decide to just put my hands in my pockets and walk away.

  80. In My Opinion by NetGyver · · Score: 1

    NASA needs a good bitch slapping. Seriously. What ever happened to the X-"pick a number" cheaper/better re-usable replacement vehicles we've been reading about for so long? Every one of them was scrubbed. It is my belief that NASA's #1 priority should be safety at all costs, no matter if they think it something minor. (read: minor Columbia damages prior to takeoff) Everything should be treated as serious and life threating and should be checked out accordingly.

    The #2 priority should be finding a cheaper way of getting humans into space. As it stands, strapping a shuttle to a HUGE non-reusable rocket with tons of fuel is about as efficient as buying a car every time you go to the store. They need to stick to one shuttle replacement project and stick with it till completion. It doesn't make sense why congress would throw money at the previous X-33, etc shuttle replacements only to have nothing to show for it in the end. That's about as wasteful as the current means of getting a shuttle into space.

    #3 priority should be more infomation given to taxpayers about how these projects in space could actually help us humans on earth. How do ants in space have anything to do with helping you as an human, a consumer, and a taxpayer? Granted some of the projects like robotic exploration obviously helps the robotics field, and studying astronauts in low gravity may help to understand certian illnesses here on earth. They've been doing an okay job with this, but it could be alot better, and it could help some people justify space exploration as well. (FYI, i know it's worth it :) )

    #4 prority should be to find ways in which they can get corperate sponsoring. Russia seems to have this idea. I don't mean necessarly letting civilians on paid trips to the ISS, but by other means. The more ways NASA can get funding, the more money they can invest in projects that benifit us as humans, the better.

    #5: The goverment should crack the whip a bit and set guidelines on what NASA should accomplish outside of scientific projects and safety. Things like "Man on mars" or "base on moon" or something that sets our imaginations on fire a little. It'd be nice to see NASA inspire us the way it did with the moon landing. (Yeah, i think NASA did it.)

    Can't think of anything else right now, but that'd be a decent start IMHO. YMMV however :)

    --
    A Penny for my thoughts? Here's my two cents. I got ripped off!
  81. humanity by munky222 · · Score: 1

    ok.. personally, i'm all for space exploration. former (and still silently burning) ambitions were to be an astronaut. but for some reason, the ideas of creating biospheres on other planets and moons seems a lil wild. not impossible, not crazy, but wild to the extent that it reminds me of a quote from "The Matrix," about how we as humans are nothing but leeches, destroying all of our resources and moving on to the next. i mean seriously, we can't even get it right on one planet. we fight over stupidity, we destroy our precious planet because we want to advance ourselves. we've crippled tons of viable land because we wanted to make a buck or didn't feel like going through all of the safety precautions (Chernobyl ring a bell to anyone). and we're talking about creating civilizations elsewhere. what will we do there, rob those planets of every natural resource until we have to move farther and farther on? i'm not trying to be negative about this all, i'm just trying to point out the other point of view.

    --
    munky // munky.org // subtlecaffeine.net
  82. Re:Find USEFUL short-term goals America supports.. by Lovejoy · · Score: 1

    No, the SUV drivers in the 'burbs typically support their schools. It's the urban schools that are so underfunded.

    Suburbanites know that taxes are bad but ignorance is worse.

  83. Your missing on a couple of points by mexicanfood.org · · Score: 1

    I agree, but your Jumping the gun on a few points. First, we're going to destroy the planet before nature does. Second, Mars should be our primary focus. Not only will Mars colonies soon be within our scientific grasp, but terraforming Mars is a distinct possibility. The Red Mars, Green, Blue, and Magenta Mars books provide a nice old school science fiction look into such a possibility.

  84. Orbiter Simulator by becktabs · · Score: 1

    For anyone interested in a fantastic space simulator (sorry windows based...but free) try this link.

    Unless your already a rocket scientist, you are gaurunteed to learn a few things while having a great time.

  85. Prizes by Baldrson · · Score: 1
    Jerry Pournelle's proposed prize awards for space progress are in a long line of incentives for opening frontiers.

    As Mr. Pournelle states:

    The value of prizes is that there is no cost until the task is accomplished, and the total cost is limited and known. If you insist on "being fair" to all the losers in a competition then you are in essences saying don't do anything.

    It would take Congress about 6 hours to pass the prize legislation I described. If that cause no results, well, so be it; but it might in fact get things going. There may be better ways, but I have seen no reason not to try the prizes in addition to anything else.

  86. Antigravity Propulsion may be the key... by Lodragandraoidh · · Score: 1

    This antigravity device looks like it holds some promise. We just need to solve the problem of shrinking that 20 Kilovolt power supply down to the size of a walnut, providing a means of lateral thrust (maybe some of those devices mounted as thrusters on each side?), and providing an insulated cabin (so the crew doesn't get electrocuted when they use the full scale ship) as well as a more powerful power supply to provide effective payload lift.

    The nice thing about this system is the lack of complexity (zero moving parts), and the ability to cheaply provide redundancy in the propulsion system.

    You can order all the parts you need to build and test one yourself including the power supply at the website...might be an interesting little weekend project - if I can just keep the cat, dog, and kids away from the high voltage power supply...(my wife won't let me buy one because she is afraid I will electrocute myself - or the kids...)

    --

    Lodragan Draoidh
    The more you explain it, the more I don't understand it. - Mark Twain
  87. Moon Base by emarkp · · Score: 1
    The most worthwhile space endeavor right now is to get an off-world colony going. We keep getting those asteroid near-misses, and the only good protection for the human race is to spread.

    Living on the moon for a while will give us a bit of know-how to live on Mars. From there, the sky's...er...the limit.

  88. Another idea by ShooterNeo · · Score: 4, Insightful

    Mod me down for saying this, but the honest truth may be the best next step in space exploration is to drop the manned program entirely, and spent the money on better remote probes and satellites. Three billion a year would buy at least 10, probably 20 or 30 pathfinder probes (or an improved model) per year. That's a lot of mars exploration. This isn't a popular view, but there are some convincing arguments.

    First, one of the stated goals for the space program is to develop new technology. But when are you more likely to use the latest and greatest bleeding edge experimental engine? On a manned spacecraft where loss is catastophic to the whole program, or a relatively cheap robot? Fact is, the pathfinder mission used some of the fastest processors and lots of new off the shelf technology. They had some bugs with it, which is why it can't be used with a manned mission. Sometimes this approach (known to the press as "better faster cheaper") fails, but the point is its SO much cheaper than a single manned mission a failure is not really that big an issue. For the price of one year of shuttle launches we could send dozens of probes to mars (as said before).

    Be honest here. While its said that manned exploration is a precursor to manned colonization, the hard fact is that it takes too much energy to put people in orbit. For a very long, long time it will be easier to use advancing technology to support more people on this earth than move them to space. Besides that, humans aren't adapted to live in space. The basic plan has always been to go to the final frontier...then build a huge enclosed, sheltered colony that the human colonists huddle in 99% of the time. Its like going to the Grand Canyon or Yellowstone then huddling in your Winnebago all week.

    A far more realistic plan is to create a life that can live there. I imagine "big clanking replicators" : a huge factory with fairly familar machinery, all of it automated and only requiring human supervision to perform repairs. Mining machines, robotic rock haulers, nuclear power plants, smelters, presses, lathes, ect...most of the robotic tech similar to what you would find in a general motors plant. This facility would be built on the moon, remotely operated by people on earth. It would be capable of constructing the parts to build another facility (and so on). While expensive, it would be a fraction of the cost of human missions, and after enough replications be able to produce useful products.

    Unmanned boosters blow up 4% of the time, and its nothing but a finanical nuisance. I've just described a plan that would develop far more advanced, bleeding edge tech than anything that could be used in a manned mission. The technology developed (better industrial automation, better artificial intelligence, better remote telepresense) would be immediatly useful on earth. A manned trip to mars would involve mostly old, proven technology, with a few exotic exceptions necessary for the mission. (such as a nuclear propulsion system, something NOT usable on earth)

    I understand why noone will listen to me : there's an incredible glamour about blasting off our heroes into orbit, sending a man out in space to get the job done. Hell, I want to go too. But the truth is, without all the overhead associated with minimizing the risks to said heroes a lot more could be accomplished with the same money. In addition, the new tech and perhaps even real products from space would eventually provide a real return on investment, enriching us on the ground.

    1. Re:Another idea by the+gnat · · Score: 1

      Actually, I agree 100%. The problem is that too many people have been reading too much science fiction and believe that no amount of money is too much even if there's no payoff besides watching a Mars landing on CNN. So, they make up all sorts of bullshit about how the manned program is important to technology development, etc.

      If we spend the next 50 years perfecting the unmanned missions, perhaps then we can do manned spaceflight right and cheaply. I'd rather see that than more disasters, both human (Columbia) and financial (ISS, the shuttle in general).

    2. Re:Another idea by DunbarTheInept · · Score: 1

      If your goal is to stagnate lifting technology, then by all means punt on the hard problem of getting people into space. But if your goal is to improve the space program overall, then put the money not into the payloads, but into the methods to get them up there. I see a goal of 20 or 30 pathfinders as setting sights too low. The goal should be to make space travel routine enough that we no longer have to skimp and shave off every kilogram (which is really where the impetus for unmanned missions is coming from.)

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    3. Re:Another idea by ShooterNeo · · Score: 1

      Hmm. Thing is, no matter how much you improve lifting technology it will STILL BE CHEAPER to send unmanned vehicles (however they get up there). After all, if its unmanned a failure rate of 5% or less is fine. Heck, you could get away with higher than that (whatever the optimal ratio between quality control costs and losses due to failures). But if there are men aboard people won't be happy unless that rate is made as near to zero as humanly possible Thus every part has to be checked ten times, with more paperwork overhead generated than the space shuttle weighs. After every mission, every piece has to be exhaustively tested. Every imaginable contingency has to be thought of and planned against. Even the most unlikely disaster might need a safety system custom designed to prevent said disaster.

      Also, another observation : if an unmanned mission fails : say my proposal to put factories up there completely flops. Its not a total disaster. The technology developed to build the factories now exists, and can be used elsewhere. There's not nearly the stigma of getting people killed, so perhaps next year the funders might try again. A far more productive outcome than a disaster with a manned mission, where all activity might be ceased for years while the fingers are pointed. Resources get dumped into even tighter quality control than ever, rather than new ideas and technology. A total mess, and a waste of millions of man hours of human lifespan. Imagine how much more the workers at NASA could contribute to society if they did something more productive than triple checking every part for the space shuttle. What if instead they are trying out radical new robots, changing the mission plan totally on the fly to use the space probe in a different way (all of which has happened with our probe programs) Mot to mention, if something goes wrong they merely feel guilty about losing a few big bucks of taxpayer money than a human being.

    4. Re:Another idea by ShooterNeo · · Score: 1

      As for better lift tech : hey, I'm all for it. The 20 or 30 pathfinder example was what I think could be done 2 years from now (that is, using 3 billion dollars to produce in quantity existing mars probe designs), with the space shuttle museumed and no more resources spent on it except to finish finger pointing after the disaster.

    5. Re:Another idea by Stuntmonkey · · Score: 2, Informative

      I agree very much with this approach with some modifications, and here's why.

      If one were to define a long-term goal for manned spaceflight, the only reasonable answer would be "to establish a long-term, self-sustaining human presence in space". Any other goal would not make sense in light of the overwhelming cost/risk advantages of unmanned flight.

      The angst that a lot of people have over the Shuttle/ISS programs is that they don't seem to connect where we are today with this end-state goal. Costs per pound are not falling, and the ISS isn't really going to tell us anything we didn't already know from Spacelab and Mir.

      So what should be next? I think the really tough nut is the "self-sustaining" part. I can see two broad scenarios:

      • We develop self-sustainable environments in space first, and launch costs remain high. The tough challenge is to create a self-sustaining environment with little weight/volume. There are a number of possible routes to this. One could be a Biosphere2-like program (but managed differently) to explicitly figure it out. If that doesn't work, we could wait until technology allows humans to create more space-friendly bodies for ourselves, e.g., through genetic engineering or downloading a person's neural net into a silicon-based machine.
      • We get lower launch costs first, and self-sustainability develops over time. If launch costs are low we could, in addition to sending supplies, export manufacturing technology to reduce the need for supplies. Over time, self-sufficiency could be achieved.
      Now I don't think any of us knows which of these is the path of least resistance, so the logical course is to bet on both.

      So what would I do?

      1. Explicitly separate NASA's budget into three pieces: Manned exploration, unmanned exploration, and launch systems. Do not allow money to cross these boundaries to cover cost overruns.
      2. Close down the Shuttle/ISS programs, as they are not compatible with the manned exploration goal. The budget for "manned exploration" would be much lower.
      3. Invest heavily in two areas: (1) New technologies to dramatically lower the cost of launch, and (2) development of maximally self-sustaining living environments appropriate for space. These are not easy problems -- the timescale on solving these is 10-20 years.
      4. Give the unmanned program more money, but otherwise leave it alone. The goals of the unmanned program have always been clear, being driven by the goals of the commercial and scientific establishments in a very direct way. I trust the profit motive to determine what kinds of weather and communications satellites we need, and I will trust the scientific (and ultimately peer review) process to determine what kinds of knowledge are most important to obtain and which missions/facilities best deliver it.
    6. Re:Another idea by khallow · · Score: 1
      Be honest here. While its said that manned exploration is a precursor to manned colonization, the hard fact is that it takes too much energy to put people in orbit. For a very long, long time it will be easier to use advancing technology to support more people on this earth than move them to space. Besides that, humans aren't adapted to live in space. The basic plan has always been to go to the final frontier...then build a huge enclosed, sheltered colony that the human colonists huddle in 99% of the time. Its like going to the Grand Canyon or Yellowstone then huddling in your Winnebago all week.

      I don't have a problem with this. Even if I did, the solution is simple. Once we get people there, we adapt them to the environment.

      A far more realistic plan is to create a life that can live there. I imagine "big clanking replicators" : a huge factory with fairly familar machinery, all of it automated and only requiring human supervision to perform repairs. Mining machines, robotic rock haulers, nuclear power plants, smelters, presses, lathes, ect...most of the robotic tech similar to what you would find in a general motors plant. This facility would be built on the moon, remotely operated by people on earth. It would be capable of constructing the parts to build another facility (and so on). While expensive, it would be a fraction of the cost of human missions, and after enough replications be able to produce useful products.

      I like this scenario (as have many people since the late 70's). Going to the Moon makes a lot more sense if you've already made the homes that people will live in. Manufacturing on the Moon is also extremely useful (and probably required) for assembly of space craft and other major projects in Earth orbit.

      I understand why noone will listen to me : there's an incredible glamour about blasting off our heroes into orbit, sending a man out in space to get the job done. Hell, I want to go too. But the truth is, without all the overhead associated with minimizing the risks to said heroes a lot more could be accomplished with the same money. In addition, the new tech and perhaps even real products from space would eventually provide a real return on investment, enriching us on the ground.

      I guess that depends on what you want to accomplish. As for me, my space goal is for people (and Earth-based biospheres) to live self-sufficiently in space. Even to that task, I can see the use for a large unmanned program. Discontinuing manned space exploration isn't a negotiable though that doesn't imply that NASA should itself have a manned space program.

      Let me describe my thinking here. Instead of NASA holding a monopoly on manned space, use that money to fund awards for various manned and unmanned accomplishments in space. Eg, in the vein of XPRIZE. Actually, there's nothing preventing people from awarding their own prizes for these accomplishments! For example, the Bowery Award for Amateur Rocketry which preceded the CATS prize (and aside from award amounts is identical).

    7. Re:Another idea by DunbarTheInept · · Score: 1

      That's fine. I'm 100% convince that as lifting technology improves, the argument against unmanned missions won't matter anymore. So go ahead and believe that you are working for better lift tech for unmanned flight only. I'll know that it's really the doorway to making manned flight more feasable.

      We are a curious species. We *will* travel in space once it becomes feasable. I could be convinced that for *NOW* unmanned flights are the way to go. I won't be convinced that that's all we'll ever do.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    8. Re:Another idea by DunbarTheInept · · Score: 1

      Yes, and it's also cheaper to stay at home and never take a vacation, but people do anyway. And it's cheaper to teleconference and never actually physically go to work, but people do anyway. Why? Because we *like* it. We are a species perfectly willing to waste a little bit in order to go places ourselves. Once the lifting mechanisms improve, we just won't care anymore about the extra cost to send people. Right *now* it is orders of magnatude cheaper to send robots. That is not going to stay that way forever unless you choose to cripple development of better launch vehicles. When it merely becomes two or three times more expensive to send people, then it will happen again.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

  89. Comment removed by account_deleted · · Score: 2, Interesting

    Comment removed based on user account deletion

  90. Ok, maybe we won't go to Mars in the next 20 years by Repran · · Score: 1

    ...but how would it make you feel if the Chinese would beat us to it?

    --

    -- Contradictions only exist in thought - not in reality.

  91. Space travel isn't feasible by Animats · · Score: 2, Insightful
    Space travel isn't really feasible. There just isn't enough energy in chemical fuels to propel much of anything into orbit. Only with hacks like throwing away parts of the spacecraft is it possible at all.

    It's just barely possible to overcome this limitation. But the costs are enormous. Desperate efforts to reduce weight are needed to make it work at all. The result is spacecraft that are both incredibly expensive and fragile.

    That's where it's been for thirty years. And it's not getting any better. In fact, it's getting worse. The Saturn V had the best cost per unit weight to orbit ever. The Shuttle costs far more, and this latest disaster runs up the cost per unit weight even more. All of NASA's attempts to design replacements for the Shuttle have been flops. (There have been three major attempts.)

    Heavy-payload spaceflight is an ego trip for superpowers, not a useful technology. Commercial small boosters have been built and launched successfully, but that's the limit of commercial interest. Single stage to orbit remains a fantasy. (Roton looked promising, but a bit of weight growth made the thing; it was that marginal.) The spaceplane idea goes back to the USAF's Dyna-Soar in the 1960s, but still hasn't worked.

    We either have to go to nuclear propulsion or give it up. Those are the options.

    1. Re:Space travel isn't feasible by ShooterNeo · · Score: 2, Informative

      Actually, sir, you are wrong here. Nuclear propulsion is inherently VERY, VERY, dangerous if its used in the boost phase. You have a hot, running nuclear pile. It has to have LIGHTWEIGHT SHIELDING. It has to produce an enormous amount of energy for the first few seconds during liftoff, to minimize the propellant used. If it melts down, you have hot radioactive debris everywhere. A fusion plant, even if possible, will be many decades, maybe centuries away before one with the power/weight ratio exists, if ever (think of all the lasers or magnets needed...much weight). There's an enormous difference between using a hot nuke plant to reach orbit and using a regular rocket carrying cool, freshly made fuel rods.

      The costs to minimize this danger, and the liability if it fails, would make the space shuttle seem cheap.

      However, there is in fact a third option you have not mentioned. A laser beamed from the ground would superheat an inert propellant block on the spaceship. Pulsed in the right timing, and it would generated a planar shockwave. No thrust nozzles or anything needed. Merely a heavy cube of propellant and the spacecraft bolted on top, as well as some sort of stabilization system. Much safer, nothing to explode, astronaut escape vehicles possible, and a far far better propellant/payload ratio (the laser would heat the propellant up at least 10 times hotter than a conventional rocket can reach). For the initial liftoff phase a short linear accelerator might be used to give the spacecraft its initial kick (and providing a safety delta V if the laser on the ground fails)

      This is something that would make space travel feasible in mass. Since the main power system, and most of the complexity , is on the ground (plenty of room to have backups then) the maintainence and operation costs would be far lower. Its estimated that unmanned payloads might reach orbit for perhaps $60 a pound (just the electricity to run the laser).

    2. Re:Space travel isn't feasible by dachshund · · Score: 1
      The spaceplane idea goes back to the USAF's Dyna-Soar in the 1960s, but still hasn't worked. We either have to go to nuclear propulsion or give it up. Those are the options.

      So, er, um, based on the fact that the spaceplane hasn't been worked out yet, you're willing to throw the idea out. And yet you place no similar requirements on the technically (not to mention politically) nightmarish task of building viable nuclear powered rockets?

    3. Re:Space travel isn't feasible by Christopher+Thomas · · Score: 1

      We either have to go to nuclear propulsion or give it up. Those are the options.

      I doubt that nuclear propulsion for ground-to-orbit will ever be practical, for reasons outlined in other messages.

      Methods that work around the problem you noted - low energy density - are any of a variety of methods that supply the energy externally.

      The space elevator is the most elegant, though difficult to build, solution. Mass going up makes the center of mass sink a bit. Add ion thrusters or other high-Isp drives at the center of mass, and you can reposition the cable. The net result is the cargo getting a ground-to-orbit trip using in-orbit Isp ranges.

      A magnetic launcher (or even a compressed-gas launcher like the "super gun") works well for cargo. It can't be used for humans, because the gun size for reasonable accelerations is ridiculous (thousands of kilometres), and the radius of curvature for survivable radial acceleration is similarly impractical. Still, that lets you build very large structures in space more cheaply.

      A laser-launcher scheme would provide an arbitrarily long acceleration path, as long as you had multiple stations along the (mostly lateral) launch route. This would make it potentially practical for humans. A laser launch scheme is basically an externally powered space plane. Because there is no combustion, you don't have the blowout problems you have with scramjets.

      In summary, I see several options besides nuclear.

    4. Re:Space travel isn't feasible by Animats · · Score: 1

      The most successful laser launch to date, using the biggest continuous laser in the US, lifted a 50 gram vehicle two meters. And that took a laser that cost $800 million to build.

    5. Re:Space travel isn't feasible by Christopher+Thomas · · Score: 1

      The most successful laser launch to date, using the biggest continuous laser in the US [fas.org], lifted a 50 gram vehicle two meters. And that took a laser that cost $800 million to build.

      Your data appears to be inconsistent with press releases on the subject. The release at spacedaily.com says that the test used a 10 kW pulsed CO2 laser. You can buy these off the shelf as industrial cutting lasers, for substantially less than $800M.

      A MIRACL-style chemical laser would actually be poorly suited to laser launching, as the laser launch schemes I've heard of use a 10-100 Hz pulse rate. The MIRACL would be difficult to pulse (I suppose q-switching might work, but that's typically done at much higher frequency).

      High-powered CO2 and chemical lasers are now substantially cheaper than $800M to build, also, largely in part to the basic research done for projects like MIRACL.

  92. Risks of Tether, Advantages of Space Plane by falsification · · Score: 1, Interesting
    Risks of tether

    A space tether would be a huge structure. Yes, it would be thin. It would nevertheless be very tall. As a result, it would be easy to hit. A cruise missile, ICBM, or an airplane that struck the tether would break it. An explosive device, including either a conventional explosive or a nuclear device, would break it. If the tether were stationed at sea, a submarine could clip the tether, or shoot a torpedo at it.

    There would be no way to defend the tether from terrorists. You would have to create a large no-fly zone and a no-sail zone around the perimeter. This would create a humongous, circular no-commerce zone that would harm the global economy.

    Natural events are also dangerous. A lightning strike could break it. An earthquake or volcanic activity could result in enough stress on the tether to break it. A tornado, with winds in excess of 400 mph, could damage the tether.

    If a tether ever became damaged or underperformed its design specs, there would be no way to repair it. It must always remain in place.

    Should we ever decide to remove the tether, there would be no way to take it down without it causing a catastrophe on the ground. Thus, there would be no way to ever upgrade the tether.

    What comes up must come down. A good engineer builds something so not only does it perform well, but when it breaks it won't cause major problems.

    Any breakage of the tether would result in catastrophe. First, there would be damage to the ground. Anything that big (about as long as the circumference of the Earth) is not going to totally burn up in the atmosphere.

    The tether has the advantage of allowing many trips into space. That is also one of its biggest disadvantages. If we could take 50+ trips into space every year, we would become highly dependent on space. Our economic security and probably our military security and national security would come to depend on this tether.

    The big problem is that once the tether is destroyed, you're probably looking at years before a replacement tether could be erected. If the first tether were brought down by terrorists or a wartime enemy, then military conflict would have to subside before the reconstruction project could begin. As a result, many of the tether-dependent assets we would have in space would be stranded for many years. Eventually the assets would die off from lack of oxygen, fuel, and supplies.

    Advantages of space planes

    The advantages of space planes are significant. First, you would have more than one space plane. Thus, if one were destroyed, you could still reach your assets in space with your other space planes.

    A space plane is less vulnerable to terrorism because it is (1) smaller and (2) mobile. That makes it a lot harder to hit.

    If a space plane comes down, it poses almost no risk to the ground. A good example is Columbia. Even if the fears about radioactive or toxic debris prove true, the area of effect will be minimal, relative to the area of effect of the tether breaking.

    Space planes could go into space much more often the shuttle. That would be the whole point of building them. If that is not technologically achievable, then we would just stick with the shuttle. But even today, the space shuttle is based on 30-50 year old technology. If we commit financial resources behind something, we can build it. That's what we've always done.

    1. Re:Risks of Tether, Advantages of Space Plane by quasi_steller · · Score: 1
      falsificaton wrote:

      Should we ever decide to remove the tether, there would be no way to take it down without it causing a catastrophe on the ground. Thus, there would be no way to ever upgrade the tether.

      What comes up must come down. A good engineer builds something so not only does it perform well, but when it breaks it won't cause major problems.

      Any breakage of the tether would result in catastrophe. First, there would be damage to the ground. Anything that big (about as long as the circumference of the Earth) is not going to totally burn up in the atmosphere.

      It seems that you don't quite understand how the space elevator works. :(

      An article on space.com explains it better:

      For a space elevator to function, a cable with one end attached to the Earth's surface stretches upwards, reaching beyond geosynchronous orbit, at 21,700 miles (35,000-kilometer altitude). After that, simple physics takes charge.

      The competing forces of gravity at the lower end and outward centripetal acceleration at the farther end keep the cable under tension. The cable remains stationary over a single position on Earth. This cable, once in position, can be scaled from Earth by mechanical means, right into Earth orbit. An object released at the cable's far end would have sufficient energy to escape from the gravity tug of our home planet and travel to neighboring the moon or to more distant interplanetary targets.

      In other words, if the tether were to ever break, the centripital force that prevents the station at the far end of the tether from flying out (yeah, the article was wrong, centripital acceleration is directed inward, causing the station to not fly off into space) will have suddenly dissapeared, causing the station to fly out from earth, along with most of the tether. (After all, if the tether breaks it most likely breaks in the Earth's atmosphere, ie. only a small percentage of the 21,700 mile tether.)

      --
      ...interesting if true.
    2. Re:Risks of Tether, Advantages of Space Plane by drinkypoo · · Score: 1
      Should we ever decide to remove the tether, there would be no way to take it down without it causing a catastrophe on the ground. Thus, there would be no way to ever upgrade the tether.

      Generally the tether is seen as being 'grown' from top to bottom. Want to upgrade? Un-grow it, and store the mass, then use it to build another one. Ostensibly there will be multiple elevators so having one down for reconstruction is reasonable.

      A lot of this stuff is highly recyclable, mostly you just need to apply sickeningly high amounts of energy to it, but the problems of generating energy in space significantly lessen with the presence of a large installation.

      Of course I will invoke the panacea; It may not really be feasible to build it at all without some significant advances in 'nanotechnology', whatever that means this week; But I'm talking about nanotech extrusion due to single-atom placement by nanomanipulators, or placement of microscopic building blocks which have been assembled by nanomanipulators. It might simply be too complicated (And thus expensive) to do without that technology, with "superior" nanotechnology (Self-assembling/replicating would be dandy but is in no way necessary and is not likely to come about soon enough to be worth talking about here anyway.) I'm sure it's possible to do without it but the amount of time it would take makes it unreasonable to undertake today. (Besides, today is going to be over in a couple of minutes.)

      Space planes are a good idea too but I don't think we're going to have the materials technology to make them reliable enough to make them cheap, and/or cheap enough to make them ubiquitous which is what you need to compete with a space elevator. Assuming you have enough places people want to go, a space elevator allows you to move basically as many people as want to get off earth in a fairly short time period. Or, as much stuff as you want to get on to earth, or off it.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    3. Re:Risks of Tether, Advantages of Space Plane by falsification · · Score: 1
      You assess a space tether as better than a space plane because the futuristic technology we need for one is more feasible than the futuristic technology we need for the other. I think that remains to be seen.

      We should not forget that materials science has advanced greatly in the 30 years since the space shuttle was designed.

    4. Re:Risks of Tether, Advantages of Space Plane by sdpinpdx · · Score: 1

      Space tethers, a related technology, can provide some of the features of a space elevator without the surface structures of a space elevator.

      Instead, payloads are transferred to the tether from suitable high flying aircraft (which may not exist yet).

      Tethers can also be used for orbital transfers.

      This is all in the white papers at Tethers Unlimited.

    5. Re:Risks of Tether, Advantages of Space Plane by falsification · · Score: 1

      Christopher Thomas would disagree. He says that were the tether to be cut near the bottom, it would remain floating, suspended from space. It appears there is disagreement among the tether community on this crucial point.

    6. Re:Risks of Tether, Advantages of Space Plane by drinkypoo · · Score: 1
      The point of a tether is mostly that you are using dramatically less energy. This is true at least as long as you are burning fuel for propulsion. Consider the problem that it requires a fair amount of energy to make the fuel in the first place; Then that energy is violently put into the atmosphere, which is a chaotic system. Adding energy to a chaotic system is a bad idea in most cases because you have no idea where it's going to come out.

      On the other hand, a space elevator uses a counterweight system so you never have to fight gravity, it will do that for you for free; You only have to fight against material stresses somehow (Through excellence of design of course) and you must expend a certain amount of energy to begin acceleration and aid deceleration.

      The initial cost to build a space elevator - now or later - is obviously higher than an entire fleet of space planes. However, the ultimate goal should be to not be burning tons of fuel in atmosphere.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    7. Re:Risks of Tether, Advantages of Space Plane by barawn · · Score: 1

      No, there're just two sections of the elevator: below GEO and past GEO. There isn't any "disagreement" - for crying out loud, we're talking about physics that you learn in high school.

      If the tether were cut near the bottom, the part that's below the cut would fall to Earth (and it would likely be in the first few km, so it wouldn't really be much at all - it'd be like a very long string falling back. No one would be hurt, no environmental impact, no nothing) and the part that's above the cut would shift its position based on the new center-of-mass orbit location. Fixing this is trivial - you spool out more cable, and the elevator is back to normal, just moved a little bit. Moving it back would take some time (that's a fair amount of mass to move) but eminently possible, and still a cheap repair.

      Severing higher up would likely be much more catastrophic in terms of repairability of the elevator, but virtually all of the elevator below GEO (the part that would plummet back to Earth) would burn up in the atmosphere. The mass-length-whatever of something doesn't determine how much burns up. For the most part, it's just surface area, and these things would have about a meter-wide surface area. They'd burn up in a rather spectacular show.

  93. Epic Thinking by gizmo_mathboy · · Score: 2, Insightful

    The real failing of NASA was when US (Congress mostly) stopped thinking big.

    The grand plan after Apollo was going to Mars. This needed a couple of key things:

    1) Reusable vehicle to ferry cargo and personnel to
    2) Space Station that could be used to house personnel and behind a vehicle to go to
    3) Mars

    After Apollo (during the end actually) funding was cut back and each of the steps listed had to stand on its own.

    So instead of building a reusable vehicle to ferry personnel and some cargo to orbit we got the Shuttle. So it was beefed up to spend 2 weeks in orbit, self contained, and big enough to carry ridiculous amounts of cargo and satellites.

    We then got a re-re-re-redesigned space station with a primary mission for science instead of a place to build an interplanetary vehicle.

    The Mars mission you ask? Well that's just a pipe dream since each of the parts necessary to get there were meant to stand on their own instead of working together for the big payoff.

    1. Re:Epic Thinking by khallow · · Score: 1
      The real failing of NASA was when US (Congress mostly) stopped thinking big.

      I disagree somewhat. It isn't the job of the US Congress to "think big". Instead, that task was solely NASA's. They failed both in their aspirations and in justifying their budget to Congress. IMHO the latter failure is directly due to the former.

    2. Re:Epic Thinking by gizmo_mathboy · · Score: 1

      While I agree that NASA has to come up with some good ideas in order for Congress to hand over the money. However, Congress has to be of the mindset to "think big" and be open to spending money on these ideas as well.

      It's kind of like convincing your boss that Linux is a good idea. If he doesn't have the mindset to try new things. Congress in the 1970's lacked this. They were satisfied with going to the Moon. In fact, they cut the Apollo program short, two flight I think.

      If the people holding the purse strings don't have the ability to understand what you want to do then no amount of "thinking big" on your part help.

      Otherwise everyone becomes more of a marketer then a thinker of epic ideas.

    3. Re:Epic Thinking by sql*kitten · · Score: 1

      The real failing of NASA was when US (Congress mostly) stopped thinking big.

      There was that, sure, but there was also the problem of having to finance the Vietnam War. That's what really killed the momentum. If it wasn't for that, an "onward to Mars!" mission could have come for the next decade.

  94. In 1985, the same question was probably asked... by Slashdot+Junky · · Score: 1

    Dear world,

    In 1985, the same question was probably asked after the Challenger explosion. NASA needs to do exactly what NASA did then.

    The Columbia tragedy was unfortunate side-effect of life, and life is full of risk. People will not suddenly stop wanting to be astronauts. NASA is a lot more than trips in to space.

    They need to not forget those who have given their life to the cause and then continue on in their name.

    Later,
    The still shocked Slashdot Junky
    .

    --
    .
    Landfill Mining Co.
    Managing the (Un)natural Resources of Tomorrow
  95. Disaster yes Tragedy no! by TerraByte13 · · Score: 1

    * RANT * Astronauts know the dangers they are getting them self's into. This was a disaster not a tragedy. A tragedy is when a 5-year-old child dies from a drive by shooting stray bullet. Not when a Scientist/ Astronaut dies doing something they love. Think about that!! As for the future of space travel, the big problem here is that space travel is still government funded. We need private sector corporations involved in space development! Think of all the natural resources in space ready for the taking! All is needed is government support of the privatization of space. Until then we will have to deal with pork barrel politics and over priced bureaucratic space programs.

  96. Robert Forward...? by Inexile2002 · · Score: 1

    It was really reading Robert Forward that made me realize how attainable space really is, if only we'd gather the collective will to go there. Of course, preaching to the /. crowd about heading into space is classic preaching to the choir.

    Some of his ideas (or ideas he put forward) are things that mankind should be and could be doing now. Orbital microwave power transmitters, the StarWisp, fountain towers, rotovators, sky hooks etc are all essentially doable and doable with current technology.

    However, in the modern world and with people possessing modern sensibilities - space exploration will have to give a return on investment that people (investors) can realize in lifetimes before it will really take off. It would be a hundred times easier to sell a scheme to launch a solar powered orbital microwave power transmitter satellite that could generate X megawatts of power than it would to sell a Mars mission. Why? Because the people putting up the cash want their money back.

    As much as I would the truth be otherwise, space exploration cannot in the short term rely on philanthropy and "man's quest for knowledge" if we want the gains that are achievable. Sigh. Why can't just this one thing not be about money?

  97. where to look by Gharbad · · Score: 1

    As we all know, Science fiction always has the best ideas for new innovations for new technology/breakthroughs. I mean, space elevators came from sci fi, as did many of the things for granted. Though i'm sure someone has probably already mentioned the same thing, I think we should keep looking to sci fi. Who knows what NASA could come up with next. Or if it will even be nasa who does it. Just keep an open mind about anything, who know's how big the next idea will be. -Chris

    --
    "Gharbad no Hurt!" -Gharbad
  98. Lets get it on!! by essreenim · · Score: 1

    I think Homers inanimate carbon rod would help NASA

  99. Are you sure? by NetGyver · · Score: 1

    What's the point if we have the tech and ability to spawn our human selves in another solar system? I mean, take out earth, put humans on another earth-like planet with a sun, and what you do you get? More of the same. We as humans need to socially evolve more before we can think about leaving earth for a new planetary home. In time, I think we can achieve that, but it's going to be a LONG while.

