Slashdot Mirror
48% of Americans Reject Evolution
MSNBC has up an article discussing the results of a Newsweek poll on faith and religion among members of the US populace. Given the straightforward question, 'Is evolution well-supported by evidence and widely accepted within the scientific community?', some 48% of Americans said 'No'. Furthermore, 34% of college graduates said they accept the Biblical story of creation as fact. An alarmingly high number of individuals responded that they believe the earth is only 10,000 years old, and that a deity created our species in its present form at the start of that period.
America continues to worry about losing its edge in the high-tech industry.
But that couldn't possibly be related to poor science education, could it?
Note: I'm referring specifically to the 48% who believe that evolution is not well-supported by scientific evidence and that it is not widely accepted within the scientific community. Well, and the people who think the universe is less than 10,000 years old, despite all the evidence to the contrary. You can believe in God and have an understanding of science, just like you can have morals without being religious. But thinking that evolution isn't supported by evidence, or isn't widely accepted by scientists, is just plain ignorance.
Ok, there's a mislabeling of vitamin C, and NY politicians are posturing about something, and a majority of Americans are christians.
THIS IS NEWS????
C'mon editors, what happened to news for nerds, etc?
We'd better start evangelizing science to these poor bastards.
Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.
Slashdot - where whining about luck is the new way to make the world you want.
I'm keeping a close eye on my neighbor's 911 Turbo with the I Love Jesus bumber sticker. The minute The Rapture hits, that baby is mine!
-- www.globaltics.net
Political discussion for a new world
This is interesting, but not for the obvious reasons.
The poll looks fairly well-constructed, but the problem is that evolution has become extremely politicized. For many, this question wasn't asking about science-- it was a political question (are you with the conservative-christians or the liberal-atheist-scientists?).
I think the real story here is the process by which scientific issues get politicized. It's a process that we really need to understand. John Timmer over at Ars Technica often writes about this.
It's about whether it's accepted by the scientific community. It's like disagreeing with gambling and denying that you add up the opposite faces on a die and end up with 7.
Anyone who believes in Intelligent Design has never considered the prostate, let alone actually had prostate trouble. Even a human engineer wouldn't design a component like that. They want me to believe omnipotent, omniscient being did that?
99.9% of humans have more than the average number of arms.
So why does this statistic matter?
So long as the people in charge are smarter than that, we should be okay.
*ulp*
If you can read this, I forgot to post anonymously.
It wasn't that long ago that we were having evolution trials, witch burning and with most of the world's states controlled by various churches.
Even with the rise of the evangelistic movement and the ties many have to the anti-evolution movement, they still pull only 48%.
Sounds not half bad to me.
Thank goodness that most of those surveyed are not in the scientific community!
A: 'We need a new therapy to help people with Disease X.'
B: 'Here try this.'
A: 'Did you test it? Is there any reason to think it works?
B: 'None of that matters! I believe it works.'
The mindset is simply this: Any agenda, promoted by anyone, that contradicts something said in the bible, is an attack on its literal truth and thus, an attack on fundamentalist Christianity.
That's all you really need to know.
occultae nullus est respectus musicae - originally a Greek proverb
This post is so loaded it's laughable.
Is there a decline in the belief in Evolution? Isn't 48% on par with the rest of the world? Should this be discussed every time large poll is conducted? Do we really need a 600-post discussion criticizing the US education system and society?
That's clever, April fools joke the day before April. It has to be. Please.
sometimes, nothing.
Science is not done by consensus. If it were, the world would be flat with the sun revolving around it.
We should kill these people, so they don't reproduce.
Caveat Emptor is not a business model.
Why do you fight OBL and his Qaeda comrades anyway? After all you almost share the same belief...
:)
Oh, marketshare competition I guess
Delta-Mike November Bravo Tango
I'll laugh harder when (if?) this widespread popular ignorance ceases to be a barrier to progress.
If that is true then what happened to all of those God-hating effete liberal carpet-munching college profs? Surely this 34% would have never made it through four or more years of constant haranguing by the Godless elites.
In a related note, perhaps this is an indictment against some diploma mill universities not stressing analytical thinking, much less science?
Most Americans (people over the age of 35ish) were never taught evolution in school and those who were have been taught poorly. I didn't realize the piss poor job my teachers did in junior high and high school until I took an anthropology class in college. People still like to quip that we evolved from monkeys but don't realize we evolved seperate from monkeys and share a common ancestor.
The ignorance to evolution is amazing in this country. It's no surprise at all people haven't embraced it here like they have overseas in Europe.
People wonder why this country lost its lead in manufacturing and, most recently, technological development. Why is a fairy tale -- and an expurgated, badly translated fairy tale at that -- so much more compelling than the tools and concepts that allow you to take control of your own life and environment?
Schwab
Editor, A1-AAA AmeriCaptions
If God had physically come down to earth, found a man living in one of the first civilizations, and tried to explain to him the Big Bang, stellar evolution, how the Solar System developed, and biological evolution, the man would be totally confused. It takes years in a modern school system to even parse these concepts. If other Christians can take Revelations and half of Jesus's stories figuratively, if they can understand that it didn't actually (or won't actually) happen exactly like that, WHY can't they understand this about Genesis? Is it so hard? I'm confused. It seems obvious to me. It actually follows the scientific evidence vaguely well, ex. "The earth was without form and void" meaning Earth hadn't coalesced from the nebulous cloud of material orbiting the new Sun.
--The universe will not be altered by forum threads, even those which are very wry. --Tycho Brahe (Penny Arcade)
Just because someone doesn't believe in evolution or big bang doesn't mean they are an idiot. Growing up, I was taught tolerance and understanding of other beliefs, not arrogance and talking down to others. BTW I believe in both God (but don't subscribe to any Christian denomination) and evolution/big bang.
Well, at least the people in this 48% lack the intelligence to reach positions of power and influence. Oh, wait a minute....
Yes, and with each generation, it becomes more and more apparent.
A republic cannot succeed till it contains a certain body of men imbued with the principles of justice and honour.
"Everyone that needs to believe in evolution already does." Penn Jillete
Faith: n. -- That human impulse that drives them to steal appliances when the power goes out
chickens..
100% of the people sitting in this chair reject that 48%.
"We shall grapple with the ineffable, and see if we may not eff it after all." - Douglas Adams
Schwab
Editor, A1-AAA AmeriCaptions
My take on this issue is that people who do not have extensive scientific educations are being asked to 'believe' in science in a manner similar to how they 'believe' in religion. Science is fundamentally based on observations and the progression of the scientific method. That said, for most of us, we never see the evidence, nor do we see the details of each hypothesis test. This is further complicated because the body of scientific literature is massive and for every scientific field you can find crap science. Peer review is fallible.
I think we are requiring people to 'believe' in science, simply because science has become too complicated to cover adequately with a standard, non technical education. This creates a conundrum. These people are being required to choose religion -- remember they have been in church since birth -- or science. For them, this must be very difficult. When we listen to a scientist, we hope we are hearing testimony based on evidence, when we hear a preacher we hope we are hearing testimony based on belief.
That said, as a scientist familiar with evolutionary theory, I am troubled by the level with which we understand the mechanisms of evolution and that 48% of people don't even understand the most basic of concepts within it. Should we require people to swallow science without evidence? Should we follow *anything* without evidence? I know I don't, ironically, science doesn't allow me to.
Laboratree - Scientific collaboration based on OpenSocial.
Unfortunately for that argument, scripture says a lot about sheep, most of it positive and encouraging - My sheep hear My voice, I am the good shepherd, and He separates the sheep from the goats etc
To accuse a Christian of being a sheep is not an insult.
Quite right, ignorance is different from idiocy. I'm sure you noticed that I didn't call anyone an idiot.
Much as everybody assumes this is all about fundamentalist Christianity, I have talked to many non-Christians around the world, even non-deists, and many find evolution hard to swallow.
I believe in Evolution, but for some it is a very disquieting concept. Many people generally want to believe in the transcendence of man and distance from animals. Christians just have more dogma to lean on to support this prejudice. People don't disbelieve out of ignorance, they disbelieve because they don't want to believe. Similarly many people believe in many strange and incredulous things because the do want to believe.
This said, just teaching people to set aside there natural biases when evaluating evidence in general would do a world of good in both science and politics. Evolution would take care of itself if we were successful in this.
Letter To Iran
I am not surprised.
Half of the US population has IQ's below 100.
48 percent of people are stupid and believe that Genesis is the literal Word Of Gawd and that science is some sort of mental buggery? This is not news.
The fact is that we're *this* close (holding thumb and forefinger a millimeter apart) to burning (well, hanging and pressing, actually) witches again in this country. The code words for "witches" these days are "terrorist," "paedophile," and "science teacher."
--
BMO
An interesting approach.
But probably flawed as the non-believers do not 'suffer' peer pressure to discard the theory of Evolution
At the same time the educated among them are exposed to peer pressure against Creationism...
"The likes of Facebook and WhatsApp are free to those whose privacy is of zero value."
It might not make somebody an idiot, but it is two strikes out of three.
Nerd rage is the funniest rage.
Anyway, enough of this. I want someone to help me evolve the long, thin, incredibly strong fingers I'm going to need to open up ther case of the Mac Mini to my right and slot in the replacement disk drive.
New Doctor Who was great tonight, by the way. Rose was great, but you're all going to love Martha Jones. Except for the creationists, of course, who are going to hate The Doctor kissing (whisper it) a black woman.
How big of a sample was used? Where was the study held?
Were the people being polled from a small isolated town in the bible belt or were they from one of the coastal areas?
In a country with 300 million people in it, if you ask 2000 people in an isolated area a question, that wouldn't really reflect the majority of the population, but I bet it would make great headlines......
Today's show is brought to you by the number 09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0: 25
Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with.
First you call them ignorant (which is true). Then you call them stupid. Then you call them religious fundamentalists. Then back to ignorant. These are all very separate categories, which you would understand if you had the above-average intelligence that you probably believe you possess. Given the large percentage of the population that is being cited, I think it's unlikely they are all below-average in intelligence. I didn't RTFA so I don't know about their religious beliefs. I submit to you that these are probably people of average intelligence who are ignorant. That means that we as scientists are not getting the word out in a manner that most people find compelling. The problem is not with them, it is with us.
Perhaps you should check out the film Flock of Dodos before you start pointing fingers at who is to blame. (Hint: the dodos are not the intelligent design folks, it's the scientists who are in danger of becoming extinct because they can't communicate simple facts to the mainstream audience.) Elitist attitudes like yours ("hey, if they can't keep up, fuck 'em!") is partially what drives the mainstream to give ID folks a listen.
GMD
watch this
That's what is scary. People making life changing decisions for you believe things with little/no scientific backing. That's why the country is the way it is. That's why we lost the edge we once had. There's a rebirth of celebrating ignorance and we are in the middle of it. Hell, we are basically as a culture in a dark age right now. Once knowledge is acquired it's like our culture as a whole has to check the bible to see if it's credible. Would you want people with the ability to kill you at any moment completely impermeable to reason?
If an officer ever threatens to taze you, say you have a pacemaker.
...I come with a BS in Chemical Engineering, and I would have voted yes on that poll.
More stupid Americans means less competition for me.
I sort of agree with you. This story should be labeled as politics and the discussion should be about separation of church and state. The only link that has to news for nerds is how it might affect the scientific community at large.
Thankfully, no fundamentalist has declared MP3s the work of the devil!... yet
Support NYCountryLawyer RIAA vs People
Speaking scientifically on the need for control groups and cross variable analysus I think it would be a pretty good idea to get some stats on that.
How the hell did this story get past the editors? We already know what kind of worthless discussion will take place as a result. There's no point in discussing all the copious evidence for evolution. Anyone who would listen to such a thing already believes evolution. Fundies only accept one kind of argument, and logic isn't it.
I feel a subject like the one at hand perfectly matches the other half of Slashdot's subtitle:
Stuff that matters.
"The likes of Facebook and WhatsApp are free to those whose privacy is of zero value."
This couldn't be more on topic
I'm a rabbit startled by the headlights of life
For many reasons, we--the scientist and scientifically minded--kind of gave up on trying to explain our understanding and objectives to the "layman" and now the rift between us just keeps growing...
First of all, speak for yourself. Lisa Randall is currently on tour giving lectures on cosmology. Stephen Hawking always has a sell-out crowd. You may personally have given up trying to explain science to laymen, but not everyone has. Some are actually taking time out of their very busy research schedules to present the material to the public because they feel it is sufficiently important.
"Sheeple" is such an offensive word, no wonder the public gives the ID folks a listen. You don't see them openly referring to the common man as "sheeple". The public is ignorant, yes, but describing them as some kind of sub-human species is way out of line. You make it sound like understanding science is simply not possible for them. If the material was presented in an interesting and persuasive manner (e.g., we stop referring to the audience as "sheeple"), I think you'd be surprised at how much they'd grasp and appreciate.
GMD
watch this
Everyone's a sheep. Modern neuroscience pretty much confirms that most of us run on autopilot most of the time. The real question is, who's your shepherd?
I think the average Slashdotter mostly agrees with Jesus about this. The difference is, the average Slashdotter believes that he's not a sheep, and sees this as insulting. Well, reality check. You are. But who's your shepherd? If there's a single most important decision you can make in your life, it's this. Is it Jesus? Mohammad? Richard Stallman? Pamela Jones? Jimmy Carter? Al Gore? Brad Pitt? Your parents? A good friend? A friendly and knowledgeable professor at school?
A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?
I got my Linux laptop at System76.
Near me in San Antonio there are a couple of Universities, state funded and private. One of them is most definitely a Catholic university. Another is private. UTSA everyone else goes to. The add the colleges into the mix.
If you go poll the Catholic university, and ask them if Creation was fact or if Evolution is a better concept, aren't you going to get skewed results, like one third of them towing the line from scripture?
I'd really like to see the data rather than a news story, basically.
As for the >90% believe in God thing, that's not too surprising, however, WHICH God? Did they just interview white Christians, or did they pull out Muslims, Jews, (arguably the same God but.. different concepts of it) pick another religion if you need to.
In a country like the UK where I am from, a LOT of people believe in God. However a LOT of people also don't go to church every Sunday. In fact very few people do. That doesn't mean they are not Christian and don't believe in God. It means we have less wild-eyed evangelists, and keep it to ourselves, maybe. I think any poll of any country would throw a 90% value of some degree.
Me, I don't give a shit. I think the universe was created when a couple of superdimensional membranes collided and the probability of some waveform occurring hit a certain level. Whether that is God, or it's a white dude with a white beard, I dunno. Believing the Earth was created 10,000 years ago is a bit silly, but then the Bible is nothing more than allegory in this sense; the idea is that it was a long time ago, longer than anyone alive can possibly remember and possibly imagine. Does it matter that they beleive 10,000 rather than 4 billion? Isn't that just math? Okay.. now I am thinking about when they tried to redefine Pi..
When an high percent of they (US citizens) thinks that spain is in Mexico and almost all the american history previous to the european colonization doesn't exists.
The religion numbers alone are a solid proof of Sturgeon's Law (loosely pararphrased as "90% of everything is crap").
Americans are idiots?
Where's the surprise?!
You have to understand that a Christian CAN be a scientist. There actually is quite a bit of evidence for a young earth. I don't think that a true scientist can say that evolution is fact. There are just too many contradictions. And in fact, more recent scientific discoveries tend to suggest that evolution is the religious dogma of blind zealots. Rather than accepting evolution as blind fact, scientists should be doing experimentation to support the idea of evolution... however, many of the experiments are done with faulty reasoning and make assumptions (of things that are not even good theory). Evolution is a hypothesis at best. The world has truly forgotten what the scientific method is. Now... we accept things as theories based on the popularity of the scientist. Which is sad. So... what will the future hold. Today's science is founded more and more on popularity. It has become more and more like science fiction. Science (those that do not believe in God) want to make sure that God does not exist... so, as evolution continues to fall apart (because humans DO like to learn and explore... so TRUE scientists will exist), the scientific community WILL undoubtably have to come up with another Godless answer to the creation of humanity. Personally, given our infatuation with science fiction, I believe that the next big popular "theory" will be the space seed theory. While it does not answer original creation, it will help satisfy the evidence of a young earth and a history that only goes back 4,000 years.
... is someone (other than Al Gore) who can play the "fear" card about the potential consequences of the United States falling too far behind the other world super-powers (China, etc...) in the science and technology sector, as convincingly as these mega-church preachers do with the "eternal hellfire and brimstone" gimmick.
These people need to stop drinking the religion kool-aid for a minute and start looking at the bigger picture here. That moral high ground they pride themselves on now isn't going to be around much longer once one of these other nations with the man-power, brute-force and morale to take us down actually does it. Our military power is rooted heavily in science, technology and playing the statistics, rather than raw firepower combined with large numbers of soldiers. Once we lose that science and technology edge we have now, not even God will be able to protect us.
Anyone who still believes the concept of Mutually Assured Destruction keeps us safe in this day and age is a fool. Our enemies today don't care if they survive or not, so long as they take us out with them.
If the statistics presented in this poll really are an accurate assessment of the U.S. population, then it sounds like Y2K boogie-man has most of the religious folk convinced that this is "end times", and that their death/rapture is coming, making them apathetic toward taking control of their destiny. In short, they "want" to die, but they want God (or someone else) to pull the trigger for them. People like this need to realize that their deaths will solely be a pointless product of man, rather than an act of God.
I will never understand the reasoning behind one's willingness to die a pointless death as a matter of pride/spiritual closure...
8==8 Bones 8==8
The next time a jesus chrispie gets in your face about this, ask him this: "OK, so the bible says god this, that, and the next thing. Does it say anywhere HOW he did it? And if it doesn't, did you ever wonder why? Did it ever occur to you that if god is POWERFUL enough to make a universe and populate it with life, then he might also be SMART enough to make it run AUTOMATICALLY according to certain laws, such as gravitation and evolution, that don't require constant meddling and micromanagement? And that these laws are simple enough that us mere humans can actually learn and understand them?"
I.e. "In the beginning, god created heaven and earth. For further details, consult a science book".
No, but the method of discovering the facts gets wonky when established facts are ignored when you go forward...
~ a low user id is no indication I have a clue what I'm talking about.