    --
    A Penny for my thoughts? Here's my two cents. I got ripped off!
    1. Re:Are you sure? by Moofie · · Score: 2, Insightful

      Why wait?

      America's social experiment wouldn't have worked if it were not geographically separated from the monarchies of Europe. While I would be the last person to argue that America's system is perfect, I do believe that it's a damn sight better than even a constitutional monarchy.

      There's nothing to say that the citizens of another world wouldn't go ahead and charter a new social contract. That, more than anything, is what makes me want to travel to the stars.

      --
      Why yes, I AM a rocket scientist!
  100. Let NASA sit tight by MacAndrew · · Score: 4, Interesting

    Let NASA make what decision? In whose benefit? They've done a mediocra job so far, except in self-promotion -- except for the occasional shuttle accident of roughly 2 in 100.

    Neither science nor democracy nor human safety will benefit from giving NASA free reign. We who pay the bills have to decide what the goals our and then work with the engineers to realize them. NASA has focused on self-promotion for too long, though it does a good job of it; its contractors do the work. I am astonished to hear insinuations that NASA budget cuts were behind Challenger, because they didn't have enough money to do it safely. Well, if true, they shouldn't have done it at all.

    Frankly, I think watching too much Star Trek and Star Wars is what perpetuates the manned space program. There is very little real science that can only be accomplished with manned flight, except perhaps research to support manned flight, and the circularity of that argument is obvious. The ISS practically exists to justify the shuttle program. We are squandering the opportunity to accomplish more in space and on the ground by funding an extravagantly expensive program based on the assumptions of 70's technology. The capabilities of robotics and automation, and our understanding of science, has advanced far since then.

    If decionmaking were placed in the hands of scientists (not NASA) instead of voters, if anything manned spaceflight would suffer the most. Many scientists have been furious for decades at the Shuttle for siphoning money off from useful research, especially interplanetary probes like the ones that brought us so much, Pioneer and Voyager and Mariner and Viking and so on.

    The shuttle is not financially justified, especially given its incredibly poor return, when they are many other projects in health, research, and education threatened with cuts because the U.S. faces a record budget deficit. It is hard to shrug off NASA's budget as "only" $14 billion (plus billions in cost overruns) when programs like Head Start that cost "only" $2 billion are criticized as too expensive. Certainly there are a lot of roads that could be built, too; a billion buys a lot unless it's unnecessary space travel.

    Absolutely, manned space travel is neat stuff, and I love it. As a kid I paid rapt attention to the shuttle's development, toured a mock-up at Rockwell, and trekked out to the desert to see Columbia land after its very first mission. I am shocked to see it destroyed in 2003, possibly for some the same reasons of mismanagement as Challenger (if it proves relevant, similar but nonlethal tile damage had occurred before, just as known O-ring malfunctions predated Challenger). But we can not let this tragedy spur us into the totally illogical course of wasting even more money on a program that will inevitably lead to more deaths for no reason better than "space is neat stuff."

    Is our goal manned space flight for its own sake? *That* is the kind of bad decision democracy can make.

    1. Re:Let NASA sit tight by Moofie · · Score: 4, Insightful

      People shouldn't go to space to do science.

      People should go to space to explore.

      Both are important to us as a species.

      --
      Why yes, I AM a rocket scientist!
    2. Re:Let NASA sit tight by DunbarTheInept · · Score: 2, Insightful

      The only reason manned spaceflight is expensive is because *all* spaceflight is expensive per kilogram lifted, and so the extra mass of a human body and the equipment to keep the human alive is a dearly bought thing. The fix is NOT to abandon the dream of human spaceflight and concentrate the budget on robotic science missions only. The fix is to spend the lion's share of the budget on finding out better means of getting to space so we no longer have to even have this debate. If you don't concentrate on making better launch vehicles, then spaceflight will always remain too expensive to be worth it, be it manned or robotic.

      The big problem to solve is NOT what to do in space with current (expensive) technology. The big problem to solve first is how to make it cheaper so it's not such a big deal whether a mission is manned or not.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

  101. Spaceplane + Elevator? by blincoln · · Score: 1

    I figure a space elevator is definitely the best long-term solution. Probably several spaced around the equator.

    That's a massive undertaking though, so some kind of spaceplane would probably be necessary for the short term.

    With the USSR out of the way, I would think (in a perfect world) that the US Government could get the Air Force to donate some of its advanced technology to the project. If they had the SR-71 decades ago, I wouldn't be surprised at all if they've got something now that could at least be modified into a single-stage-to-orbit vehicle.

    Emperor Dubyah (as much as I dislike most of his other policies) does seem pretty big on space, and even if the details of the technology remained classified it would definitely make a nice "peace dividend" impression, as well as showing off some advanced technology like when the stealth aircraft were revealed.

    Bah, wishful thinking, I know.

    --
    "...always new atoms but always doing the same dance, remembering what the dance was yesterday." -Richard Feynman
  102. Ask a.... by Siriaan · · Score: 1

    Where Should Space Exploration Go From Here?

    Er....... up?

  103. semi-OT: F22, the military and space exploration by XaXXon · · Score: 1

    BTW, the F22 can already supercruise, as it's been out for a while now.

    Looks like it can supercruise at mach 1.5. While it tops out around 1.8, that doesn't really matter. Top speed in fighters is virtually worthless because of the amount of gas you're going through. The ability to sustain mach 1.5 over long distances is VERY impressive. linkage

    I agree with the original poster about how these technologies will help build better space vehicles of tomorrow, while providing immediate benefits to us now.

    I'd like to point out that we're in a situation where we can spend $20 billion on space exploration BECAUSE we've spent so much money on defense. I'm not saying it's ALL necessary, or that the current use of it is good, but I would like people to remember that living in a world where your biggest concern is that optimal choice in the latest /. poll isn't an option (I drink my coffee black, you insensitive clod!) because we've been diligent in defending it.

  104. Lunar base by Scryber · · Score: 1
    IANARS (I Am Not A Rocket Scientist), but the next feasible step is a lunar base. Mars is certainly a notable goal, but probably not technologically (or economically) attainable...yet.

    Consider though a lunar base. Getting there is something we have done with proven success. Launch vehicles would be far less complicated than a shuttle-on-a-booster rocket, i.e. safer. Once a team is there in a medium-sized complex, NASA could just launch regular, unmanned rockets to them. These supply shipments would just settle down in a general drop area and the lunanauts could get in their buggy or tractor to retrieve them. No complicated docking maneuvers necessary.

    The structure would probably be safer than a space station. No worries about collisions with Russian spacecraft. The ISS has all sides exposed to potential space debris. A land-based, horizontal structure obviously only has it's upper surface exposed, and has much greater design strength being built on a solid foundation.

    I'm sure the amount of scientific research on the moon would be just as good as in earth orbit. Again IANARS, but there may even may usable resources in that moon rock.

    The shuttle has limited safety options due to its nature -- not really, actually its perception -- as a re-usable (read: disposable) vehicle. Because a lunar base is long-term project, contingency plans for evacuation would be practical, and expected.

    The public would go for it. We haven't been to the moon in 30 years. People hardly ever knew that a shuttle was in orbit at a given time, but with a moon base on a cloudless night you'd be hard pressed not to look up and think, "Huh. There are actually people up there." Paranoid foreign dictators might get even more twitchy, but you can't have a better reminder of your technological superiority than that.

  105. Space station by glenebob · · Score: 2, Interesting

    I think a complete and usable space station needs to be the first major priority.

    The first short-term priority should be a cheap efficient way to launch materials into space. If it costs a small fraction what it does now to get material into space, the space station will get built much faster and using far less expensive materials and designs. Humans can still ride the space shuttles or some similar thing, but materials can survive a much more violent (and one-way) trip to space. Perhaps the shell of the launch vehicles could double as space station modules.

    Once the space station can support a fairly large crew, how about adding an assembly facility, so that long-range space craft can be sent into orbit in pieces, then launched from the space station. Additions to the station will also become easier to complete.

    The basis of all exploration beyond Earth orbits seems to me to lie in a functional space station. Without it, space will continue to be wildly expensive and insanely dangerous.

    Then, explore, baby!!! With the problem of re-entry gone for long range space vehicles, long range missions should be much cheaper and safer. So let's start by exploring the moon a bit more, some asteroids (and see if money can be made mining those suckers), and then Mars.

    Long-term goal? Space station in Mars orbit and at least a minimal surface base.

  106. Re:Power Generation [ not really so off topic ] by cervo · · Score: 1

    It is not really so off topic, because power generation is important to everything. If NASA could generate cheap and renewable power, after the rush of the power companies trying to stop it, NASA could make enough to support the space program. But more importantly, the problem with space travel far away is power. Once you get too far from the sun, solar energy is no longer feasible. Also without carrying around explosive fuel, space shuttles would be much safer not to mention cheaper. Fuel weight makes the shuttle heavier and so it needs even more fuel to fly. A nice lightweight energy source such as a laser beam from a satellite or a solar battery in the shuttle itself would be much more efficient and cheap.

  107. Wernher von Braun and China by dexter+riley · · Score: 1
    Tom Lehrer once sang;


    And what is it that put America in the forefront of the nuclear nations? And
    what is it that will make it possible to spend 20 billion dollars of your
    money to put some clown on the moon? Well, it was good old American know-how,
    that's what. As provided by good old Americans like Dr. Wernher von Braun.



    Gather round while I sing you of Wernher von Braun,
    A man whose allegiance
    Is ruled by expedience.
    Call him a Nazi, he won't even frown.
    "Ha, Nazi Schmazi," says Wernher von Braun.

    Don't say that he's hypocritical,
    Say rather that he's apolitical.
    "Once the rockets are up, who cares where they come down?
    That's not my department," says Wernher von Braun.

    Some have harsh words for this man of renown,
    But some think our attitude
    Should be one of gratitude,
    Like the widows and cripples in old London town
    Who owe their large pensions to Wernher von Braun.

    You too may be a big hero,
    Once you've learned to count backwards to zero.
    "In German oder English I know how to count down,
    Und I'm learning Chinese," says Wernher von Braun.
  108. It should not be an option by mexicanfood.org · · Score: 1

    Unfortunately science isn't something we can leave up to the people. Too often, the public can't see the immediate advantages of research. The benefits of Space Travel are particularly important to all of society, though. Limited resources will always be the primary cause of poverty. Eventually, space travel will decrease the resource deficiency as other sciences have by allowing humans to bring resources in from outside of our planet. Asteroid mining is a possibility. One day, we're going to blow this Earth of ours up. Destructive capabilities are only increasing. Not only is Mars (among other non-Earth locations) a distinct colonial possibility, terraforming Mars might be the destiny of our race. Continual human space exploration may not currently be as productive as robotic missions, but these missions provide inspiration and an immediate goal (exploration, human destiny, blawblaw Columbus blawblaw) to the public. A Mars mission would be a wonderful way to focus the people on something more important than Iraq. The next step might, though, be the design and construction of a new spaceship. Soon enough, there will be no one left in NASA with shuttle designing experience. The time to act is now. This does not mean we should discontinue Shuttle trips, though. NASA will look into the Columbia disaster and discover a number of possible reasons for the disaster. These errors will be eliminated and future missions will be that much safer. The importance of space exploration and increased NASA funding is not something that should be left to a check box on your tax form. Its something that requires immediate and massive attention as it is important to all of society, all of Earth. Bush seems to be in favor of increased funding. I'm just afraid he's going to go all JFK on us and give me something positive to remember him for. In any case, I hope those in Congress that hate the man as much I do don't make this a partisan issue. Hopefully Democrats can begin championing research issues more than they have in the past. -Sorry 'bout the rant, Ben

  109. The Buran!!! by mrbrown1602 · · Score: 1

    I personally think the US should buy the remaining Buran space shuttles that the Russians made in the late 70s throughout the 80s. Although they were never used, in tests they proved to be more efficient and in someways safer than the U.S. space shuttles.

    1. Re:The Buran!!! by Indy1 · · Score: 1

      actually i belive the buran was once launched and recovered sucessfully, though it was an unmanned flight.

      --
      Lawyers, MBA's, RIAA? A jedi fears not these things!
  110. Defense spending doesn't help anyone by reverendG · · Score: 1

    Unless you subscribe to trickle down economics. If you do, then please go drink a nice warm glass of reality.

    If that 20 billion dollars that's being spent JUST to develop one plane were given to NASA, we'd end up with a lot more scientific advances than blown up camel stables.

    --

    Why should I argue rationally with someone being irrational? I'll just mock them instead.
  111. The Pervasiveness of Money by flyingV · · Score: 1

    I don't know much about the way politics work, but I, for one, think that an opt-in list would be a great idea. Because the true problem is: when money is needed for -everything-, regardless of the nature of that thing which is being acquired, and money is limited (which it is), then increasing spending in one field necessitates decreasing spending in another, often wholly unrelated field.

    When money is the issue, the question is not "Moon, or Mars?" The question is not "Shuttle, or new spaceplane?" The question isn't even "International Space Station: fly or scrap?" It becomes, "fly a shuttle... or feed the hungry?" "Space research... or cancer research?" Yes, of course I know there's corruption, and dollars don't go where they're supposed to go, but I'm talking about the principle of the matter. The principle of the matter is that there are more immediate issues here on earth, and those should be tackled first.

    I don't know what NASA's future is, given such drastic budget cuts. Perhaps NASA will -ultimately- lose out to smaller start-up companies that are doing independent work to get sattelites, and humans into space (consider John Carmack's Armadillo Aerospace). Or maybe ultimately, it's another engineering problem: better materials for less money, faster and smaller computers, and complex systems that lend themselves to easy maintenance and repair. Only time will tell.

  112. Future of American Space Travel by JWSmythe · · Score: 1

    NASA has and always will be a big political game. Politicans want to look good to the public, so they throw money into something the public will (hopefully) like.. Why did we (America) go to the moon? Because Russia put something in orbit, and we wanted to prove to the world that we're the cool elite superpower that no one else can beat...

    If it was all about the advancement of mankind, NASA shouldn't be contracting out the jobs to select companies who can never disclose their work.

    Space travel should be handled by corporations looking to make money off it.. They'll make their money, they just need a little "encouragement".

    Take automobiles for example. If the gov't had said "These are for government use only, and will only be built by our select contractors, who will work under top-secret clearance, and can never share or disclose any information about the project", there would be only a few select types of cars on the road, and they'd each cost 10 billion dollars. And, no individuals would have cars in their garage. :)

    If the government turned around tommorrow and said, "We'll give a 100 billion dollar grant to each company who successfully prototypes a reusable space vehicle for regular commercially viable use, and has it ready for production", I'd bet we'd have 5 to 10 working reusable space vehicles within 10 years. Not only that, but you'd see airlines picking up a few of them for use too..

    But, space is the government's monopoly. Normal humans don't go to space. Anything about say 40,000 feet is unreachable, and no one is traveling there. The government has a nice safe place to keep their communications and spy satellites. They can put almost anything they want up there, and know it will remain relatively undisturbed .. Well, except for micrometors, and other assorted space junk.. (insert the obligatory alien/UFO reference here)

    I'd *LOVE* to see a few of the aircraft manufacturers making working spacecraft, using the information that the government has researched on aerospace science over the last 60+ years. But they'll never let it all out, so aircraft manufacturers are starting with what they've learned about aeronautical science.

    {sigh}

    We need to adjust our government a bit..

    When I'm president............ :)

    Vote for me, JWSmythe, on the Slashdot party, on election day! WhooHoo :)

    --
    Serious? Seriousness is well above my pay grade.
  113. Stop keeping private spaceflight down! by Russ+Nelson · · Score: 1

    If we wanted to get into space in a big way, we'd do it the American way -- via private enterprise, rather than the centrally-planned, tax-funded socialist way. How about not making private spaceflight illegal? There's plenty of people ready and willing to fund spaceflight. Look at what John Carmack has done.
    -russ

    --
    Don't piss off The Angry Economist
  114. The best idea I've seen... by C0LDFusion · · Score: 1

    ...involved Mag-Lev and a Ramp-like runway.

    Basically, it could run down the runway, building up momentum and use the ramp to help direct the ship upward. It's hard to explain, and I don't have a link, but the ideas been around in Japan for a while, even though they have yet to implement it themselves, as it would be a fairly large construction project, and not necessary to them, when the US does all the experiments they need done.

    --
    Only in slashdot are posts of solidarity modded at -1 Redundant, while posts of antagonism are modded as -1 Flamebait.
  115. Expensive? by vitaflo · · Score: 1

    Given the fact that the Dept of Defense budget is 25 times what NASA's is, shouldn't we be a tad more worried about why we're paying all this money for Defense? Cut the Defense budget just 4% and give that money to NASA and you just doubled NASA's budget.

    As for people worring about saftey, I think the astronauts are well aware of the risks, and that rocketing into space is no where near the same as flying an airplane. It's a whole different beast altogether. To me, astonauts are no different from military soldiers. They know they are putting their lives on the line, they know the risks and accept them. If they're ok with it, I think the general public should be as well.

  116. Moon Unit Zappa by Bob+Vila's+Hammer · · Score: 1

    Why not return to the Moon to perfect the skills needed to set up a mission to Mars? Exercises and missions launched from the Moon would be much more efficient than on Earth, and although not as efficient as space, would yield the complimentary research study of living and conducting space missions on another world.

    --


    --"The perfect example of the man of action is the suicide." - William Carlos Williams
  117. Comment removed by account_deleted · · Score: 3, Interesting

    Comment removed based on user account deletion

  118. ROBOTS ROBOTS ROBOTS ROBOTS ROBOTS! by MillionthMonkey · · Score: 1

    For space exploration purposes, people suck. They have two advantages- local decision making ability, and propaganda value. That's it.

    By all other standards human beings are horrible astronauts. They need to be pampered with reasonable temperatures and pressures, a comfortable oxygen environment, water, food, toilets, thick heavy shielding from cosmic rays, and worst of all, a return trip! The rockets carrying them need to conform to tighter specifications and when they inevitably crash we have to sit through another God Bless America orgy. Humans get unexpected disorders and diseases and require elaborate medical care. Even in pedestrian frontiers like Antarctica we've been treated to spectacles like a doctor performing a biopsy on herself and administering herself chemotherapy using medical supplies dropped from a plane. Can you imagine someone developing cancer, appendicitis, or schizophrenia halfway to Mars? Although it would save a great deal of money and actually make some missions practical to carry out, we would never ask a volunteer to go to the surface of Mars or Europa and then take a cyanide pill. But that's because we're a bunch of hypocrites. This is practically what we are doing when we send people into space.

    This is all a high price to pay for local decision making ability, especially when you consider that humans are likely to travel no more than a few light-minutes away anyway, in regions of the solar system that are easily accessible by radio with relatively short ping times. And there is NO reason to send people to low earth orbit. What the hell is the point of that? LOW EARTH ORBIT IS NOT SPACE EXPLORATION.

    Robots make much better astronauts than people do. When they're in accidents, nobody cares. In fact, the French crashed an unmanned rocket last month and it was a one day "ha ha" story. Our robots have visited several planets and have even landed on the surface of a few of them. Despite the small amounts of funding they get, their track record is much more impressive. And there are many more things we would be doing with robots within the solar system, if it weren't for the crowd-pleasing money pits known as the Space Shuttle and the International Space Station.

    And what the hell is the point of these programs? Critics usually counter with some dumb argument involving the Wright brothers. But air travel has obvious benefits. You can get from point A to point B really fast in an airplane. What is the point of cramming people into garbage cans in low earth orbit? Except to suck money away from more deserving programs? In a few years our launch window for Pluto will have expired. It is receding into the further part of its orbit. By the time a probe arrives, its atmosphere will have frozen onto its surface where it will remain for centuries. You could fund a dozen of these programs with the money wasted on a single shuttle launch.

    If you feel strongly that we should fund the shuttle because "the future of mankind is in space", you're fooling yourself. The most the Space Shuttle will do is scatter mankind across Texas and parts of Louisiana.

  119. Safe Craft For People, Powerful Craft For Stuff by istartedi · · Score: 1

    SRBs and other dangerous (yet powerful) equipment should be used to launch the "stuff" to perform experiments and build human habitats.

    A next generation expendable capsule should be built in cooperation with the Russians (for the practical experience) and others (to bring in modern updates to this time tested design).

    Let's face it: The shuttle was built because it comported with our notions of how space travel ought to be. It would work great if we had duratanium and antimatter propulsion, but we don't.

    Under an efficient system we could man the space station, establish a *permanent* presence on the moon using a combination of automation and human presence, and travel to Mars.

    Separate the danger from the humans whenever possible. For example--lunar habitat module lands with no occupants. Occupants arrive in smaller, lighter, more easy to design LEM, board the module (assuming it landed properly) and then use the module's drive system to align it with other modules on the Lunar surface.

    Once the Lunar presence is established, it can be the staging area for Mars and beyond. The knowledge that we gain building these systems might lead to duratanium and antimatter drive, making the shuttle practical again someday.

    Until then, the mantra should be Powerful, Cheap and Dangerous (PCD) for the inanimate objects. Small Expensive and Safe(SES) for the humans. The shuttle is Powerful Expensive and Dangerous--not the way we should choose to merge those two acronyms (of course they didn't know that when the thing was on the drawing board--at least not the dangerous part).

    I think that if the turning point comes *now* then we can undo the damage that was done post-Apollo. That means we hit Mars in 30 years. I'll be 64 years old. If I play my cards right, I'll be able to let the grandkids stay up late and watch history being made.

    --
    For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
  120. China's space program = Big Bucks for NASA by dexter+riley · · Score: 1

    Don't worry about NASA's funding...once the Chinese reach the moon in about a decade, and they start building their space station, NASA will get all the funding they need. The U.S. would not have rushed to reach the moon as quickly without the threat of Soviet domination of space. I suspect that the serious prospect of another nuclear power gaining superiority in the 'high ground' of space will get more money to NASA fast. Maybe if we're lucky, this new space race will lead to the permanent settlement of space, and not just another arena for conflict between the U.S. and China. Maybe.

    Meanwhile, I just hope the Cassini-Huygens probe makes it to Titan in fewer than a million pieces.

  121. Its got to be inexpensive and effective by Wo-Fat · · Score: 1

    What NASA needs to do to stay alive is show progress. We managed to fly to the moon in a few short years, yet here we are flying the same trips in the shuttle over and over again for 20 years plus, and gaining little that the public can sink their teeth in to ('fraid to say Hubble doesn't interest most people).

    What is needed is for goals to be set, then those goals to be met. NASA needs to pick something that can be done inexpensively, and start doing it. As they show success, public confidence will build, and so will the funding. This is the nature of our economy, and NASA isnt exempt from the rules.

    Personally I like the idea to start a base on the moon, which we can later use as a waypoint for future space missions. Use the less expensive launch systems of today, and simply start dropping off the parts to do it with unmanned flights. After a few years or even less, we send up a set of astronauts to put it all together. Then we can start using that as a base. Sending off flight to Mars from the moon is much more economical.

    What this type of thing does is give the public 'goals' that NASA can work on and achieve, and actually show some progress for the money spent.

    Back to the topic at hand though. Offering a check box on a tax return? You can't get 14.5 billion (2002 NASA budget) that way... It's just too much money.

  122. On word by xihr · · Score: 1

    Onward.

  123. nasa is not the hog you might think it is by asv108 · · Score: 1
    We all know NASA is completely mismanaged, and needs a complete restructuring, but it doesn't get that much money. Take a look at this image from the WSJ, that shows that the NASA Budget today is a far cry from the late 60's.

    Take a look at this chart of the 2003 Bush Budget proposal increases, which is going to put our economy in the shitter for a long time. The defense budget is getting a $379 billion dollar increase. That's right, in order to fight terrorism we need to invest in the latest defense technologies since we all know 9-11 wouldn't of happened if we had better tanks, fighter jets, and my favorite project looking for an enemy, the missle defense system. I love how the government uses an incident which could only have been prevented by quality intelligence work, immigration procedures, and airport security, as an excuse to feed already bloated defense budgets.

  124. GRAVITY DRIVE by essreenim · · Score: 1

    My rocket beats all - it uses the JXR gravity drive

    ^
    ^I^
    III
    III
    ^ ^
    ~~~~~ /\/\/\ /\/\/\

  125. what goes up must come down by cassady_ · · Score: 1

    The only problem I see with your plan is this: what gets these pods up in space? If we launch rockets up, what do we do? Leave them there? Seems like a bit of a waste. As an emergency re-entry system for the ISS though, this does make some sense.

  126. You don't mean...? by leonbrooks · · Score: 1
    it is well known that they have weapons of mass distruction

    Time for the Pope to start panicking? (-:

    --
    Got time? Spend some of it coding or testing
  127. NASA needs to set their sights higher by WolfWithoutAClause · · Score: 1
    NASA is a government organisation, their equipment is too expensive to open the high frontier fully.

    NASA has done a ton of research, and the results of that will allow companies to open it up further.

    Compare NASA's costs to the Russian costs (Russian equipment is atleast 20x cheaper, but their wages are no less than 1/10 of the US wages), so it looks like the Space Shuttle is atleast twice as expensive as it strictly ought to be, and you start to see what can be achieved in making Space more cost effective.

    Truthfully, the frontier has moved on; NASA needs to explore the new frontiers, and leave launching to other organisations; and that's not because of Challenger nor Columbia, it's just the way it is.

    I think George W. Bush's move to go for nuclear interplanetary propulsion is a smart one; NASA need to look at tethers, Mars, lunar and asteroid exploration.

    --

    -WolfWithoutAClause

    "Gravity is only a theory, not a fact!"
  128. Krugman article in NYT by MacAndrew · · Score: 1

    From the other end of the political spectrum, Paul Krugman says pretty much the same thing in yesterday's NYT. I'm surprised he said it so soom after the tragedy, but then Tuesday is his column day and people are actually listening. This is when we can get people thinking.

    BTW, both Paul and Gregg can get pretty snitty when they think everyone else is an idiot (usually). But they both have some great insights.

    The timing here is eerie for me, becuase I've been hashing out in my own mind whether manned spaceflight is worthwhile, specifically the shuttle. Just a few weeks ago I was figuring the odds of 100 successful shuttle missions in a row with NASA's own predicted failure rate of 1-in-500 (about 70%, not great). Then a week ago the teacher-in-space thing reappeared, which to me is the pinnacle of unnecessary threats to human life. Then I looked at NASA's deficit out of a $14 billion budget.

    Now is the time to reform our expectations. Manned space flight has for so long been held out as the way things would be done, but most of the reason for it -- any actual need to have humans in space to manipulate things -- has largely disappeared. The Hubble telescope repair might be one exception, but that's a big exception and we could have just sent up another for the cost of an orbiter (indeed, the next-gen NGST has been in the works for several years and if anything is delayed by Hubble).

    Unlike the 70's, when a glacially slow personal computer was exotic stuff, machines can do most of the astronaut tasks now, and that's cause for celebration. The most honest consensus that there is nearly no valid scientific reason to pursue manned spaceflight except the circular desire to pursue manned spaceflight. Much as I like manned spaceflight, I scads of data from unmanned probes is a lot sexier. I have trouble thinking of many accomplishments that are uniquely thanks to the shuttle.

    The past leaves an impression on us. The older generation remembers Apollo 11 as a defining moment. I was 2. For me, it was the wildly successful twin Viking landings in 1977. Mind you, I was there in person for the first Columbia landing, and I still think Viking was more memorable -- those pictures! The deep red cover of National Geographic!

    Robots are cool (think of the advances in robotics if we emphasized them for spaceflight?) and relatively cheap; they accept one-way missions with alacrity; and if we lose a shuttle full of robots it's not a moral quandary but a pocketbook issue and maybe a spectator sport. We can always come back to manned flight later.

    Let's study space for now, conquer it later, if we even feel it needs conquering in person at that time. That we have learned is a just way to honor those whom we have lost.

    1. Re:Krugman article in NYT by eclectro · · Score: 1

      I really did not give this any thought until this last weekend. I always thought that NASA's odds of another disaster were a bit optimistic, but I thought that NASA had a handle on it.

      Then after the disaster I heard NASA administrator O'Keefe say "We will find out what is wrong, fix it, and continue flying."

      I found this particularly saccarhin (esp. as it was the same thing they said after Challenger - like a script), and I started asking myself, what is it we are trying to accomplish here?? Certainly, it's not good science.

      It's like the the little thread on the sweater, once you pull it the whole thing comes unravelled.

      The whole NASA organization seems to be so self-deluded that it feels that it needs to continue manned space exploration (specifically shuttle flights), even though they are not accomplishing anything important (certainly not science), other than a public relalions campaign. At $3 billion a year on shuttle flights, not including the ISS, it's an expensive PR campaign. I too think the idea of a teacher in space is ridiculous (and they are even now promising to press on with it). Richard Feyman said at the end of his report on the Challenger disaster;

      "For a successful technology, reality must take precedence over public relations, for nature cannot be fooled."

      I came to the same exact conclusion you did, and am grateful that there is another slashdot poster of like mind, admist the irrational chorus of "manned spaceflight must go on."

      BTW, I too think that the Viking missions was a hight point.

      --
      Take the cheese to sickbay, the doctor should see it as soon as possible - B'Elanna Torres, "Learning Curve"
    2. Re:Krugman article in NYT by DunbarTheInept · · Score: 1

      I get sick of hearing this argument about manned vs unmanned spaceflight. It's missing the point. There wouldn't even BE such an issue if the cost to lift a kilogram to orbit wasn't so horribly expensive. The only reason to replace humans with robots in space is that a robot doesn't require as much lifting capacity. But *that* is only a relevant issue because current spacelift technology isn't that good yet. You call it a waste to spend money on manned flight and instead we should spend it on unmanned probes. I call it a waste to spend money on researching how to make the the payloads lighter when we should be spending the money on how to make the lifting stronger and cheaper. Then the whole question would be rather moot.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    3. Re:Krugman article in NYT by Fweeky · · Score: 1
      The older generation remembers Apollo 11 as a defining moment. I was 2. For me, it was the wildly successful twin Viking landings in 1977

      Personally, I've always thought Voyager was the coolest thing NASA ever did. Never mind putting a bunch of men on a barren boring-ass piece of rock; Voyager gathered truckloads of data on *four* major planets and their moons for something like 1% of the cost of Apollo, and for that matter, the ISS.

      I agree, we should be studying our solar system, perfecting our launch and return and automation methods, and getting yet higher resolution images of all the wonderful objects in our sky to use as wallpapers (never mind Hubble, we want Wallpaper Imager 1, gathering sharp, colourful 1600*1200 images of every nebula and planet we can see! ;)
    4. Re:Krugman article in NYT by MacAndrew · · Score: 1

      You're totally right, except maybe on the Wallpaper thing (I use a Mac and we called them "Desktop Pictures" first -- what the heck is this "wallpaper" thing anyway? It's a desktop, not a wall. :) I thought of Voyager later. A lot of Voyager was overshadowed by the Shuttle, both its successes and, directly, the Challenger catastrophe.

      Viking had more of that "defining moment" quality with the actual landings (two!). The idea of these robotic human-designed craft setting down on MARS was amazing to me in a way I suppose Apollo touchdown to have been. I thought the Pathfinder "hard landings" were cheating a little. :)

      Yet I don't have any real interest in sending humans to Mars, not because I'm older and wiser but because the inefficiency and mortal risk are just too huge for a "gee whiz" moment. Apollo can be described uncharitably as a "stunt" -- a damn cool one but also a damn lucky one for loss of life. Apollo 13 wasn't the only close call; Apollo 12 avoided total breakup when it was struck by lightning because of accident of design. Look at the extremely expensive double failure in 1999 -- at least no one was killed. Even NASA's unmanned plans for Mars are stumbling badly.

      Voyager -- that those things are still functioning 25 years later! -- and doddering Galileo -- also well past its design life -- are what draw my attention. The brilliant Galileo tape recorder repair is mentioned here.

      Manned spaceflight, specifically the Moon landing, is an amazing accomplishment that will always symbolize so much, but it can't compete now with the performance of the engineers in these ingenious probe projects. I don't want the the program gutted, I want it refocused and improved with modern sensibilities adn technologies.

      Even ISS can be serviced mostly by "dumb" rockets, as was Mir, if we must go the route of a space station. (Yes, the Mir resupply vehicle had a fender-bender, but humans could have done that, too.) The shuttle's role there has been overemphasized so that the shuttle would have a role as all.

    5. Re:Krugman article in NYT by MacAndrew · · Score: 1

      No, you are missing the crux that every useless pound displaces a useful pound. Sacrificing resources and endangering lives because "manned space travel is cool" is irresponsible, there need to be real justifications and there aren't. I'm not saying we should necessarily reduce launches, I think we're launching the wrong stuff. Anything that can be done without people should be done without people, and that's a lot more than we have been led to believe.

      In the 70's the shuttle program rapidly siphoned money off from hard science programs to the resentment of scientists. They didn't applaud the manned space program, except for that fraction that need humans to do experiments that current technology can do on the ground or in unmanned vehicles.

      We don't have to spend any money to know we can lighten payloads immensely by eliminating the humans -- and fewer people will get killed to boot.

    6. Re:Krugman article in NYT by gorilla · · Score: 1

      It's not just a cost to orbit thing. Undersea exploration has a very small cost to submerge weight. The cost there is getting a support ship above where you want to go, and then it's essentially the same if you put down the smallest ROV or the largest manned submarine. But the best stuff happening there is with ROV's. You can leave a ROV down longer than a manned sub and you can take a risk with a ROV that you'd never take with a manned sub.

  129. Special Interests on your tax return? by whitefox · · Score: 1
    I dunno. Seems to me if a checkbox were available for NASA funding, other special interests would be sure to follow. Why not a checkbox to disallow the funding of nuclear weapons research and development from you taxes? Or one to go to specialized social programs?

    The point is our tax system is already complicated enough as is and the 1040 I file every year is already 4 pages long. Do we really want to clutter up the tax code more?

    1. Re:Special Interests on your tax return? by Xeger · · Score: 1

      We have voluntary donation boxes on our tax returns for campaign advertising contributions. If we can afford to pay for some podunk House member's bid for another term, then we can certainly afford to pay for our space program.

  130. What should NASA do next? by NortWind · · Score: 1
    I like several ideas I've heard over the years, besides the elevator to space, which still seems out of reach.

    1) Send a robot to Mars with empty tanks, a reactor, a pump, and telemetry. Let it mine the Martian atmosphere for a year or so to extract oxygen from C02 in the thin air, and H2 from the water vapor in the thin air. Check on it to make sure there are plenty of both before sending the people, and then you don't have to carry your return fuel and oxygen all the way there. The savings are astounding! Here is one plan.

    2)Put a base on the north pole of the Moon. There 's water there (as ice) so with energy from a reactor you can make a livable place much cheaper than at a space station. It lots easer to get rocks to protect your living quarters too! Melt the rocks down to make the equivalent of fiber glass, concrete, etc. It's very much cheaper to take off from the Moon, (even at its north pole) than it is from the Earth at its equator.

    3)Talk to Burt Rutan about making an airbreather plane that converts to a rocket after it leaves the atmophere. Most of the weight of a rocket now is oxidant.

  131. The SSX and DC-X by melatonin · · Score: 4, Interesting
    Jerry Pournelle has written the best article I've read so far on the subject. He's a guy whose actually gotten funding for his ideas (the DC-X) and has good insight into what Americans should be doing with their space program.

    The X-series (discounting the dumb X-33/34, and I use dumb lightly) were a smashing formula for success, and they were the blueprint for the process of getting man on the moon. Pournelle says we need a similar project to focus on building a space ship. Haven't you always wanted a space ship? :)

    --
    Moderators should have to take a reading comprehension test.
  132. The Moon. by WoTG · · Score: 1

    Seriously. I, like many Slashdotter's, was not around when the Apollo missions took place. I can only imagine the the feeling of watching folks romp around off the planet. Sure it's been done before, but a long time ago, and with similarly old technology (and knowledge!). Why not send another mission out, maybe land on the dark side (correct me, if they already have), take some new high res. photos and videos, set up a long-term, unmanned monitoring station. I'm sure with 20 years of research, there must be a LOT of new questions that need answering. It would also make for a great warm up for something bigger (i.e. Mars). But most of all, like I said earlier, it's all about capturing the imaginations of humanity. Rekindle the support that NASA had in the past. LC

  133. Sorry, wrong named mission by dWhisper · · Score: 1

    Not the Global Surveyor, I was thinking about the weather module of the same project. It was the one that was lost half-way between here and there.