The fundamentalists distort the bible to come up with their 5000 year theory. For starters, in Peter's Epistle, 3:8 it says to God a thousand years is but a day and a days is a thousand years. That indicates the days in Genisis for the creation are metaphorical, and are at least a thousand years. But Peter was just giving an example, and he could have easily have said to God a million years is but a day, or a billion years is but a day. You can't put human perceptions on God's perception of time.
Furthmore, the Bible is full of parables, symbology, and methaphor. Jesus himself often used parables to describe even realtivley simple things, because the people of the time were unable to grasp much of his teachings. Since Jesus used parables to decribe realively simple things, it is likely the case, in fact certain that God used parables to describe the creation. Do you think primitive tribesmen would have been able to grasp something as complicated as the creation? No, they couldn't, therefore God used parables. When Jesus used parables, he was giving us a lesson on understanding the word of God.
It might also be said that time, in prophecy, is frequently given in symbolic terms. That is, expressed in unconvential means because the time itself is meant symbolically. In Daniel 8, 2,300 evenings and mornings is given as time until the time of the end; seventy sevens is given in Daniel 9 to mean the same thing. A time, times, and half a time is an expression used for the length of time of the reign of the Beast. Jesus's forty days in the desert is linked to the Jews forty years wandering in the desert under Moses. Since time is used symbolically so frequently in the Bible, it is plausible that the days for creation in Genisis are sybmolic.
When it comes to interpeting the Bible, fundmentalists can't see the forest for the trees.
This ad space for rent.
"To believe that God does not exist, is to believe that a stiff wind could blow through a junk yard a create a 747."
r em
What about a near-infinite number of stiff winds, or a near-infinite number of junk yards blowing continuously for an infinite amout of time?
http://en.wikipedia.org/wiki/Infinite_monkey_theo
No, it is not a contradictory statement. Not on the surface, not in any way.
For a few months in college, I had a room mate who was a paleontology major. He didn't believe that they lives millions of years ago. He also didn't think humans and dinosaurs lived at the same time. He thought that God put the fossils there.
Why is it that we insist on freedom of thought, unless it's thought we don't want people thinking? Am I the only one who sees the inherent hypocrisy of orthodox free thought?
You're not going to Hell for not having a literalist interpretation of Genesis. But... neither is society going to hell in a handbasket because not enough people believe in evolution. It's okay if your auto mechanic believes something different from you. Your software isn't any better or worse because an evolutionist|creationist wrote it.
Really, it's no big deal. Take a deep breath and relax. You'll find you'll live longer for it.
Don't blame me, I didn't vote for either of them!
Most have not seen any proof of it.
Most have an extremely difficult time understanding or explaining it.
About half the people believe in it, and the other half are quite hostile.
Is "it" evolution, or God?
I think it takes about the same amount of faith, whether it's some powerful man in the sky or some incredibly slow, yet constantly happening biological process.
This is a free country and if people want to believe in creationism then they damn well have the right to do so without someone coming along and making hints that it's all the creationists fault that the world isn't some atheistic utopia.
Absolutely. If people wish to hamstring themselves in such a way that "magic" becomes a valid explanation of things ( even divine magic ), by all means we should let them.
However, those same people lose the right to complain that we are losing our technological edge in the world. If you want to be part of the problem, you are welcome to do so. You don't get to complain about said problem at the same time, however.
Mod me down with all of your hatred and your journey towards the dark side will be complete!
That most of _those_ people are selling herbs, homeopathic 'drugs,' and supplements--which people are buying. Folks just don't realize the value of science these days.
Keep it simple - post facts related to evolution and I will listen and debate. So far only conjectures and ideas about the origin of man have been created by clever people and all the evolutionists just say "if enough of us smart people say evolution is true then it must be true". Hogwash and very narrow minded. So far no facts, just a bunch of BS. Post the facts or shut up.
http://slashdot.org/article.pl?sid=07/03/28/204224
I guess we must not be praying hard enough.
I find it interesting that people on Slashdot (and elsewhere) follow the belief that if you believe in creationism and intelligent design that you are "stupid" and if you believe in evolution you are "smart". I know a number of highly educated people that believe in creationism. Evolution is a theory, not necessarily a fact. The same is also true for creationism. Being a Christian, I believe in intelligent design. I believe we were created by God. But, I don't really care how He did it. I don't really care if He used evolution or the creationism theory. I don't really care if the earth is 5000 years old or 5 billion years old. Either could be true, but in the long run, it doesn't matter. Believing in evolution or not, does not matter when my grandpa is dying or my friend gets divorced or my neighbor's house burns down, etc. It doesn't affect my day to day life.
This blatant bias is why most of Slashdot, outside of the circle of regular posters, will always be regarded by the rest of us as a nest of total losers. You may have your opinions about any number of ideas, and people such as myself (which despite what your opinions are, are 98% of the time WAY more informed than this inner circle) may often agree with many of the things posed here (and in regards to the subject at hand, I too think that there was way more than some magic wand waving around to the creation of the earth/universe/etc.). That said, when you start posting straight off that anyone who has a different opinion especially when it involves deep seeded spiritual beliefs must be somehow stupid, uneducated, or just a moron, then you have already lost the argument. Does the phrase, "catch more bees with honey than with vinegar" mean anything to you? Probably not. I'm sure you justify this with "oh they're too stupid to waste my time on". Hey, I feel the same way a lot of the time. But if you have any delusions that you're accomplishing anything more than one big circle-jerk, any thoughts towards influencing others to your way of thinking, then you have approached it from the perfectly, exact wrong direction. Attitudes like that don't win anyone over, it makes them turn around and go listen to someone else, anyone else, who doesn't come across as a sanctimonious asshole, such as is often the case here. And please, none of this "religion is the biggest bunch of arrogant people there is!" crap either. The belief in science as the total master of everything to the point of sterilizing any kind of faith or hope from any and all subjects, has become a far more powerful religion than most traditional religions could have ever hoped to be. And its a religion completely devoid of anything inherently "human".
Please, try and educate yourself before speaking in public. Evolution (as in natural selection) is the only theory that adequately explains the complexity of life. The "747" didn't appear from nothing, it evolved from very simple parts over at least 3 billion years that were subject to ongoing selective pressure. Natural selection can use random mutations to evolve complexity in a remarkably short period of time.
If you require God to explain the existence of complexity, then please also explain where God came from. It's a circular argument; adding God to the equation doesn't answer anything. If God must exist to create complex beings, then something equally or more complex must have pre-existed to create God. Ad infinitum.
Unfortunately it matters to society. Unfounded beliefs of all sorts - religious, economic, racial, and nationalist - have caused incalculable harm and the deaths of uncounted millions throughout history. It may have no effect on physical processes but it has a very real effect on people.
How does this matter? Whether people believe in evolution or not is irrelevant. People are not going to stop inventing, trading and banking simply because they disagree with someone else about a purely abstract idea. The world will not end. This is just elitist preening.
Slashdot: Playing Favorites Since 1997
You say that as though all sheep have shepherds. However, as you say, we run on autopilot most of the time: we have no pilot, or shepherd, or whatever. It's rather patronising to assume we each follow a single leader in making our decisions.
No kidding!!! What do you say at this point?
Time to start fighting the war on Ignorance and Stupidity...
Oh wait, you president is probably amongst the 48% of immensely ignorant people isn't he? Nevermind, please carry on your slow slide into national collapse.
"The first time I got drunk, I got married. The second time I bought a chimpanzee, after that I stayed sober" Arian Seid
Actually, scratch all but the final sentence of that. Don't drink and post, folks, you wind up with word salad.
No kidding!!! What do you say at this point?
...and a majority of Americans are christians.
Apparently this problem extends to maths as well. Since when has 48% been a majority?
Oh good, for a minute there I thought the heavens were going to crash into the Earth because people didn't understand exactly how they worked...
Natural phenomena still continues in spite of the fact that people don't understand it or believe in the most accurate theory. So what? What is the value of pointing that out?
"Reality is still reality despite what you believe" is an argument that works on *both* sides of the debate. It doesn't get us anywhere.
Computers are useless. They can only give you answers.
-- Pablo Picasso
reject Americans
What?
It's not in TFA, but the poll also reported the following statistics:
27% of Agnostics and Atheists think God guided the process of evolution
13% of Agnostics and Atheists think God created man in his present form.
So a better title for the article might have been "40% of Atheists believe in God".
When you're getting that kind of result, it might be a clue that there's something wrong with your methodology.
There is one further question: Which one?
Genesis Chapter 1 has animals created before man. Genesis Chapter 2:19 implies that animals were created after man. As always, if you want to accept something as fact, you need to prepare to handle any contradictions that arise (or otherwise accept it as "best fit" or a theory.) The forceful application of religion as fact as resulted in problems, also known as witch-burning or equivalants thereof.
A scientist that digs the mysteries of a universe can easily believe that his deity is more intelligent than what most people think, as it takes skill to make self-assembling life forms without micro-managing the design.
As a final point, there's one religion that embraces the theory of evolution - which proves that science and religion are not incompatible.
You misconstrued my point.
Ah, but see, the beauty is that this is exactly my point! I perceived hostility and elitism in your post and immediately stop listening and giving your point of view a fair evaluation. And guess what? That's what (almost) everyone does! I'm saying that we as scientists need to start paying as much attention to how we get out message across as what that message is. We like to believe that the truth will be so amazing that the public will accept it, no matter how terribly it's delivered. That's just not realistic.