    Sorry, wrong name on my part

    1. Re:Sorry, wrong named mission by LMCBoy · · Score: 1

      Yeah, it's easy to forget the stunning successes, and focus on the failures, I guess ;)

      --
      Liberal (adj.): Free from bigotry; open to progress; tolerant of others.
    2. Re:Sorry, wrong named mission by Moofie · · Score: 1

      Only thing I want to hear from a robot on Mars is "Hey, Boss, this looks like a good place to land. Come on over."

      : )

      --
      Why yes, I AM a rocket scientist!
  134. Democratize government spending of our money by cpeterso · · Score: 1


    I think democratizing the entire government budget would allow people to literally "vote with their dollars". I get pissed off when state bond measures are floated to support "extra stuff" that I feel should be paid with the tax money I already forfeited. Change the 1040 tax forms to allow the taxpayer to specify how much of their tax dollars should fund their favorite programs. The government's actions (driven by the available budget) would be directly guided by the hand of the people.

    Sure, some people will give 100% to environmental cleanup or 100% to defense spending. I imagine the first few years would be bumpy when certain programs 0% of their previous budget, but I think this budget system would soon become self-correcting as people realize the direct consequences of their budget choices.

    1. Re:Democratize government spending of our money by Associate · · Score: 1

      would soon become self-correcting

      Sorry, I mis-read that as self-corrupting. Think, if I worked for the DOT, would I not want more money to go to roads? I'm not saying this is a bad idea, but many times when we have that obvious answer, we are dissapointed by the results.

      --
      Someone hates these cans.
    2. Re:Democratize government spending of our money by ArsonSmith · · Score: 1

      Yes, I understand where you are getting with this. If roads are bad then people will vote more money to the DOT; good except now what incentive does DOT have to make good roads? so let's not give them money; now what do they make new roads with?

      We would have to have a 3rd party auditing group, such as mass media or something to insure that these places are doing the best they can with my/our money.

      --
      Paying taxes to buy civilization is like paying a hooker to buy love.
  135. Why didn't they see the damage? by KidSock · · Score: 1, Offtopic

    ..in space? Don't they go outside and spacewalk once in a while? If they knew the dibris from the external tank may have contacted the underside why didn't they get someone to go out there and look?

    1. Re:Why didn't they see the damage? by Minna+Kirai · · Score: 1

      Why not? Because it would've made them cry, that's why. They'd struggle through a spacewalk, see the damage, and know they were all going to die. Since there was no way to fix it, they didn't bother to look.

      It would've been honest and responsible to try and inspect for damage, but NASA kept its fingers crossed and optimistically hoped that nothing could go wrong.

      Why could nothing be done about it? They couldn't wait for a rescue shuttle (well, there's was a slim chance). They couldn't go to ISS and wait there (unless they were launched on an intercept course, that much travel would exceed their manuvering fuel). And, assuming the damage was to the fragile heat-insulating tiles, they couldn't fix it themselves.

      Why couldn't they fix it? They had no spares? Why not? Because even standing on a scaffold with proper tools, it takes 30 hours to replace one fist-sized tile. (I had trouble believing it took so long, but NASA said so. Retiling is one of the slowest parts of refiting a shuttle for another flight)

      Bouncing a tennis ball of the shuttle would break 2-4 tiles. If that happens after lift off, you've just gotta write off the whole vehicle.

      PS: The long-shot approach (waiting for another shuttle to be launched for rescue) might've involved the kinds of bitter calculations sociology undergraduates tackle in classroom exercises each spring. In a rush, the ground crews might've taken 3-5 weeks to prepare a another trip. No shuttle so far has stayed up even 3 weeks. I can imagine them doing the math: "They rescue us in 25 days. But we suffocate in 21 days- unless we kill two people immediately!"

    2. Re:Why didn't they see the damage? by EddieSam · · Score: 1

      According to http://www.nydailynews.com/news/story/56873p-53217 c.html, there are no handholds under the shuttle, so astronauts can't spacewalk there. There's also the risk of doing more damage to the tiles, and the inability to repair them.

  136. Re:Casualty count by MacAndrew · · Score: 1

    In the interest of excruciating accuracy, 2 techs were also killed during the shuttle program when they were accidentally caught in a nitrogen atmosphere. They weren't trying to get in space, but they were in service of it. I think the on-ground safety record of the program is said to be fairly good.

    The Challenger was a big shock because we were quite proud never to have lost anyone in flight. The "in flight" qualifier I think had more to do with distinguishing ourselves from the Soviets than any real logic. If we are desperate, and I hope we are not, we will fall back on the claim we have lost no one in space.

    Here's a Q: how many people have died in the unmanned space program?

  137. Armadillo Aerospace by Galvatron · · Score: 5, Interesting
    You want the future of space exploration? See these guys, or any of a number of efforts like it. Their most recent newspost acknowledges the Columbia disaster with an image at the top of the page, and then doesn't even mention it again. How's that for balls? 7 people were just killed in one of the most expensive space vehicles on Earth, and they don't even question whether they ought to press forward.

    As long as our space efforts are funded by the government, they will always be politicized. People on Slashdot always say "we should give NASA more money," or "we should let NASA be more independent," but you just can't alter the fundamentally political way in which they're run. It's one of the bugs in democracy. Actually, it's present in other political systems as well ("In Soviet Russia, politicians assasinate YOU!"), but that's not important, because I don't think anyone here thinks we should give up democracy for the sake of greater efficiency in NASA. But look at the government programs that surround you every day. Look at the bitter controversies over what age sex education ought to be taught in the public schools (if at all, and should the subject of condoms be raised?). Look at the way the post office raises the price of stamps a penny every year, instead of a nickel every 5. So long as the entire county has to live under only one government, governmental programs are always going to be inefficent, as they must satisfy at least 50% of the population, and a few rich interest groups. The essence of democracy is what they say about a good compromise: "everyone's a little bit upset."

    NASA probably was useful in its day. They did get the ball rolling after all. But today, with corporations sending up satellites as part of routine business, expecting a govenrment program to do all of America's space exploration is just not a good idea. We need sustainable space efforts, we need people who have an interest in bringing the cost of getting into space down, and who can take risks without having to think about what it'll mean next November.

    Well, this has been a bit of a rant, but that's alright.

    --
    "The question of whether a computer can think is no more interesting than that of whether a submarine can swim" -EWD
  138. Solutions for NASA? by Quixadhal · · Score: 2, Interesting

    First of all, educate the public. Nobody wants to see people die, and of course it's a terrible tragedy... but you know if I had the chance to go up in space, I'd gladly do it without hesitation. Those people died doing something most of can only dream of, and the odds that they faced were probably not that much worse than when you and I drive to work in the morning. The knew the risks, and accepted them. Is this how we choose to honor their sacrifice? By putting an end to the very ideals they died trying to advance? Did it never occur to anyone that maybe if NASA had a budget that was more than a joke, they might have been able to research more reliable materials?

    That said, it is difficult for me to imagine what goes through the minds of people trying to stop NASA at every mishap. Do they really believe that we'll magically fix all the problems we have here on Earth before the population density grows so high that real-estate in Antarctica starts looking attractive to management? I believe our future lies in space, spreading out from the Earth is the only way to ensure the long-term survival of the species, and Mars is the second step in that goal.

    For those of you with less lofty ideas, might I remind you of the HUGE number of technological advances that came out of the well-funded space program of the 1960's? Anyone here use plastic? How about microwave ovens? Miniaturized computers (aka laptops)? Batteries to run them? All of these are available to us now, because they were developed for use in the space program, and then refined by the military.

    Imagine what kinds of new technology we'd see if Congress would toss the same $2 billion dollars at NASA that they're tossing to AIDS resarch. Isn't our long-term survival and quality-of-life worth just as much as our short-term survival? Probably not. Most politicians can't see beyond the next election, so having things like an actual Goal for the nation is a concept that died with the Soviet Union.

    I think if the public knew (or remembered) all the good that CAN come from a well-funded space program, they'd be screaming at Congress to fund them, knowing that in 5 years they'd get it all back in lower-priced consumer goods.

    1. Re:Solutions for NASA? by digitalhermit · · Score: 1

      I fully support the space program, but not for the reasons you mention. I don't believe that the shuttle will lead to lower priced consumer goods, don't believe it'll anyway help us colonize other planets, don't believe that the shuttle can ever be made safe, don't believe it will ever be cost effective for putting satellites in space or ferrying astronauts to the ISS. The reason, IMHO, for a space program is that it awakens children to the wonders of science -- physics, math, biology. These were scientists aboard the shuttle, and, for the few times in US history, scientists and not sports players or rock and roll singers were/are the heroes. Think of it: our children idolize Eminem, Madonna and Shaq. Why? Because the other non-local, highly-publicized "heroes" don't exist.

  139. Future of manned space flight... by Gooberheadly · · Score: 1

    Manned space flight is exciting, thrilling, high adventure stuff. It makes great photos. It appeals to something in every science fiction fan, every adventure fan, every person who is an explorer at heart. It really is our last untamed and unknown frontier. Watching the incredibly majestic ballet of a space station docking or recalling men walking on the surface of the moon stirs something powerful within us.

    It's also really, really expensive compared to sending up rockets and manipulating robots. Virtually all the experimentation people are interested in could be performed by automated mechanisms and various forms of telepresence. Manned space flight also kills people.

    Unless there is some really compelling reason to have men in space, I think it's inevitable that the US and the world in general will back away from the risks and costs. Maybe no one will explicitly say 'That's it, we're done', but it will probably happen. Unless there's a reason for us to be up there. Unless it pays for itself. Unless it's worth the risk.

    What could we be doing in near-earth orbit that would be so valuable? Not a lot. Sure, make arguments about micro-gravity science, but really, machines can do the work. Nope, the value isn't in near-earth orbit. It's a bit farther out.

    If I recall correctly, a surface to orbit elevator on the moon would be a tiny fraction of the cost of an earth-lift elevator. What could we produce from mining the moon? What could we do with a stable mining colony there?

    I think that if we're going to go to space, lets *GO* and make it pay. Otherwise, humans have no business up there. Too risky, too costly. Add the no-kidding reality of making money and it'll happen.

  140. Ameliorating risks. by Christopher+Thomas · · Score: 2, Insightful

    Most of the risks you list for a tether turn out to not be as serious as you paint them, or to have far less drastic consequences than you seem to be assuming.

    A space tether would be a huge structure. Yes, it would be thin. It would nevertheless be very tall. As a result, it would be easy to hit. A cruise missile, ICBM, or an airplane that struck the tether would break it. An explosive device, including either a conventional explosive or a nuclear device, would break it. If the tether were stationed at sea, a submarine could clip the tether, or shoot a torpedo at it.

    Clipping the bottom of the tether, or firing a missile at it, would do next to nothing. The single-ended tether (with counterweight) is 40,000 km long; the double-ended one is twice that. Low earth orbit - which is the maximum practical range for things like ICBMs, unless they're built specifically to be anti-geostationary missiles - is in the 200-300km regime. Lose the bottom of the tether? Just send down a replacement segment from the hub, and you're back in business.

    There would be no way to defend the tether from terrorists. You would have to create a large no-fly zone and a no-sail zone around the perimeter. This would create a humongous, circular no-commerce zone that would harm the global economy.

    Not really. What is the maximum distance a hostile craft could travel from detection to interception? That's the radius of your no-fly zone. This is tens of kilometres at most if you're dealing with civilian craft. Antimissile interception range is left as an exercise for people with more military background than I have. Either way, impact on trade is next to nil. Commercial flights fly *thousands* of kilometres - why would a 10-km detour have any effect at all?

    Natural events are also dangerous. A lightning strike could break it. An earthquake or volcanic activity could result in enough stress on the tether to break it. A tornado, with winds in excess of 400 mph, could damage the tether.

    Extreme weather only exists in the lowest 10km or so of the atmosphere. 99.97% of your tether is above this level. If you see the storm coming, pull up the bottom 20km or so until it passes. If you get blindsided, send down another small segment as a replacement.

    I'd worry more about space junk, myself. More of the tether could fall.

    If a tether ever became damaged or underperformed its design specs, there would be no way to repair it. Should we ever decide to remove the tether, there would be no way to take it down without it causing a catastrophe on the ground.

    How do you figure this? You can just spool the darn thing back up to the counterweight/hub in geostationary orbit! That's where its center of mass is.

    As for repair - how do you think the cable would be built in the first place? You aren't going to lift a full-thickness cable on chemical rockets - you'll lift a very thin leader cable, and send crawlers up it with extra strands/ribbons to thicken it with.

    To repair a damaged (but still holding) cable, send down a patch, connect above and below the damaged section, and remove the damaged section. Or, if multistranded, remove the damaged strands and send down replacement strands. You've overspecced the cable strength, so the undamaged strands will hold. Any given strand breaking isn't a big deal with a multistranded design.

    Even if you're foolish enough to build a difficult-to-repair elevator, there's nothing to stop you from lifting materials for a new one up ahead of time. Keep a backup elevator - spooled up - in geostationary orbit for use as a replacement if anything happens to one of the elevators currently in service. Only the first elevator will be expensive to build - cost of lifting matter goes down drastically once that one's done.

    In summary, I find your claim that an elevator would be fragile or impossible to repair puzzling.

    Any breakage of the tether would result in catastrophe. First, there would be damage to the ground. Anything that big (about as long as the circumference of the Earth) is not going to totally burn up in the atmosphere.

    Firstly, since it'll wrap around like twine as it orbits (speeding up tangentially as it falls to conserve angular momentum), it could easily burn up - it's impacting over a very large area.

    Secondly, there's a strong upper limit on the amount of damage it can do - that limit being the gravitational potential energy of the cable. Potential energy per unit mass for something most of the way outside the gravity well is on the order of 10 times its equivalent weight in TNT or other high explosive. Declare a maximum acceptable explosive yield for the whole cable coming down, and that gives you the maximum weight of the cable. Simple enough.

    Any real disaster would be far _less_ severe, as a) it's unlikely the whole cable would come down; most logical point of breakage is within easy reach of the surface, and b) even if the whole cable from geosynch onwards came down, it would impact over a large and mostly-uninhabited area (if you've placed your cable with any sense at all). Only the fraction that hits populated areas matters.

    Our economic security and probably our military security and national security would come to depend on this tether.

    The big problem is that once the tether is destroyed, you're probably looking at years before a replacement tether could be erected.


    If the tether's that important to the economy, you'd a) have more than one in service at any given time, and b) have replacements stashed in geosynch, ready to unspool. If space travel is that widespread, then you also have the manufacturing facilities off-planet to produce a new one. Build it, send it to geosynch from wherever else it's built, and spool it down.

    In summary, all of the risks you've pointed out have easy workarounds.

    Lastly, there's a very compelling argument for a tether being much better in the long run than a space plane. An *ideal* space plane would have a specific impulse of perhaps three times that of chemical rockets. Lifting cargo is still expensive with such a beast - on the order of thousands of dollars per kilo even under ideal conditions (and likely much more, given the industry's track record with other launch vehicles). Lifting cargo with a space elevator is orders of magnitude cheaper, if you have high volume. The theoretical limit (cost of the gravitational potential energy paid in electricity) is absurdly low (on the order of $1/kg). The practical limit is determined by how fast you can haul cargo up the cable (no more than, say, an amount equal to the cable's weight can be in transit at any given time, and it has 40,000 km to travel before being unloaded). Haul fast enough, and you can make the cost per unit weight as low as you please. All of your hauled weight is cargo, because your fuel can either be burned on the ground with electricity sent up the cable, or (more likely) produced at the counterweight by solar or nuclear generation, and sent down.

    The long-term rationale for building a tether is clear.

    1. Re:Ameliorating risks. by falsification · · Score: 1
      Antimissile interception range is left as an exercise for people with more military background than I have.

      Antimissile interception is experimental at best today.

      I'd worry more about space junk, myself. More of the tether could fall.

      So what would you do to protect the tether from space junk?

      Secondly, in the event of military conflict, how do you propose to defend the tether from "space junk" that has been purposively deployed by an adversary for the purpose of breaking the tether?

      You say that if a tether is clipped at the bottom, it will continue to hang from space down to the point where it was clipped. On the other hand, quasi_stellar says that if it is clipped near the bottom, the tether assembly will fly off into space. It would appear that the tether community is not in agreement on this crucial issue.

      The argument in your post is unpersuasive.

      One last point. A reason why I'm unconvinced that the tether would burn up in the atmosphere, were it to come down, is the conduction of heat. Most of the tether would be in space. The part of the tether that was falling through the atmosphere would be subjected to great heat, but it seems like much of that heat would be conducted upwards to that part of the tether in frigid vacuum, where the heat would dissipate. The heat, being conducted away from the tether in the atmosphere, would not burn that part of the tether. Is that not true?

    2. Re:Ameliorating risks. by Christopher+Thomas · · Score: 1

      I'd worry more about space junk, myself. More of the tether could fall.

      So what would you do to protect the tether from space junk?

      Make it multi-stranded, per my previous post. A paint fleck will take out at most one strand. As your strands will be separated by at least tens of centimetres (and maybe tens of metres), it would take a very, very large object to sever more than one strand. Such objects are very rare and very easy to detect.

      Secondly, in the event of military conflict, how do you propose to defend the tether from "space junk" that has been purposively deployed by an adversary for the purpose of breaking the tether?

      If there's enough to be a problem, you'll see it coming. Haul up a large block of styrofoam, spool up the cable, and wait for all of the debris to impact on the styrofoam. Either capture the shield and dispose of it as you will, or just de-orbit it.

      You say that if a tether is clipped at the bottom, it will continue to hang from space down to the point where it was clipped. On the other hand, quasi_stellar says [slashdot.org] that if it is clipped near the bottom, the tether assembly will fly off into space. It would appear that the tether community is not in agreement on this crucial issue.

      Spend more than half a second thinking about it, and you'll see that losing part of the tether moves the center of mass of the structure up by some small amount. This puts it in a slightly elliptical orbit with a perigee (lowest point) at the original position of the tether.

      If you're using a counterweight with a single-ended tether, no possible cut will cause any of it to fly off into space (lose the whole thing, and the counterweight will occupy an elliptical orbit). If you're using a double-ended tether and cut it close to the middle, you'll get one piece with escape velocity, but clipping any part close to Earth won't even come close to doing this.

      The argument in your post is unpersuasive.

      Persuaded now?

      One last point. A reason why I'm unconvinced that the tether would burn up in the atmosphere, were it to come down, is the conduction of heat. Most of the tether would be in space. The part of the tether that was falling through the atmosphere would be subjected to great heat, but it seems like much of that heat would be conducted upwards to that part of the tether in frigid vacuum, where the heat would dissipate.

      This is only true if the tether is a) a superconductor of heat and b) conducts it instantly. Neither is true for any tether likely to be built.

      Any non-ideal conductor won't have enough heat transport (look up "Newton's Laws of Heating and Cooling", and remember that the tether is very thin and thousands of kilometres long).

      If the tether is built out of magical materials and doesn't burn up, you still don't have a big problem, due to the total impact energy arguments in my previous post.

  141. Solve the budget problems with better marketing. by gnobulator · · Score: 1

    Remember the incredible sales of the Hotwheels Mars Rover? This was licensed through NASA. If they just did better marketing of toy versions of their non-exploding spacecrafts they could start bringing in more dough. Sure it wouldn't double their budget, but look what toys have done for Hollywood. And it would give all us geeks the ability to directly contiubute to their budget, and have more toys.

  142. The shuttle worked, stick with it by Cranx · · Score: 1

    The shuttle worked, and worked very well...so I see no reason why NASA shouldn't simply either improve the existing design or design a "better shuttle" and continue, business as usual. A grand total of two shuttle crashes doesn't undo the world's greatest space program.

  143. oooh... by Kalewa · · Score: 1
    "Civil Reserve Space Fleet"

    That phrase just gives me shivers for some reason (the good kind).

  144. independent space exploration by halfpuppy · · Score: 1

    I really do believe that the future of space exploration lies in the hands of companies like Armadillo Aerospace. The US government is to clumsy and inflated to handle something like space exploration.

    Can one of you Uber-geeks explain why craft like the shuttle need to take off vertically? Couldn't we take a really powerful jet, take it up to a rediculously high altitude, and then switch to rocket power for the last leg of the trip? The shuttle just doesn't seem like the most convenient/economical solution.

  145. Make it cheap, and they will come by cosmosis · · Score: 5, Insightful

    The answer has been staring us in the face for decades - Price. If we make space access cheap, the rest will follow. What we have done up to this point, is basic feasability testing. Enough already! We know its feasible. There are thousands upon thousands of amzing engineering papers that have been published that will revolutionize space travel and habitation. The one thing, the ONLY thing keeping it from happening, is the cost per pound to orbit.

    And the sad part is, there are hundreds of designs that could and would reduce the cost to orbit from its exorbitant $10,000/lb to less than $100/lb. But you know what? All of the aerospace contractors have lobbied for years for these advances to be underfunded, never considered, or just plain cancelled.

    I agree with the Cliff, I'm pinning all of my space dreams and hopes on the advent of mass-produced carbon nanotubes. Once they become available, the entire economics of space will change radically. Finally, it will make economic sense for even the most conservative corporations to invest in space industrialization.

    Planet P Blog - Liberty with Technology.

    1. Re:Make it cheap, and they will come by Anonymous Coward · · Score: 1, Interesting

      The problem is, that mass space travel isn't feasible yet. Of 113 Space Shuttle flights two ended in complete disaster, this is a horrible track record.

      If planes would have similar rate of failure tens or hunders of airplanes would be destroyed daily, who would use them then?

      Back to the original question: Space Shuttle has a very little to do with a space exploration. Best solution is to send light and cheap probes t o the other planets.

    2. Re:Make it cheap, and they will come by silentbozo · · Score: 5, Interesting

      I'm hanging my hopes on Armadillo Aerospace. Looking forward to them trying out for the X-Prize, and their approach of documenting everything on their website via pictures, video, and blog-type updates is great. I hope they succed - we need a commercial manufacturer of rockets that doesn't need to charge a premium to support overhead of non-space units.

      Think cheap dumb boosters - the kind of vehicle the shuttle should have been before it was hijacked into being a commuter service. Keep in mind, we don't need to throw away the STS infrastructure (crusty as it may be.) Just replace the orbiter with a larger unmanned payload module, keep the external fuel tank and boosters. Then, build dozens of payload modules, external fuel tanks (screw the insulation - which is needed to keep ice from forming on the fuel tank, make the payload module disposable), and boosters, in order to get economies of scale. Since there's nobody on board, we don't have to worry about having 99.999999% reliability, nor do we have to waste money on life support.

      Just so you know, this payload version of the shuttle already exists on paper, as one of the alternate configurations of the shuttle combo - known as the Shuttle C.

      If you're curious about other never-built shuttle designs, visit http://www.abo.fi/~mlindroo/SpaceLVs/Slides/sld022 .htm.

      Or, we can buy Russian rockets wholesale, if we don't want to invest in our domestic rocket industry. Just don't put pilots in cargo vehicles - there's no point! If you want to send up pilots, put them in spacecraft specifically designed to deliver people... survivable spacecraft.

    3. Re:Make it cheap, and they will come by Oriumpor · · Score: 1

      Michael Flynn's dream will probably never come true, and we all will probably be crushed by an asteroid/comet or something else we don't have the infrastructure to defend against.

      The *star series (firestar saga)
      is all about cheapening space flight by deregulation and comercialization of space flight. Although I don't agree entirely with the concept it is one option of the many many we could do.

      I believe there was also talk of a space cannon a while back, (obviously for payloads and not individuals.) Such a thing could be powered by natural gasses, or refined gasses. It would be interesting to see at the very least a new generation actually setting their sights on the stars, instead of saying "The moon, what good is the moon?"

    4. Re:Make it cheap, and they will come by TheRaven64 · · Score: 1, Interesting

      I'm pinning all of my space dreams and hopes on the advent of mass-produced carbon nanotubes.

      I don't like to break this to you, but nanotubules simply do not have the tensile strength to support a space elevator (the studies carried out on this were in New Scientist about 3 years ago, I don't recall the exact date). The only substance strong enough to build a space elevator with is neutronium, and this has two disadvantages:

      1. We have no idea how to manufacture it
      2. The gravity of a space elevator that massive would cause problems

      Personally, my space elevator hopes lie with a less matter-based approach. I can see two possibilities that may be feasible. The first is a pure energy elevator, where vehicles equipt with an ion drive based propulsion system ride up a microwave beam generated by an orbiting powerstation, thus reducing the need to rely on the low energy yield of chemical fuels. The second is a hybrid, where magnetic fields are used to bind specially shaped molecules together more tightly, as a sort of 'structural integrity field'. The problem with this approach, is that a power failure would be very expensive, since the entire structure would collapse.

      --
      I am TheRaven on Soylent News
    5. Re:Make it cheap, and they will come by Pescatore · · Score: 1

      My moneys on the Rocketman and Starchaser Industries.
      http://www.starchaser.co.uk (great site btw.)
      They've already launched several rockets proving their concept and have their first manned flight planned in Oct 2004.

      There's an excellent documentary on Discovery Channel in which it is stated that the worst thing that happened to space development was the space race. Since money wasn't the issue things were bound to get expensive and once the goal had been achieved public interrest rapidly declined, making it even more difficult to justify the pricetag. The Shuttle was a great idea and a marvel of engineering, but an economic disaster.

      What is needed to make space available to the public is a bunch of ambitious people on a tight budget.
      That's pretty much what the X-Prize is for I believe.

    6. Re:Make it cheap, and they will come by TooTallFourThinking · · Score: 1

      I don't like to break this to you, but nanotubules simply do not have the tensile strength to support a space elevator (the studies carried out on this were in New Scientist about 3 years ago, I don't recall the exact date). The only substance strong enough to build a space elevator with is neutronium,

      What are you talking about? According to this article, the tensile strength needed for a space elevator is 62GPa. Which is fucking insane for anyone who understands stress and strain of materials. And according to this site, carbon nanotubes have a tensile strength of 150 to 200GPa. Which is even insaner (if I can use that word!)

      Now, the process for producing nanotubes is expansive, and the nanotubes that are produced are very small. To make miles of nanotube cable (to the knowledge) is not possible, but they are working on it. Well, not miles of nanotubes, but longer strands.

      Carbon nanotubes can definitely support the weight, as well as the temperatures needed to support a space elevator.

    7. Re:Make it cheap, and they will come by vryhpyammoadded · · Score: 1

      Whatever happened to the Aerospike, or was it plug nozzle? I can remember reading some book years back on SSTO spacecraft based on this engine design. It was a pretty cool idea to use the rocket engine (think inside out bell nozzle) as the heat shield for reentry but nothing seems to have ever become of it. Does anyone know if the concept fizzled due to problems like weight or materials? Did it even work?

      --
      27b-6
    8. Re:Make it cheap, and they will come by bleckywelcky · · Score: 1


      I think you may be misunderstanding the importance of the insulation. Yes, it is used to insulate the ET so that ice will not form on it, but your solution to 'screwing the insulation' via "make the payload module disposable" is completely inane. We do not want ice forming on the ET because the weight restrictions are quite exact already, and the boosters do not have the ability to lift up the extra weight of the ice (or rather, to the point that we want them to). If we did not insulate the ET, the extra weight of the ice would throw off trajectory calculations, burn points and times, and the overall flight path projections. Simply making the payload disposable will help one thing: it won't matter that much everytime the payload and shuttle crash back into the Earth because the weight calculations were skewed, but I don't think many people would be that happy otherwise.

      And the insulation performs another key function in the lift off process. You know what the ET is filled up with? Liquid O2 and liquid H2. You know what the boiling point of liquid O2 and liquid H2 is? A helluva lot lower than the ambient temps in Florida. So, one thing we do to avoid having all of our propellant evaporate while we wait to launch our vehicle is we fill up the ET only right before lift off. We can't have the ET filled up and then sitting in Florida for a couple hours, because half our propellant is gonna be gone by time we get around to the actual launch. The other way we keep the propellant from evaporating is by insulating the ET.

      The combination of ice formation and propellant evaporation by simply excluding the insulation because the payload is 'disposable' would ensure that these disposable payloads would never make it into space.

    9. Re:Make it cheap, and they will come by jdray · · Score: 1

      Simplify things by using non-cryogenic propellants like High Test Peroxide (HTP) and Kerosene. Reduced ISP (a measure of thrust) is partially compentsated for by reduced equipment requirements, and the rockets are cheaper to build, or so the theory goes.

      --
      The Spoon
      Updated 6/28/2011
    10. Re:Make it cheap, and they will come by Jack+Dixon · · Score: 1

      The Space Elevator is a great thing for someday. We don't have to wait for it. The problem with the space shuttle is that it is like using a Ferrari to deliver lumber over dangerous mountain roads. It is so expensive and hazardous to operate that its costs eventually eat into its maintenance.
      20 years ago there were those of us in the aerospace industry that advocated much less expensive solutions. But NASA has always been enamoured with iffy cutting edge technology. While they reluctantly went thru the Space Launch Initiative program, which invited innovative entrepeneurs to come up with launch ideas and thereby employing a few of the engineers who were excluded from NASA, Boeing, etc, thru affirmative action, they dissed their work and went back to Boeing, Martin, etc, "big iron" companies with more political pull. A quick look at what the entrepeneur solutions shows how a low tech, very safe approach would reduce costs by much more than a factor of 10. I don't suppose we will hear much about that in the PMA atmosphere.

  146. inventing new technologies by magarity · · Score: 1

    There are a lot of comments in this thread regarding the feasability and riskiness of new replacement technologies. This is really sad. There was a time in this country (USA) when we didn't fret about whether some new technology was possible or completely safe. We just went and invented it. This attitude made us the economic and scientific powerhouse we are today. Now that we've become rich and soft, all we do is whine and try to minimize risks. I weep for the USA's future.

  147. Where should space exploration go? by Mika_Lindman · · Score: 1

    Where no man has gone before?

  148. teflon by commodoresloat · · Score: 1
    I remembered reading that Teflon was discovered because of the space program. But I remembered wrong. Turns out, it's the other way around! According to DuPont's website (they would never lie): "Teflon® has been involved in the U.S. space program since the program's infancy. When astronaut Neil Armstrong took his historic 'giant leap for mankind' in 1969, the moon module included numerous applications involving Teflon® resin, including space suits and blankets, heat shields, insulation and cargo hold liners."

    Ah well, Tang is cooler than Teflon anyway.

  149. Go NASA-Glenn! [nt] by Chris+Pimlott · · Score: 1

    Go NASA-Glenn! [nt]

  150. China by bushboy · · Score: 1

    The USA is not the only country with a Space Agency, yet from the tone of the questioning, once again USAcentric /. forgets about the rest of the world !

    quote:
    <i>"About what's next for human space exploration. Most of the punditry agrees that extending the shuttle program for many more years is a bad idea. So what are the practical alternatives?"</i>

    I love that "so what's next for human Space exploration" heh - so basically, what your saying, is that you've totally forgot something :-

    The Chinese are agressively persuing Space Exploration and it's entirely possible they'll have a man on the moon within a decade.

    Wakey Wakey.

    --
    A slashdotting - you get the stick first and then the carrot !
    1. Re:China by cruachan · · Score: 1

      In the medium term this is why the USA will not abandon the space program, and possibly part of the reason why Bush has increased NASA's budget this year.

      The Chinese have show themselves to be willing to create their own technology, albeit behind that of the west. Nuclear technology, chips and space travel are obvious examples. Historically the chinese have always thought in the long-term - decades or even centuries. They may be (much) poorer than the USA, but they have vast resources, both human and natural, and the benefits of long term planning in an area where it is of importance. There's also the matter of prestige - not with the west, but in the eyes of the third world.

      The USA has effectively downgraded space exploration since the end of the 1970's. If this continues then in another 20 years the Chinese will have caught up and possibly passed the them.

  151. Sleazy answer by leonbrooks · · Score: 3, Informative
    ...and here is a straightforward but far from easy way to go up. With dollar figures and production schedules.

    Perhaps they should have priced it in terms of Shuttle missions. The shuttle has launched over 100 times, at a typical cost of about $500M per launch equals roughly $50G, so their elevator would be priced at 80 shuttle missions or under 4/5 of the money spent so far running the Shuttles.

    Speaking of which: in terms of fatalities per passenger mile, they're much safer than jetliners, orders of magnitude better than your car. OTOH, you car doesn't cost billions of dollars to replace if you write it off. OT3H, I'd be really happy if I got that many miles out of any car, ever. (-:

    --
    Got time? Spend some of it coding or testing
    1. Re:Sleazy answer by yog · · Score: 1

      I'm starting to think that these space elevators are the way to go. A time may come when we, or our descendants, will look back at rockets as a crude and barbaric means of transportation. It's like crossing a canyon by catapult rather than building a bridge.

      I especially liked the last page of the howstuffworks.com article, the obligatory "Shop or Compare Prices". This gives you the chance to "Search for Space Elevators on eBay". What am I bid for this one of a kind priceless 31 mile long nanocarbon tube??

      --
      it's = "it is"; its = possessive. E.g., it's flapping its wings.
    2. Re:Sleazy answer by sbaker · · Score: 1

      Quoting shuttle reliability in terms of fatalities per mile is just silly.

      What's the reliability in terms of passenger HOURS? That's what matters to
      most people.

      If those 100 missions lasted a week each - then that's one fatality per
      8400 passenger hours.

      A Jumbo jet racks up 8400 passenger-hours on every return trip to Europe.

      Most cars go their entire 150,000 mile lives without a fatality. If they
      drive an average 30mph, that was 5,000 hours without a fatality.

      If you car was a shuttle and you drove it two hours a day every day, you'd
      expect to die within 10 years...that's not good odds!

      Get real - the shuttle is an EXTREMELY unreliable and dangerous transportation
      system by any useful measure. On the evidence we have so far, climbing into
      a shuttle and launching gives you a one in 50 chance of dying.

      HOWEVER: Astronauts are very willing to take that risk. They aren't
      stupid people - they know the odds. The don't fly the shuttle every
      day - or even every year. Most of them only get to fly two or three
      missions in their lifetimes - and they find the odds acceptable because
      the returns are so great. If you asked for volunteers to fly one of
      the remaining shuttle tomorrow without any further investigation of
      the causes of the accident, they'd be standing in line to do it.

      IMHO, people should be less sensitive to shuttle accidents. It was a
      terrible tragedy seeing those people die so publically over Texas - but
      more people die in road accidents every day - more people are shot to
      death in US cities every day. Those astronauts were well aware of the
      risk - and took it. Their families were prepared for the possibility
      of their deaths - and they have an amazing support network. If your
      nearest and dearest is gunned down in the street or mangled in a car
      wreck, it'll come as a much bigger shock and you won't get as much help
      to recover from it.

      --
      www.sjbaker.org
    3. Re:Sleazy answer by Shadowrose · · Score: 1

      I've read something about this, the elevator would likely have a constant air squadron flying about it, not sure about the space junk, though. Live Action Asteroids, eh?
      --Dante

  152. Russian deaths by lommer · · Score: 1

    We all know of the american astronaut deaths:
    3 - Apollo 1 fire
    7 - Challenger
    7 - Columbia

    What about Russian deaths? I've heard it mentioned that they lost 3 cosmonauts on the return from orbit in the '70s, but haven't seen any evidence to back it up. How many russians died in the quest for space? (IMHO, they were more succesful than the americans in terms of leaping the first hurdles)

    Also, another poster mentioned scientists who died in the service of the space program. I'd like to know and remember every man who gave his life for what I believe to be humanity's final frontier.

    1. Re:Russian deaths by meringuoid · · Score: 1
      What about Russian deaths? I've heard it mentioned that they lost 3 cosmonauts on the return from orbit in the '70s, but haven't seen any evidence to back it up. How many russians died in the quest for space? (IMHO, they were more succesful than the americans in terms of leaping the first hurdles)

      To my knowledge, the Russians have lost four in space; I don't know how many on the ground. They lost Col. Vladimir Mikhailovich Komarov on Soyuz 1 on April 24 1967, and they lost Lt. Col. Georgi Timofiyevich Dobrovolsky, Vladislav Nikolayevich Volkov and Viktor Ivaonvich Patsayev on Soyuz 11 on June 29 1971.

      Soyuz 1 suffered multiple hardware failures and ended up reentering the atmosphere at the wrong angle. Komarov knew he was doomed and spoke with his wife on the radio before he burned up; the conversation was intercepted by US radio bases in Turkey.

      Soyuz 11 suffered decompression, again on reentry. The explosives that separated the flight cabin from the orbital module for reentry shook open an exhaust valve in the cabin; the automatic thrusters kicked in to correct for the change in orientation produced by the jet of air, and the resulting gyrations disoriented the crew sufficiently to prevent them stopping the valve. They would have been dead within a minute. The rest of the reentry continued as normal under automatic control, and the cosmonauts were found dead in the intact capsule.

      --
      Real Daleks don't climb stairs - they level the building.
    2. Re:Russian deaths by aiabx · · Score: 1

      I understand that some 160 or so Russians died after a launch accident where a rocket failed to launch and then exploded when it was swarming with engineers trying to get it running. Anyone else heard this?
      -aiabx

      --
      Just this guy, you know?
    3. Re:Russian deaths by meringuoid · · Score: 1

      Yes, the Nedelin disasterin 1960. Nobody in the West knew until the fall of Communism; chances are even the CIA were in the dark, because I'm sure if America knew of such a disaster they would have published it to the world with great glee. And I admit to my deep shame that I had forgotten entirely about the whole event.

      --
      Real Daleks don't climb stairs - they level the building.
  153. You don't quite get it by alizard · · Score: 2, Insightful
    The point your quote misses out on, however, is that there is is no "reliable" way of getting into space. It's dangerous like playing russian roulette, you go up there with several thousand pounds of explosives attached to your ass, and you come back down in the middle of a plasma fireball. Between those two events you're seperated from an intense vacuum by nothing more than a few inches of steel and some ceramic tiles.

    Your arguments are even less convincing. I'm sure you could come up with equally dramatic descriptions of the environment in which early airplanes operated, and they killed people, too. Airliners are a bit safer than they were in 1910. The early sailing craft were dangerous.

    The technology has improved quite a bit since the 1970s. Perhaps we do know enough now to build a shuttle craft with safety comparable to that of an airliner.

    We've been putting people into space since the 1960s. Surely something has been learned since then about getting to orbit and back safely.

    Every man and woman who's died in space did it with the full knowledge this was one of the most dangerous jobs they could have picked. I see no reason to insult their sacrifice by scurrying under rocks, pretending like it's only a matter of time before a 100% safe route into space evolves.

    Don't insult the ability of our engineers and scientists, either. 100% safety is impossible. You can get killed on a trip to the mailbox. Humans have paid for the right to explore every new domain we have taken with their lives, and there are a few of those people buried or lying around within a few miles (kilometers) of every reader of this post. However, as a result of those sacrifices, most of us can walk safely to the mailbox without a gun and without watching our backs.

    When do we get out of the human sacrifice stage with respect to the kind of trip that should have become routine with the second generation shuttle and something you buy tickets from your travel agent for the third generation available Real Soon Now? We've been putting people into orbit for 40 years. I think it's time to find out whether or not we can do it right now.

    It's time to honor our pioneers and move on to the future. It's time to get out of the status quo. You know as well as I do that if we keep flying a shuttle that's been kept running longer than the average city runs a public transit bus that more and more of these vehicles are going to fall out of the sky. Will the public support NASA if one of these deathtraps hits a public building full of people?

    It's time to either start putting real money into the manned space program or shut it down. It's wrong to ask people to give their lives to solve problems that should be solved with money and engineering skill no matter how dedicated or brave they are. If America doesn't have the will to do this right, we don't deserve to keep our technological leadership and we won't be allowed to.

    Your argument in favor of the status quo is pointless at best.

  154. We should look before we leap by io333 · · Score: 1

    I guess it's time to dredge up my old post

    I'll just reprint it here too:



    The greatest question of all time is: "Are we alone?"

    That's really the other ultimate goal of space exploration, isn't it? (The first goal is to find us a new place to live after the earth is used up).

    But there is such a simple way to answer the question: Take all the cash we are using on rediculous stuff like the ISS and:

    BUILD A GIANT TELESCOPE IN SPACE OR ON THE DARK SIDE OF THE MOON.

    And I mean BIG.

    One so Hugeomegagigantic that it can actually SEE the surface of extra solar earth sized planets in detail to pick out cities, roads, and lights.

    And then, if we saw with our own eyes that there was another civilization -- imagine the space program we'd start to have then. ...and yes I know the dark side of the moon isn't always dark, but we'd want to cut down on earthshine too probably.

    1. Re:We should look before we leap by glenebob · · Score: 1

      I'm not sure at all that it would be physically possible to build a tele that big with current technology... and if it was, where would the money come from? You'd have better luck getting funding for a new space shuttle that runs on cow farts and bread bag twisters.

    2. Re:We should look before we leap by io333 · · Score: 1

      We could just put thousands upon thousands of smaller ones all synced with fiber optics and lasers all over the back of the moon.

  155. Obvious answer #2: Up! by Ratface · · Score: 1

    (OK - I know there's no up or down in space. Bah humbug!)

    --

    A little planning goes a long way...
  156. Why shoot for the moon? Nanotube launch platform by MickLinux · · Score: 1

    Quick thought here -- if we can build a space elevator with mass-produced nanotubes, then we can essentially build a tall platform, as high as we like.

    That being the case, why shoot for the moon? Instead, build a nanotube launch platform that is designed to grow. Start it out in a geologically stable location at the equator, and start getting fuel savings immediately. Eventually, it will *be* a space elevator, but meanwhile, it becomes commercially feasible.

    This, then, would not be a "top down" design such as caused the shuttle accidents. It would rather be a "current technology" and slow-growth design that would allow us to understand our technologies and thus avoid disasters.

    --
    Correct Horse Battery Staple: 72 bits of entropy. Enter "Correct H" into google. When it generates the phrase, that's
  157. Flame away... by Ryu2 · · Score: 2, Insightful

    i hate to be a cynical bastard, but i can't get past the fact that the columbia tragedy is little more than a glorified car accident. i don't want to belittle these deaths--because death is an awful thing--but people die everyday by much more inhumane and unnecessary means. the columbia explosion is sad, yes, but these astronauts are no more saints than the hungry children dying of malnutrition in africa everyday. and we sure as shit don't memorialize them, the thousands that die because instead of buying them bread and milk we use our billions to research why our flying tower of babel got too hot and caught fire on reentry. instead of creatively finding ways to get AZT and other retrovirus drugs across the atlantic, we perfect an unmanned plane capable of launching smart missiles from a few hundred feet at whoever it is we feel like assassinating.

    maybe--just maybe--we rally around national tragedies± because we need to create a pain to counter balance the numbness of our mundane life necessary to keep from hating ourselves. or maybe we really are the navel-gazing, imperialistic gluttons that the world thinks we are, incapable of imaging a world beyond Must See TV and the Cosmo sex quiz, too callused to even give a damn. how did we get here? where are we going? where have we been?

    boy, this generation needs a hero.

    --
    There's 10 types of people in this world, those who understand binary and those who don't.
    1. Re:Flame away... by lineymo · · Score: 1

      We got here because we have turned into ourselves. We got here because we no longer believe there is anything more important than our own individual wants and desires.

      We are here because we have turned our back on God and placed ourself on the pedestal.

      We are where we are because we believe the rights of an individual trump any and all other things. We are where we are because we believe that science is the be all, end all answer for why and no longer the answer for how. It used to be that science was used to explain how God did this, or that; but we are so into the drug-induced trip of marvelling at our fingers that we have completely ignored the marvel of the one who created them.

      We got here because we don't believe anymore that humans are unique from all of creation and have dignity which comes from that uniqueness. When people argue that pets and cute , furry baby seals have equal (and some argue more ) rights as humans, and those same people have no compunction to destroy humans, we get to the state where contradictory states of mind are acceptable. People have fire in their eyes when they state "Well, that's fine for you; but I don't think that way..." or "There is no absolute truth..."; but boy oh boy, watch out when you take that to it's logical conclusion.

      A hero would be nice, but every husband and father being a man of God would be even better.

  158. Re:Casualty count by DunbarTheInept · · Score: 1

    Here's a Q: how many people have died in the unmanned space program?

    The same number that died in the manned space program, since they are the same program. A vehicle that carries stuff into space is the same technology whether the "stuff" is humans or cargo or a mix of both. When technology learned to make Apollo 1 is also used today to launch an unmanned satellite, those three astronauts in Apollo 1 were, in effect, dygin for both the unmanned and manned space programs (since they are one in the same.)
    --

    Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

  159. You Decide the Future of the Space Program by JDelphiki · · Score: 1

    The events of this past week were certainly a tragedy, however make no mistake that the space program as well as the current shuttle program will continue, at least for the short term. It is unfortunate that it takes an event like the one we saw on Saturday to initiate a public dicussion on the direction of the space program. Dispite the naysayers most people involved in the space program would relish such a publish debate. Most of the members of the NASA family share a sense of civic duty, and believe that our primary goal is to serve the American public. NASA, like any other human endevour has it's flaws, but we are always looking for ways to improve. So what changes if any should be made to improve the space program? Some say we should develop a new launch vehical to replace the shuttle fleet. NASA has been trying to develop additional human and cargo launch capability, however each proposal has been canceled right before the development of an operational prototype. The reasons for this are complex, but they include a general engineering tendancy to choose proven sub-optimal technology over unproven technology, and the fact that the prototype phase is the most risky part of space craft development. Development of an operational prototype involves investment of a significant amount of money at a higher risk of failure. In addition, there really is no large public or political will to replace the current shuttle system. Therefore it becomes very hard for NASA Administrators to justify such programs. Some have suggested getting rid of the human element in spaceflight. In my opinion this would also be a serious mistake. Once we eliminate human flights, we lose precious knowledge and experiance that would allow us to eventually establish profitable space industries, outposts, and colonies. While, these ideas certainly sound like science fiction, NASA still considers such human endevours as the long term goals of the space program. As for the commercialization of space flight, I know of no conspiracy to retain a NASA monopoly. In fact many NASA employies would welcome such development of the comercial space industry. While NASA employies do hold the belief that no one can do spaceflight safer or more reliably then NASA, this is merely a reflection of the pride they have in their work, and not (as is often said) a commentary on the disadvantages of space commercialization. The real reason for the lack of commercial investment in space comes from the inherent high risk of working in space. Space flight is a exceptionally high cost, high risk, and low tolerance endevour: not the kind of thing you want to base profittable a bussiness around. Every day NASA and other space agencies are developing new technology to make space flight cheaper, safer, and more error free, so that it will become easier to comercialize space. Experiance shows us that knowledge gained in space today, will translate into commercialization tommorow. To see a practical example of this we need only look at the colonization of the America's. The first few steps were taken by government funded expiditions. It wasn't until more 100 years after Columbus landed, that the comercialization of the new world by private industry took place. Why did this occur? Originally, getting to the Americas was a costly and risky bussiness. Commercialization wasn't possible, and indeed did not take place, until the Europeans had gained enoough experiance and knowledge about the new world to make it commercially feasible to go there. Similarly, once we have gained significant knowledge and experiance about space, commercialization will occur. So what direction should NASA take? That really should be up to you, the people NASA is chartered to serve. Do you want to see efforts dedicated to a perminately manned space station? Do you want a mission to mars? Increased manned or cargo launch capability? Development of next generation propulsion technology? None of these things will happen without signifigant political and public will. Most importantly, be excited about the space program. Find out all of the great stuff NASA does for you. You'd be supprised to learn that NASA plays a role in everything from yout daily weather report, to the produce you buy at your local market, to the velcro you use to fasten your shoes. Right yout congressman, your senator, your president. Tell them what you think NASA should be doing. Don't wait for an event like this recent tragedy to focus on the space program.

  160. Moonbase by The+Leather+Duke · · Score: 2, Insightful

    To get space profitable fast: Build a moonbase.

    The cost of space is getting out of our gravity well, as most here point out. So let's build a moonbase instead.
    Once there and operational, the rest of the solar system is open. The cost of getting from Earth to the Moon is actually higher than getting from the Moon to say Mars, or the asteroid belt.

    Then refine the minerals on the moon and drop them down the gravity well for use on the earth.

    In the long run it will probably be less expensive to produce minerals down here on earth. So why go into space at all? Mainly for the technological returns. An active space program generates technology for humans everywhere. And we are suckers for tech. Not only geeks and hackers, but the entire global economy are fueled by thechnology. If we don't want do go Amish we go to space. And we will. Eventually.

    There's no question that the moon will get a base on her face sometime in the future. What language they will use in the command centre is uncertain though. It might be chinese, or hindu.

  161. Manned Space Exp.NOT necessary by marebri · · Score: 2, Interesting

    The question occures whether there is anything we can do in space in the foreseeable future that cannot be done using robotic instruments. This is probably much cheaper, financially, and certaily cheaper w/regard to costs on human life. Then there is the fact that for a long long long time, perhaps the only other interesting place humans can be able to visit (other than our now boring orbit) is Mars, where they have already sent a robotic instrument. What, the question arises, in Mars (for the foreseeable future) can we do that the Pathfinder cannot? Its likely to be much cheaper and easier in a hundred years. Perhaps its time we shelved Manned Space flight for a while?

    1. Re:Manned Space Exp.NOT necessary by sql*kitten · · Score: 1

      The question occures whether there is anything we can do in space in the foreseeable future that cannot be done using robotic instruments.

      You are assuming that the sole purpose of space is to act as a giant laboratory. The focus on space has to be industry and habitation - in other words, before space can become "mainstream" it's got to be able to pay for itself. That means mining, manufacturing and tourism. Once there's a commercial infrastructure in place, you can do some real science, move your whole lab and all its people to orbit or to Mars, for example. Remember Mars has a land area equal to Earth's (no seas) so if you want to do "big science" like a 1000-km diameter collider, you can.

    2. Re:Manned Space Exp.NOT necessary by marebri · · Score: 1

      Ok. Mining, manufacturing, tourism etc. and so , presumably, habitation. Ok. That sounds good. But for now and say the next 50 to 100 years, how will manned space flight further this aim? The path to this (aim) is furthering our understanding of outer space and the various planets and moons out there that we might inhabit. Already, it seems to me that astronmers and other physcists have learned a great deal (say about Mars) using telescopes and the like. Missions like the pathfinder could explore further and bring back samples. Ok. Even at this time, humans could go out there and take the same photographs as well as the samples. But it would be a long drawn, expensive and (with our present technology) very dangerous mission. I do not think that the astronauts who would get there would do anything more that scratch a tiny part of the surface. (Logistics and current technology again) Why not do the same thing 100% more safely using robotic instruments? I do support the larger aim of manned space exploration. But I do not think we shall be ready for anything significant in a long long time! In addition, remember that there is really nowhere to go, for perhaps another millenium, other than our solar system, and very limited parts of it at that! Other than the moon and Mars, other environments are tremendously harsh!!! Just a thought.

    3. Re:Manned Space Exp.NOT necessary by Yunzil · · Score: 1

      Perhaps its time we shelved Manned Space flight for a while?

      No. Manned exploration is only not necessary if you have no imagination.

      I want to eventually be able to take weekend excursions to the moon. I was born in '71, so I missed Apollo; and I want to see humans walk on another planet. I want to hear about cargo ships on the way back from mining the asteroids. None of that will be possible until we figure out a better way to get people safely out there and back.

      So the only answer is to keep trying until we get it right.

    4. Re:Manned Space Exp.NOT necessary by sql*kitten · · Score: 1

      I do support the larger aim of manned space exploration. But I do not think we shall be ready for anything significant in a long long time!

      But what if Columbus had waited for Spain to develop steel hulls before setting off across the Atlantic?

  162. teflon discovered by perfessor+multigeek · · Score: 2, Informative

    Wasn't teflon developed to protect tubes used to process uranium?
    Why, I'm so glad you asked. Teflon was first created by mistake by a researcher studying flourocarbon variants. The goal was fluids for refrigeration systems, not teflon. After a series of tests he found a strange waxy mass in the chamber. That was teflon.
    It is worth noting that this is a perfect example of the sort of free-form experimentation allowed to proceed in an unplanned direction that NASA has proven so very bad at pursuing.

    Rustin

    --
    Data is the lever, rigor the fulcrum, brains the force that drives it all.
  163. NASA, Complexity, and Astro-Parachuting by Merovign · · Score: 1

    1) NASA is the DMV of space travel. Go visit the DMV. You'll see what I mean.

    We don't need a huge bureaucracy that makes more money from its failures than from its successes. We don't need a huge bureaucracy.

    2) Complexity isn't why we need thousands of cross-checking engineers, thousands of cross-checking engineers is why we need complexity.

    We don't need hundreds of tons of crap to get into orbit. We do need hundreds of tons of crap to make the job so big that only NASA can do it. I honestly believe that if NASA disappeared overnight (let's get those other astronauts down first, however), someone would be making money doing it faster, better, and cheaper within two years. A lot of people want to do it now, but when it's a government game, there's only one game in town.

    And you have to know what the game is if you want to win. And we should want to win, since the prize is survival.

    3) As to the "falling from orbit in an ablading pod" idea, that is way cool.

    I'm on for that one, when do we leave?

  164. Sometimes history interupts itself... by mattkime · · Score: 1, Interesting

    as terrible as the event is, i can't help but be thankful that we have something to talk about besides war for a little while.

    hrm....if we can just solve the loss of life problem, maybe we can distract Bush from the idea of war until he forgets about it.

    --
    Know what I like about atheists? I've yet to meet one that believes God is on their side.
  165. Re:A hundred years from now... by more+fool+you · · Score: 1

    i'd be much more interested in the laser if the aliens are anything like the movie

  166. Barbaric. by Skadet · · Score: 1

    A few years back, I was getting chemo and radiation treatment for cancer. I remember seeing some of the really bad cases (you know, radiation burns on their faces, lost teeth from the radiation, et al) and thinking, "Medicine is so barbaric."

    I imagine we'll be saying the same thing about space exploration in 10-20 years. While our technology today is immeasurably more advanced than it was a century ago, I think it will look nothing short of barbaric to us in the not-so-distant future.

  167. Re:How does this crap get moderated up? by dWhisper · · Score: 1

    Not part of MGS, but they were all part of the greater Mars Initiative that included the Pathfinder, Polar Lander, Climate Orbiter and MGS. Pathfinder and MGS were successful, the others were an assumed rather splendid crash. They were all separate missions, but part of the same program.

  168. Human orbiting, not exploration! by missing_boy · · Score: 1
    I'm a long time trekkie and fan of all things space and I certainly believe in little green men, but we have remember one thing: space is vast. Space is so vast, indeed, that the old "needle-in-the-haystack" analogy won't even come close to express the probability of finding another lifeform out there, even if we raised the haystack to it's own power. Plz excuse the geekery.

    "Space exploration" as we know it is done by astronomers and astro-phycisists who look up into the night sky and analyze composition of star-systems and their ages and distances and so forth. Sending 7 guys up in orbit in a tin-can is not gonna get us any closer to actually being able to go there, wherever "there" might be. It's too darn far away, it'll take too long.

    1. Re:Human orbiting, not exploration! by marebri · · Score: 1

      Agreed 100%.

  169. Restart project Orion by kinnell · · Score: 1

    This would be a great way to use up all those old nukes from the cold war, would massively advance space exploration, and would fire peoples imaginations for generations.

    --
    If I seem short sighted, it is because I stand on the shoulders of midgets
  170. Did you pull that number out of your butt? by Iron+Sun · · Score: 1

    Crappy movies to the contrary, planet killer asteroids are a very big medium-term (next 200 years or so) threat.

    According to who?

    It seems to me that humanity has managed to get through six thousand odd years of recorded history without being annihilated by a big rock. Mega-extinction class impacts happen on a timescale of tens to hundreds of millions of years. Smaller city- or country-busters can be expected on a timescale of tens to hundreds of thousands of years. While I do think that programs such as Spacewatch are an excellent return on measly investment, I also think that people who declare that the cockroaches' day of dominance will happen next week are resorting to hyperbole because they really, really want to holiday on the Moon. By all means let's have a robust space exploration program, but try not to bruise the truth too much while lobbying for it. The genuine desire to explore is a better and more honest motivator than Chicken Little-driven overstatement.

    1. Re:Did you pull that number out of your butt? by Moofie · · Score: 1

      Tunguska could have been bad, and it's been several tens of millions of years since the last asteroid.

      No, there's no hard timescale here: But there are a lot of big near earth asteroids. I for one don't fancy rolling the dice.

      Yes, I did make that number up.

      --
      Why yes, I AM a rocket scientist!
    2. Re:Did you pull that number out of your butt? by Firethorn · · Score: 1

      According one show I saw recently, we've finished going through the spiral arm, and have just entered the period when the dinosaur killing comets are going to be coming through. Though I'd say the danger is short term in measurments of thousands of years.

      --
      I don't read AC A human right
    3. Re:Did you pull that number out of your butt? by Iron+Sun · · Score: 1

      Tunguska could have been bad

      Tunguska could have been bad, yes. It was also a rare event. Just becuase your next door neighbour wins the lottery does not mean that you are going to win it next week...

      and it's been several tens of millions of years since the last asteroid.

      ...and just because you haven't won the lottery in the last thirty years of weekly entries does not improve your chances of winning it next week either.

      Given that you are a rocket scientist, I can't believe that you don't understand probability, which leaves the impression that you are once again using Chicken Little tactics to overinflate the threat faced.

      We should fully fund Spaceguard because it costs peanuts, has useful scientific return, and ya never know, maybe something will turn up to genuinely be worried about. But repeated and intellectually dishonest warnings about the sky falling in is no way to lobby for a human spaceflight program.

      I for one don't fancy rolling the dice.

      Possible translation: I can use the fact that there is a non-zero probability of this event occurring to inflate it into a scare campaign in order to push a personal agenda. Do you drive a car? Use air travel? Both far more likely methods of punching your clock, and I bet you don't spend shitloads of your own money trying to prevent the unlikely event of it occurring. The standard counterargument by the Chicken Littles is that a big asteroid strike would wipe out "all life on the planet" (hasn't actually done precisely that in any of the major strikes in the last few billion years, but what's one more hyperbolic distortion of the facts? Not that a world with algae as the highest lifeform would be a fun place) and thus is worthy of serious consideration. Probability-wise, I would rate the nuclear annihilation of humanity many, many orders of magnitude more likely than a comet strike. Should we be on the lookout for impact events? Most certainly. Should we demand billions of dollars be spent on it in the next decade because otherwise we will all definitely die? No.

  171. Moon IS critical to succeed by msfodder · · Score: 1
    Going to the moon is absolutely NOT a dead end. The moon is a prerequisite for any sophisticated exploration of the solar system.
    1)A launch and construction facility based on the moon in it's weak gravity facilitates further exploration rather than trapping it behind absurd $$ figures for each pound of cargo that has to be lifted from earth's gravity well.
    2) A semi-permanent site on the moon pushes the space program towards a deeper commitment to exploration and provides much needed know- how on dealing with the hazards of deep spaceflight and living in vacuum.
    3)The moon could provide residents with a high percentage of the resources they need to live given experimentation and new methodology that only exposure to the environment will bring about.
    Trying to economically bring resources from the earth into space and planning for extraplanetary adventures like Mars without any experience is demonstrably painful and expensive.
    --
    ..Free Live Free...
    1. Re:Moon IS critical to succeed by Moofie · · Score: 1

      I don't believe that you are correct. The Moon is close to earth, and might be good for some industry in the medium term, but there's nothing you can do there that you can't do with a little bit more work on orbit.

      Even if you can find oxygen on the moon, nobody's found convincing evidence of nitrogen, which means that you can't grow food there, unless you import nitrogen. Now, of course, you have the same problem on orbit, but the only advantage to the Moon is that you're in a gravity well. Apart from that, it's basically a desert.

      My priest on this subject is Dr. Zubrin, who advocates (rather than doing a lot of on-orbit assembly for a Battlestar Galactica Mars mission) launching two rockets, one with the return vehicle and one with the crew hab module, directly to Mars from Earth. No rendezvous in orbit, no assembly required.

      It's (obviously) a bit more involved, but I suggest you check out his web site and read his plans.

      Incidentally, the habs that he is talking about for Mars would also work fine on the Moon. So there's no reason not to build a couple extra and dump some crews there to do some more exploration and some real science. But, I don't believe we should depend on Luna as some sort of waystation.

      Mars Direct

      --
      Why yes, I AM a rocket scientist!
  172. A Space elevator is inherently stupid by dcmeserve · · Score: 1

    Quite a few reasons, but the biggest one can be summed up in 2 words: SERIAL CONNECTION.

    You'd only be able to lift one batch of cargo at at time. Yes, you could pipeline many of them, but they'd still all have to start at one point on the earth, and all go to a single destination. And any hiccup in one would stop all of them.

    How would one lift these cargo loads, anyways? Well, electromagnetic techniques seem reasonable, but what if you took the resources it would require to build that 100,000-kilometer-long EM lift and split it into one thousand 100-km-long rail guns? They'd be able to shoot loads into space, in a variety of directions, each at the same rate as the single elevator. Which means you'd be able to put 1000 times as much stuff into space in the same amount of time. i.e. do it in PARALLEL.

    Of course, you'd need a lot more power for each of these rail guns as the equivalent-length section of the elevator. But you know, they probably don't each need to be 100km. Maybe 10km? Also, maybe you don't need a thousand of them. Try 100. So probably for the same power expenditure, and 1/100th the construction materials, you'd be able to deliver freight/passengers into space at 100 times the rate.

    One other thing people seem to forget about a space elevator: rotational inertia. As you raise cargo up, you're going to have to accelerate it laterally as well, or your elevator will get pushed backwards. So you'd either have to constantly be using thrusters on the base station at the top, or each load would need a rocket. Which negates the supposed "no dangerous fuel" advantage.

    Something else to think about: why are automobiles so much more popular than trains?

    Ok. Done ranting for now.

    --
    "Orthodoxy is unconsciousness" - Orwell
    1. Re:A Space elevator is inherently stupid by Des+Herriott · · Score: 1
      You'd only be able to lift one batch of cargo at at time. Yes, you could pipeline many of them, but they'd still all have to start at one point on the earth, and all go to a single destination.

      So? Ultimately, we could have dozens of space elevators and an entire network of colonised asteroids surrounding the Earth. But an initial space elevator will be a loss leader.

      How would one lift these cargo loads, anyways?

      You're ignoring one very important point: cargo goes up, cargo comes down. The net energy requirements are tiny compared with launching cargo into space. Balancing rising and descending loads also addresses your lateral acceleration problem.

      The construction cost for a space elevator would be enormous, I don't think anyone disputes that. It's also slightly out of reach of current technology, but may be feasible in the next 50-100 years. However, a working space elevator would mean that the enormous energy expenditure we currently make to get vehicles into orbit would cease to be an issue.

      Something else to think about: why are automobiles so much more popular than trains?

      Automobiles (I assume you're talking about trucks) are less useful than trains when it comes to transporting bulk cargo. They're also less efficient in terms of energy used per weight transported.

    2. Re:A Space elevator is inherently stupid by dcmeserve · · Score: 1

      > Ultimately, we could have dozens of space elevators...

      But they'd be aligned in a single ring along the equator, instead of having perhaps thousands of rail guns arrayed across the globe. Which will be easier to use? And which one will ultimately be more bandwith-limiting?

      > But an initial space elevator will be a loss leader.

      I wonder about that. To build the next elevator, if we're talking about material brought up from the Earth, it could still take a lot more energy/time to do that, even with an existing space elevator, than to build a rail-gun launcher. That's due to the sheer *amount* of material we're talking about for an elevator -- it's not quite so ribbon-thin at the higher altitudes!

      If we're talking about capturing an asteroid, putting it in the proper orbit, minining it, etc -- well, that's even *more* effort, isn't it?

      > You're ignoring one very important point: cargo goes up, cargo comes down

      Hmm, yes, I was. I focused my argument too much on just one side of the equation. But...

      > The net energy requirements are tiny compared with launching cargo into space.

      I wouldn't say that's a sure thing. You're not going to retrieve 100% of the energy on the way down. Even if you only lose a few percent, over such a vast distance, I could see that very well adding up to more than the energy cost of a rail-gun launch. This could especially be true if you only want low-earth-orbit. I don't know any actual numbers, of course.

      Also, you still need a way to go from the top of the elevator to your final destination. True, the elevator-top would itself be an attractive destination, but we're talking the bigger picture here. Anyways, you'd need to keep a supply of propellant of some kind up there. If you have to transport it from Earth, that effectively cuts the efficiency of the elevator. With rail guns, you could very well give your craft enough energy to make it all the way to the moon, mars, etc, with only minimal manuvering thrusters needed on the ship.

      Yes, you can just let ships fly away from the elevator-top due to centrifugal effect, but you might still need more additional acceleration to be provided by the ship itself than you would if a rail gun was providing the initial energy.

      > Balancing rising and descending loads also addresses your lateral acceleration problem.

      Hum, yes. One minor problem might be interference between waves travelling up/down with the elevators. Though careful scheduling of the elevator trips would probably avoid any constructive interference from becoming, er, destructive.

      > > Something else to think about: why are automobiles so much more popular than trains?
      > Automobiles (I assume you're talking about trucks) are less useful than trains when it comes to transporting bulk cargo. They're also less efficient in terms of energy used per weight transported.

      But then why are trucks so popular? Because of the freedom gained by having a much larger number of source/destination points. If you're a company in North America needing to get a 2-ton item to the moon, how would the cost analysis work out between:

      A) hauling it, what, 5000 miles to the equator, sending it up on the elevator, then transferring it to another vehicle to go to the moon, vs.

      B) sending it 100 miles to the nearest rail gun, and launching it directly to the moon?

      The rail launch itself may be more expensive, but the total cost (in $$) may be less. And it may be the only option if you need it there quick.

      I was also referring to passenger automobiles -- the same logic applies to why cars are so damn much more popular than trains. Yes, they're a lot less energy efficient, and more expensive, but they afford a much greater degree of freedom. People are willing to pay extra for that -- in energy, money, and even risk to life.

      Actually, I guess I can see a place for both technologies. As passenger/freight trains/slow boats across the ocean still have a place where low cost outweighs timeliness, the space elevator may have a role. But for most space travel, I see a rail-gun or similar approach being more popular and even economical, if not more energy-efficient.

      --
      "Orthodoxy is unconsciousness" - Orwell
    3. Re:A Space elevator is inherently stupid by drinkypoo · · Score: 1
      If you're wondering why you didn't get modded up, it's because it is entirely possible (and probable) to have multiple elevators on the same cable.

      Using a magnetic linear accelerator to launch loads works best when you are launching without an atmosphere, which complicates things significantly. It doesn't help you bring things DOWN, either, which is also an issue.

      The counterweight is in geostationary orbit. Only minimal stationkeeping is required; through the use of massive solar arrays, or using nuclear power, we can most likely generate enough power to accomplish that with ion drives.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    4. Re:A Space elevator is inherently stupid by drinkypoo · · Score: 1
      Think of the space elevator as 'last mile' technology. Earth is the home, and space is the fluffy internet cloud that we like to put on our network diagrams to represent the internet.

      In space you can go anywhere, but you have to GET there first. Just like you can do all kinds of shit with the internet. A space plane is like a modem in australia; It's got limited bandwidth and you have to pay every time you use it. By contrast a space elevator is like getting Cable for less than modem prices, except you have to pay a grand for your DOCSIS modem. (I have to stretch this stupid metaphor past reason, so bear with me.) The point is that you have tons of bandwidth, and the price per trip (or pound or ton or however you want to measure it; Right now it's about 10,000 a pound down to 5,000 a pound to put mass into orbit, so no one measures in tons, but the space elevator will achieve a several-orders-of-magnitude reduction in that cost, literally) is very high. I would suggest that you'll have as many as eight cars, though initial development will probably only include two, and maybe only scale up to four total. Each of them can be VERY large.

      Your comparison of space elevator vs. space plane to cars vs. trains is unreasonable. Instead compare private planes to airliners, for international flights, because this is what we're dealing with here; A major barrier which is, while not insurmountable, dramatically difficult to cross for the individual. Even NASA has (obviously) been having a lot of trouble with it lately. (Shuttles are simply too complicated. Too many things can go wrong. Did you know that the C5 corvette has half as many parts as a C4 corvette? Chevy gets it, what's wrong with NASA?)

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    5. Re:A Space elevator is inherently stupid by dcmeserve · · Score: 1

      > If you're wondering why you didn't get modded up, it's because it is entirely possible (and probable) to have multiple elevators on the same cable.

      I guess you didn't see the word "pipeline" I used.

      --
      "Orthodoxy is unconsciousness" - Orwell
  173. It's entirely possible that... by constantnormal · · Score: 3, Interesting

    ... until we achieve practical nanotechnology or large-scale robotic assembly (both here and in orbit), that making space travel practical will simply be too expensive.

    However, that having been said, making expensive incremental advances is the best we can do until then -- so we must keep plodding along.

    But what I want to know is WHY haven't important advances like the linear aerospike engine developed for the X-33 been put to use? I thought NASA's job was to push technology forward, not to bury it. For those unaware of what a linear aerospike engine is, here's one small tidbit that helps explain its value: conventional rocket engines lose effectiveness as the ambient air pressure changes and must use expensive and complex nozzle geometry changes to minimize this. The linear aerospike maintains a near-constant efficiency from surface to orbit.

    Before the X-33 program was folded amidst cries of bug-ridden technology and cost overruns (ostensibly due to a single fuel tank failure during testing -- remember the early problems with shuttle tiles? the Apollo 100% oxygen atmosphere that resulted in 3 deaths before everything was redesigned to become more flame-retardant? The X-33 fuel tank problems were a stalking horse designed to let the military take it over.), the linear aerospike performed flawlessly. And where is it now? Check the url above to see in what part of Boeing it resides.

    And with the inherent weaknesses of the decades-old shuttle fresh in your mind, check out this link (originally from www.milnet.com, but now only available via the google cache) for the advantages the X-33 presented over the shuttle. The VentureStar might not have made as good a truck as the shuttle, but unmanned cargo rockets (like those the Russians do so well) are better vehicles to boost freight into orbit.

    Perhaps when we have a Chinese space station passing over the US every ninety minutes the government will figure out that NASA has a role other than a place to take funding from to backfill budgets that cannot be supported on their own merits.

    Eventually, when large scale robotic manufacturing and practical nanotechnology drive the cost of making things through the floor (assuming it doesn't bury us in grey goo), we'll be able to grow space elevators and put hotels and shopping centers in orbit (not to mention nanotech development facilities, zero-G hospitals and organ farms). Until that time, access to space will continue to be controlled/blocked by that servant of the people, the gummint.

    1. Re:It's entirely possible that... by khallow · · Score: 1
      ... until we achieve practical nanotechnology or large-scale robotic assembly (both here and in orbit), that making space travel practical will simply be too expensive.

      I've never bought into the nanotech religion. We already have the functional equivalent of large-scale robotic assembly. We call these labor units "people". Maybe they are a pain to support in space, but they do function correctly - er, most of the time. ;-) Also, who or what ends up controlling nanotech gets to control space exploration. Not necessarily a good thing.

      It's entirely possible that... (Score:2) by constantnormal (512494) on Wednesday February 05, @04:21AM (#5229999) ... until we achieve practical nanotechnology or large-scale robotic assembly (both here and in orbit), that making space travel practical will simply be too expensive. However, that having been said, making expensive incremental advances is the best we can do until then -- so we must keep plodding along. But what I want to know is WHY haven't important advances like the linear aerospike engine developed for the X-33 been put to use? I thought NASA's job was to push technology forward, not to bury it. For those unaware of what a linear aerospike engine is, here's one small tidbit that helps explain its value: conventional rocket engines lose effectiveness as the ambient air pressure changes and must use expensive and complex nozzle geometry changes to minimize this. The linear aerospike maintains a near-constant efficiency from surface to orbit.