Getting the word out in a compelling manner seems like it would be a good answer, but that strategy has to fight apathy and indoctrination, both of which are much stronger. For better or worse, there is no way to replicate the techniques of what I'll call the dark side (for lack of a desire to think of a better phrase) without walking the dark path.
I agree with your first sentence ("apathy and indoctrination are stronger") but disagree with your second. Yes, the onus is on us to take a complex subject and make it understandable to a public that lacks very basic scientific and mathematical knowledge and skills. It's a tough challenge. But if we're really so smart, we should be able to tackle this! Fuck, we can send someone to the moon using spacecraft equipped with computers that pale in comparison to modern cell phones, but we can't teach most people the basics of evolution? I don't believe that and this gets to your second sentence. The ID proponents probably aren't as truly, deeply intelligent as scientists are so they have to fall back on "dark side" techniques to make their case. It's quicker, easier, and more seductive. We are (supposedly) better so we ought to be able to make our case while still staying in the light. The dark side isn't more powerful, it's just easier. For those of you who think science has to be boring, I would encourage you to check out some of the graphs in Edward Tufte's books. Many of those are so well done that they communicate very powerful information in a manner that is intuitively understandable and aesthetically pleasing to the common man.
We need to start paying attention to how we get the word out about evolution. What we're doing now isn't working. I'm not calling for scientists to use the techniques of the ID hooligans. But I am saying that we can't just throw the data out there and expect it to do the work for us.
GMD
watch this
If you read through the comments on this article you can see why its hard to have any kind of real argument on this topic.
The people responding to this poll - in large part - aren't responding to the actual question. They're responding to the feeling that they are given by the word "Evolution" which has been thrown at them over and over as something that disproves the religious faith that is one of the most important things in their life. You go to College and you hear, basically, "You shouldn't believe in God because Evolution has made that foolish".
If you dig in, and study the original Theory of Evolution, you start to see that it is possible to believe in the process - that evolution has and does occur in nature - without embracing it as an explanation for how all life came to be. There is that huge hurtle of figuring out how life began in the first place.
My point is not to argue that one way or another, but rather to point out that people are responding to the feelings that they have about Evolution more than to the question itself.
Its worth noting that the vast majority of the /. comments on this are the same thing in the other direction. Folks don't like Christianity - in particular the "Ignorant Fundamentalists", and so its much more fun to make fun of them, than to try to figure out what's really going on, or to even *gasp* try to understand their point of view.
Custom, hands-free Linux installs. Instalinux
It suggests that 48% of American refuse to evolve, the question is from what?
A positive attitude may not solve all your problems, but it will annoy enough people to make it worth the effort.
Now, I'm confused. If the survey is correct, for whom was GEICO's site Intelligently Designed?
It must have been something you assimilated. . . .
Maybe it would be constructive if we stopped assuming that the 48% of people who reject evolution were all dribbling idiots. After all, the ability to see both sides of an issue is probably a good indicator of an evolved species.
Before I get too far, I feel it necessary to head off the inevitable insults that will come my way for presenting a differing opinion. Yes, I am an intelligent person. I have been a network administrator for 10 years, I am an RHCE, I scored high on my SATs. And I am also a Christian who believes in "Intelligent Design", the simple concept that God masterminded creation. I believe that he planned and designed the human species. I do not believe that we evolved from other species. I understand that there are intelligent people who do believe in evolution, and it is possible that I may be wrong, so I try and look at both sides of the issue.
It might help to acknowledge that what you accept as "fact" influences what theories you are prepared to believe. I think it is a fact that the Earth is round, therefore I am inclined to reject the theories of the Flat Earth Society, no matter how much evidence they present. Many people are atheists. Since they don't believe in God, they are well prepared to look for and accept scientific explanations for our existence. If, on the other hand, your faith tells you that God exists, and you accept that as "fact", then you are less likely to believe that God had no hand in designing humans.
It simplifies things a bit to recognize that there are 2 types of evidence: logical (or circumstantial), and empirical. Sometimes logical evidence can make perfect sense, but might still be wrong. This is why criminal court cases are stronger if they have empirical evidence, such as a smoking gun and a witness. Unfortunately, none of us can claim to have witnessed the Earth 1 million years ago, so we have no empirical evidence of the state of the planet and its species at that time. And don't tell me that some species adapting to a different environment over the last hundred years (micro-evolution) is empirical proof of macro evolution. No one in the last hundred years has witnessed the spontaneous birth of a new species. I think that natural selection makes perfect sense within a species, but it is a stretch to extrapolate that to fish crawling out on dry land and developing legs. What most posters on here don't seem to realize is that they sound just as dogmatic and close-minded as the Creationist believers they casually dismiss. How about instead of dismissing those with a different point of view as dribbling idiots, we actually discuss the issue with an open mind.[sarcasm] Don't you know that carbon dating is wholly inaccurate? As is the dating of layers of sediment etc...[/sarcasm]
Amazing how much folks get lathered up over where things came from. Do species change over time - you betcha! Just watch one dog show and you will see the amazing results of selective breeding over a short time period. Natural selection and evolution of living things is not in question. Nature abhors a vacuum.
.05% mutations tend to be positive. Life - even if using self replicating as the measuring stick - is amazingly complex. I don't care if someone believes in the beginning 'bang it happened' or 'God created the heavens and the earth' - whichever you chose requires an enormous amount of faith in a theory that does not match nicely to what is observable. Picking a theory on where life sprang from seems largely irrelevant and a waste of time.
My beef is people taking evolution and pushing the theory that 'life' started from a random mix, and then natural selection/evolution got us where we are today. Working in the lab with 'simple' single cell organisms which seem to die by just looking at them funny leaves me a bit cynical. It is not like
+++ UGUCAUCGUAUUUCU
I'm not surprised by the percentages, frankly. I'd be interested in seeing the trends. I'd (like to) be surprised to see if it was really all that different in the past. That said, I do think it reflects on our state of education in good ol' USofA. Possibly a good excuse to rail about the state of science education in particular, but I'll take it, 'cause I think it does indeed suck.
I love the story of Genesis; there's good stuff in it. Almost as good as the Silmarillion.
As chance would have it, I'm reading through my old copy of Carl Sagan's Cosmos. Now, I know it would be viewed as dated (both factually and cinematographically), but it was a tremendous influence on me. It addresses topics in a very approachable and friendly manner, and is (as I remember it) very far from preachy. It lit me on fire about science, and though I don't make my money in science, I think this program had an impact on my science-based view of the world.
But this is more than 20 years ago now. Short of a Sputnik analog, what voices do we have to popularize science?
.sig,
I've read the original article (perhaps) which indicates that this article is misrepresenting the data, but even there I couldn't find out how they selected who they would ask questions of.
I think we've pushed this "anyone can grow up to be president" thing too far.
To an ignorant person, it would be just as impossible for them to believe that we created plastic, spaceflight, and nuclear power. Surely it must be the work of God or Demons!
And don't demean philosophy by attributing religious doctrine to it. That argument is purely theistic, and relies on a hilariously poor understanding of the difference between the workings of a mechanical thing like a watch (or a 747 if you want the updated version), and the workings of the sort of life you find on this planet, which is not in any way inconsistent with our understanding of organic chemistry.
Sure, no one was around to watch it happen, but looking at the fossil record we can watch hugely simple creatures in the deepest strata being replaced by more and more complex creatures that become more and more familiar to us as they evolve. We can see the mechanisims at work all the way up to the current day, with every succeeding generation of bacteria becoming more resistant to our efforts to kill them off...That's evolution at work.
I find it absolutely hilarious that a person can live in the modern world and see, every day, around them everywhere, evidence that science is capable of some truly amazing stuff, and that the scientific method is the most powerful tool we've ever built for ourselves in the entire history of our race...And still be willing to discard all the mountains of evidence for a book written by some primitive Hebrews thousands of years ago...No questions asked.
ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
This kind of ignorance makes it possible for once again, the same few to control the many.
These people who claim they reject science don't seem to reject the fruits of science.
Perhaps a better polling question would be:
"Would you take anti-biotics to treat a deadly bacterial infection, would you rather just die?"
These folks who *say* they take creationism over science are just mouthing empty words. Their actions speak more clearly. How many Christian Scientists *actually* die of apendicitis? How many christians actually tithe their 10%?
Lots of people today claim to be religious. But by the standards of their Puritan ancestors 2 or 3 centuries back, they are plainly athiests, pagans and idolators.
Historically, religious fanaticism has been the norm, not the exception. With that perspective, we are living in very liberal, enlightened and rational times. Each generation is more secular than the last, and everyone knows it. We're just watching them pull their wagons into a shrinking circle.
A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?
I disagree. The best intelligence litmus test is to be skeptic and never accept everything as the complete unquestionable truth. The way I see it, the creationists have about 0.000001% chance of being completely right, the evolutionists have about a 30% chance of being completely right. The complete truth is probably either a slight modification of the evolution theory or a completely different concept that either no one has ever thought of, or that no one is capable of thinking of.
There should be a "-1:Groupthink"
only six percent said they don't believe in a God at all. Just 3 percent of the public self-identifies as atheist, suggesting that the term may carry some stigma. Still, the poll suggests that the public's tolerance of this small minority has increased in recent years.