      I started to whine about the lack of real information contained in the above link. However, when I google for aerospike engines, I find that all the information is being dropped from the internet. For now, here's a couple of links that work - the FAQ on aerospikes and the remnants of the aerospike homepage. Googling on the USENET proved to be much more valuable in that I actually saw comparisons of aerospike technologies with regular nozzles.

      The technology indeed looks interesting (and more important seems to work!), but the problem can also be solved by getting the craft out of atmosphere ASAP. Now that's done with a first stage optimized for performance in this region. Ie, it's much more compelling a feature for a SSTO (single stage to orbit) than the usual multistage rocket.

    2. Re:It's entirely possible that... by Zirnike · · Score: 1
      "But what I want to know is WHY haven't important advances like the linear aerospike engine developed for the X-33 been put to use?"

      You know the real cause of the Challenger accident? O-ring, right? You should be aware that the only reason the SRBs had o-rings is because they're too big to ship in one piece over rail. And the low bidder on the contract, in Florida, from where they could ship in one piece, didn't get the job... because an important stonewalling Senator wouldn't approve the shuttle until he got his kickback.

      That help answer your question?

      --
      I'm not shy, I'm stalking my prey
  174. It's time to move on. by perfessor+multigeek · · Score: 1

    While obviously you're kidding, you've actually got a valid point.
    Look at the numbers in that potato cannon story. The velocities show that these days things we're used to thinking of as heavy duty are actually doable for as little as a thousandth the cost our government tells us it will take.
    For example, as Jerry Pournelle keeps pointing out, our space suit designs are absurd and vastly better options are available for far less.
    Hooo boy! Vacuum! Think again; don't call it vacuum, call it one atmosphere of pressure. A good pair of bike shorts handles that sort of differential just fine, including the famously troublesome issue of what to do at joints. Oh, no! Radiation! Yeah, whatever. Any good lab supply catalog sells gear able to handle that too.
    The same can be said for piles of the stuff we're doing in space.
    I've loved space travel since I was a wee lad, used to belong to L5, all that stuff. And one of the worst moments of my life was going down to Cape Canaveral and seeing a mothballed Saturn sitting out in the tropical wet and sun, reduced to a paperweight. All I could think of was how far we had declined.

    What do I think? F*ck NASA. They've blown the whole deal of manned space flight. I say increase the X-Prize series and match it to the various rewards tied to milestones mentioned here and elsewhere.
    Pay the Russians to boost the ISS for a few more years, push as much useful mass up beyond LEO to stable orbits as we can, hope that somebody creates a new Beal Aerospace and this time actually gets funding, and allow the shuttle system to swiftly decline into irrelevancy.
    The shuttle is our modern Pony Express. Huge amounts of money and support structure supporting a tiny number of brave, dedicated folks running a breathtakingly inefficient transport system that was outdated on the day they had their first trip.
    NASA does great pure science. They deserve every kind of credit for Pathfinder, Hubble, and all the rest. But they're not competent to run a high-volume transport system. It's like putting geologists in charge of Greyhound.
    Let's move on. Only then will we move up.

    Rustin

    --
    Data is the lever, rigor the fulcrum, brains the force that drives it all.
  175. Easy cowboy. by jotaeleemeese · · Score: 1

    -The Sun is in the middle of its life. That means it will not expand and die for another 4 or 5 billion years. Plenty of time if you ask me.

    -Any asteroids or comets that are big enough to wipe out human life on Earth and that may one day collide with our planet will be discovered by the improving telescopes. To divert such a threat should probe relatively easy (and we don't need to send Bruce Willis to do the work, that is why we have unmanned spaceships that could put in position small rockets to divert any asteroid or comet).

    If humanity still exists in lets say 2999990000 years they would still have at least 10000 years to solve the problem of the Sun expanding, which may be imperative by then.

    To worry about that now is frankly childish.

    --
    IANAL but write like a drunk one.
  176. Redundant Array of Inexpensive Spacecraft by niftyzero · · Score: 1

    With all the sexiness RAID and Beowolf, why not apply the same reasoning to spacecraft?

    Manned spaceflight is too expensive (in dollars and in lives) with current technology. Perfect unmanned technology first. Make it cheap and plentiful, so that one failure (or ten) would just be a percentage increase in cost instead of a major setback.

    And since it's to be cheap, private industry should take the lead. How about some tax incentives?

  177. Space exploration by robots by Per+Abrahamsen · · Score: 1

    The right thing would be to drop manned space exploration for the forseeable future, and put all the money on sondes and robotic crafts. This will give far more science for the money, and the spin-off techonolgy is also likely to be more valuable.

    I know there is a lot of semtiments involved with manned space exploration, but I believe we need to put these aside, and consentrate on the science.

    When the technology is cheap enough, or rich people are rich enough, a self-sufficient space turist industry may put back men in space, but until then, let the robots take over.

  178. $cience!! by beatbox32 · · Score: 1

    Let us pour our funds into NASA so that we may find our true lord, Xenu!

    --
    "The purpose of learning is growth, and our minds, unlike our bodies, can continue growing as long as we live." - M.J. A
  179. Where? Anywhere but where we've been! by Eggs+Ackley · · Score: 2, Interesting

    There once was a town on the shore of a small harbor. Outside the harbor jetty were tremendous waves, but beyond the harbor entrance the sea was calm all the way to the distant islands on the horizon.

    The townspeople wanted to explore those islands, and at one time they sent small, fast boats out past the waves to one of the islands, and discovered many great things. Amazingly, it only took them ten years of research to reach that distant island.

    The waves were a problem though. Once they got past the waves, they could go anywhere they wanted, but coming back through the waves destroyed the boats. So the town's leaders decided that if they just built a fleet of large ships, they could go out and back through the waves many times easily. So the town used up all of their money to build these wonderful large boats.

    The problem was, once past the waves...that was as far as the boat could go! It would motor around for a while, staying close to the entrance, then come back through the waves. It was a wonderful boat, to be sure, but the huge cost of building and sailing her left almost no money to build anything else! The large boat sailed for nearly 35 years, and never went anywhere. It just went outside the harbor and then back.

    Over time, the concept of going to those far islands soon faded from everyone's mind because they had convinced themselves that this was "exploration", when they actually explored nothing more then the harbor entrance.

    Occasionally the large ship would sink, and the townspeople would grieve for the loss of the crew. Sadly though, they were so blinded by large boat's wonderful technology, and so forgetful of what true exploration is, that they could think of nothing better then building another boat to sail around the harbor entrance. After all, it was all they knew how to do!

    The distant islands were still there, filled with wondrous treasure, but the townspeople couldn't see them anymore, because the large boat was in the way.

    It was sad, you know.....

    If they had only lifted their eyes a little bit higher, the could have seen past the large boats to the islands beyond. They would have seen the treasure sparkling in the distance. They might have remembered what exploration really means. They might have populated those bright specks, they might have lived in heaven.

  180. How to get off this little rock... by Genda · · Score: 1

    Gentlemen,

    This is so simple it's a wonder nobody thought of this sooner. We simply doctor up a report that indicates that Mars and a number of the more interesting objects further out in the solar system have unlimited amounts of oil, and that the nation which claims these resources first, will be able to dole them out to an oil hungry world with impunity.

    I figure Dubyah and his cronies would start dumping money into NASA so fast, they'd need to hire an army of bean counters just to keep the finances straight.

    Just an idea...

    "To make an apple pie, you first need to create a universe..." -- Carl Sagan
    "I will not exclude the option of using nuclear weapons in the Middle East..." -- Someone slightly less intelligent than an apple pie...

  181. Return to the moon in a new vehicile & stay lo by irabinovitch · · Score: 2, Interesting

    As pretty much everyone has commented, price is important. But safety I'd say is even more critical than price. What I would love to see is a new vehichle thats cheaper per launch as well as safer. I'd like to think our technological abilities since the 80s have improved enough where this can be pulled off to some degree.

    An extended stay on the moon seems like it would be a good test prior to taking a trip to Mars. I think its been too long since we've gone there.

    I wouldnt mind us paying for this by doing sattelite launches for comercial purposes etc, (ala Russia). The only requirement I'd put on this is that it should not impact scientific research or become NASAs priority.

    But anyways ya, I'd give to space exploration if I knew it wouldnt be going to administrators paychecks but rather to new developments / research.

  182. Oh My God!! by ubrayj02 · · Score: 3, Interesting

    Have I been waiting for this day on Slashdot!
    I know that this won't get modded up. First it is an anti-space exploration post (i.e. flamebait). Second, there are over 700 other posts out there - good luck moderators.
    Anyway...
    Here is the next direction NASA should take into space: they shouldn't send humans into it!
    It is expensive.
    It is dangerous.
    It achieves little but inspiration for powerless/low social status techno-geeks.
    Instead, our country should explore alternatives that advance science and technology as much as NASA uplifts our geeky spirits. There is, to my mind, only one true alternative to the wasteful, and hardly economically viable model of space exploration we currently have. That alternative is to explore and study the OCEAN.
    Obviously, satellites, and mechanized thingamajigs belong in our country's arsenal of neato-exploration-based stuff. Their practical benefit is a widely heralded success.
    However, the economic reality of sending people hurtling into the upper atmosphere and beyond, for a dubious "scientific" cause of "jus' cuz we can" is one that our country (and that no country on earth) can accept.
    An intensive study of the ocean, based on the same sorts of ideas that NASA uses to explore space would yield inumerable direct benefits to commerce, defense, and concomitant scientific progress. Further, in terms of inspiring geeks, I can think only of the CS majors at my coastal university who I see walking alone on the beach, looking out to sea for answers. If we as a nation decide that our tax money ought to be spent in beneficial research and exploration into new frontiers, then, lone geeks on the beach everywhere, the ocean has the answers waiting for you.

  183. Research, not all space based. by nuggz · · Score: 1

    Sorry, the space program didn't bring us everything that came after the wheel.
    I'm not saying that there hasn't been much innovation or research, but it isn't ALL NASA.

    Plastic was invented in the 1860's
    Fully Synthetic in the early 1900's
    Microwave ovens were "invented" in the 40's
    Batteries were invented back in the 1600's

    If Congress gave NASA $2 billion, that would be more then 10 billion less then their current budget of 12-15 billion annually over the last few years, not including the plan to double it.

    I think that the space program should continue as it is, they will be a bit more careful, hopefully this won't happen that much more.
    Realistically manned Space travel is dangerous, but there are thousands of people who would qualify, and who take the chances to keep going despite the risks.

    People dying today is more important then cold temperature velcro performance. It is more important to the average voter, politician and to me.

  184. Re:You forget about inflation by GMontag · · Score: 1

    Factor in inflation.

    The rate of inflation for the past decade has been pretty low. But nice try. An increase is still an increase and a decrease is still a decrease.

    The budgets are at best flat, and I believe actually DO drop over the years in the graph

    I believe you are a troll banking on others not even looking at the graph or the numbers.

  185. Safty by TamMan2000 · · Score: 2, Insightful

    So the failure rate of the first 113 flights was a little under 2 percent for the shuttle...

    What do you think the failure rate was for the FIRST hundred or so manned atmospheric flights?

    Manned space flight is still young, and you can call me a dreamer if you will, but I think it will get safer, and safer as time goes by and we gain experience, and we will continue to do so, it is human nature to want to explore. Accidents are unavoidable, no amount of preparation can prevent all accidents. Astronouts know this, and go up anyway, that is why you have to be brave to be one. Ultimatly sending people into space is the only way to get good at sending people into space.

    --
    "I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
    1. Re:Safty by Oscar26 · · Score: 1

      And you forgot to mention that the first accident was preventable. An engineering coverup.

      If you're a dreamer than I am too.

      While I'm writting, I'm going to rant. I'm sick of all the ignorant fools who say "why didn't they do a space walk" or "why didn't they just travel to the space station".

      Phew. Why doesn't change the fact that 7 people died while trying to benefit humanity. May their souls rest in peace, may their dreams live on in others.

    2. Re:Safty by Izmunuti · · Score: 1

      "And you forgot to mention that the first accident was preventable. An engineering coverup."

      They're always preventable in hindsight. The O-ring problem wasn't covered up. The engineers at the time (without the hindsight we now enjoy) thought they understood the problem and had it under control. They knew that when the joint flexed, the O-ring wouldn't seal for a short period and that there might even be a bit of erosion until it did. They had seen erosion on earlier flights and it matched their model, seeming to confirm their understanding. Everything was documented according to the procedures of the time -- hardly a coverup.

      There are probably any number of other components on the Shuttle with problems that are (or believed to be) understood and managed. That's engineering.

    3. Re:Safty by TooTallFourThinking · · Score: 2, Informative

      And you forgot to mention that the first accident was preventable. An engineering coverup.

      It wasn't an engineering coverup. We studied this intensively in college, and the engineers who designed the O-rings knew the temperatures at the lauch site were lower than the O-rings were tested at. In other words, the engineers weren't quite sure what would happened, but from the data they had, their inital recommendation was not to launch.

      They informed NASA about this, but the adminstration was pressed to launch. The Challenger launch had been delay for months due to weather and other conditions and because it was a highly publicized launch for sending up a civilian. Eventually, enough pressure was placed for the engineers to change their recommendation and the launch went. (If one subcontractor of the Space Shuttle recommends a No Go, the entire launch is scrubbed. The subcontractors who made the O-rings were the ones holding up the launch.)

      Anyway, there were many factors that lead to the disaster of the Challenger, all of which could have been avoided.

  186. Tax cut to the rich by oliverthered · · Score: 1

    $600bn over 10 years.

    --
    thank God the internet isn't a human right.
    1. Re:Tax cut to the rich by ShavenYak · · Score: 1

      There's nothing stopping Joe Married Couple on $90,000 from investing in stocks that pay dividends. I know plenty of people who stick hundreds or thousands of dollars in savings accounts that earn less interest than the dividend rate on some stocks.

      I think the dividend tax cut is a good idea. It should encourage investment in stocks and bring money into the market, thus improving the economy. Yes, it will benefit the wealthy more than the not so wealthy in terms of actual dollars on the 1040 forms. But as I said before, there's nothing stopping the middle class from investing in stocks, and those too poor to invest aren't paying (much) tax anyway so we can't cut their taxes.

      --

      Hey kids, there's only 5 days left 'til Yak Shaving Day!
    2. Re:Tax cut to the rich by SirTreveyan · · Score: 1

      Who would you ask for a job...a rich man, or a poor man?

      The more 'rich' men there are the more people able to employ others, either directly or indirectly throught the goodies they buy.

      Democrats like to think that anyone who makes more than 45,000 a year has, in the words of Daschle, "hit lifes jackpot." Those of us who have attained that level know thats not the case. But then the Democrats like to engage in class warfare often with ethnic overtones. But what would one expect from those who pander to a constituency that for the most part is very uneducated, and are always looking for someone to blame for problems they themselves caused.

      --

      SELECT * FROM User WHERE Clue > 0

      0 rows returned

  187. Sponsor a soviet design international spaceplane? by geoswan · · Score: 2, Insightful
    I think I prefer this Soviet design, the MAKS (Multipurpose Access System), a little brother of Buran. The orbiter and external tank ride to a launch height of 9,000 meters on top of a big cargo plane -- similar to the 747 used to fly the American shuttle from the landing site back to Kennedy.

    A google search for spaceplane turns up lots of articles. Another slashdot reader already recommended Gregg Easterbrook's 1980 article on Columbia's first launch. I guess one lesson from looking back on it is to take the claims of the designers with considerable skepticism. Fity or more launches per year? Cost a third or less per ton of the cost of single shot rockets? Ha.

    Yet, I would guess that the general public was seeing the American shuttle as being a big success. I expect people will see it as a success again.

    I like the idea of putting aerospace workers from the former Soviet Union to work. I like the idea of putting them to useful, peaceful, dignified work. I don't like the idea of them being owed six months of paltry back-pay. Not when some of them have skills developing WoMD.

    I like Dennis Tito's answer to one of the questions he was asked when he returned from being the world's first space tourist. He was asked whether it was frivilous to spend $20,000,000 on a vacation, when the world faced terrible problems, like grinding poverty. He said something like:

    You are correct. That money should have been spent helping the poor. And it was. Do you know the average wage of a Russian aerospace worker? About $100 per month.
    I read an article some time ago, by a tourist, who knew something about aerospace, who dropped by the Buran that was being turned into a cafe, in Gorky Park, while it was still being converted. The security guard who stopped him, was quite knowledgeable -- because he was a former aerospace worker who had worked on Buran. This seemed like a terrible coincidence at first, a terribly ironic one.

    But then it turned out that the Buran cafe project was a project of the former Buran workers. They were all involved.

    I couldn't help really feeling for these men and women. I imagined they had traded back-pay they were never likely to see for the Buran mockup they were turning in to a cafe. (Cafe patrons were going to get to order real cosmonaut space rations.) But they hadn't given up. They hadn't given up on aerospace. They hadn't given up their dignity. They hadn't given up on peace. They hadn't given up on their country.

    The Soviet Union had a space program any former citizen could be proud of. I'd like to see their talents put to use. This isn't charity. They were talented.

    Plus, there is the peace factor. Everyone is worried that "rogue states" are going to acquire weapons of mass destruction by subverting penniless former defense workers from the former Scviet Union. Well, why don't we address this issue by making sure they weren't left penniless?

    Yes, I know organized crime is (was?) a terrible problem throughout the former Soviet Union.

    Still, would the dollars, yen, euros of the international community be better spent in the former Soviet Union, where paying an aerospace worker $1000 a month would be a ten-fold pay increase, then in, let's say, the USA.

    The USA, or more precisely, the US aerospace industry, is the land of the $1000 spanner. Let's be honest. That too, is a kind of corruption.

    The US's milltary-industrial complex built many weaspons systems over the years. Do you know which one provided the greatest invulnerability?

    That would have to be the one with a sub-contractor in every congressional district.

  188. Cost of giving.... by oliverthered · · Score: 1

    Everyone in the country you plan to passively attack with a really nasty(but not fatal) common cold, significantly reducing the life cost of war.

    Held up for contravening BIO weapons agreements.

    Why can't we develop low cost (life and money) disabling BIO weapons?

    --
    thank God the internet isn't a human right.
    1. Re:Cost of giving.... by oliverthered · · Score: 1

      Ok, so you can nuke somone.
      You can develope DU weapons,
      you can use propaganda, bomb the fuck out of anything you feel like.

      But your not allowed to develope 'safe' bio warfair incase someone might develop harmfull bio warfair.

      Well, there's not a great point in developing really nasty BIO, it's easy and there's enough of it about.

      safe BIO warfair is hard, I used the common cold as an example because it's a pain, you won't be able to do much if you have a nasty cold, but few people die from a cold.

      Putting LSD in the water supply would work quite well, it's low toxisity and there ain't no way your going to win if everyones on acid. though thats chemical weapons and we all know how bad they are.

      Give a man a gun, or give a man a joint.

      --
      thank God the internet isn't a human right.
  189. Someone other than Lockheed and Boeing by bareman · · Score: 1

    Cut NASA/lockheed/boeing budget and send the money to another company that can figure out better ways to get into space instead of being focus on better ways to obtain space funding.

  190. Same garbage talk as last time we lost a shuttle.. by nurb432 · · Score: 2, Interesting

    The shuttles work, they are proven. They are paid for. Yes they cost to maintain.. but so will *any* replacement.

    Sure look for alternatives for the future, but don't act stupid now because of this.

    Considering what they do they are safe. *Accidents* happen, it wasn't a fundamental design flaw, it was a damned ACCIDENT

    Now the program will be on hold for years, and people will complain about safety, cost, bla bla and delay even longer.

    Space travel is NOT safe.. Yes its sad this happened but its space travel things do happen.. geez get a grip.

    --
    ---- Booth was a patriot ----
  191. Some possible reasons why it wouldn't work by Iron+Sun · · Score: 1

    One of NASA'a takes on why this may be technically feasible but impractical in reality hinges on the component of the ET that seems to have led to the recent tragedy: the foam insulation. It is rather fragile, and would be likely to shed lots of high-speed bits in orbit, creating a debris cloud that could make approaching it hazardous in the extreme. Even if you account for the fact that craft rendezvousing with it would approach the cloud at a small relative velocity, it's still a rather inconsiderate thing to do the the LEO environment. One suggested workaround would be to put the whole tank in a big sock to minimise such debris, but getting it over the outside of the tank would likely be orders of magnitude more difficult than any of the on-orbit construction that has taken place to date.

    Also, the intenal pressure vessels are not equipped with human-sized ingress holes, so airlocks etc would have to be cut and welded to the structure whilst in orbit. This would be even more difficult than fitting the giant condom.

    As for mining it for materials, to break it up would be hazardous as outlined in point 1, and there is currently no means of refining it into anything usable. To build an orbital facility able to process the thing would likely be so expensive that it would defeat the whole point of the exercise.

    1. Re:Some possible reasons why it wouldn't work by shadowbearer · · Score: 1

      "One suggested workaround would be to put the whole tank in a big sock to minimise such debris, but getting it over the outside of the tank would likely be orders of magnitude more difficult than any of the on-orbit construction that has taken place to date."

      I can see the patent now:

      Shuttle External Tank Condom

      *ducks*

      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
  192. We can't do it alone anymore. by Sergeant+Beavis · · Score: 3, Insightful

    Now that the shock of the Columbia's loss has set in and we are starting to put together what exactly happened, I was thinking to myself what NASA should do to increase mankind's presence in orbit and how to go about it. It is apparent to me that the current Space Transportation System (STS) is in need of replacement. The last time we tried to do that was under the Space Launch Initiative (SLI) under the Clinton administration. That program was a failure, not because of Clintons people, but because there were technological and monetary hurdles that couldn't be properly addressed. However there is a way to do this. Right now the STS fleet is grounded, so the immediate concern is how to keep the ISS in orbit and fully manned. Russian President Putin has promised to build more Soyuz space craft to insure ISS is manned and supplied. From what I've found, it cost Russian anywhere from 25 to 50 million bucks to launch a manned Soyuz and a little less for a Progress supply ship. I would propose that the US discontinue any crew transport missions for the Shuttle to ISS and pay a significant portion of the money needed to keep Soyuz ships flying to ISS instead. If these ships cost 50 million bucks then there is a savings of 450 million bucks for each transport (the Shuttle cost 500 million to fly). When the Shuttle is back on it's feet, it should ONLY fly construction missions to finish the ISS. The the STS should be retired. That begs the question, what do we do with 450 mil for each flight that doesn't go? Since there are typically 6 or 7 flights by the Shuttle per year, about half of them are for significant construction of ISS. So we are looking at a savings of nearly 1.5 billion per fiscal year. THAT money should be invested in a completely new Single Stage to Orbit (SSTO) space shuttle like the X-33 was meant to be. But that's not all. In order for space travel to become affordable, space vehicles must become more affordable. Building 5 space shuttles cost the taxpayers between 3 and 5 billion for each one (the Endeavor cost 3 billion because it was built from spare parts). If we could build say 20 or 30 space shuttles, the cost could possibly be cut in half or perhaps more. NASA doesn't need 20 or 30 shuttles, however, if we could get the European Space Agency (ESA), the Russians, the Japanese, Aussies, and even the Koreans to join up with the promise of owning their own shuttles, the cost could be easily be spread out. You see, the Europeans would get out from under NASA's shadow which they have for so long hated. They wanted to build a ship back in the 80's called the Sanger but they didn't have the money for it. The Europeans don't have the experience of space travel that we or the Russians do but they do have a lot of technology and engineering that they can bring to the table. The Russians are obvious additions because of their experience. What they can't bring to the table in money, they can definitly bring in know how. The Japanese have always wanted a manned space program but they too don't have the money to foot the bill all the way. In addition, their rocket program has suffered many setbacks. The Koreans would look on this as national pride IMO and rightly so. We of course know more about Shuttles than anyone and of course can bring more money to the table. America would still have it's leadership role in the project but would still have to work with members of the coalition. You see, I no longer see space exploration as an American dream. This is a HUMAN endeavor. We as Americans (or Russians) just happen to be better at it than anyone else. If we build a shuttle or two that can haul cargo and personnel to low Earth orbit in a cost effective manner, we will see more and more people going and that is the goal. Get more up there so we can do more. NASA has already learned that it needs to get out of the space launching business and get into the Space Exploration and Space Science business. NASA was essentially going to sell the Shuttles to the United Space Alliance and lease them back. The USA was going to maintain the Shuttles and NASA pilots were going to fly them. NASA needs to get away from the space monopoly that it has created so that competition can be built. The same thing happened when NASA got out of the satelite launching business after the Challenger disaster. Getting people to compete and getting a new reliable shuttle with the world behind it will establish a firm foothold in space for the human race. Right now we have had our foot in the door for too long and last Saturday it got jammed. Now it's time to kick open the door and step inside. Once we have a firm foundation in orbit and on the moon, then we can procede to the Planets and the stars.

    --
    There is nothing inherently safe about liberty. That's why so many people died protecting it.
  193. Re:Look around you, not up in the sky by Cheeze · · Score: 1

    yeah, what a great idea. Lets fix humanity, and then just hope humanity doesn't self destruct.

    *that was sarcasm*

    no, really, the only way we are going to propogate ourselves as a species is to start moving to other planets. If we don't spread, any little jackass with a few nukes can ruin it for all of us.

    --
    Why read the article when I can just make up a snap judgement?
  194. How about OTRAG by Pig+Hogger · · Score: 1
    It's amazing that no one ever mentionned OTRAG, which more than 25 years ago, nearly came to be a successful PRIVATE venture to put things in orbit for very cheap.

    They used clusters of a very simple rocket to hoist very big loads. But they ultimately fell under pressure from the soviet-union and the united-states...

    No wonder the clunky shuttle and the wasty coho3 are the only game in town...

  195. Obligatory that 70s Show Reference by Cyno01 · · Score: 1

    Kelso(reading a magazine): "Man, chicks must love Astronauts, it says here they get all the tang they want."

    --
    "Sic Semper Tyrannosaurus Rex."
  196. Re:Antigravity in the UK by hplasm · · Score: 1

    Details, anyone?

    --
    ...and he grinned, like a fox eating shit out of a wire brush.
  197. Space elevator by TA · · Score: 1

    Much as I would love to see a space elevator, I shudder by the thought of how bad it will go if it does: Let's say the anchor asteroid gets disconnected at the top end. The elevator will fall down and wrap itself around the whole of Earth's equator! Can you imagine the consequences?

  198. "Civilian" travel? by n-baxley · · Score: 1

    I'm sure many won't like this, but what about civilian travel. The Russians got $20 mil a pop for a ride in a noisy capsule. Imagine what you could get for a ride in the Shuttle. Hell, take out all of the science, build a passenger compartment in the payload bay and put 20 people in it. 20x20 mil = 400 million. If I recall, it currently costs $500 million per launch the shuttle, including astronaut training and maintenance. If you're payload has no science, you'll save the money on developing the experiments and you won't have to train as many astronauts. The "passenger" compartment can be isolated from the cabin so you don't have to train the "dumb civilians".

  199. Hard Answers To Easy Questions by xdroop · · Score: 1
    Ah, but up is locally relative. Would you want the Americans using the Australian vector for 'up'?

    Perhaps what you meant to say is 'away from the center of the earth'.

    --
    you should read everything on the internet as if it had "but I'm probably talking out of my ass" appended to it.
  200. Maybe it's time to back off from manned flight by stevelinton · · Score: 1

    It's not an idea that appeals to me intuitively, but maybe the thing to do is back off from manned flight for a decade or so. This frees up a huge amount of money for unmanned projects, in orbit, on the moon, on Mars and beyond. Those projects will need launchers, and it would not be hard to nudge things a little so that some of the projects needed largish launchers and some needed reentry vehicles for relatively fragile and large cargo.

    With a much bigger market and modest encouragement, new launchers will be developed that are cheaper, more reliable, easier to manage and so on. They might be wholly or partly reusable, they might not. They might use exciting new technologies, they might just refine existing ones.

    Once this has happened we can pick the most reliable, proven heavy-lift and reentry systems and essentially put a passenger capsule inside them. The vehicle would already have a track record before we put people in it. Then we can go back into space in a saner fashion.

    Given this blueprint for the next 20-30 years (and a lot of exciting science and commercial activity from the unmanned space program) a moderate amount of money could also go into a longer-term research program developing new concepts and materials for the 30-100 year timescale.

    Steve

  201. Losing experienced engineers and craftsman by nomadicGeek · · Score: 2, Informative

    One of the reasons that many of the military projects continue is that we are afraid of losing the experienced people who build these projects.

    The SeaWolf submarine is an excellent expample. We don't really need the new subs but if we don't build at least a couple of them, all of the engineers and craftsmen that build them will be out of a job and more on. Some of the needed skills will be lost forever.

    It seems to me that we could use the space program to help to keep the people employed and the skills up to date. Keep bright minds and talented hands busy while getting the benefits of science and exploration.

    I'm sure that I am making it sound simpler than it is but we could divert some of the money that is being used for unneeded military projects and maybe get something more useful out of it while still preserving the high tech skill sets that we need.

  202. Re:Same garbage talk as last time we lost a shuttl by EvilTwinSkippy · · Score: 1
    Unfortunately, the Space shuttle is such a camel of a spacecraft that I doubt it will ever fly again. In 2 accidents we have already passed the russians in fatalilites in space.

    20 launches of the shuttle at $250 a pop would pay all of the R&D for retrofitting an existing rocket design to fly manned missions. (The Gemini spacecraft was launched on a modified ICBM btw.)

    In the meantime, all efforts should be made to find some other way of getting crap into space. The shuttle is, and has been for it's entire existance, a sucking sound for American taxpayer money.

    --
    "Learning is not compulsory... neither is survival."
    --Dr.W.Edwards Deming
  203. Start with What We Got... by iCharles · · Score: 2, Insightful
    I would like to see us start with reviving the X-38 program. It was far enough along that a manned vehical doesn't seem too difficult. Though a earth-to-space version would be dependant on expendable boosters, it would give us capability in addition too the shuttle. Shuttle will still need to be used to delivery some of the components for the space station.


    The X-38 provides a blend of some proven methods, along with newer technologies. It takes advantages of the materials science, aviation, and computer imporvements over the last thirty years. It can act as a real-world demonstrator for these technologies, that can later be rolled into the next vehical. Plus, some of the burden could be taken off the shuttle for crew transfers and basic science.


    Speaking of science, the ISS should be expanded to allow a full crew of seven. One common critique of the station is that there is not enough crew to do meaningful science. This seams plausible: if a diverse skill set is required for some of the experiements, a larger crew would be the logical fix. By having the crew and capability to perform experiments, launching shuttles, with large cargo bays for space labaratories, will not be required for pure science.


    Gradually, as the station is built, the dependence on the older shuttle is reduced, the newer vehicals (starting with the X-38) can take up most of the work of transfering crews and experiments. Progress can do the initial work for providing supplies. As other demonstration systems (X-43, other runway-to-space type of sytems) become more viable, unmanned versions can take on supply delivery roles. Grandually, as experience with these grows, manned versions can take over for the X-38.


    Truethfully, this is the way it should have been all along. An evolution of systems is how both technological improvments and economical capabilities are realized. Unfortunately, the entire history of manned has been one of fits and starts. Since the first shuttle launch, it's replacement has been proposed, funded for a while, then cut. A year or two later, we start again. A commitment is going to have to be realized.


    A historical note: it has always been this way. Way back when, we were going to create a spaceplane known as the X-20 DynaSoar. It would have launched on a conventional rocket, and landed like an airplane. However, the space race forced us to use Mercury capsles first. Then, JFK decided we should go to the moon. Rather than creating a sustainable space capability, we created Apollo. What if we had stuck with the X-20?

  204. Against whom ? by MosesJones · · Score: 1

    Who are these things going to be used to protect the US against ? When was the last major sea battle the US was involved in.

    These are classic cold war elements, saying that you HAVE to have X when you aren't saying why is just stupid. The US has the largest of everything, why continue with these convential programmes over intelligence funding. The US is building an armed force to fight the USSR. Sadam is NOT going to come CLOSE to stretching this technology.

    So bollocks that this stuff is "required" its subsidising the defence contractors who support Bush....

    Oh but then increasing funding to NASA would also go mainly to the companies mentioned above.

    --
    An Eye for an Eye will make the whole world blind - Gandhi
  205. More Ant Farms, obviously. by frenchgates · · Score: 1

    To replace the one damaged in the crash.

    Apparently the writers of The Simpsons are designing the experimental payloads.

    --
    Syntax error: loose != lose, affect != effect, then!=than
  206. Linear Accelerator by Kintanon · · Score: 2, Funny

    I'd say what we should do is get a mile long (Or 3 mile long, or 5 mile long, or however long it takes to get up to speed) linear acceleartor. We use it to launch material capsules into space for essentially nothing after the cost of construction. Then we make some remote controlled robots designed for constructing things in space. We launch them up the same way in big shock resistant containers that burst open and are then also used as building materials. Then we set the robots to work building us a superlight craft in space. Once the construction is complete we launch its payload via the L.A., the payload consistes of all of the equipment we can think of that would be useful for terraforming a small chunk of the moon or mars. Then we send the ship there, also remote controlled. Land it, remotely control the construction of a habitat, populate the habitat, continue to build ships with this method. Once we have 3 or 4 of them they can pretty much ferry back and forth between levels of earth orbit carrying supplies to the moon base. The moon base people work on finding water or raw materials on the moon. If we find water they set up a slow but steady method of converting it into fuel (hydrogen) if we find raw materials then we boost the water or hydrogen and they start setting up manufactoring facilities to create the materials for more ships. At some point we dismantle most of the freight carrying ships and rebuild them into one much larger ship designed to hold 200 or so people. We get those 200 or so people. In the meantime though we are now launching freighters out to mars to drop supplies down to the planet as well as robots, solar factories, anything we can think of that will help make a small piece of mars habitable. Once we've got a couple hundred people, a mars that is covered in supplies, and a very lage ship we set out for Mars establish a colony there and begin the research to make larger sections of it habitable as well as searching it for water/raw materials to use in constructing that habitat.
    Now we build a few booster heavy tugs in orbit, find a convenient asteroid and pull it into orbit around Mars (or just land some miners on one of the Moons of mars) and start extracting raw materials from that to continue habitat constructions. This plan puts us well on our way to permanent residency on Mars, and I'd say it will take about 75 years to complete. If I were lucky I could see us land on Mars and establish that colony base before I die...

    Kintanon

    --
    Check out JoshJitsu.info for Brazilian Ji
  207. Learn the economics. by barawn · · Score: 1

    Okay, I'll simplify everything I'm going to say right now. Learn the actual economics and physics of the situation, because your ideas are wrong.

    It takes about a week to launch something via a space elevator, so pipelining means you can launch as many payloads as you have climbers, basically. This puts you FAR above the capabilities of rocket-type launchers.

    Also, the reason people "forget" about rotational inertia is that it doesn't apply. You're stealing rotational inertia from the Earth to speed things up. Gravity keeps it from slowing down.

    1. Re:Learn the economics. by dcmeserve · · Score: 1

      > Okay, I'll simplify everything I'm going to say right now.

      I'll excuse that, since my own post was a bit flamish.

      > ... rocket-type launchers.

      I never said anything about rockets. A rail gun uses electomagnetic effects.

      If the space elevator uses EM to raise an elevator, it's using roughly the same technology, only it's a track that's maybe 10,000 times as long. Even when you recoup the energy from the descending elevators, the inefficiencies will probably add up to more than the energy required to do a rail-gun launch (into LEO, at least).

      And I don't see any reason why you couldn't pipeline a rail gun just as much as a space elevator.

      > You're stealing rotational inertia from the Earth to speed things up. Gravity keeps it from slowing down.

      I think you're the one who needs to brush up on his physics. Or maybe geometry.

      But it doesn't matter -- see the other response to my post, regarding how it's not a problem due to descending elevators cancelling it out -- as long as you have equivalent mass going up/down.

      As far as economics, think about this: one of the major reasons why the shuttle program is so expensive is the monolithic nature of a government agency like NASA. If incentives were found for private corporations to invest in manned space flights, the process would soon get much cheaper, technology would advance faster, etc. etc. I refer you to maybe half the other posts in this discussion.

      A space elevator will be an inherently monolithic project. It's just begging to be a pork-laden, budget-overunning, gigantic money hole. And think of the power of whatever agency/government/corporation winds up controlling it!

      A smaller-scale rail gun or similar design would be much easier to build, and therefore more distributed. Competition would be possible, driving costs down much further.

      --
      "Orthodoxy is unconsciousness" - Orwell
    2. Re:Learn the economics. by barawn · · Score: 1


      I think you're the one who needs to brush up on his physics. Or maybe geometry.

      But it doesn't matter -- see the other response to my post, regarding how it's not a problem due to descending elevators cancelling it out -- as long as you have equivalent mass going up/down.


      What the heck are you talking about? What you're doing is taking an object that's spinning at 1 earth circumference/day, and moving it out to a point where it is STILL moving at 1 earth circumference/day. It doesn't speed up or slow down at all.

      What you have done is increased its angular momentum, since you increased its radius. That increase came from the Earth, since the elevator remained taut during the entire time (again, gravity is doing this) and applied a torque against the Earth.

      You don't need equal mass going up and down. It's functionally identical to a skater spinning around, and extending a string with a counterweight on it. She'll slow down slightly, but not much, because the string has so little mass. The angular momentum of the counterweight is now quite high, and the skater's angular momentum is a little less, but the angular momentum of the system is still the same.

      The skater could then slide more counterweights down the string - imagine her spinning fast enough to keep the string taut. The string won't "bow" or move laterally as counterweights along the string - it'll stay taut, because that's what the forces on it are forcing it to do. This is the exact same situation that you have with the space elevator, except gravity is providing the tension rather than a skater.

      The skater could slide as many counterweights down the string as she wanted to. None need to come back. All that happens is she slows down a little more each time.

      Also, space elevators vs. rail guns are pretty silly - rail guns would be FAR more inefficient than a space elevator for the same reason that the Shuttle is inefficient. Air resistance. A rail gun has one shot at applying escape velocity to an object, and it then has to propagate through the atmosphere, dissipating tons of energy, so the rail gun needs to impart even MORE energy to begin with.

      This isn't the case for a space elevator. Air resistance goes as velocity^2, so going slowly, you burn less energy. If the elevator climbers simply move slowly, they will be so insanely more efficient than a rail gun that it wouldn't even be worth talking about.

      It's also trivial to transmit power to the climbers - just use a laser, in a frequency where the atmosphere doesn't absorb. This is already what they're planning on, and then the "track distance" doesn't matter. The efficiencies would still be incredibly above a rail gun, simply because they don't have to fight air resistance - all you need to do is just beat gravity.

      A space elevator is by far the ideal method for launching satellites. One thing that people forget is that not only do you get the object into orbit (just walk it up, and poof! off it goes) since the cable needs to extend PAST GEO, you can continue past GEO, at which point you're moving at superorbital velocity for that point. If you continue far enough, and then just let go, you will actually continue on with a ridiculously high velocity, without ANY use of boosters, rockets, anything like that. Obviously this is true for any launch vehicle, but most of them do this in a second stage while in orbit, because they barely make orbit.

      Yes. That's right. You get to Mars in a matter of a few days by climbing a very large cable, and then letting go. No engines. Just maneouvering rockets. You get to the Moon in hours, if not less.

      If you read the NIAC proposal to NASA regarding the Space Elevator, you'll realize that the proposed elevator they're talking about is flat cheap - $10 billion, and that's including something like a 2X contingency for overrun, and it could get to Mars, Venus, Jupiter or the asteroids with NO ENGINES. No fuel. No nothing. The efficiency of the system becomes so ridiculously far above other launch mechanisms that it becomes silly. No fuel. Just math, and timing.

      Rail guns can't do that (remember, air resistance goes as v^2, so it gets harder and harder to launch something into higher and higher orbits). Nothing can do that save a space elevator. Space elevators are the logical ideal launch mechanism. The only thing that had been holding us back was the lack of a material, and now carbon nanotubes look like they were handed to us on a silver platter.

      All launch vehicles have to fight air resistance. A space elevator is the only one that fights it the best way possible - with a low "v", and a long "t".

    3. Re:Learn the economics. by barawn · · Score: 1

      Whoops, typo. Should say "angular velocity of 360 degrees/day" instead of "1 earth circumference". Rest of the argument still stays the same, though. The lateral acceleration is provided simply by the requirement that the elevator has to be taut (it can't "drift", and while it will have a natural period of oscillation, that can be damped rather easily).

      It's in orbit. It just happens to be so ridiculously elongated that a portion of it touches the ground. Think in the smaller sense - if someone walks back and forth along the length of the space station, does it drift in one direction? No. It'll start oscillating, yes, but since you can fix one point of the space elevator, you can damp the thing.

    4. Re:Learn the economics. by dcmeserve · · Score: 1

      > What you're doing is taking an object that's spinning at 1 earth circumference/day, and moving it out to a point where it is STILL moving at 1 earth circumference/day. It doesn't speed up or slow down at all.

      Ok, I'll go ahead and get into some details.

      In terms of how many degrees/day, yes, no difference. However, actual acceleration has to do witjh *linear* velocity. I think you get this, but I'll do a quick calc anyways:

      On the surface (at the equator), that's 25,000mi/day, or about 1000 mph. At an altitude of 60,000 miles, that works out to 2*3.14*(60000+4000) miles/day, or about 17,000 mph. So that means you need to apply a lateral acceleration to get from 1kmph to 17kmph. If you don't put a rocket or other propulsor on the elevator, that acceleration has to come from the cable.

      Now...

      > What you have done is increased its angular momentum, since you increased its radius.

      Yes, exactly -- more linear speed, more momentum.

      > That increase came from the Earth, since the elevator remained taut during the entire time (again, gravity is doing this) and applied a torque against the Earth.

      I think this is your mistake -- you're assuming that the elevator's base station up at 60k miles is somehow permanently fixed relative to the earth. It is not. It is in orbit, and if you apply a lateral acceleration to it, it will speed up or slow down just like any other satellite.

      Think about it: you have a force being applied laterally on the cable somewhere in the middle. There are 2 larger masses attached to this cable, one on each end: the earth, and the base station. The one whose velocity will change more is the one with the smaller mass -- and that'd be the base station. Yes, you'd affect the earth's angular velocity a little bit too, but because it's so much more massive than the base station, the difference will be negligible relative to the effect on the station.

      So, you're going to have to compensate -- either by using propulsion at the base station, or by balancing the lateral forces by keeping the same amount of mass going down as coming up. The balancing would obviously be the preferable solution.

      As for your skater analogy, imagine she has two balls on strings instead of having her arms outstretched, while she's spinning. If she pulls in the strings, making the balls come closer, they're going to start rotating ahead of the rest of her body; if she pulls hard enough, the balls will come around and whack her. The reason that doesn't happen with her arms are because her arms are relatively *rigid* -- they are able to communicate these lateral forces back into the main body, allowing the whole system to equalize and spin as a rigid body.

      Ok, now on to...

      > Air resistance.

      I should have described this in my original post: this rail gun/maglev launching device would have to terminate a a very high altitude -- one high enough to be above at least the majority of the atmosphere. But I think this would be no more difficult than building the base station for the elevator -- which, according to at least one proposal I've heard, would have to be something like 10km high. Build that on top of a mountain, you'll get another few kilometers. That may well be high enough to make atmo resistance a relatively minor concern (remember, atmo density decreases exponentially as you go up). Though of course, I don't know the precise numbers.

      If this holds up, I would regard that as an equivalent challenge, between the rail and the elevator. Though the rail *would* need something else too -- a tunnel along its entire length, which can be evacuated of all air. I admit, this may be difficult.

      > You get to Mars in a matter of a few days by climbing a very large cable, and then letting go.

      I'm not so sure those numbers would work out -- if you have a reference, I'd be interested to see it. For now, let me go through a few mental steps:

      - If you release *at* the base station, you'll just float along beside.
      - If you release a *little* ways out, you'll go away from the station, but you won't be at escape velocity. You'll just be in an elliptical orbit, with the point at which you detatched from the outer cable being the closest point (apogee or perigee? I can't remember).
      - There will be some critical distance where you'll be at escape velocity when you detach. But if you're only just above that, you're really not going to be going that fast. The craft that went to the moon were going only just above escape velocity, and it took several days. Our current mars probes are going a bit faster than that, and take 18 months to arrive.

      So then the question is: how far out do you have to go to get the kinds of speeds you're talking about? Will there be enough outward length of cable for this? We'd have to work out the numbers.

      Note that lateral acceleration problem comes up again: as you let masses go out along this outer cable, you're going to need to have a balance for the lateral acceleration you'd get. That means you'll have to have other masses arriving at the cable somewhere much farther out, and being drawn in at the same time. Could get tricky.

      -----

      Ok, so anyways, after all this discussion, I want to say that I regret the title I gave to my first post. The space elevator would definitely have a place in an overall spacefaring economy. But I don't think it'd be something that would be relied upon exclusively, in the long term.

      --
      "Orthodoxy is unconsciousness" - Orwell
    5. Re:Learn the economics. by dcmeserve · · Score: 1
      The one whose velocity will change more is the one with the smaller mass -- and that'd be the base station.

      I found the paper on the space elevator by Bradley C. Edwards. From section 10.8:

      Small oscillations or traveling waves that may be induced by wind or meteors can also be actively damped out at the base of the cable if a cable displacement monitoring system is implemented to detect any movements in the cable.

      One oscillation that Pearson [in an earlier paper on a somewhat different elevator setup] investigated was that of transverse waves induced by climbers. The bottom line on this oscillation is that large oscillations can be induced when the climber transverses the length of the cable in one period of the cable s characteristic frequency. (Pearson assumed no counterweight so had the climber traveling twice the length of the cable during one period.) Since we just calculated our cable's characteristic period to be 7.1 hours we will only need to worry about this particular affect when we plan to have climbers traveling at close to 10,000 km/hr.

      So looks like the details of the scenario will make it a workable problem after all: a given elevator/climber will cause a transverse wave to travel up and down the cable. At the base station on Earth, an active-dampening system can be employed to cancel out any (small) waves that make it to the bottom (that aren't already damped out/overshadowed by the effects of the atmosphere). The wave that travels up will mostly reflect back downwards if the base station at the top is much more massive than the cable at that point, and if there is an abrupt transition from cable to station. The reflected wave could then be damped at the bottom.

      Thus, the lateral force will indeed be communicated down to the bottom, and will ultimately come out of the Earth's rotation.

      --
      "Orthodoxy is unconsciousness" - Orwell
    6. Re:Learn the economics. by barawn · · Score: 1

      I'm not so sure those numbers would work out -- if you have a reference, I'd be interested to see it. For now, let me go through a few mental steps:

      Check out the NIAC proposal at www.highliftsystems.com. You can trivially figure out accessible orbits vs. cable length via a first year undergrad equation.

      Incidentally, the base station is at sea level. On the sea, in fact.

      The cable extends rather far past GEO. It doesn't take too long to get to escape vel: you just have to be traveling at 1.4 * your orbital velocity, and poof, you're out of Earth orbit, and traveling rather fast w.r.t. the rest of the solar system, depending on when in the day and year you let go.

      The "standard plan" for the cable length (91,000 km) gets you to Mars, Jupiter, etc. Actually to Mars doesn't require very much at all - I think it's like 60,000 km or so. This sounds insane (it's a third the distance to the moon!) but it's really not that big a deal, as all you're doing is spooling out cable, and considering how thin the cable is, it's easy to bundle it up tightly.

      I did a calculation (on Slashdot, actually) of the release velocity and transit time for a 91,000 km cable a while ago, but I can't find it. The moon was definitely of order 10s of minutes, and Mars was of order 2 months (days was a bit off, but 2 months vs. years is still incredibly better!). I didn't take into consideration out--of-plane velocities, so your launch time would be once or twice every couple of years at this speed, but otherwise you just need a plane-correction rocket and a bit more time (few more days at most).

      At 91000 km, you're moving 7 km/s with respect to the surface or so. 7 km/s! You'd get to the Moon in about half a day. So, I was a little optimistic, but keep in mind this is without ANY fuel. None. And you're already in orbit when this happens, so speeding up your trip is as easy as flinging mass out the back, and getting a delta-v in front.

      I think this is your mistake -- you're assuming that the elevator's base station up at 60k miles is somehow permanently fixed relative to the earth. It is not. It is in orbit, and if you apply a lateral acceleration to it, it will speed up or slow down just like any other satellite.

      You don't apply a lateral acceleration to it. In order to do that, you need to apply an acceleration at its center of mass at GEO (it's an extended object) and that's not what you're doing. You're torquing it at a certain radius, which will induce oscillations if there is a fixed point, and rotation if there isn't. In this case, there is a fixed point - the Earth. Anyway, you already posted the correct info on this, but the real ideal fix is to simply damp the oscillations, since they're such an incredibly long period.

      I should have described this in my original post: this rail gun/maglev launching device would have to terminate a a very high altitude -- one high enough to be above at least the majority of the atmosphere. But I think this would be no more difficult than building the base station for the elevator -- which, according to at least one proposal I've heard, would have to be something like 10km high. Build that on top of a mountain, you'll get another few kilometers. That may well be high enough to make atmo resistance a relatively minor concern (remember, atmo density decreases exponentially as you go up). Though of course, I don't know the precise numbers.


      Exponentially, yes, but not that fast!

      At the top of Mt. Everest, you've still got about 1/3 of the atmospheric pressure to deal with, which coupled with the temperature decrease means slightly more than 1/3 the density at the surface. Decreasing the air resistance by 1/3 isn't that helpful, when air resistance goes as v^2. Tacking on an additional 10 km is at best going to get you down to about 5% of the original atmospheric pressure, which is still not that good. It means that you can shoot about 4 times faster than you could on the ground before running into the same air resistance, but somehow I doubt that the amount of "net velocity once out of the atmosphere" from the railgun on the surface is that good.

      Plus, where would you rather transport your materials: the top of Mt. Everest, or a sunny tropical place at the equator? :) It should be noted you're again defeating your initial reason for building a rail gun by restricting its location.

      Rail guns would be ideal on, for instance, the Moon (two stage launch process! space elevator to the Moon, then rail gun off again) or maybe Olympus Mons, where you have no air resistance, but ANY air resistance anywhere comparable to the surface air resistance kills you.

    7. Re:Learn the economics. by kyletinsley · · Score: 1

      A space elevator is by far the ideal method for launching satellites. One thing that people forget is that not only do you get the object into orbit (just walk it up, and poof! off it goes) since the cable needs to extend PAST GEO, you can continue past GEO, at which point you're moving at superorbital velocity for that point. If you continue far enough, and then just let go, you will actually continue on with a ridiculously high velocity, without ANY use of boosters, rockets, anything like that. Obviously this is true for any launch vehicle, but most of them do this in a second stage while in orbit, because they barely make orbit.

      This doesn't make sense to me. If there has to be a counterweight 'station' at the other end of the string, and it extends beyond geo-sync orbit, what's keeping it moving faster than the orbital speed for that distance??

      Why should the cable remain taut if the weight at the end of it keeps wanting to slide backwards relative to the spot on the earth where the other end of it is connected? Wouldn't it slide backward, and then the fact that its tied to a single point on the Earth means that it would be pulled closer to the Earth's surface the farther it fell back (ie. wrapping around the earth until it finally plunges into the ocean)?

      Wouldn't you need rockets or some other kind of thrusters to keep the weight at the end in its desired orbit? Or are you talking about building a structure that is completely rigid and handles all the stresses that are placed on it while always pointing straight out into the sky? Are you really suggesting building a 23,000+ mile building? A skyscraper 78,000 times taller than any other building ever built? If so, why would you want a weight at the end, it would just be extra stress for your structure to have to handle?

      And how are you going to get equal weights moving up and down the cable at the same time? You would basically be accomplishing absolutely nothing if you had to move the same mass up and down every time you travelled. (ie. Where can your satellite/ship go if you need the weight of it to carry up the next load? And how did you get the initial weight up there that you brought back down while moving your satellite up there in the first place? Seems like a chicken/egg thing, unless you plan on slowly moving an initial weight 'car' up the pole as it was being constructed, and no future loads could be heavier than that one.)

      Unless you plan on mining asteroids or something so that you always have a supply of rocks to be trucking back down to the surface or something. Is that part of your plan, because I didn't see any mention of anything like that. Or am I totally missing something here? Please explain.

    8. Re:Learn the economics. by barawn · · Score: 1

      This doesn't make sense to me. If there has to be a counterweight 'station' at the other end of the string, and it extends beyond geo-sync orbit, what's keeping it moving faster than the orbital speed for that distance??

      Gravity! That's what's so cool - gravity is providing the tension which is what's forcing it to continue moving. That's why when you let go, zip! off you go!

      Why should the cable remain taut if the weight at the end of it keeps wanting to slide backwards relative to the spot on the earth where the other end of it is connected? Wouldn't it slide backward, and then the fact that its tied to a single point on the Earth means that it would be pulled closer to the Earth's surface the farther it fell back (ie. wrapping around the earth until it finally plunges into the ocean)?

      The center of mass of the object is located at GEO, which means that the entire object will remain fixed at one place relative to the Earth's surface. The counterweight does want to orbit slower than it actually is moving, however, the tension of the remainder of the cable keeps provides the additional centripetal force required to keep it moving at that velocity.


      And how are you going to get equal weights moving up and down the cable at the same time? You would basically be accomplishing absolutely nothing if you had to move the same mass up and down every time you travelled. (ie. Where can your satellite/ship go if you need the weight of it to carry up the next load? And how did you get the initial weight up there that you brought back down while moving your satellite up there in the first place? Seems like a chicken/egg thing, unless you plan on slowly moving an initial weight 'car' up the pole as it was being constructed, and no future loads could be heavier than that one.)


      You don't need to have equal up/down loads. Doing that eliminates the oscillations caused by moving things up and down the cable. (Moving things up accelerates them laterally due to a normal force from the cable and an incredible tension on the cable preventing it from bowing. This produces a counterclockwise torque until it reaches GEO, and then a clockwise torque after it reaches GEO). This can also be compensated for by active damping, since the torque is really small and the period is long term, so you just need to make sure it damps out over time, rather than holding it still.

      It literally just is a "big cable that goes up to space" - you crawl up the cable slowly (it takes ~week or so to reach the top. You don't want to go fast, otherwise you start getting killed by air resistance just like all the other launch vehicles). and once you reach the orbit you want, you let go. You presumedly then fire attitude correction rockets to get out of the way of the elevator, but that's a trivial change.

      The best way to think about it is this: a satellite's orbit is determined by the height above the surface of the Earth of its center of mass. That is, you place a satellite in GEO, and it stays there relative to the surface of the earth (it orbits the earth once every earth day, just like we do). If it extended big metal "feelers" both towards and away from Earth, keeping its center of mass where it is, it wouldn't move. A space elevator is just a dramatically excessive version of this, where those "feelers" extend all the way down to Earth's surface.

  208. How many B2 bombers = 1 shuttle? by Anonym0us+Cow+Herd · · Score: 1

    Would one or possibly two B2 bombers buy a space shuttle?

    Not that I advocate that we should actually buy another shuttle. I'm just trying to put the cost into a certian perspective.

    After the Challenger was destroyed, and Regan signed the bill to build another shuttle, I seem to remember the cost as being about $2.4 Billion (probably in some late 1980's dollars). Since we spend about $2 billion on a B2, I was just wondering if two B2's more than buy a shuttle vehicle?

    --
    The price of freedom is eternal litigation.
    1. Re:How many B2 bombers = 1 shuttle? by sbaker · · Score: 1

      The Enterprise (replacement for Challenger) cost $2.1bn in late 1980's dollars
      - *BUT* it was built using spare parts ordered as a part of the original
      shuttle procurement.

      There are no replacement shuttle bodies left. The tooling and expertise
      for building them has long evaporated.

      The engines *are* replaced routinely after every few missions - so
      presumably those are in good supply.

      Since no two shuttles are exactly alike - it's hard to know what the
      electronics and other subsystems would take to replace.

      NASA have said that it would be cheaper and easier to design an entirely
      new craft than to build a straight replacement for Columbia. So, it would
      be considerably more costly than $2.1bn - even after adjusting for 2003 dollars.

      --
      www.sjbaker.org
    2. Re:How many B2 bombers = 1 shuttle? by PCBman! · · Score: 1

      The Endeavor, you mean?

      The Enterprise is a museum piece that was used to test the structure of the shuttle in atmosphere. I don't think it ever even glided in anywhere. Anyway, it became a museum piece a little before Columbia was built and launched, IIRC

      --
      So, when's lunch?
    3. Re:How many B2 bombers = 1 shuttle? by sbaker · · Score: 1

      Sorry - yeah - I did get them switched around. Actually, Enterprise did do
      a couple of test glides off the back of it's Jumbo Jet launch.

      --
      www.sjbaker.org
  209. To the moon, Alice! by jbarr · · Score: 1

    Wait...been there, done that...or have we?

    --
    My mom always said, "Jim, you're 1 in a million." Given the current population, there are 7000 of me. God help us all!
  210. My $0.02 by superdan2k · · Score: 3, Interesting

    For starters, I'd like to see the X-33/VentureStar program get back on track. The Aerospike engine was a phenomenal success, IIRC, and the only problem they had was that of the composite fuel tanks. (If they go with standard aluminum tanks, they lose like 90% of their payload.) I'd like to see that program reactivated and the composite fuel tank problem solved.

    Also, a "from orbit" escape system wouldn't be a bad idea. Set up a "mini" space station that orbits in the same general area as the new shuttle system. Said mini station would merely be a truss (similar to what they've been putting on the ISS), with two Apollo-style capsules attached, a solar panel system to keep the capsule systems warm and the batteries charged, and a small set of OMS thrusters to automatically maintain the station's orbit. This way, if an orbiter is ever damaged on the way up again, and it's uncertain whether or not it will survive re-entry, it can dock with this, the crew can return to Earth in capsules, and a later servicing flight can come up to repair the orbiter and replace the capsules.

    I'm not sure we can cease shuttle flights altogether, and I also think it's important to remember that Columbia was the oldest in the fleet and on the verge of being retired. I think we have to keep flying Atlantis, Discovery, and Endeavour for the time being. Along those same lines, I'm also an advocate of "Big Can" construction projects in orbit. It's a clever hack.

    I also think it would be dangerously stupid to build just a reusable launch system again. The Space Shuttle Main Engines (SSMEs) are extraordinarily powerful and extremely reliable, and we're in need of a good heavy-lift booster system...especially if we're going to do what NASA needs to do in the near future -- the Moon and Mars. A system similar to what Robert Zubrin proposed in A Case for Mars would be great: basically, a space shuttle launch stack without the space shuttle, and the primary tank fueling four SSMEs. I believe this would allow you to throw ~200 tons into LEO, but I don't have the book in front of me.

    Once a new reusable launch system and heavy-launch system are in place, I'd give the last three shuttles a final flight into orbit, with return capsules for the crews. Once in orbit, they ought to be stripped down and overhauled for use as orbital "tugboats"...

    And lastly, start going somewhere again...first the Moon, then Mars and the asteroids...then...who knows? :-)

    --
    blog |
    1. Re:My $0.02 by tmortn · · Score: 1

      I like your idea of a mini station but it probably is very impractical with current re-boost systems. THe low orbits generally used by shuttle are very very very fuel intensive orbits with high rates of decay, even station in its relatively high orbit ( according to general shuttle orbits ) encounters atmospheric drag which deteriorates its orbit and there is a great deal more the closer in you get... its an exponential increase if I remeber.. its realted the function governing gravitational attraction.

      A simpler option is that shuttles should not be launched without the option of an emergency dock with Station now that it is available. However re-fuling ability etc was scratched from stations capability and the shuttles OMS system is not designed to be refulable on orbit. We would also need to add more escape vehicle ability to Station to make this of much use as well. So just being able to rendezvous is not enough. I really think we ought to modernize and maintain a capsule production ability. THey are relatively simple in comparison to the biconic space plane design of shuttle... also much more robust physcaly.

      All in all I agree, I think in hindsight most people realize dropping Saturn V and Apollo production was not a good move. Had shuttle deliverd the promised savings it would have been great... but if you dig at the costs enough you will find that shuttle launch cost as they have developed realisticly are approximately the same as a Sat V launch and that is with having to build from scratch every time, this is allowing for inflation and not allowing for improovemnts in the production line that would have happend as a matter of course. Maintnence and facilities costs ascociated with Shuttle have never been balanced by economies of scale as was the initial plan. If we could operate on the initial turn around schedule envisioned and with a fleet of 50-100 shuttles per launch savings could still be a reality. However it would still be incredibly more expenisve than the current system from an overall program standpoint which is what eventually killed that idea anyway.

      Since bringing the F-1 booster and the Sat V stack back is not an option I would love to see the ARES concept developed to fruition... however ARES would be horribly expensive if it used SSME's and we did not include a recovery option. Including the heat shield and a viable return ability would seriously eat into the payload gain of ARES. SSME's are incredibly expensive due to the engineering required to allow them to be reused. I would like to see an ARES concept which uses the newest single use booster from Boeing ( ~600k lbs thrust to SSME's ~400k ) designed for use with Delta stacks. This booster was still largely on the drawing board when Zurbin developed the concepts behind his 'Case for Mars'. Now it is a reality and could be fit to operate with a shuttle stack as it is a LOX LH engine same as the SSME. Its cost is much less than a SSME and it provides a higher thrust per engine to boot. Its roughly analogus to the Russian booster he considered in his concepts that is beyond mothballed at this point.

      I would also love to see the rest of the Shuttle fleet "retired" to orbit as you suggest... but that refurb would have to be designed and implemented on the ground most likely and would be part of transforming them along the old Shuttle C concept with protrubances and heat shield removed.

      --
      I don't ask you to be me. I only ask you not expect me to be you.
    2. Re:My $0.02 by JohnnyCannuk · · Score: 1

      I think you have it bang on....

      Instead of apollo style capsules perhaps a new version of the Delta Clipper to act as a "tug boat" or life boat from space. Seems to me that Columbia could have been avoided had it been a "powered" reentry instead of glider. The pilots could come in slower and more in control. This is what the both the Delta Clipper and the X-33/Venture Star were meant to do. Who says you have to have One kind of orbiter? That's like telling early explorers they could only use ships like the Pinta (as opposed to Viking Longboats, Chiniese Junks or English Man o Wars)

      I hope this is a wake up call to the US Government on the dangers of underfunding the space program and of a too narrow focus because of maney.

      --
      Never by hatred has hatred been appeased, only by kindness - the Buddha
  211. NASA vs DOD research by maddogsparky · · Score: 1
    The Moon Walk was cool and all but how did it change your daily life?

    The Apollo Luner Module development was the driving force behind development of the integrated circuit. At one time, 90% of all integrated circuits in the _world_ were in its landing computers. And we all know how important integrated circuits are in our modern PCs...

    On a slightly different vein, I applied for a job after graduation with the company that is/was developing the Crusader artillary system. I asked several different people in their organization if there was any way that their work could have civilian application. The answer was always "No" and I never worked there.

    I didn't (and still don't) wan't to work for a company that _only_ provided new means of destruction--even if it was to "defend" my country. IMO, we get a higher return on money spent by NASA's than money spent by the defense department when you measure by bennefits to society (I don't count new ways of killing people as a bennefit).

    --
    science is a religion
    1. Re:NASA vs DOD research by gorilla · · Score: 1

      The integrated circuit was invented in 1958. Both Texas Instruments and and Fairchild Semiconductor were working on it, and came up with workable designs at the same time. They were working on it because it was clear to engineers that it was the future. They were sold commerically from 1960 (The SN502 solid circuit flip-flop). This is of course before Kennedy's 1961 'We will go to the moon' speech.

  212. Open Engineering Group? by chamcham · · Score: 1

    Any ideas for a not-for-profit space exploration engineering group?

    Funding and donations would go into protecting the research and making it publicly available. I'm sure there are a number of difficulties in making something like this work.

    What do you think?

  213. Why not the space elevator? by bbuda · · Score: 1

    Since the Columbia tragedy, I have also wondered which direction NASA should take with future missions. In the course of my investigation, I found this paper, commissioned by the NASA Institute for Advanced Concepts in 2000, that claims that a space elevator is not only technologically feasible, but is possible to build within the next 15-20 years at a cost of approximately $40 billion US dollars. This would be a tremendous project, but on the same scale as other large American engineering feats.
    It seems that such a promising technology, which would not only decrease launch costs by orders of magnitude but also result in many 'spin-off' technologies, would be at the top of NASA's list of research topics. However, I can find no evidence that NASA has pursued the idea since. I am not advocating that we start building a space elevator tomorrow; however, I think it would be horrible for NASA to shelve a radical but potentially remarkable invention for another 50 years. How can we encourage NASA to, at the very least, begin a second round of research to independently and skeptically study the results of the first team and put together a plan to actually build this, if possible? Or is the American space program doomed to another 50 years of risky and minimally rewarding shuttle flights?

  214. Keeping your neighbours healthy by midgley · · Score: 1
    Is not a bad idea given that their diseases spread worldwide.

    And if nobody else said so, thanks.

  215. Re:Same garbage talk as last time we lost a shuttl by SpitFU · · Score: 1

    I agree, why are so many contributors here so pesamistic when it comes to NASA's space program. I think two accidents (not deliberate I might add), out of 88 missions is a formidable statistic considering all cosmonauts and astronauts agree that space travel inherently comes with these types of dangers and risks.

    Consider what percentage of fatal accidents occur with traveling in an automobile which most people agree should be inherently safer but is apparently not.

    I hope at least that all these people that are arguing that the NASA STS program should be shut down are consistant and oppose stem cell and cloning research programs.

    --
    reassign null to be the tape device - it's so much more economical on my time as I don't have to change tapes_BOFH
  216. Re:orbit sucks, moon rocks by khallow · · Score: 2, Insightful
    Who wants orbit, its a waste, id rather push at 50K kph and get to the moon in 36hrs

    "Reach low orbit and you're halfway to anywhere in the Solar System."

    -Robert A. Heinlein

  217. Sci-Fi correction by TheConfusedOne · · Score: 1

    Instead of OT3H shouldn't it be OTGH? Let's see all of those "The Mote in God's Eye" readers chime in with the decipherment. :-D

    --
    --- I wish I could hear the soundtrack to my life. That way I'd know when to duck.
    1. Re:Sci-Fi correction by leonbrooks · · Score: 1
      Instead of OT3H shouldn't it be OTGH?

      ...but I'm not a Motie.

      --
      Got time? Spend some of it coding or testing
  218. Put me down for the space elevator. by cryptochrome · · Score: 1

    The elevator would be the cheapest and most flexible option once constructed. But more importantly, developing the elevator is really contingent on only one new technology - the material the ribbon is made of. And that can be conducted down here on the ground. Even if it fails to meet the requirements the basic materials research should still be viable and useful here on earth - like velcro, except with major industrial applications.

    Of course you shouldn't put your eggs all in one basket.

    --

    ---If you can't trust a nerd, who can you trust?

    1. Re:Put me down for the space elevator. by tmortn · · Score: 2, Insightful

      ummmm how about getting the damn ribbon long enough and getting into orbit in the first place ? We going to have a swammi play a flute to lift it ? I have tried my best to read through the space elevator proposals with an open mind but hell I just don't see it, to many practical hurldles like the one I just mentioned tend to be over looked becasue they assume by the time they solve the other problems we will have suitible enough launch ability to actually get the first one up there.

      The theory seems sound enough but I have yet to see the solutions for the practical issues regarding construction... current launch mass is limited to around 50k pounds with shuttle.... 200k pounds is the limit of most design ideas using checmical... and even thrn I doubt you could launch a 200+ mile long cable into orbit. and it seems a single strand system that long is a fundamental requirement of the theory.

      If anyone can explain better how to implement the theory I would love to hear it.

      --
      I don't ask you to be me. I only ask you not expect me to be you.
    2. Re:Put me down for the space elevator. by DuckDuckBOOM! · · Score: 1
      ummmm how about getting the damn ribbon long enough and getting into orbit in the first place ? We going to have a swammi play a flute to lift it ?
      Firstly: you don't lift the cable, you drop it. Start from synchronous orbit. Pay out the cable both toward and away from Earth, keeping the deployed masses equal so you don't drift. (The cable leading away from Earth is shorter and heavier.) Tidal forces orient the cable vertically as you deploy. Eventually you'll reach the ground. Note that, until you anchor, the tension at each end of the cable is zero - the weight of the cable below geosync is balanced by that of the cable above geosync. (The cable tension at geosync is rather insane, as an earlier poster put it.) Guide a small asteroid to the high end of the cable, and anchor it. At the same time, anchor the low end to bedrock. One orbital elevator, ready for use.

      Secondly: you don't ship the cable up from Earth, you manufacture it in place. If you're smart, you bring the raw material down from the Moon via linear accelerator. If you're really smart, you choose a carbonaceous asteroid as your anchor weight, and mine that for material as you move it into place.

      If you want a good tutorial on the practical aspects of space elevator construction, check out Arthur C. Clarke's The Fountains of Paradise. Decent read, and the depiction, given the body of knowledge in 1979, is dead on.

      --
      Life is like surrealism: if you have to have it explained to you, you can't afford it.
    3. Re:Put me down for the space elevator. by tmortn · · Score: 1

      OK when I started out reading that I remebered the Geosync part and really started boggling. I have never heard the idea of manufacutre from the other end though. Still not easy but makes a hell of alot more sense.

      That still creates some boggling big problems...

      1) capturing soemthing thats a massive enough to anchor against. I'd have to say breaking off and assembling chunks of the moon woudl be more likely than an asteroid there, we would have to be very fortunate to find just the right kind of asteroid not to mention the shear amount of power needed for the capture. Where a construction process from the moon would be breaking it up into bite size chunks so to speak.

      2) Station keeping for the mass.. IE how the hell do you keep something Geosync without it being in Geosync. If your using thrust I can't imagine it would be much less than needed to get out of the atmostphere in the fisrt place when pushing that kind of mass around. Perhaps you keep it in geosync untill you embed it in the earth and then use the tension to hold station makign the universes largest weed whacker. OH wait I get it.... the collective mass of the arangement is at geosync. Then once you have tension at both ends you can back it further out where the tension increases from the counterweight beyond geosync.

      3) the obvious manufacturing infrastructure to create the chord needed to be launched before you have a working elevator, and if the acnhor isn't suitable raw material then raw material transportation. usign current means to move something massive isn't unthinkable.... but lifting the needed prop would be hella expensive unless we find a better way to motivate things. I don't see a mili thrust ION system doing this except for mabye a belt asteroid. and we have a long way ago just to reach that far with somethign massive enough to be a propulsion system for an even more massive object.

      I have to think we have much less complicated problems to solve before really thinking about that. Probably something better than byprop rockets for starters so we can lift more up mass to begin with before thinking about capturing and or controling an anchor like this.

      Also seems to be this would be far more doable around mars.. Phobos and Demos come to mind... perhaps we could we perhaps steal one of them ? COurse it woudl really suck if the got the orbital equations screwed up and crashed a moon into earth while trying to capture an elevator anchor :-D

      --
      I don't ask you to be me. I only ask you not expect me to be you.
    4. Re:Put me down for the space elevator. by jdray · · Score: 1
      There's a couple of good explanatory posts here already, and if you're still interested, check out PERMANENT, a web site dedicated to Projects to Employ the Resources of the Moon and Asteroids Near Earth in the Near Term. |phew!| It's riddled with good ideas and tutorials on the basics of how to do a lot of stuff as far as we know.

      I, for one, think Earth's gravity well is too deep to make space elevators feasable. If I'm wrong, great, but I'm pretty sure the near term is going to be all about SSTO HLLVs.

      --
      The Spoon
      Updated 6/28/2011
  219. that's easy by g4dget · · Score: 1

    Scrap manned space exploration entirely for the next half century and use the money to build lots and lots of unmanned probes instead. For work in earth orbit, build better telepresence systems.

  220. The way to waste money oh the military by mangu · · Score: 1
    ...noone can touch you anyway if it comes to a conventional war.


    And we aim to keep it that way. The only way to stay ahead is to keep moving forward.


    Yet, when people deviate the tiniest bit from conventional war you are entirely helpless. It took a few men armed with boxcutters to take down your biggest buildings. With all your military power and those hundreds of billions of $, after a year and a half you still haven't been able to locate the people who ordered that. Your people is subjected to irrational fears and obnoxious harrassment daily. Why would the enemy fight and lose a conventional war when they can fight and win using unconventional means?