This is bullshit. There is no tolerance of atheists.
From another article that made the rounds only last year:
From the article.
only six percent said they don't believe in a God at all. Just 3 percent of the public self-identifies as atheist, suggesting that the term may carry some stigma. Still, the poll suggests that the public's tolerance of this small minority has increased in recent years.
This is bullshit. There is no tolerance of atheists.
From an article that made the rounds only last year:
Based on a telephone survey of more than 2,000 households and in-depth interviews with more than 140 people, researchers found that Americans rate atheists below Muslims, recent immigrants, homosexuals and other groups as "sharing their vision of American society." Americans are also least willing to let their children marry atheists. Is that tolerance? The average american doesn't even want you to marry their children if you are an atheist or agnostic. And as much as it always seems like there is nothing religious people hate more than gay people, they actually hate atheists even more!
Oh, yes. Such tolerance! And yet these are the same assholes that are always going around telling us how Christianity is a minority in this country today and how religious people are persecuted.
I am not an atheist. I am an agnostic. But you can bet your damn ass that I am hesitant to admit that to anyone who asks me in person unless I have a really good idea of how that person will react. Otherwise - at the best - I might find myself being locked into a two hour discussion trying to explain to the ignorant bastards why I can be agnostic and still not go on a murderous rampage - because in the mind of religious people, the only thing keeping them from slaughtering people wholesale is that their god might not like it.
So.. tolerance toward atheists and agnostics? Bullshit.
Based on a telephone survey of more than 2,000 households and in-depth interviews with more than 140 people, researchers found that Americans rate atheists below Muslims, recent immigrants, homosexuals and other groups as "sharing their vision of American society." Americans are also least willing to let their children marry atheists.
Is that tolerance? The average American doesn't even want you to marry their children if you are an atheist or agnostic. And as much as it always seems like there is nothing religious people hate more than gay people, they actually hate atheists even more!
Oh, yes. Such tolerance! And yet these are the same assholes that are always going around telling us how Christianity is a minority in this country today and how religious people are persecuted.
I am not an atheist. I am an agnostic. But you can bet your damn ass that I am hesitant to admit that to anyone who asks me in person unless I have a really good idea of how that person will react. Otherwise - at the best - I might find myself being locked into a two hour discussion trying to explain to the ignorant bastards why I can be agnostic and still not go on a murderous rampage - because in the mind of religious people, the only thing keeping them from slaughtering people wholesale is that their god might not like it. Yet atheists and agnostics are the ones who have no morality, are responsible for all the brutality the religious people and their delinquent children commit and are selfish. What the fuck?!
So.. tolerance toward atheists and agnostics? Bullshit.
Also from the a
I believe I speak for a considerable amount of non-US readers which are in complete awe of the US. The land that brought us so many outstanding scientific achievements. The land that seems to be divided in brilliancy and utter ignorance. The land that wants to introduce creationism as a science in schools. The land where division of religion and state seems to vanish.
I hadn't the slightest objection to his spending his time planning massacres for the bourgeoisie... (P.G. Wodehouse)
I read a comment on Slashdot just a few days ago (really wish I had bookmarked it, since I'd love to read it again) where the poster mentioned evolution, the Y2K bug, avian flu, and said "science just has no credibility left." I wanted to say "so I guess you won't be using medicine, driving in cars, or POSTING ON THE INTERNET anymore...?" but I've said it before, and the absurdity of rejecting science while depending on it so heavily is just lost on these people.
Evolution rejects Americanssss????
Because of my car's bumper stickers I'm frequently asked: "Do you believe in evolution?" Instead
of just saying that I do, I try to raise their consciousness a bit by answering "No, I accept
that evolution is the theory that best explains the evidence." This usually gives them a pause.
Belief is often closely associated with faith, and faith is something that isn't necessary to
accept evolution. Only evidence is needed and there is lots of that available.
I'm a teacher and my bumper sticker if very appropriate and funny in several different ways, it
reads: "Leave no child behind - Teach Evolution." I wish I had another one as this one is very
faded.
"Drug related crime" is a misnomer, "prohibition related crime" is the more accurate and correct phrase.
And yes I'm an American.
Yes, but evolution you can read up about. You can study it in school, become involved in the research. It's all out there waiting for you to figure it out.
Now the church route? Well... good luck on proving the existence of a supernatural being. Much less that it had a few spare days to create all this and leave behind the evidence of evolution we have now.
The Ancestor's Tale and The God Delusion should be required reading in American schools.
I read a book called Darwin's Black Box, which I found extremely compelling. He posts some very devastating evidence against gradualistic evolution, which I have never heard really answered. Most of the answers are basically, "Yeah, but most scientists disagree with that." I don't care what most scientists disagree with. I care about what is true. I have read several Dawkins books, I have The Origin of Species, and I find Darwin's Black Box more compelling.
Now, I don't mind people disagreeing with me. I have friends who disagree strongly with me. We are friends and they don't call me ignorant, stupid, uneducated, or fundamentalist. What I DO have an issue with is being called ignorant, stupid, or whatever because I challenge the status quo. There was a point in time when it was firmly established by all educated people that the earth was the center of the universe. Not that it was flat, but the center. There was a lot of astronomical evidence that really predicted the motions of the stars that supported this. It was several hundred years before Copernicus' evidence held sway.
I would strongly recommend a book by Thomas Kuhn called The Copernican Revolution, or another called The Structure of Scientific Revolution. It simply does not do to dismiss ideas you do not want to believe out of fear for being called ignorant or a fundamentalist. We are interested in discovering the actual truth, right? We don't want to go on supporting a myth because of the fear of the opinions of others, right?
For the record, I am educated, not a fundamentalist, I agree that the earth is probably several billion years old, etc. I simply do not believe that the evidence for evolution is well supported at all. I don't know what actually happened; do we need a myth to explain it? Perhaps the fact that it is a mystery is the most profound truth of all.
If I have nothing to hide, you have no reason to search me
It's pretty well-known that most people who call themselves Christian don't practice it in their daily lives and in essence, don't actually or truly believe. They are just club members who don't pay their dues. But when you corner these people, they will assert that they are true believers to the very end. It's best nnot to provoke Christians by asking them direct, polarizing questions. Better to let them go on acting like heathens. They will have children and they too will be non-participating Christians except that they will not likely go to church but once in a while... the next generation after that will be lighter still. Eventually, religion will fade away. It's fighting religion that keeps it alive.
It's not faith, but accountability of those doing the teaching. On one hand we have scientists, who are undoubtedly smarter than I, whose motivation is learning how the world and universe work. On the other hand there are a multitude of un-named authors from thousands of years ago (several if you're talking old testament) whose motivation appears to be social control, and perpetuation of their own superiority over the common folk. Scientists tend to apply logic to their theories and then test them (over and over again) to verify or discredit the theory. While the biblical authors regurgitated the camp fire tales of illiterate desert nomads, with a edit or addition here and there to ensure they stayed in control.
Note to self: No more arguing with the faithful.
it takes far more faith to believe that a "deity" did not create human life
It takes more faith to not have faith in a diety than to have faith in a diety? So... not believing in Santa Claus is really to have more belief in Santa Claus than those who... believe in Santa Claus? Being skeptical that Bigfoot exists means that you really have a stronger faith than those who believe in Bigfoot?Could you please explain your logic? You don't seem to be making any sense. Me not believing in your God does not mean I have more faith than you--it means that I lack your faith in your God.
Unfortunately, a combination of other facts and beliefs make these beliefs relevant to our lives. Specifically, the fact that many of these people hold positions of power (and those that don't often make up a powerful majority), and their belief that they have a mandate from god to dictate how we live our lives.
sic transit gloria mundi
is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?
Why is it disturbing to define intelligence as having a modicum of knowledge and rational analysis capability?
DNA + "survival of the fittest" = evolution. It's not a theory - it's just a plain consequence of the the tautology "survival of the fittest" and the fact that we're based on a naturally varying chemical hereditory mechanism (DNA). If you don't understand that people who have more children leave more descendents, or that we're based on DNA, then, YES, you are stupid.
"A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?"
I often tell my biologist friends that they are lucky that evolution came before a well developed theory of statistical mechanics. Evolution is a direct consequence of border line cast iron assumptions made in statistical mechanics. And statistical mechanics is so reliable no one questions it's assumptions. I wouldn't even call evolution a theory, it borders on a tautology because it is so obviously true. It isn't like Newtonian Gravity, or Quantum Mechanics, or even special relativity, it is unique. I say that as a physicists who wishes it was a physical theory rather than a biological one. Evolution is special in science because it is one of those theories that no matter what we discover we will always call the process of how life went from the single cell to it's current form evolution, unless the very foundations of science itself are destroyed. It borders on a mathematical proof because the assumptions made arriving at it are few and so well tested.
That is why no one in science of any credibility questions the central tenets of evolutionary theory. That is why anyone who does not has their credibility questioned.
The article itself says absolutely nothing about opinions on acceptance 'within the scientific community'! That was, apparently, the poster's desire to paint evangelicals in the worst possible light.
The truth is that most evangelicals simply believe what their pastors tell them about creation but almost all would be aware this is not supported by mainstream science.