    And the real way to waste money on the military is to do it half assed.


    Wrong. The real way to waste money on the military is to give it to them. Or do you have any idea on how giving more money to the military could have averted 9/11 or help capture the Al Qaeda leadership?

    1. Re:The way to waste money oh the military by YrWrstNtmr · · Score: 1

      Avert the events of 9/11? Not possible with the environment of the day. Any open society is at risk of such terrorist actions.
      We have to be lucky every time, they only have to be lucky once.
      Any reasonably intelligent person, with a bit of time and money (and a fanatical following) can come up with a workable terrorist action. And follow it through.

      As far as 'giving them' military aid, that's a complex subject.
      Three possible benefits spring to mind.
      1. Our (common) enemy is defeated. In the case of Afghanistan in the 80's, it was Russia. We funded the 'rebels' in helping to defeat the USSR in their expansionist move.
      2. We maintain a presence in that part of the world.
      3. Hopefully, the people we fund will turn a little bit less assholish. Sadly, it did not work in this instance. They remained assholes. And even got worse.
      But if we had not aided them, we and they surely would have lost out to the USSR. The USSR would have been stronger, with a new client State. Possibly delaying or preventing their collapse in the early 90's. And that was NOT in our(the West), or their best interests.

      So...what do you do? Leave them alone to fight their own wars? (i.e. NOT help Saddam defend himself against Iran). Or assist, in the hopes that Saddam the insane will see the light, and turn into a GoodGuy(tm).

    2. Re:The way to waste money oh the military by ckaminski · · Score: 1

      You're trying to compare a terrorist act to open warfare? War is a means to an end. What is the end that the terrorists want? I don't know that. Unless the end they wanted was "Let the U.S. bomb afghanistan into oblivion. That'll show the Taliban.... But Osama, we *ARE* ze Taliban... doh!", then they got it. But what I'm guessing is that Osama & Co. are pissed off, and upset because the seat of human civilization 6000 years ago is a slave to the rest of the nations of the world, and feels that's unfair. So he wants to terrorize us back to the stone age. Well, it's not working. Except for more memorials, and plaques, and parks, and bad memories, America hasn't changed. Oh, we're in a recession, big deal. Life goes on.

      Asking our military to be a police force is the absolute worst thing we could do. We have police for that. Unfortunately, our police are only empowered to protect the homefront, not project power and make war. It's very hard to get cooperation from the people you're trying to save if you roll in with a shitload of tanks, helicopters, and painted men in green and brown carrying machine guns and hand grenades. If you think talking to a cop giving you a speeding ticket is tough, try doing it with a jumpy grunt with an M16 and no idea WTF he's doing...

      But yes, we spend too much money on defense.. :-) I think we spend too much more on social projects gone wrong, but that's just me.

      Have a day!

    3. Re:The way to waste money oh the military by Firethorn · · Score: 1

      As 9/11 happened to mostly civilian targets, it was more of an intellegence failure. Our intellegence agencies were also decimated during the Clinton administration. They missed the clues because they didn't have enough people or resources to track the leads that would have told them about what was planned.

      After the attack, when we finally figured out what happened, then the military went into action to help prevent more attacks. Think about it, how many terrorist attacks have happened recently, outside of the desert? We've taken alot of their capability away from them.

      --
      I don't read AC A human right
  221. Extensive reading? by Junks+Jerzey · · Score: 1

    In four days?

  222. Well if MS were in charge by TheConfusedOne · · Score: 1

    We wouldn't have to worry about rocket ships ruining the nice blue sky. :-D

    --
    --- I wish I could hear the soundtrack to my life. That way I'd know when to duck.
  223. The Challenger disaster has the same roots by alispguru · · Score: 1
    The Challenger blew up:

    because the O-rings in its solid-fuel boosters leaked

    because the boosters are made in two pieces

    because the boosters have to be transported by rail and barge

    because the boosters are manufactured in Utah

    because the money to run the Shuttle has to be sprinkled across as many Congressional districts as possible (see here and here, especially the list of subcontractors at the bottom of the second one).

    Before Challenger, the Air Force was planning to have a Shuttle fleet of its own, operating out of Vandenberg AFB. The Air Force Shuttle's boosters were going to be made all in one piece, on site, and would have been stronger and lighter than the reusable Shuttle SRBs, allowing more payload to orbit. They wouldn't have been reusable, but I doubt they would have been a lot more expensive when you factor in the costs of recycling SRBs (recovery, transport to and from Utah and refurbishing).

    As usual, when you show Congress an engineering versus safety decision, it will choose the option that spends the most money in the most districts.

    --

    To a Lisp hacker, XML is S-expressions in drag.
  224. Re:How does this crap get moderated up? by gorilla · · Score: 1

    And all together, they cost less than a single shuttle launch. If you look at it that way, and compare the typical success/failure ratio of the individual submissions on a shuttle mission, then it doesn't look so bad.

  225. moon me by bobba22 · · Score: 1

    For god's sake. We have to set up a moon base, with a semi-permanent population, much like the Antarctic. There would be just enough gravity to make life bearable yet not a significant gravity well for take-off. A unit set up on either pole would have good sunlight for energy and clear line comms with earth. We could learn a vast amount there for future colonists to take to Mars etc. Junk that stupid space station!

  226. $3 billion has been spent on FAILED Mars missions! by apsmith · · Score: 1
    Unmanned and robotic spacecraft are far from inexpensive. In fact, the manned spaceflight portion of NASA's budget has been less than half the total for quite some time now - see this fact sheet for more information.


    I know the general public finds thrills in both robotic and human missions; the real problem has been the ultra-cautious and pork-laced patterns in which NASA has been forced to play by congress for the last few decades.

    --

    Energy: time to change the picture.

  227. Elevators, funding by mwood · · Score: 1

    I think it'll be a long time before we can film Clarke's _The Fountains of Paradise_ entirely on location. Even if we have lab. samples of the materials, there's a whole lot of engineering to do. We already know how to build a shuttle, and after two decades we probably know how to do it a lot better, either from scratch or by evolving the existing design.

    As for voluntary contributions to support NASA, why bother with tax checkoffs? Just send them money. Maybe gather a few volunteers and set up a foundation to aggregate contributions and send a few large checks instead of a zillion small ones. It would be an interesting way to find out how much value people really place on space exploration and exploitation.

  228. Buran by ckaminski · · Score: 1

    Personally, I think the Russians had it right with Buran. Decouple the launch mechanism from the orbiter. Putting the SSME's in the shuttle increases vehicle complexity, and makes development of a replacement launcher prohibitively expensive. Could we have rebuilt the Shuttle launcher around an Atlas V rocket stack? Or revive Energiya or something like it?

    1. Re:Buran by mpe · · Score: 1

      Personally, I think the Russians had it right with Buran. Decouple the launch mechanism from the orbiter. Putting the SSME's in the shuttle increases vehicle complexity, and makes development of a replacement launcher prohibitively expensive.

      The Russian approach also means that you have a heavy lift vehicle which can launch other kinds of payloads.

    2. Re:Buran by zurab · · Score: 1

      The Russian approach also means that you have a heavy lift vehicle which can launch other kinds of payloads.

      Which was done with Energiya; I believe it put a heavy Soviet military satellite into orbit. Russians proposed using Energiya for ISS but NASA scratched the idea. Maybe that was a mistake.

  229. What we are missing is Leadership by joebok · · Score: 1

    The problem is that we have no vigourous leadership, no vision of where we ought to go or what we ought to do. Apollo succeeded not only because of cold-war pressures, but because there was a goal and a deadline.

    We need a national or world leader to step in and challenge us to achieve the impossible.

  230. Not Mars, not the Moon, way out by dpille · · Score: 1

    I know this is way at the end of the discussion, but it doesn't look like anyone's saying it. To my mind, the problem with re-engaging human exploration of the solar system is that it all needs to be done a little bit at a time: we can't just say "build the Mars transit vehicle, here's the money" and expect it to be done directly.

    I think a case can be made that the most interesting activities of the current space program are the Hubble space telescope, followed by the Voyager missions. And when I think that they launched the Voyager craft 30 years ago, with only planetary objectives, I just feel lucky that they're out there.

    So what I think should be done is to re-fund something along the lines of the Pluto Kuiper Express mission, but equip the craft for some serious extra-solar science. And an energy source and transmission capabilities appropriate for a very long distance/time. Shoot, screw Pluto, maybe just send it out of here as fast and direct as possible.

    Honestly, I want to send something up that makes my son say in 2040, gee, dad, I'm so happy your generation decided to launch that, we're getting such cool data and it's so far away...

  231. where? by OwlofCreamCheese · · Score: 1

    where should space exploration go? SPACE! duh!

    --
    -You're wasting your time. Alfador only likes me.
  232. NASA needs clear goals! by apsmith · · Score: 1
    And goals which are supported by Congress and the people of the US. One such plan was attempted in the house last year: The Space Exploration Act of 2002. A similar vision of our future in the solar system was presented in the recent report of the presidential commision on the future of the US aerospace industry. NASA's own proposals include a NExT team project starting with a lunar L-1 point base and lunar surface base.


    So what has happened to all these great ideas? Stifled (so far) for lack of public support! Write your senators and representatives - tell them you believe NASA needs a clear new mission! It doesn't require much or any increased funding - it just needs to get NASA up out of the pork-barrel mire it's been stuck in by Congress for the past 30 years!

    --

    Energy: time to change the picture.

  233. Amen, brother. by DuckDodgers · · Score: 1

    My father-in-law used to work for Lockheed Martin, a major government contractor. The company competes in the free market only in theory. It's fat from government subsidies, and he's got dozens of stories of wasting millions of dollars like water.

    This is exactly what we don't need. The plant where he worked switched locations (constructed entirely new buildings) 3 times in ten years. If my employer tried to do that, we'd be out of business in an eyeblink - and we have record profit.

  234. One word: Robotics by jvlb · · Score: 1

    The cost, both financial and human, of keeping people alive in space is too high. NASA should work on the technology, but improve it substantially before using public monies to keep even a few individuals alive in space, spending most of their time idle, sick, or both. Robotics have long offered an underfunded alternative to Buck Rogers. Lighter in weight and not requiring life support, robots can do more to bring the space experience home to the public, by providing superior visual and environmental data. It is simply not a responsible use of the technology at our disposal to proceed with the status quo. We must soberly face the limitations of that technology and embrace its strengths. Robotics.

  235. Manned Space Experience _IS_ Necessary by Teancum · · Score: 1
    The attitude of people who make this argument is so totally absurd that I don't even know where to begin. This is such an elitist short sighted viewpoint that I'm willing to throwaway karma here to get into a flame war over this whole concept.

    Why is it short sighted to do only robotic exploration?

    I'll try to list some reasons below:

    • Space is BIG - I can't do a better job of it than Douglas Adams, but I'll try to paraphrase in my own words in a pathetic attempt to say what that grand master said. Space is so huge that if the entire solar system could be compared to a grain of sand, the milky way galaxy alone could be compared to the entire Pacific Ocean. It is huge. And the only way we will really appreciate what is happening it to get out there and explore it for ourselves.
    • Robots don't vote - By this I mean that astronauts have built-in constituancy just by being there. A robot doesn't. Yeah, the people around the Jet Propulsion Lab might get a little upset if Congress would cut funding for robotic missions, but not much else. However, when an astronaut goes up, people who don't otherwise have any connection to NASA can identify with the person who "went up there". One of the smartest moves by NASA was to send up Senator Jake Garn, who together with John Glenn showed that becoming a United States Senator is one of the easiest ways to become an astronaut. And that is one vote that really counts where it is needed...the appropriations comittee.
    • Earth is doomed - There are a number of ways to put this, but in general staying around on this little rock is a sure way to make sure that mankind is going to be destroyed eventually. Cataclysmic events to happen, and one of the problems right now is that a small number of people can litterally destroy all advanced forms of life on this world of ours. This is putting all of our eggs in one basket. Not to mention that keeping people on this planet will only add to the pollution of this world, and stunt any future progress, no matter what way you describe progress.
    • Limited Fontiers - To restrict to only machines to explore space is to forever limit what frontiers we are actually going to visit. We will only be able to get information back as can communicate from the great distances that our probes can send it.
    • Limited Imagination - This goes together with the previous point, that robots lack imagination. On the Apollo 17 flight, Harrison Schmidt was walking around and had something catch his eye at the last moment when he was farthest from the Lunar lander. He picked it up and threw it into a bag because he didn't have enough time to really study it. That rock turned out to be one of the best geological (or should I say lunilogical) finds ever done by all of the Apollo missions. Experiments such as "How far does a golf ball fly on the moon?" or "How does a feather fall when next to a hammer?" would never be proposed in a serious robotic mission. We need to send people there who can get the feel of the environment and respond to it with human feeling, imagination, and mistakes. Yes mistakes.
    • New Ideas from a Fresh Perspective - just as America has introduced many new ideas into Eurpoe simply by having people live in America and sharing them with the rest of the world, I believe that having people living on the Moon and Mars will introduce many wonderful ideas simply by having to live in a different environment and face different challenges. Having all of the ideas for space exploration to come from the JPL is eventually going to run out of steam.


    There is so much more, but I think this is a good start to a whole bunch of arguments that need to be made regarding a robotic-only push.

    Don't get me wrong, I think that robotic missions are useful, and to use robots as scouts for eventual human exploration are going to a permanent part of space exploration, and have been from the beginning with Sputnik.

    However, I want to be able to give my children and (future) grandchildren the opportunity to live and work in space, and I genuinely want to see some of my posterity to even be born somewhere that does not have an address on this Earth. When children are born on the moon and refuse to go back to the Earth (you mean that disgusting polluted place where you feel so heavy), I will feel that the dream of having people spread out among the start will be fulfilled. I'll take that frontier with my kids and spread out, and you can keep the Earth. Just don't go crying to me or my kids if the Earth gets destroyed.
    1. Re:Manned Space Experience _IS_ Necessary by marebri · · Score: 1

      You seem to have misunderstood me a little. If you carefully read my original post, you will see that I am NOT, in principle, opposed to manned space exploration. Now I will address a few of your points: Space is BIG: Yes. Very big. Which means to explore you have got to travel unbelievable distances. Thats why we use telescopes. To do anything that the telescopes cannot do at this time (w/regard to the distance objects in this vast space) would require enourmous time, expense and technology and an understanding of science vastly superior to what we have now! Robots don't vote: Of course they don't! By putting this point here, you are assuming that U and I are in agreement that we should continue to allocate scarce resources to (manned and otherwise) space exploration. Say this to somebody who agrees with you in a discussion about how to dupe American and other populations into paying a huge amount of money for these hyped up missions! Earth is Doomed: Certainly. But if you think the earthly environment is getting harsh, try any other planet (even Mars). In fact, this is an often heard and rather dubious argument. Look: Even a completely dead earth will NOT be any harsher than, say, Mars! Limited frontiers: Yes. Very limited I assure you. Thats why aliens (who presumably are a million years ahead of us in understanding of the universe) have not visited as yet!! Limited Imagination: This point, I think is quite correct. Eventually we would like to do it ourselves. But my point is lets study matters from here and wait for better and safer technology and, crucially, for a time when we can actually afford it. Consider that humans invented rocket power a few thousand years ago. That, together with Newton's theories is, in principle, sufficient to give you an escape velocity from earth. But we waited for the computer and other electronic advances that make it feasible and safer and cheaper.

  236. Space Plane Question / Russian Heat Shield? by sampson7 · · Score: 1

    Okay, contrary to many here, I am not a rocket scientist. I am a lawyer, which means the last time I had physics was ... well, far too long ago. But watching the space shuttles was one of the great thrills of my life, so I try to read and understand and spread the gospel.

    Why not take a plane and just fly it really high?

    I'm not trying to be flip here -- take something like a cargo jet and use conventional technology to get off the ground. One in flight at 40k-60k feet, it seems like it would require far less thrust to acheive orbit. As I understand it, both gravity and friction would be dramatically reduced at that point.

    Obviously, the details are where it's at -- but is this even a sound theory? I'm guessing that fuel weight would be the biggest problem?

    The ironic thing of course, is that the shuttle still has to come down, no matter how we get it up there. And of course, the fundamental technology underlying Columbia's mission is well tested -- it seems to have been an accident in the true sense of the word and not a design flaw that brought her down. If the tiles really are to blame, then any future space vehicle is likely to have similar problems. So this brings me to my second question -- do we know what the Russians did to get around this?

    1. Re:Space Plane Question / Russian Heat Shield? by joskay · · Score: 1

      >Why not take a plane and just fly it really high?
      Several people are considering it. Here is one that is using a ballon to try it.
      http://www.xprize.org/teams/ilat.html
      There are other designs out there.
      > do we know what the Russians did to get around this?
      If I understand the question, most heat shields were designed for a single use. The shape of the craft also dictates some of how it can be attached and formed.

  237. Private Biospheres by Sloppy · · Score: 2, Insightful
    That sounds like a request for everyone's half-assed option. I've got two ass halves, so I'll chime in...

    First, fix the funding issue: cancel all government funding, except perhaps for military applications. Most of it should be done privately.

    That doesn't necessarily mean it needs to be all commercial and profit-generating. There's no reason philanthropists and "regular people" like you and me can't make voluntary donations like we do for PBS, etc. Money is already being taken out of your pocket, whether you like it or not, and being spent in a manner that you don't have any control over. That is the primary thing that needs to change. If someone else has a plan that you think is better or more valuable than what NASA does, then you should be able to send your money there instead of to NASA.

    I'm sure NASA is full of a lot of bright people, and if they were spun off and had to be accountable, those people would still be able to attract a lot of interest.

    As for where I would put my money, if I had a choice: Biosphere type stuff. It is ludicrous to even think about permanent lunar bases or trips to Mars, right now. Show me you can live in a closed system, and then I'll maybe believe that you can handle space. Show me you can live in Antarctica without periodic supply drops. This kind of practical research is dirt cheap and low-risk, compared to anything involving a spaceship. I don't even want to hear about long manned missions until these techniques are proven.

    Until we have the capability to have people up there long-term, I am sceptical that there is much value in having people up there at all. I can see a case for some medical research (e.g. what happens to a person who lives in low-grav for a long time), but that's about it. The "science" that the shuttle currently does can be done cheaper on spaceships that don't need to worry about life-support. More importantly, it needs to be not a huge paralyzing catastrophe when some sort of technical problem causes a spaceship to be lost. The fact that some people are even considering dropping the shuttle, shows what is wrong with it. If space exploration is going to happen, then spaceships are going to keep blowing up; we need this to not be a big deal.

    --
    As copyright owner of this comment, I authorize everyone to defeat any technological measure which limits access to it.
    1. Re:Private Biospheres by tmortn · · Score: 2, Informative

      The moon may well require a closed loop system but mars does not. There is water on mars and there is an atmosphere on mars ( largely C02 ) and the two combined with a source of power can be used to maintain living conditions. Go dig around and find info explaining the whole Mars Direct Concept. I would provide some but I find most people are more convinced if they take the time to find their own sources. Guy named Zurbin and 'mars direct' used as key words should give a good start.

      Privitization is not a real option yet, though I agree NASA's organization needs to be better. Mostly I think they need to be seperated from the political process which surrounds the budget. NASA and its contractors spend so much time fighting for its budget money its impossible to focus on operations. Its like having to wory every year if your salary is going to be different. It makes it extrodinarily dificult to make any long term plans. NASA needs a stable budget that it does not have to worry constanly about. The larger the goals we want met the longer term the budget consistency needs to be. Not that there dosn't need to be some oversight but there are programs which start off knowing they are multi year ventures but they are asked to justify their expense EVERY YEAR... and experimental technology exploration does not lend itself well to to the budget justification processes so any program that meets with any difficulty especially early in its process is in danger of being cut. This leads to very very very short term near sighted goals. It also makes people very conservative in what they are willing to risk.

      --
      I don't ask you to be me. I only ask you not expect me to be you.
  238. It seems to me .... by Vel0ur1a · · Score: 1

    The US military budget is way over-bloated.

    That said, wouldn't it make sense for the Defense Department and NASA to work together on building efficient and reliable space vehicles? I'm sure there is some collaboration between NASA and branches of the military (used to work for NASA, so I know at least they share military bases and the personell work well together) -- they may not have a common goal, but they share common technological needs. R&D results from the military would probably (and maybe already do, not sure) benefit NASA, and vice-versa.

    I guess what I'm saying is -- we all know the military budget is not going to be reduced in favor of the Space Program (or any other program, for that matter). Why not share information between agencies, so at least some of the benefits (whatever those may be) we get from spending billions and billions of dollars on a massive and bloated military are extended to others who could also use the information/technology/whatever.

    Wait, would this be an open source gov't??

    And, also, I would absolutely be o.k. with a checkbox on my tax form to give money to NASA -- instead of my current option to give to the Demoplican party.

  239. Re:Why not use massive stationary balloons as.... by YrWrstNtmr · · Score: 1

    Hey, Abdul...whaddya think? Is that a big fat easy target, or WHAT?

  240. Re:How does this crap get moderated up? by dWhisper · · Score: 1

    True, but the cost of a shuttle mission is directly related to the people involved in them. Manned missions are a much greater stake.

    Don't get me wrong, I love almost everything NASA does. I followed Gallileo from launch day and have been keeping tabs on Cassini. The Voyager, Pioneer, and Viking missions were things that I loved, but the manned missions are what embody the spirit of NASA.

    And as for success failure, the cost is lower, but it gets a little harder. 113 Shuttle missions and two accidents, that's much higher than the success/failure of the un-manned launches. But I'd believe that everyone involved in one of those unmanned successes would gladly watch it fail if there would be no more accidents like Columbia.

  241. Re:How does this crap get moderated up? by gorilla · · Score: 1
    Manned missions are a much greater stake.

    So only do manned missions on those which justify it. And 'how do spiders spin webs in space' don't justify it.

  242. Re:This isn't meant to offend so read it open mind by felonious · · Score: 1

    It's funny that I wrote this from a realistic point of view and it's viewed as flamebait by a mod. I even stated that it wasn't writtent o offend. Those who cannot accept the truth need a serious dose of reality.

    --
    You aren't free to do anything, until you've lost everything.
  243. Track Record? by gandy909 · · Score: 1

    Sure, it is a relatively horrible track record to be sure, but if you look at the entire history of US space flight thus far, it seems to be getting better...maybe?

    28 Mercury, Gemini, and Apollo missions: 1.5 disasters: 5.3% disaster rate
    113 Shuttle missions: 2 disasters: 1.7% disaster rate

    Even 1.5% is far to great a disaster rate, but history usually shows great improvements precisely because of the things learned from disasters. Considering that in the Shuttle alone we had 24 flights followed by a disaster. Then we learned about and fixed the problem and had 88 more successful flights in a row before the Columbia disaster. And let's not forget that no one knows at this point what caused it. Possibilities still include things like being struck by a small meteor or other space derbis during the reentry itself...

    --

    (Stolen sig) Remember: it's a "Microsoft virus", not an "email virus", a "Microsoft worm", not a "computer worm
    1. Re:Track Record? by IrvineHosting · · Score: 1

      Why does space flight have to be safe?

      These are explorers braving the new frontier.

      Why must we ensure that 100% of the risk is taken away?
      br> I would like to see a manned flight to one of Saturn's moons. With technology today we should have no problem doing it. But let's just tell the astronauts up front that they are going to die. Tell the public they are going to die as well to prepare them. You will still get hundreds of people willing to sacrifice their life for this journey, no doubt. And the public will love the story and watch every second of their flight with held breath. And if the astronauts should make it back by some chance miracle, they will truly be heroes.

      Any volunteers?

    2. Re:Track Record? by Shadowrose · · Score: 1

      It doesn't have to be safe, but it helps for it to be profitable. The USA is a Capitalistic Country, Capitalism means Profit. If it's bad for business, it probably won't happen. Now, in order to make Space Travel profitable, we need it to be safe.

      As for the explorers, look at those who first traveled to North America. Was the safety of their ships in question? Did they often have unexplained ships that broke apart, as they returned to port? We need to take the risk before we start making it profitable. If you want to pursue space travel in the United States, you'll have to make it profitable.

      A Manned Flight to one of Saturn's Moons right now, Isn't overtly feasible. All of the technologies for advanced space travel are thoroughly untested, let's figure out how to use the one we've got first, eh? Now, look at the Apollo Missions. We got to the Moon. Sure, not a big achievement, but go stand by a Saturn V rocket. It'll make you feel small. With the current technology, to get to Saturn's Moons, we'd need a substantially larger Rocket. Personally, I would like to see more efforts out of other countries. China, France, Russia, they all have space programs, I'd love to see them go to the moon, or support some private business.
      --Dante

    3. Re:Track Record? by blitziod · · Score: 1

      I volunteer Lance Bass!

      --
      The only way to bust a doper--is when you yourself become a smoker!
  244. Llinear Motor Catapault by drbart · · Score: 1

    Here's another old sci-fi idea that I haven't seen mentioned recently.

    Basically, the notion is to build a long Mach N (2 < N < 6) linear motor along the slope of a mountain to give a smallish space plane a running start.

    The benefits are twofold: 1) external propulsion to take a couple steps outside the weight-fuel-weight vicious circle, and 2) release at 8000 ft or so to reduce somewhat the energy required to pass through the atmosphere.

    I don't know how big a deal (2) is in the grander scheme of getting into LEO. The bigger deal by far is to stop having to build rockets that are so huge because of the small margin chemical reaction energy has over the gravity well we live in.

    Fireball XL5 here we come!

  245. Safety is Expensive by Interrobang · · Score: 1

    Ok, so far we're talking about either Charles Perrow-type normal accidents here, or we're trying to build a high reliability system and failing. However, since large, catastrophic events in unusual areas (such as space travel) draw a lot of attention, public risk perception may be higher than the actual risk. I don't know. Personally, even a catastrophic 2% "normal accident" rate is too high for my taste when it comes to space travel.

    Unfortunately, as everyone who works in occupational health and safety (as I do) knows, good safety practice is expensive, and requires a lot of good safety theory and research behind it, which is also expensive. NASA has a history of having funding taken away from it, and according to recent press statements, NASA has been having trouble (of one variety or other) retaining safety personnel.

    The upshot is, of course, that unless anyone doing space is willing to pay the extraordinary overhead costs of space safety, people, both on the ground and in the air, are going to keep dying.

  246. Re:"It's neat." by Sacarino · · Score: 1

    heh. I like this part:

    Did Hubble require a Shuttle for delivery?

    Maybe not so much for the delivery, but it sure as hell did for the up2date rpm so it could see straight. ;)

    --
    -- El Sacarino tiene gusto de la chocha
  247. Things to Do by hackus · · Score: 1

    1) Get rid of those damn rockets.

    Rockets = suck for space transportation.

    No, in fact let me go one step further and say rockets = Newtons 1st law of gravity = sucks for space transportation.

    There is a better way.

    Invest money into understanding the nature of gravity and over come the basic force using Geometrodynamic theory.

    in 1000 years, at current budget levels we could do that...

    Rockets suck.

    2) Increase the budget, by 1000 times, and get #1 solved in about 10-20 years.

    No more riding very large chemical bombs into outer space.

    We would overcome gravity using variation on magnetic and or gravitational (gravitons) propulsion.

    Not only that, but with this propulsion system, the entire solar system would be open to us, ready to pull large asteroids into areas for mining, expand to Mars or the Moon.

    How about going to Mars in 60 days, max, regardless of having to wait for it to be in some dumb special orbit like we do with chemical or atomic rockets.

    How about lifting huge materials into low earth orbit in a practical manner? Right now it isn't practical.

    How about reentering the earths atmosphere without having to turn the space craft into a fireball?

    All can be done with a new drive system that doesn't use rockets, but uses gravity/eletricity.

    Rockets suck.

    3) Finally how about a system that practically allows civilians and old or young to get into space, even if you have a life threatening illness?

    Right now you have to be very fit to get into space and pull the G's required for liftoff.

    How about letting the very old or the young, or just plain sick people into space?

    Perhaps even treating thier disease form there?

    Rockets suck.

    -hack

    --
    Got Geometrodynamics? Awe, too hard to figure out? Too bad.
  248. What planet do you live on? by FallLine · · Score: 1
    More specifically, Congress should instruct NASA to expose all its science programs to the normal process of peer review used to make funding decisions in the sciences. Congress should then abide by those decisions. This would have the effect of eliminating the manned space program, which has a ridiculously low ratio of scientific results to funding. Unmanned probes are the real workhorses of space science and planetary exploration.

    That's just science, of course. NASA shouldn't even be involved in commercial stuff, which can be handled more efficiently by private enterprise than by a government agency.
    Peer review is not the answer for christs sake. Peer review might work for exposing flaws in a particular scientific study or debunk its conclusions, but it does NOT engineer and it cannot do cost effective cost vs benefit analysis. About all it can tell you, in essense, is whether something is true or false. What NASA is doing does really not lend itself to this sort of scrutiny.

    Do you really want to tell me that this fabled peer review process has delivered us highly efficient research in academia? Well there exists no such process for the actual studies themselves, only for the results, but even the results themselves have problems. MOST academic research is unproductive, wasteful, and even stupid. What are you comparing NASA's supposed wastefulness to? NASAs mission does not lend itself to peer review. Sicking a bunch of academics at a problem, who have no practical experience building machines that really work, who have not even studied space travel, rocketry, or whatever is just plain stupid. NASA has expertise today that practically no one else has. Yes, NASA has to cater, to some extend, to the whims of voters, tax payers, and politicians and that creates some problems, but that is nothing in comparison to engineering and scientific study by committee.

    Furthermore, I think you're being a bit too dismissive of the commercial angle. I'm normally very pro-privatization, but this is just not an area that is practical just yet to privatize. There are certain fixed costs and risks that only a government agency can incur, that industry cannot. Yet industry, as a group, can serve a function for NASA in helping to deflect some of the costs. Strapping sattelites to rockets may be the most cost effective method if your sole objective is to haul stuff into orbit, but that does not mean that it is cheaper on the aggregate if you assume greater goals for NASA (e.g., manned space flight, safe landings w/ humans, and the ultimate objective of regular and cost effective space flight). Rockets offer no such path.
  249. Corporations to save the day (at least initially) by Scott · · Score: 1

    I dispise the garbage which goes on just outside of public view in corporations, and the consolidation and crushing of creativity they inevitably lead to, but I think they will be the driving factor in space as time goes on. It's certainly not an original idea and is slowly starting to happen (see shooting average people into space for cash). Only they can make it affordable and cost effective though.

    Whereas the US Government will tack on all kinds of crap and forces the taxpayer to pony up for it whether they like it or not, corps have to answer to money hungry shareholders who will demand it be cheap and fast and cost efficient. It's basically a trade between paying for pork to being subjected to more advertising and corporate greed, but at least you can ignore advertising.

  250. Carbon fuel tanks by chamcham · · Score: 1

    I agree, the X-33 was our best hope for a shuttle replacement in the near future. Advanced composites like carbon fiber offer incredible strength-to-weight ratios. The only problem with thermoplastic carbon fiber is that it would very expensive to create a manufacturing process for such large tanks.

    Another approach could possibly be making a number of smaller fuel tanks that can fit tightly together. The smaller tanks will not require the same wall thickness as the large tanks, but would still be a reall pain in the butt to mold with a resin treated carbon or aramid fiber.

    I'm no where near an expert on materials processing, but thats my $0.02 :)

  251. Mitsubishi robots in space by chamcham · · Score: 1

    put those mitsubishi robots in space, then if the oxygen supply runs out it won't matter.

  252. Exploration can't be capped by leprasmurf · · Score: 1

    Its in our nature to want to go farther, its in the government's nature to try to get there first, but to spend as little money as possible. I'd also like to say that I think if the government had even the slightest idea that the shuttle would explode, they would have spent whatever was necessary to prevent it. As for the design of the space shuttle's, I think NASA should combine with some corporations with mass advertising experience (AOL, Microsoft, Disney, etc.). Not only could that rack in support on the whole financial end, but it would also get more people involved in something that should effect all of humanity.

    The astronauts, though tragic, knew what they were getting into, and given the opportunity, I would go up right now. Sorry to sound like an after school special, or whatnot, but if we stop now, would we be doing them justice? Ok, the first Israeli astronaut was on the flight, well lets send up the second and the third, we should carry on, learning what we can from the mistakes made.

    As for commercializing the space program, I say definitely. It will lead to more research done on space travel, it will lead to more funding, and greater frontiers. One thread I've read said something about if planes had the same accident ratio as did space flights (approx. 2 out of 113) we would lose tens or hundreds of planes a day, but think of when air flight was still in its infancy. Shoot, all together air flight is less risky, because you can test it lower to the ground. Commercialization could lead to the creation of self-contained ejection modules designed for either space or atmospheric conditions (ie an hour of oxygen, with a parachute module, and minimal thrusters). You know the Jetson's are starting to look like a good idea right about now :-D

    --
    "And The Geek Shall Inherit The Earth" --Jeff Darlington
  253. Buran works, RPVs don't by perfessor+multigeek · · Score: 1

    Yeah, funny about that. I've wondered about the same thing. Frankly, while it seems odd to me that the makers of the various unmanned craft say they haven't figured out how to automate landing when Buran pulled it off, all that I can conclude is that a.) Buran did it in "demo mode", working vehicle don't get such controlled conditions, b.) Buran is bigger and more stable somehow, c.) an awful lot of different projects have agreed on the "robotics need work" conclusion, and d.) the Russians have lied before. So for now I'm going with "still needs work".

    Rustin

    --
    Data is the lever, rigor the fulcrum, brains the force that drives it all.
  254. Cheap to test? by AntonyBartlett · · Score: 1
    It occurs to me that re-entry technology along these lines, might be relatively cheap to test (in the first instance, anyway), as the experiments could be dropped from high-altitude balloons, rather than orbit... or maybe 100,000ft just isn't high enough.

    "We are aiming to reach the edge of space in an attempt to break the world record for the highest manned balloon flight"

    1. Re:Cheap to test? by Twirlip+of+the+Mists · · Score: 1

      The current record for highest-altitude free-fall skydive was set back in the 60's by Joe Kittinger. He rode a balloon up to something over 100,000 feet and stepped out.

      Let us take a moment to contemplate the balls required to do such a thing.

      If I remember correctly-- I'm too lazy to google it at the moment-- Kittinger fell at terminal velocity, which means he was going as fast as a human being could go in the atmosphere. Skydiving from an even higher altitude probably wouldn't be that big a deal. Kittinger was already wearing a pressure suit, and since he reached terminal velocity, the only difference between his 100,000-foot skydive and a 200,000-foot skydive would be the duration of the free-fall.

      The big deal with orbital skydiving, if I can call it that, would be shedding one's orbital velocity. You're going to be doing about 17,000 miles an hour when you hit the upper atmosphere. Kittinger's velocity when he bailed out of his balloon was zero, more or less, so he didn't have any friction-heating problems to worry about. The same would be true of any other skydiver who jumped from a balloon or other (relatively) stable platform.

      But when you hit air at 17,000 miles an hour, friction heating is very much a problem. So you'd have to deal with (1) your excess velocity, and (2) the heat generated as a side-effect of dealing with your excess velocity. Once you slow down to something less than the speed of sound, it would probably be safe to pop the explosive bolts and skydive. Maybe. I guess.

      --

      I write in my journal
  255. Xenon's thoughts by XenonOfArcticus · · Score: 1

    Oddly enough, I have an opinion on this.

    First, to understand where I'm coming from, you should peruse my report and video on the DC-X project, currently graciously hosted by John Carmack's Armadillo Aerospace site.

    The Aerospace industry has collapsed, leaned down, merged and consolidated since the end of the cold war. We now have Boeing, Lockheed-Martin, and a few small fish. All the big fish merged together into these two big fish.

    NASA has proven that it is a Government agency in the classic sense of the word, and does not have the proper motivations to perform its tasks quickly and efficiently. No offense to anyone at NASA. Most everyone I know there understands this as well as I do. Government agencies, and their funding and operations process are generally not conducive to fast efficient development. In addition, NASA has to live in fear of budget and political cuts from year to year. This is not conducive to good planning and development.