A small minority carefully track the science of creation/evolution and choose to believe that the Flood really could create the fossil record and that the evidence of helium diffusion (presented at a mainstream geology conference) explains the dating problem.
I think the problem is, that belief in a deity is seen as incompatible with accepting evolution as a scientific fat. Ofcourse, this isn't a problem unless you take the Bible to be a literal account of the nature of the universe. The problem with that is that you would also have to believe that the sun goes round the earth, that mankind came before the animals, and that animals came before mankind.
If you suggest to people that the bible can be taken metaphorically beforehand, I bet you'd see a substantial difference in the results.
Kyle: Yes, yes I am.
Stan: Yeah, at least one fourth.
Kyle: Let's do a test sample. There are four of us here, and you're a retard. That's one fourth.
What sound do people on rollercoasters make? Hint: it's not Xbox 360.
C'mon, what is informative about such a blatant ad hominem attack? Promoting this kind of behavior doesn't promote a rational argument in favor of evolution.
Boom Shanka
I think this is a sad thing because it shows we are regressing to thought patterns more common to turn of the 20th century thinking. This is more regression than progression. What's next? Will we re-enact laws making it illegal to teach evolution in the classroom? As other slashdotters have remarked, this is very sad. Evolution happens on both macro and microcosmic scales; it is really more than just a theory. I thought we put this issue to bed decades ago. Apparently, we have people so fervently religious that they are blinded to any view that would contradict the bible. Personally, I would like to believe that there was some mix of the two. I think a higher power did something to set the evolution dynamics in motion. But, after the dynamics were set in motion, life takes on its own forms and changes independently. This is my compromise to the different set of beliefs. I do not dispute Evolution at all but something was needed to trigger life and it is difficult to believe that life started randomly. It would have to be a 1 in several trillion chance occurrence. That said, I would not say the Bible tells the entire story either. The world was not created in seven days and our fossil and other (much more reliable) geological records attest to that. This may be the unanswerable question . . . at least with our current technology.
When the other 52% accounts for several religions as opposed to one.
If we can hit that bull's-eye, the rest of the dominoes will fall like a house of cards... Checkmate.
"If a nation expect to be ignorant and free...it expect what never was and never will be." Jefferson, Thomas 3rd President of the United States (1801-1809)
Evolution can not be wrong. It's not a theory - it's just a plain fact.
If your DNA causes you to have more children than me, then the DNA of our species has taken a step in the direction of your DNA rather than mine. If the DNA of species A group #1 has diverged from that of species A group #2 to the extent that they can't interbreed then (by definition) one of these groups is a new species.
There may be additional subtleties to how evolution actually plays out (there's plenty of post-Darwin realizations such as that it's environmental change that drives punctuated equilibrium), but the mechanism itself can't be wrong - it's just plain fact. More children = more descendents with your DNA.
No it doesn't make you an idiot but it does make you unintelligent.
Did anyone read the actual poll response in question?
"Do you think the scientific theory of evolution is well-supported by evidence and widely accepted within the scientific community?"
48% = Well-supported
39% = Not well-supported
13% = Don't Know
39% not 48%. Zonk, you're fired.
These uneducated dolts don't gbet to pick and choose their science, or the technology based on it. No evolution? Ok, then: no cell phones, no SUV's, no printing press, no metallurgy, no crop rotation, nothing. Don't care about evidence? Fine, you don't get a trial by your peers, we'll try you by Ordeal just like when the Church ruled Europe. Better start praying you weigh more than a duck.
Take your oh-so-precious superstitions and go back to living in caves... us rational, civilized, enlightened people will even put a big fence around where ever you want to sequester yourselves with a big sign that says "Garden of Eden".
When science discovers a maker's mark on the universe that says "God, 6000 BC" (very doubtful), then the situation will be diferent. Until then, someone telling you god is real doesn't make it true. I'm sure you wouldn't believe me if I told you the Flying Spaghetti Monster is upstairs in your house right now, having his noodly way with your wife.
And I bet when you walk in on that live pasta pr0n, you'll still deny it, despite all the evidence.
/rant
That's why we have findings, and we publish the process for the findings as well as the findings themselves. If another party can't reproduce the finding then our proof can be debunked.
Well we used to, there's numerous global warming reports (Michael Mann's report early on comes into mind, though he's not the only one in the global warming debate, and far from the only scientist guilty of this) that issued findings with out their processes, as well as other places in science. So this wonkiness we speak of appears. Personally I think it's time science journals demand the processes as well as the findings for everything, but then their magazine would shrink because science has slowly been moving to a point where the "answer" is far more important than any question that can be asked.
This is especially depressing because of the form of the question - they're not even being asked about their personal belief or not in evolution, but a simple factual qustion "'Is evolution well-supported by evidence and widely accepted within the scientific community?". Someone could not personally belive in evolution and still come up with the correct "yes" answer to the question. The second part of the question is an indisputable factual "yes" - theres no room for opinion here. The first part of that question is pretty damn close to an indisputable factual yes as well - any honest creationist might be able to say "yes, evolution is well supported by evidence, but my 'god did it all 6000 years ago' theory is also perfectly supportable within my belief system" (honestly, pretty much anything is supportable if you assume an almighty being with limitless powers to say "abacadabra!" any time it wants to).
Evolution can not be wrong. It's not a theory - it's just a plain fact. If your DNA causes you to have more children than me, then the DNA of our species has taken a step in the direction of your DNA rather than mine. If the DNA of species A group #1 has diverged from that of species A group #2 to the extent that they can't interbreed then (by definition) one of these groups is a new species. There may be additional subtleties to how evolution actually plays out (there's plenty of post-Darwin realizations such as that it's environmental change that drives punctuated equilibrium), but the mechanism itself can't be wrong - it's just plain fact. More children = more descendents with your DNA.2 007/01/21/ING5LNJSBF1.DTL retrocausality could throw a curveball to evolutionism.
Actually, evolution is an interpretation of facts observed in nature and is thus a theory. All the data observed could conveivably be used to support another theory as to how life came to be the way it is. Also, such things as proof of http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/
There should be a "-1:Groupthink"
Nope.
From a purely scientific perspective, the creationists (or Intelligent Designers or whatever their current name-of-the-month-so-people-won't-know-we're-creat ionists) are not so much right or wrong as they are irrelevant. That's why scientists have a hard time understanding what they're fighting, or that they need to fight at all. I mean, it's just so hard to take Creationists seriously because you don't really believe that rational human being would believe what they're saying. I mean, they have to be joking, right? No, they're not, they're dead serious. Now, I'm not entirely sure that all of them do believe ... there are other agendas at work here and that makes them even more dangerous.
... but for many theories the margin of predictive error is so small that they are considered physical Law. Evolution and natural selection are in that category, regardless of what the creationists want you to believe. Is there a one hundred percent correspondence between current evolutionary theory and observable fact? No ... but there is zero correspondence between creationist "theory" and those same observations. Evolution wins on points alone. It's the best we have to date, it explains so much of what we know about how life changes over time. Will something better come along? Sure ... but like you said it will be a refinement of what we already know, and I guarantee that it won't involve a 10,000-year-old Earth or fossils placed here just to fool us. Creationists make the frequent mistake of assuming that what we know now is all that we will ever know.
Science is all about modeling reality, and refining such models to more closely reflect what is to an increasing degree of accuracy. Consequently, no scientific theory is ever considered perfectly correct, only correct to within a certain probability
Scientists will accommodate religion to the point where religious beliefs conflict with reality. Many religions have reached the point where they will alter their dogma to accommodate new knowledge, whereas the creationist movement insists upon making a simple value judgement: we are right and science is wrong. They leave no room for compromise, and when you get right down to it, neither should we. What is, is.
Contrary to what some would have us believe, ignorance is not bliss. It is downright dangerous, in fact, especially to the ignorant.
The higher the technology, the sharper that two-edged sword.
I participated in this survey. It was conducted over the phone.
When they came to the question about whether evolution is accepted in scientific circles, I immediately thought the question was poor. But I answered yes. It is the accepted scientific explanation of how things are. I answered this way even though my own religious beliefs do not agree with scientific reasoning on this matter.
So I am also one of those that the survey identified that believes that humans appeared in their present form in the last 10,000 years.
I suspect that a large percentage of those that said evolution is not supported by science were actually answering the question "Do you believe in evolution?" rather than what the survey actually asked. The way the question was worded is, I think, poor.
As for people who believe the biblical account of creation, it does not mean that they are ignorant (though granted, it is likely that a lot are). It just means that they have differing views. I am fully aware of scientific views of the subject, as are many people. But I, like many others, have religious views that are contrary.
Intelligent responses welcome, flames will be met with marshmallows.
Because the education level in one subject area does not indicate the overall intelligence of an individual. Especially an area as hotly debated as macroevolution, which most people uneducated in evolutionary theory will immediately associate with the word, evolution.
Personally, I don't consider all those people stupid. I consider them to be poor biologists. However, if you want to define intelligence in the manner you did above, then by your own standards you're not so intelligent yourself. You certainly failed in your rational analysis of those who don't believe in evolution.
Who the hell are you to decide what people "actually or truly believe"? (FWIW, I don't understand the difference, but that's not really the point.) One of the things I really do appreciate about Judaism, for all that I dislike, is that most Jews are willing to give a wide latitude toward what constitutes "Jewish." As a religion - at least, from my experience with the liberal branch of the religion - no one gets to say "Yup. You're Jewish."*
And as far as I've been able to determine, the New Testaments basically says the same thing - it's up to God to say whether you were 'good enough' or not, and it's up to you to figure out how to best do that. For all the problems with the Bible, Jesus was pretty clear that being a good person and believing in God are more important than going to Church every Sunday. Again, I am no great fan of organized religion and have little patience for fundamentalism in any form. But you don't get to decide whether someone else is Christian or not. Neither do I. And, while there are certainly people who claim that the Pope or whomever gets that authority, I still have to disagree. Every individual knows for themselves whether they are or aren't religious and screw you for saying otherwise.
It sounds like you're an atheist, although it's possible you're simply an opponent of organized religion specifically. Regardless, I really take issue with your anti-religion stance and, as a larger issue, the occasional anti-religion stance on Slashdot.** The idea that intelligent design should be taught in school next to evolution is ridiculous. The only place religion has in public school is social studies, history, and (arguably) English or literature. And I would readily agree that religion has brought forth some unfortunate consequences (ID being one of the more recent ones). But that doesn't mean religion (or religious people) are inherently bad, or that religion and scientific inquiry are mutually exclusive.
I've drifted off-topic, so I'll get back to my main point. People completely and utterly have the right to create their own identities. That's what really bothered me about your post - that you claim to have the ability to judge who is "truly" or "actually" Christian, as if you are privy to some mystical knowledge that eludes the rest of us. You can't make that call.
-Trillian
As a post-script, part of my conviction of self-identity comes from long discussions this past summer about the Jews for Jesus who had suddenly appeared in the New York City subway system. After doing some research on Messianic Jews (see http://en.wikipedia.org/wiki/Messianic_Jews) I came to the conclusion that while Jews for Jesus are annoying as hell, Messianic Jews as a larger group honestly believe they're Jewish and I really can't argue. Likewise, even if someone practices religion in a way you don't understand or in a way you feel isn't "good enough" doesn't mean they're not religious.
*There are theological complications if you want to talk about more Orthodox branches of Judaism, but my understanding is you'll find that in the more fundamentalist branches of any religion
**I know, it's not everyone...
>I've said it before, and the absurdity of rejecting science
:= Technology.
>while depending on it so heavily is just lost on these people.
These people are rejecting science and depending on technology. Science
Why can't I be my own shepherd? When I do think, I can make decisions that I will use when I'm on autopilot. I don't run out in front of cars all the time, because I've previously decided that that would be a bad idea. Why can't I do the same with my beliefs?
Ewige Blumenkraft.
This is a variant of what I call the "Argument from Plumbing". When the plumber comes and fixes your drains, he isn't taking away your free will. He's enabling you to exercise your free will to do other things than suffer crappy plumbing. An omniscient good God would have created a world different in too many ways to count.
:-)
There's more interesting ways to exercise your free will as a healthy well fed buddist than as weak starving christian, to boot
You can't take the sky from me...
Next time, crack open a few history books before you shoot your mouth off. It was during the Enlightenment when most witch-burnings happened. The Mediaeval Church was pretty open-minded about the role of science in explaining the world (try looking up Augustine's opinion on science for a laugh).
The particular brand of moronity referred to in TFA is almost exclusive to the United States of America. Meditate on that before you start spouting off more stupidity.
Mart"I know I will be modded down for this": where's the option '-1, Asking for it'?
25% of the Swedish population do not believe in Evolution either.
Source: Svenska Dagbladet (one of the largest news papers in Sweden)
Personally, I think the effect we see is due to a change of public perception of science and scientists today. People just do not respect scientists the way they used to. If this is due to news coverage, politicians or bad science I have no idea.
A standard hypothesis is that as soon as you have conditions in a chemical soup that can support selection for self-replicating chemical chains, you have the beginning of life. That is: As soon as evolution is a supported possibility, just then is when life takes hold.
Now, this is not proven, yet. But for decades there have been experiments with very suggestive results on this - setting up initial (and lifeless) environments in chemical conditions approximating early Earth, and seeing what just could be the start of the formation of such chemical chains. This was standard in main-stream press science reporting well back into the '60s. There's still much current research in it, and a whole lot of theory.
"with their freedom lost all virtue lose" - Milton
Have you ever met a person that you would describe as having an average intelligence? What do you mean, I am reading a post by one right now?
Anyway, half of the people, are even less intelligent then that.
There are people out there with IQ's well below 100 and they are allowed to vote.
Now just because a person has a low intelligence does NOT have to mean they are stupid. Far more dangerous are the people with just enough of intelligence to think they know better. You know the type, "How can there be global warming when it is freezing outside".
These same people look at evolution, can't see how a bacteria instantly develops into a human being and therefore it must be done by magic. Evolution is possible because of two things. First because if you have enough time even the most unlikely event is bound to happen but far more importantly, because the end result isn't nearly so fantastic as we would like to believe.
Lets face it, if a god had designed human beings would he have made such a mess. Take teeth, human beings live far to long for their teeth, so why hasn't god given us the constatly growing teeth of rabits OR the constantly replaced teeth of sharks? No instead we are lumbered with teeth that rot because of our diet and just don't have the required lifespan to last for 80+ years.
The eyeball is often used as an example of god's existence but lets face it, who of us couldn't come up with a better design if they were all powerfull. How about a simple autocorrection system so we don't need glasses. For that matter why not give your "top" design not the same eyes as say an eagle so they can see properly?
Part of the blame for religous nonsense like ID lies with the scientists. I seen everything from scientist trying to explain woman's boobs to us walking upright by "logic". Nature/evolution don't work that way. Women got boobs, because they got boobs. They are NOT substitutes for a baboon's bottom. (think about it, other big apes don't have them either, plus just because humans walk upright don't mean you can't see their asses) And human walk upright because, well we do. I am pretty sure that if somewhere there is an intelligent species that cartwheels around on 1004 limbs they will have scientist claiming that this is the most efficient system that could evolve.
Evolution happened because given enough time anything will happen. Nature does not exist, there is no goal, no end result, no plan, no path. We just happened.
Darwin never claimed Survival of the fittest. It is like how the term "global warming" got used instead of global climate change wich in itself is just a part of the impact human's have on nature. People focus on the warming bit because they can attack that and ignore that even if it NOT correct, we still are in trouble if we die of poisenous air and/or destory the ozone layer.
But yeah, global warming ain't real, because it is freezing outside, and god created man because you have this amazing eyeball that is outmatched by dozens of animals eyeballs. We can't see in the dark, our color vision sucks, we can barely see any distance, have trouble with fast moving objects OR objects standing still. IF a god created us, he didn't want us to see much of his creation did he. We can't even properly see the bloody flowers.
MMO Quests are like orgasms:
You may solo them, I prefer them in a group.
A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence? 1- No, some people are sheep, some people are weasles, some are pigs, etc.
You might be a sheep, but I'm a platypus.
2- 'Is evolution well-supported by evidence and widely accepted within the scientific community?'
Well supported, widely accepted, unwavering belief... yeah, those are the same.
You can't take the sky from me...
The sooner you fall behind, the more time you have to catch up.
>Conversely, at least here in the UK, I know of many religious Christians, including IIRC the Archbishop of Canterbury, and I believe the Pope (obviously he's not in the UK); who accept the theory of evolution with no problems.
This is not because you and your friends are British! It's because you're the type to post on Slashdot (e.g., at least moderately well-educated, and somewhat scientifically or technologically inclined) and they're the type to be your friends!
Because actually, the stats tell the same story about the UK that they do about the US.
It's true that most Americans are bleeding idiots, but that's not a trait of Americans so much as it is of Homo Sapiens.
Many of these 48% are the same people who are pushing to go to war and kill thousands of innocents on the flimsiest of evidence, yet a century of carefully researched, incontrovertible evidence for evolution fails to convince them. Newton's laws are more likely to be wrong at this point than evolution.
And may of these 48% are the same people who think that the closer a market economy approximates social Darwinism, the better, yet when the same principles apply to evolution, they all of a sudden become an instrument of evil.
All I can say is that, with any luck, those same 48% of Americans will be rejected by evolution.
AFAIC I am not worried or alarmed by people believing in God or being agnostic or even atheistic. I am far more worried about people blindly following an ideology, be it communism, be it islamic terrorism or be it blind faith demanded by many churches. Fortunately communism is in the dust heap of history and the power of church over the population has been in decline for a long time. I just wish the churches will leave science alone and pick its fight with an equal adversary, the islamic terrorists.
sed -e 's/Chuck Norris/Rajnikant/g' joke > fact
We are witnessing evolution and natural selection in the 48% polled. As people become increasingly more ignorant, they are slowly evolving back into lemmings which will, in turn, increase the number of people that are unable to comprehend simple scientific fundamentals such as evolution, natural selection, or formatting a floppy disk. I blame Clippy.
boycott slashdot February 10th - 17th check out: altSlashdot.org
Everyone decides these things on their own. It is simply a case of a hypocrite versus practitioner. I was a born-again Christian for several years in my teens. When I was nineteen, I literally left the church, left my faith, because I simply didn't "believe" anymore and that happened over a two year period. My fellow Christian friends told me, "If you are leaving, then you never really believed in God to begin with."