    The Space Shuttle is still the most complex machine ever built by mankind. It is large, powerful, flexible and high-maintenance. We use the shuttle for a lot of missions that it is overkill for. We need a wider variety of launch vehicles that can take off some of the load of the shuttle. At a current catastrophic failure rate of 1.7% (2 failures in 113 launches), we need to reserve shuttle capability for only those missions that really require its capabilities. For most launches we should be relying on Atlas, Arianne, Proton or Pegasus (or the like) vehicles, and developing additional non-shuttle launch vehicles to assume any possible additional roles the shuttle currently can deliver that other existing systems cannot. Very promising systems such as DC-X and Roton have floundered when we most need them. Either one of these systems could have most likely been finished and flying using the budget NASA allocated to the failed and now cancelled VentureStar project.

    For the most part, a lot of the ISS missions could probably be fulfilled by these less complex systems. Missions such as the Hubble servicing missions are what the shuttle was designed for. We should be able to use the ISS to its full manned capacity -- doing so would reduce the need for the shuttle itself to carry research missions up just to let them float around in zero-G space. This is what the ISS was built for. We aren't using it to full capability because we can't man it to capacity. We can't man it to capacity because it currently only has a 3-person escape vehicle, therefore only three staff can remain on ISS when the shuttle leaves. We only have a 3-person Soyuz escape craft because the development project for the ISS escape pod vehicle was cancelled by NASA due to technological problems and cost overruns.

    The private sector seems to have a better record at taking risks in R&D, especially space R&D. This is rocket science, but it's now a science, not voodoo. We have companies capable of designing, building, testing and flying safe reliable launch vehicles. The reason they're failing is NASA. NASA holds the keys to space -- they determine who is certified to launch using criteria known to no-one but NASA. NASA has no motivation to endorse private-sector solutions -- these are seen as detrimental to NASA and of course will not be ruled in favor of.

    Now, some research in space will only be possible with government support and funding. I believe NASA's role should shift from being a research/development and logistics operation, to a mostly research operation, leaving development and operations logistics more to the private sector, who will bid competitively to build and launch vehicles and research/craft and systems for NASA. NASA already has many of their systems built by subcontractors. They need to shed the day-to-day operations and drudgery of space launch and focus on the real research.

    The one-of-a-kind facilities that NASA already owns/operates (Deep Space Network, launch sites, Mission Control) should be leased to a private contractor to operate. NASA (and others!) can then lease time, space and delivered capability from this contractor, with a contractual guarantee of a desired level of quality, reliability and availability. This should be done at market cost, no subsidies or discounts. Level the playing field. If then, another supplier can provide the desired level of quality, etc to a customer (NASA or otherwise), then the customer can seek out the supplier of the proper level of cost/benefit required for each individual mission. Not all missions require the massive support infrastructure of Kennedy Space Center and Mission Control. Even today a lot of missions are not launched from Kennedy -- we need to expand this. Outsource launches to Baikonaur, or to SeaLaunch or Pegasus if practical.

    The last thing we should do is build another shuttle to replace Columbia. It will be over-budget, delayed and just as complex and risky as today's shuttles. We need to allow private ventures to flourish, and ensure they have a fair competitive stake in future space business. Only then will we be able to start bringing the cost per pound of orbital launch down to levels that actually encourage new research and commercialization of space, yes, even Tourism. Space travel need not be Rocket Science anymore.

    --
    -- There is no truth. There is only Perception. To Percieve is to Exist.
  256. "NASA is the only agency that lies." by stonewolf · · Score: 1

    "NASA is the only agency that lies" that is a direct quotation from one of the many reports on the Challenger disaster. Now they have lost Columbia, and they still lie. They lied about what the shuttle could do and they lied about what it would cost. They even lied about how long it would take to build it. Since they built the shuttles they have lied about every new spacecraft project they have started. They gave specific costs and capability estimates for everyone and then failed to deliver EACH AND EVERY ONE OF THEM. And they used their lies to destroy every commercial attempt to build a competing system.

    In the '60 when IBM took actions like that back in destroy their competition they were sued for antitrust violations and forced to change their behavior. But, NASA is a government agency that is hugely popular, even though it has wasted 100 of billions of dollars and lied about the waste.

    When the US federal government wanted to help develop the aviation industry in the US they did two things. They create NACA, the forerunner of NASA to do research that private companies couldn't afford to do. The research was in part guided by the companies and the results of the research were made available to all companies equally. They also started offering competitive contracts to deliver mail by air. So, they created a way to research aeronautical problems so we could build better aircraft and they created an economic motivation for developing better and better aircraft. They did NOT develop their own air transport system. They build experimental planes, never production aircraft.

    NASA was supposed to do research, they do some, but mostly they have built and jealously guard, a space transport monopoly. They actively work to create an economic disincentive to private space craft development. And, they guide their own research. They no long take guidance from industry on the problems that need to be solved because they have destroyed the industry they were meant to serve.

    If we want space travel the first thing to do is shut down NASA now. Or, at least get them out of the business of building and operating a space transport system. I tell you this, they will use this disaster to try to take back the partial privatization that has already occurred. That must be stopped.

    After NASA is out of the business then go back to using private companies to build and operate space ships. Put out a set of specs and let companies compete to meet the specs. You want a safe reliable way to get to and from the space station? Offer a transport contract and buy from whomever can fill the contract. The price will drop and the reliability will improve.

    The X-prize is another model to follow. It has created more useful activity in a few years than we have seen from NASA since 1975. If we want to go to Mars, offer a Mars prize. Offer a billion dollar prize to the first group who reaches Mars with a crewed space ship and returns safely to earth. It might take 20 years, but someone will collect that prize.

    If you are in favor of space travel, then NASA is not your friend NASA is your worst enemy. The saddest part is that they people at NASA are good well meaning well intentioned people who have no idea that they have as a group destroyed space travel. But, then "the road to hell is paved with good intentions". The road to space is over around or through NASA, not with NASA.

  257. the space elevator is dead post 9/11 by RaymondRuptime · · Score: 1

    No one will ever commit the money to a space elevator, regardless of its relative TCO, because there is no way to defend something that large with a fixed location from terrorists who fly Boeings into things--and they would aim for such an attractive target. It could never be insured, so no investor would consider that an acceptable level of risk. Save the space elevator idea for Martian colonization. (Or send all terrorists to Mars without one.)

  258. Space Elevator by Drog · · Score: 1

    Despite carbon nanotubes suddenly making the space elevator more than a pipe dream, many still feel that it's still at least 50 years away. Not everyone though. In this article, physicist Bradley C. Edwards, who left the Los Alamos (N.M.) National Laboratory to work on the elevator design for a private company, Eureka Scientific, says that the elevator could be a reality in just 15 years. And once it's been running for a few years, a round ticket might cost as little as $20,000, thus enabling space tourism.

    More importantly though, it would totally change the face of space exploration. Not only would it be cheaper to get vehicles into space (as well as not harming our upper atmosphere) but it would allow for the assembly of much larger space stations and spacecraft. And the huge centrifugal force at the end of the ribbon could be use to inexpensively fling spacecraft to planets such as Venus and Mars. And then we could build an elevator on Mars.

    I find this endeavour to be incredibly exciting. It just feels achievable. And according to Edwards' estimates, it could be done for under $10 billion. Considering the potential return on investment for this project, and how feasible it's become, I'm very surprised that they've found it so difficult to find the funding. I expect that in the wake of the Columbia tragedy, that won't be the case.

    More info on space elevators can be found here.

    Drog

    --

    Looking for political forums? Check out "The World Forum".

  259. Heavy launch vehicles by Daetrin · · Score: 1

    The US desperatly needs to develop a next generation of heavy unmanned launch vehicles. Or hell, they could just ressurect the Saturn V. (For which i've seen cost estimates ranging between $6 and $10 billion.) The Saturn V could deliver 129,300 kg to orbit and 48,500 kg to the moon. The shuttle can deliver 25,000 kg to LEO, and, well, absolutly nothing to the moon. I'm not even sure if they're counting the shuttle itself and the crew and life-support in that figure or not. The ISS would be _done_ by now if we'd just kept building Saturn Vs in addition to the space shuttle.

    --
    This Space Intentionally Left Blank
  260. Where to go ? by tmortn · · Score: 1

    I think the key word is GO. Station is nice but we stripped the design of anything even remotely allowing it to serve as a stepping stone to GO anywhere else.

    Perhaps this will jolt us out of the LEO rut we have been in since giving up Apollo. We need LEO access and there is microgravity research that may proove important. But we need more than that to keep the fire lit on the program. Lets go somwhere... lets reintroduce ourselves to The Moon, its probably forgoten it ever had visitors in the first place. How about a space station in LLO instead of LEO ( low lunar orbit instead of low earth orbit )?? Getting to LEO is the hard part. Dark side astronomical observation would be very valuable and communcations would be improoved over LEO operations. LLO is closer to LEO than the ground is the LEO from an energy needed to get there standpoint. It would be a better microgravity environment and would provide us a chance to study the moon more in depth and just possibly provide a staging point for landings and creating a lunar outpost.

    Mars of course... heck people the biggest problem of space travel has been solved as far as mars goes. WATER. There is water on mars. WATER. The stuff of life. With access to water we can create a long term sustainable environment.. with enough effort we can create a self sufficient habitat.

    I truly think as the reality of water on Mars sinks in we will see momentum building to mounst a mission to get there. Possibilities for Microbial life aside if water is there we can live there if we want to bad enough. As for why go ?? Hell its there and we havn't been there yet. There are alot of places we have yet to go.. the whole rest of the universe. Right now man kind is living on earth, it has never left it to go anywhere but just outside and to our nearest neighbor... we havn't even been everywhere in our neighborhood and we have been here for Thousands upon Thousands of years if not millions. Just like that 30 year old living in Moms basement its past time to start looking for other options.

    --
    I don't ask you to be me. I only ask you not expect me to be you.
  261. Where or where would you get that kind of $? by SubtleNuance · · Score: 1

    From this page:

    Military spending makes up more than half of the entire discretionary budget, the money that Congress and the administration can control. For FY 2003, military spending comprises 53% of all discretionary spending ($755 billion). This is an increase from the FY 2001 proportion of 48%. More money will be spent on the military next year than on all discretionary social programs combined

    From that page, only 3% of that $755 is spent on "General Science, Space and Technology".

    From this dandy page we learn that US Military spending ($396B) is almost 4X more than the #2 spender Russia ($60B). If you reel in your military spending youll have TONNES of money for NASA...

  262. The need for Manned Spaceflight by Teancum · · Score: 1

    I would dare say that the time is {SHOUT}_NOW_{/SHOUT} rather than some time in the future to be engaged in human spaceflight.

    First of all, we've already done it. With the Chinese and Indians getting into the game with their own indiginous spacecraft, and a resonalble assumption that the Europeans could do it (technically) if they didn't find it easier simply to use American or Russian technology, the simple capabilities for doing human spaceflight are spreading to other countries, and eventually _SOMEBODY_ will finally get out in space and discover just how rich the resources are for those willing to get out there and do it.

    Second, I can't imagine any other human endeavor that has been studied to death. Well, possibly military armaments, but in terms of pure scientific research as to what it takes to get to Mars and the rest of the Solar System, the propulsion systems, the shielding, the habitats, life support systems, and more either are already being done or have been done.

    I mean if a nuclear submarine can stay underwater for 3-6 months without even surfacing, and we can maintain a year-round research base on the South Pole, this is really no different than living on the Moon or Mars. Yes, there are going to be some differences, and some new technolgies that will have to be developed, but it won't be developed until people are actually out there and creating the need for these technologies to be developed.

    Also, there is a famous statement that Low-earth orbit is half-way to the rest of the Solar System. I would have to agree with this statement, which is why in particular the Low-Earth orbit needs to be fully developed and manned. I believe that a major push should happen to get orbiting hotels, playgrounds, real space stations (not the ISS), factories, and other things that we now know how to do, and get people up there doing stuff we already know how to do. By having this kind of infrastructure, including orbiting research labs where probes are built in orbit, it will have a much bigger payoff in the future.

    I would have to say though, that I am not quite sure that NASA activity towards manned spaceflight should continue. To continue to use existing shuttles may have to continue due to international agreements, but I think a gradual phasing out of the current shuttle system should be done... and sooner rather than later. Not only is the shuttle a 40 year old technology (its origin was in the 1960s), but there are numerous examples why it is sucking the lifeblood out of NASA. I think having NASA be a research agency instead of a (tax subsidized) trash hauling company would be tax dollars well spent. Scientific research and coming up with wild and crazy ideas are some of the things that NASA has done very well with in the past.

    What should replace NASA's manned spaceflight program? There are a number of different options, including letting private industry take over, including the launching of all unmanned rockets to Low-Earth Orbit. There isn't really new technologies that need to be done there, or if there are, there needs to be financial incentives to get them developed rather than relying on a government monopoly to get them done. NASA certainly won't pay for the development of a $100 per pound to Low-Earth Orbit launch system.

    I think a proposal by Jerry Pournell is a fantastic way of getting into space that doesn't compromise scientific research. Indeed, it will make robotic space probes much cheaper to prep and launch, and allow ordinary science professors at state univeristies that don't have huge budgets the opportunity to get their projects into space. I'd rather have a hundred space probes go to Mars and study the geology or possibility of life than one huge expensive mission like we are currently doing. And getting lots of people into Low-earth orbit is going to get that done.

  263. Feynman, Nanobots, and elevators by SparklesMalone · · Score: 1

    Richard Feynman (who so deftly demostrated the brittle nature of frozen o-rings after Challenger and the father of nano-technology) isn't here to tell us what went wrong this time. As a doff-of-the-hat I say advance our nano technology, shoot the little buggers to the moon and build our space elevator use lunar raw materials. A goal like that would focus NASA, spur research, and evolve us to a spacefaring species.

  264. Jules Verne and Gustave Eiffel were right by DanielRavenNest · · Score: 1

    A combination of a Big Gun and a Space Tower would provide a transportation system vastly superior to what we have now.

    First - why is the current system not working well? It comes down to two fixed numbers: the energy in rocket fuel (15 MJ/kg for the best
    fuel we have now - LOX-Hydrogen) and the energy
    to reach earth orbit, which is a function of
    the mass of the Earth (31 MJ/kg). As you can see, the fuel has barely half the energy required to get itself into orbit, much less any payload. Therefore rockets use most of their fuel to get some of their fuel plus the cargo to the halfway point, in energy terms, from which point the rest of the fuel can do the job. In fact, you have to have 88% of your takeoff weight in fuel. Now a vehicle that has decent safety margins weighs 15% or more of the takeoff weight, so you can see you are already in a less than zero payload situation. To get something to orbit, you have to resort to expedients like dropping part of your vehicle when the fuel in that part is gone, or using very thin margins or very expensive lightweight materials. Until we have bulk carbon nanotubes (100x stronger than steel), where we can drop the vehicle weight drastically and
    still have some safety margins, we need to change the fuel energy, the mission energy, or both.

    The Jules Verne approach, that of a big gun, gives the vehicle a substantial push, so the mission energy is reduced. There is a big gun not far from where I work (at the NASA center in Huntsville, AL) that uses the powder charge from a battleship gun to fire ~1 lb projectiles at orbital speed. The gun has been used almost daily for 30 years, and it's main job has been to test heat shield materials. An even bigger gun was built about 10 years ago at the Lawrence Livermore Laboratory that could fire ~10 lb projectiles at half of orbital speed. The livermore gun cost $3 million to build, which is peanuts by aerospace standards. One big enough to
    throw a couple of hundred pounds at half of orbital speed would cost in the tens of millions, and could deliver useful payloads to orbit (~20 lb at a time).

    Because this type of gun could be fired several times a day, even if the payloads are small individually, they add up over the course of a year. This type of launch system is best for launching bulk items - food (frozen), water, fuel, and structural components.

    The Eiffel approach, a space tower, is related to the space elevator, but not as all-encompassing. A conventional rocket uses a lot of it's fuel just climbing above the atmosphere. For the Shuttle, it has used up two thirds of it's takeoff weight by the time the solid boosters separate at an altiude of 28 miles. A full space elevator requires materials beyond what we have
    available in quantity. A tower tens of miles high can be built with today's graphite-epoxy. For example, a typical graphite-epoxy has a strength of 300,000 psi and a density of 0.066 lb/cubic inch. Therefore it can support a column of itself that is 4.55 million inches (72 miles) tall.

    In a well designed tower, the structure would taper similar to the Eiffel Tower,since only the bottom has to support the entire weight. Higher parts only have to support what's above them.

    A rocket starting from the top of the tower can therefore have more of a safety margin, or carry much less fuel and therefore much more payload.

    Towers less than 17 miles tall do not need to be considered, since strapping on fighter jet engines as boosters will do an equivalent job below this height. Jet engine boosters are much cheaper and more reliable than solid rocket boosters. Their only limitation is that they have smaller thrust (~30,000 lb each) than big solid rockets (Shuttle is 3 million lb thrust each), so they can only be used for smaller vehicles. But they are perfectly adequate for launching, say a crew of 3 into orbit, or a couple of tons of delicate cargo the big gun would pulverise.

    Dani

  265. Re:Why shoot for the moon? Nanotube launch platfor by SparklesMalone · · Score: 1

    A space elevator can't be built from the ground up, it hangs from a geo-stationary orbiting mass. As the elevator hangs down a correspondingly large mass must be added ABOVE the orbiting platform. When it is done you have something that is an elevator from gound to its midpoint and a large empty scaffold reflecting the bottom mass.

  266. More feasible than a space elevator by WillWare · · Score: 1
    A space elevator is a great idea in the long term, but in the near future a better idea is J. Storrs-Hall's space dock: http://www.imm.org/Reports/Rep016.html

    Build a straight track 300 km long and put it 100 km above the ground, above almost all of the atmosphere. Make the track a linear motor. Use an elevator to get your ship up to one end of the track. Accelerate at 10 Gs for about 10 seconds. Poof, you're in orbit. Now it's relatively easy and cheap to leave orbit and go elsewhere.

    When JoSH wrote up the idea in March 2000, he estimated that the price to put a kilogram in orbit would be 42 cents, once all the costs had been amortized. And the cost of working spacecraft probably shrinks a lot.

    --
    WWJD for a Klondike Bar?
    1. Re:More feasible than a space elevator by WillWare · · Score: 1
      Accelerate at 10 Gs for about 10 seconds.

      Mea culpa, I read too quickly. That's 10 Gs for 80 seconds.

      --
      WWJD for a Klondike Bar?
  267. Stubborn? Actual? by Read+Icculus · · Score: 1

    The actual budget? What I posted WAS the actual budget. Bush and the Senate just upped it to $15.5 billion, so your numbers are a bit off. Wow NASA's budget is going UP you say?! At this rate we'll be on Mars in no time... The administration of is requesting $396.1 billion for the military in fiscal year 2003. This is $45.5 billion above current levels, an increase of 13 percent. It is also 15 percent above the Cold War average, to fund a force structure that is one-third smaller than it was a decade ago. Watch out military, NASA's on your ass!

    --
    Anti-social? My code is just platform-specific.
    1. Re:Stubborn? Actual? by dzurn · · Score: 1

      The reason I posted the budget from NASA's web page was that the original article said that the budget is going DOWN.

      Regardless of military or social services or AIDS spending, the NASA budget is not going down, in absolute terms. That's that "fact" I was disputing.

      Frankly I find defense to be much more important lately than space exploration. Even though I'm a space buff, 9-11 shifted a lot of priorities. Or rather, it should have.

  268. There are some folks out there trying by Wan2Be · · Score: 1

    Take a look at these: http://www.civilianspace.com/default.asp http://www.gsreport.com/articles/art000091.html http://www.spacefuture.com/archive/designing_user_ friendly_civilian_spacecraft.shtml http://www.planetary.org/solarsail/ http://www.wws.princeton.edu/cgi-bin/byteserv.prl/ ~ota/disk1/1989/8904/890404.PDF http://www.spacefuture.com/directory.shtml and last but not least, your library for the last 40 years in hard science fiction

  269. Very true, we've been safe by alexhmit01 · · Score: 1

    Yes, the Islamist holy army has launched more attacks against our military, but our "homeland" has been secure. After 9/11, I expected more hits every few months. I mean, why plan such a massive attack without follow-ons.

    However, we have done a good job of showing that it won't work. We haven't stopped projecting power in the middle east, we've increased it. We haven't abbandoned israel. We've done a good job of keeping the pressure on them as well as take away any benefits from their attack.

    While there are plenty of angry teens in Muslim countries, they can't point to 9/11 as a "success" by any measurable results, and that is critical.

    Alex

  270. The Space Elevator Concept by DaedalusLogic · · Score: 1

    The space elevator would certainly have to be an international project. I think it also presents the most interesting challenges. For instance we were talking about failures in a space elevator system in a class I had on Tuesday... The kinetic energy of the system would pose a HUGE problem if the cable should ever fail.

    The example we discussed was a steel cable linking barges. When those cables snap they can cut through 2 inch thick steel plates. Imagine the space elevator cable snapping and cutting a continent in half.

    It was mentioned a sci-fi book was written about a space elevator that destroyed a planet. Anybody know what it's called? I'd like to read that.

    1. Re:The Space Elevator Concept by jdray · · Score: 1

      The book you refer to is the Mars trilogy by Kim Stanley Robinson (Red Mars, Green Mars, Blue Mars). Having the elevator cable come down didn't destroy the planet, but the author goes into pretty great detail about what happens. It's not pretty.

      On the upside, in the book, a lot of the carbon nanotubes turned to diamonds, so there was a planet-wrapping trench (canyon) that was peppered with diamond fragments. :^)

      --
      The Spoon
      Updated 6/28/2011
  271. Passenger hours are not your pigeon by leonbrooks · · Score: 1
    A Jumbo jet racks up 8400 passenger-hours on every return trip to Europe.

    Um, no?

    Shuttle has racked up (at 100 missions, week each, figures worth checking), 16800 hours per average passenger, Jumbo racks up only 168 hours per average passenger per week, assuming it flew constantly (it does not, so call it 100 hours), so would have to fly for roughly three years to tot up as many miles.

    Every shuttle down is 7 deaths, every Jumbo down is roughly 400 deaths (depends on model), some of the bigger airbuses will be 800 or more deaths, perhaps plus innocent bystanders (very unlikely that a falling Shuttle part would kill anyone), assuming that very few people survive hitting a hillside at over 500km/h, the typical scenario. So the passenger miles even out.

    If you drove your car for an hour every single day, you would have to drive for 48 years to knock up as many hours.

    --
    Got time? Spend some of it coding or testing
    1. Re:Passenger hours are not your pigeon by sbaker · · Score: 1

      > Shuttle has racked up (at 100 missions, week each, figures worth checking),
      > 16800 hours per average passenger,

      Right. And over those 16800 hours, it's crashed TWICE - so 8400 hours is the the average time between crashes. In passenger hours, it's still 8400 hours because 7 people fly each time (more or less) and 7 died each time. Avg Passenger-hours is still 8400.

      > Jumbo racks up only 168 hours per average passenger per week, assuming it
      > flew constantly (it does not, so call it 100 hours), so would have to fly
      > for roughly three years to tot up as many miles.

      But I wasn't talking about miles. It takes 9 hours to cross the Atlantic (DFW to LGW - I fly that route a lot)...an 18 hour round trip. If it hauls 466 people each time (I think that's about right for a Jumbo) then one round trip is the same number of passenger hours as the average passenger hours between shuttle crashes.

      You are right though - if the Jumbo crashes - it kills all of those people at one go. But Jumbo's from DFW to LGW fly one return trip every single day except for major overhauls), so if they can stay in the air for more than about 18 months (on the average) they are doing better than the shuttle. By far the majority of those aircraft have 20 year plus lifespans - and hardly any of them crash during all that time. Jumbo jets are easily a couple of hundred times more reliable than the shuttle - if you measure passenger-hours.

      > If you drove your car for an hour every single day, you would have to
      > drive for 48 years to knock up as many hours.

      But if you drove it TWO hours a day (which is what I said) and if you accept the 8400 passenger-hour average for the shuttle rather than your incorrect 16800 number - then it's 11.5 years. Sorry - I rounded it down to 10.

      --
      www.sjbaker.org
    2. Re:Passenger hours are not your pigeon by leonbrooks · · Score: 1
      would have to fly for roughly three years to tot up as many miles.


      But I wasn't talking about miles.

      Neither was I. My thinko. Read it as `hours'.

      It takes 9 hours to cross the Atlantic [...]. If it hauls 466 people each time (I think that's about right for a Jumbo) then one round trip is the same number of passenger hours as the average passenger hours between shuttle crashes.

      The two cases are still not equilavent because one jumbo crash loses 466/7 (==66) times as many people as one Shuttle crash.

      OK, we've had our fun, time for some facts. The fatality rates I could find were: trains are roughly 4 per 100M hrs, coach/bus 1, private cars 171, motorbikes 382, pushbikes 57, pedestrian 22, air 3. For most modes of travel the casualty (permanent damage) to death ratio was roughly 10:1.

      So... motorbikes are roughly 2.5 times as dangerous to their owners as cars!

      On the same scale, using the 8400 hour figure to save dispute, the Shuttle has 12000 fatalities and a 1:1 ratio. Forty times as dangerous as a motorbike, and four times as dangerous as smoking.

      --
      Got time? Spend some of it coding or testing
  272. Point by point deFUDding by leonbrooks · · Score: 1
    a big, looming space elevator wouldn't be a target for terrorists, would it?

    Yes, but much harder than a building to hit and destroy, and fairly easy to mount defense ordinance on.

    Also likely to have space-based lasers mounted at top end which could be brought on line in seconds, plus the ground-based propulsion lasers could be borrowed, ganged and focussed for the very brief occasion (a safer option IMESHO).

    Near ground level, something like a bazooka shell would be easy to isolate automatically due to its trajectory, and a perfectly ordinary Vulcan Phalanx (50x20mm shells/second) would take care of those as it does for ships. Even if you completely flubbed that, and assuming that you could build enough brains into a bazooka shell to hit a terribly skinny target, and scored a direct hit on a ribbon, you won't necessarily have achieved anything. Firstly, each ribbon would be a wonderful shock-absorber, secondly, there would be many ribbons, so even if you got two or three of them, the results are unlikely to be catastrophic, thirdly, the elevator is in orbit, so severing it low down wouldn't achieve much (in fact, the plans include winding it up a few miles if a really nasty storm arrives).

    You really should go read the site, they've obviously thought of this stuff.

    Something that large will get hit by meteors and junk regularly, so facilities for repair would be routine. The ribbons are arranged in a semicircle (there's not really any such thing as an `edge on' hit) so anything hitting it would have to be seriously sizeable to cut more than one strand, in which case the lasers would get it. In fact, said lasers would become important and useful for cleaning up LEO.

    --
    Got time? Spend some of it coding or testing
  273. Forget the technology, the problem's the monopoly. by Moderation+abuser · · Score: 1

    For space exploration to reach the masses, the technology has to be cheap, monopolies don't do cheap. There is no incentive for NASA to create a cheap method of space travel.

    NASA's purpose has to change. They shouldn't be building rockets, shouldn't be flying rockets. That's what the commercial organisations are for.

    The stagnation, in fact, regression in space travel over the last 30 years is down to the governmental monopoly.

    --
    Government of the people, by corporate executives, for corporate profits.
  274. This quote made me laugh... by ralphclark · · Score: 1
    Also listed in the calculation are six flights a year for communications satellites, like those made famous by Comsat, Inc. Communications satellites fit Columbia just perfectly; NASA says three of them could go up on one shuttle ride.

    How many communications satellites are now being launched? Two a year. Intelsat, the international consortium that is the largest private space user (Comsat is part of it), plans to send up two satellites in the next three years, a spokesman says. The satellite communications business is expanding, with RCA, Western Union, AT&T, and SBS (a venture of IBM, Aetna, and Comsat) planning to enter. But to require six shuttle launches a year, there would have to be 18 satellites. "Barring some extraordinary breakthrough in technology," says an informed communications industry source, "that's inconceivable."

    LOL! "Extraordinary breakthrough in technology" indeed! Like the spread of satellite tv, more intercontinental telephone calls, and large-scale domestic and commercial internet use maybe? Isn't it odd that hardly anybody back in those days saw the comms revolution coming ...I don't know how many comsat launches there are per year now but I'm betting those figures no longer seem quite so far-fetched.

    1. Re:This quote made me laugh... by ralphclark · · Score: 1

      Drat. I meant to post that reply under this comment, where there is a link to the extremely good 1980 Washington Monthly article I quoted from.

  275. If we could just get condensed for space travel. by Wargames · · Score: 1

    I've always been told that there is a surprisingly large amount of space between electrons and their nucleii. So If we could just remove all the electrons of whatever we wanted to ship to space and then reconstitute them after reaching space...

    I guess I need another beer.

    --
    -- Each tock of the Planck clock is a new world and here we are still life. --
  276. Orbiting tethers, not attached tethers... by israfil_kamana · · Score: 1

    Everyone talks about tethers, looking at the space-elevator notion. However, there's a reasonable (with simulations in applets) site promoting the notion of a rotating, orbiting tether that could be used either as a fuel-saving "last mile" (well, last 300 mile) trip to space, or alternately as an sling-shot that grabs the exiting craft in mid-flight and launches it balistically, like a trebuchet. Interesting, and they make a reasonable case, at least to one without the physics background to criticize. ;) i.

    --
    i - This sig provided by /dev/random and an infinite number of monkeys at keyboards.
  277. Re:How does this crap get moderated up? by dWhisper · · Score: 1

    It wasn't about justification. The loss of a person will always be greater than the loss of any number of space craft. The experiments they perform have a lot to do with how humans exist in space, and how other animals would. It's looking at a sustainable environment. Some experiments are more important than others, but life is more important than experiments.

  278. Re:Last successful big project?!?! by dWhisper · · Score: 1

    Actually, I'd heard of most of those. I was talking about high profile missions, the one that they use both for exploration and for PR relations.

    I was talking about the greater Mars initiative, and coming off of the outstanding success of the Pathfinder, they put a lot of PR power into the Polar Lander and Climate Orbiter. The real black eye is when the reason for failure on the MPL came out... meters or feet, who knew?

    Things like the Deep Space missions, Cassini, Earth mapping mission and countless other probes have been launched, and no, the press does not cover successes of most missions, but failures are big time.

    And don't criticize my understanding until you talk to me, not based on one of my posts. If you would have looked at some of the other posts I made in response, I said I had put MGS where I had meant to put Mars Exploration Initiative, which has included some 2 dozen mars related missions.

  279. NASA, the future, AIDS in Africa, and the military by xnixman · · Score: 1

    NASA is not the future. NASA has trivialized themselves for 20+ years. They have degraded into typical bureaucrats. It sickens me every time they come up with some new stunt. "Hey, let's send a teacher into space!", "Hey, let's send a senator into space!", "Hey, let's send a really old astronaut into space!", "Hey, let's send a bunch of ants into space!", "It's for "Research".", etc.

    Then when some guy comes up with $20M and wants a ride they accuse him of being "Un-American". Again, when Radio Shack wants to pay to have a commercial shot in space they again balk. They don't want success, they want their cut of the tax dollars for being a perk for military pilots. Why again is it that you damn near HAVE to be a military pilot or ex-military pilot to be an astronaut? It's not like they have to do barrel rolls in the thing, you RIDE in the shuttle, you don't DRIVE the shuttle.

    Commercialization IS the future of space. Hell, if the CocaCola company wanted to carve an ad into the side of the moon it's fine with me as long as it gets us a permanent base there. There is a doctored picture of the shuttle that shows it covered with ads like a race car. It is generally titled with some cutsey title that implies that would be how it would be if NASA was commercial. You know what? Fine, put the ads on the shuttle, I'd be happy for that $15B to be coming from corporate sponsorship and not taxation. Someone always points out tech spinoffs or potential medicines being created in space. Let me answer that. Throw $15B at a bunch of universities and see what kind of spin offs you get, I'd bet that it would be a damn site better then a pen that writes upside down and a bed that contours to your back. Second, I don't care if they come up with a cure for idiocy, if you have to create it in space, then no one could afford it anyway (well maybe in Canada they could. ;-)

    As for military spending, that is the job of our government, one of the few assigned to it by our constitution. With the kind of taxes I am paying I certainly expect that they will do it well and ~~$400B doesn't seem excessive if they do.

    As for AIDS aid in Africa, that is just a waste. Now I suppose I am a bit sorry that they are suffering (mostly for the women and kids), but first, I am not responsible for their affliction, second, it is largely a problem that stems from their own actions and attitudes. Believe me, since the 80's we have had to change the way we did alot of things to get it kinda under control here (the 70's were ALOT more fun then the 80's and 90's). The time has come for them to step up and fix their own cultures, $15B isn't the answer, responsible governments in Africa are.

    Dan

  280. Re:Why shoot for the moon? Nanotube launch platfor by MickLinux · · Score: 1

    Stresses will be approximately the same. In reality, if you want to minimize the stresses, you'd build one in space as you describe, and another mounting out from the Earth, and join them like the TransContinental Railroad, but with a diamond spike, not a gold spike.

    That being the case, it's probably better to start on the ground, and get some benefit immediately.

    Plus construction costs for that part will be a lot lower, because you don't have to lift materials by rocket up there. So you build the platform first, get it as high as you can, and then use that to launch rockets to put a nanotube factory [and material supply industry] into space from that.

    --
    Correct Horse Battery Staple: 72 bits of entropy. Enter "Correct H" into google. When it generates the phrase, that's
  281. Re:Flynn's books by jdray · · Score: 1

    Hooray for that! Great series of books, by the way. Well, maybe it got drug out a little, but what the heck? At least there aren't a bunch of songs in Elvish...

    But Flynn's idea of the Planck (his name for the SSTO craft) is on the drawing boards of several aerospace engineering companies. It's based on the DC-X (Delta Clipper) series, which, immediately after proving its feasability, had an accident. Politics scrubbed the program. The accident in question? One of the landing struts failed after a test flight (unmanned) and the thing tipped over and blew up. They scrubbed the program instead of rebuilding with a better strut.

    You might not be right when you say that the dream will never come true, but it's going to be a long time coming.

    --
    The Spoon
    Updated 6/28/2011
  282. Re: The backside of the moon by jdray · · Score: 1

    AFAIK, putting a launch facility on the back side of the moon only has one benefit: Centrepital force helps the launch (barely).

    The downsides include more asteroid hits, lack of radio contact with Earth (without a lunar polar relay or something), lack of visibliity from Earth, etc.

    Some would question why you'd want to put a launch facility on the moon, anyway. It's just another gravity well, albeit a more shallow one. Personally, I think that the availability of resources, such oxygen, which is bound up in oxides in the soil, iron, aluminum, and possibly some water are reasons to put a facilty there. Even the gravity can be an advantage, because we terrestrial creatures really seem to prefer having a "down" to work with, something you don't get in space.

    I'm sure it's neat working in space when you can let go of a wrench and have it float nearby until you need it. What happens when it floats out of reach, or floats into what you're working on? Furthermore, when I go to the can, I want to know that whatever I'm getting rid of is actually accelerating away from my body at some useful rate. Gravity helps with all problems like this.

    From a strictly resource-economic point of view, launching from orbit (L-5, for instance) is way better than launching from a gravity well of any sort.

    --
    The Spoon
    Updated 6/28/2011
  283. So Freakin' Simple... by longbottle · · Score: 1

    Where should space travel go?

    MARS!

    --
    I don't suffer from insanity. I enjoy every minute of it!
  284. Re:Corporate mercenaries... by Anonymous+Custard · · Score: 1

    I guess I should have said "the USA shouldn't start a war for profit". In fact, other than the civil war, we haven't ever started a war, especially a pre-emptive war (vietnam was an extension of the ongoing economical/political war between capitalism and communism). You're correct, though, that we often (always) consider economics a major factor in our decision to go to war. In the past, it was "can we afford to join this war?" or "morally, are we responsible for joining one side of an existing war". With the pending new gulf war, it feels like bush is thinking "can we profit from this war?". The whole anti-terrorism thing may be valid, but it's just a front. Bush and his father have been eyeing iraqi oil fields for more than a decade now. There are lots of dictators who do horrible things to their country and people and others, but not all of them have oil fields.