Basically, they were calling me a hypocrite. That over those years, I was simply "going through the motions" and not really believing in what I was doing. And at first, that couldn't have been further from the truth. But towards the end, they were right. I really didn't believe anymore.
Point being, "truly believing" means that someone is simply practicing what they preach. People who preach something and don't practice it don't "truly believe" in what they are saying.
In other words -- hypocrites.
I agree with you about the benefits of the scientific method, invention, and other things that advance society, but I want to play devil's advocate.
Modern Meds, cars, and the internet... science or business?
During the Black Plague... using science to cure the disease was crucial for survival. These days we have medical companies being accused of the life-long treatment of disease instead of actually finding a cure. These days, it seems everyone worships the power of the holy "buck".
And here's a different tangent...
The internet? Yes, the original Arpanet was a magnificient development - but what it evolved into (the internet) is ubiquitous. My guess would be the 75% of the users of the internet don't even know what Arpanet was (and that is was created as a weapon during the Cold War).
Then again... this article is about how half the country doesn't believe in evolution, so how could Arpanet evolve into the internet?
We've always been at war with East Asia and the internet has always allowed us to post our ignorances to the world.
===
Sorry for jumping around and not staying on topic. I had two different points to make, and couldn't find a good transition.
Support the 30 Hour Work Week!!!
What the hell is wrong with the US people? Why has rejection of evolution become a necessary part of believing in god? If you North Americans reject science I am worried that other countries, ones culturally colonised by the US such as Australia will follow suite. This would clearly be a disaster. Scientists over there clearly need to get with the new mind control program. You guys have got to get on TV and you've got to be FUNNY. That's right MAKE FUN of creationists, not with elitist in-jokes like the Flying Spaghetti Monster but with broad, undeniably funny humour. See Dave Chappelle and Sasha Baron Coen for inspiration. The best way to undermine ridiculous ideas is with humour. God bless Jon Stewart and Stephen Colbert.
"is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?"
Not really, mostly because I've never encountered this. In the world of science, you know...*real* science, unwavering belief is generally looked down upon. If you can bring actual reasons to the table to call evolution into question people will generally listen to them, and I think that the crowd that believes in evolution has been more than accommodating when it comes to listening to cock and bull crackpot refutations of evolution (no matter how long you shake a box of electrical components you'll never get a radio to fall out...) However when it comes down to it I've never once heard a real reason that evolution can't exist. Keep in mind that God may well have created everything and evolution can still be possible. So, in conclusion the litmus test you describe really only applies to people that argue non-reasons for why evolution can't work, people that have no idea what they're talking about and talk as if they've studied the subject and have come to solid conclusions.
Someone mod parent up, please.
You shouldn't have posted anon.
--
BMO
When you read Genesis, it is clear that god was following an agile methodology -- except that he was his own customer. He did all of that in six days. That probably would have taken six years using a waterfall methodology.
The start of Genesis reads like agile. He literally wrote a story card (declared the requirement), solved the story, approved it (saw that it was good) and then took the next card. He didn't plan and design it all in advance.
Only problem is that nobody reviewed his implementation. So when it got fucked up, he just got pissed at himself and flushed it (literally) down the toilet so he could start over.
Even god refactors things, I guess...
Apparently the headline comes from the answer to question 12 on the survey. Here is the actual text of the question:
Uh, I think this should have been followed by a question 13: "Did you understand question 12?" (yes) (no).
This was by far the longest and worst worded question in the survey.
The other fascinating thing to note is that on the detailed survey was that 13% of self-described "agnostics and athiests" answered "yes" to the idea that God created the Earth in its present form--a philosophical logical fallacy.
Tells me the numbers in the survey are at best junk.
Jeez, what kind of fascistic bent this post had. Who cares what people think. My guess is that world wide, well over 50% believe in some kind of creation myth/faith instead of evolution. Do you think the 1 billion Muslims believe in evolution? The 1 billion Catholics? The 1 billion Buddhists?
The fact is that forcing people to recant their religious faith in favor of Evolution is just as wrong as religions forcing scientists to recant their beliefs in favor of religious dogma.
Physics is nothing like religion. If it was, we'd have an easier time trying to raise money!
Think about all the news coverage and random people encouraging intelligent design in various states. I know the evolution is correct, not a doubt in my mind. It's a scientific theory and I know what that means. But reading this question makes me think briefly as to what the answer should be. Anyone who read it as "Is evolution well-supported by evidence and widely accepted?" and just that probably responded "No" because so many idiots are arguing about its validity.
The sad part here is how backward the Church is being (assuming that those 48% are all God-fearing Christians). Rather than trying to fill the gaps in science or offer alternatives for the trickier aspects (where did the Big Bang come from? What was there before? etc), Christianity (or its public face) tries to send us back to medieval concepts. Their mistake is denying clearly factual evidence (the Earth is 6000 years old? Ancient fossils are there to test our faith? etc) rather than moving with the times and working alongside scientific theory and using it as a backup for Christian beliefs rather than a contender.
You have to click through a few links to get to it, but the actual poll states:
It looks like the submitter got mixed up with the two stats that were both 48%.
Disclaimer: This quote has been modified from the original version. It has been reformatted to fit within Slashdot's HTML limits.
What are these nearly 50% of morons in this country going to do when Transhumans come down the pike?
They're going to try to exterminate them.
And they will fail - getting exterminated in the process. Because, contrary to the Star Trek and Terminator movies, there is no way humans are going to outmaneuver Transhumans. Can't happen.
This applies to most other humans worldwide, I suspect, since religious stupidity is not limited to this country.
The human race will be mostly gone from the earth by the end of this century (by extermination, transmogrification, or their own hand) - and late, too.
Have a nice day, chimps.
Richard Steven Hack - This sig is TOO GODDAMN SHORT TO DO ANYTHING USEFUL WITH! MORONS!
Thanks for the response.
I completely agree with you - someone going through the motions without believing is a hypocrite. But what I was responding to was the claim that only occasionally going to Church and not 'practicing' in a daily, public way means you're not Christian (or Jewish, or whatever). More to the point, if they "truly believe" that being Christian can mean occasionally going to Church, celebrating Christmas, and believing in God in a non-confrontational kind of way, more power to them. erroneus said that these people call themselves Christians but don't "actually or truly believe" and, while you have given me some things to think about on what it means to truly believe (and I agree with what you said) I don't think you responded to my original issue: erroneus claimed that "most people who call themselves Christian don't practice it in their daily lives and in essence, don't actually or truly believe."
I'm challenging that assumption on the grounds s/he has no right to claim knowledge of the beliefs of another. S/he could have said "Most people who call themselves Christians aren't living in a way that I feel lines up with what it means to be Christian" or even "Most people who call themselves Christian have very vague definitions of 'Christian,' but s/he didn't - s/he made a very specific claim and I'm calling bullshit.
Likewise, s/he was vague as to what it would mean to "practice [Christianity]." Daily Church attendance? Weekly Church attendance? No Church attendance at all but obeying the Bible as you understand it? Keeping slaves and stoning neighbors who don't observe the sabbath? Depending on your viewpoint, any of those might mean "practicing Christianity." My point is that there's a wide range of what it means to be Christian (Jewish, Muslim, etc) and no one person gets to decide for everyone else what exactly that means.
Unless you found your own religion, in which case feel free to go hog-wild (see Scientology).
As a complete side note, kudos to you for having the strength to leave the church when you no longer believed.
-Trillian
Kelson:
... the Soviet Union ... and it doesn't exist anymore.
"America continues to worry about losing its edge in the high-tech industry.
But that couldn't possibly be related to poor science education, could it?"
I don't think anyone would argue that acceptance of evolution has been an ongoing process in America.
This would mean that currently more Americans believe in evolution than at any time in the past.
Conversely, it would mean that during the period of America's greatest technological and scientific dominance, there was less belief in evolution than at present.
If anything, this factoid would tend to support that the *acceptance*, not *rejection*, of evolutionary theory correlates with any perceived reduction in America's technological and scientific dominance.
*insert obligatory comment about correlation, causation and coincidence here*
There *was* a country that rigorously enforced evolutionary scientific education, religion was not tolerated in any way in it's schools. It's name was
Theory is a problem-word. No big surprise: I'm sure most /.ers
realize this. But I can't help but wonder whether we don't all
underestimate how *much* of a problem this little word is.
Referring to the *theory* of evolution makes too many people think of
some dubious hypothesis, perhaps just another man's opinion, rather
than of the fact-constructed model for explaining observed phenomena
that it truly is.
I bet if we talked about the *model* of evolution, we'd have less
trouble than we currently do with all the knee-jerkers who attack
the word theory. A model is stronger than a mere conjecture, but
even an unproven conjecture as it's used in math or science is on
firmer territory than figmental tenets of something like, oh,
Frisbeetarianism (just to pick a religion I'm unlikely to get
lynched over).
Consider number theory: no one imagines number theory to be some vague
notion open to individual interpretation and belief. Imagine if
instead of talking of Newton's three laws of motion, these were
bundled together and called Newton's theory of motion. Swap law into
theory and what happens? Sound a bit shakier?
Not if you understand that theory means more than just somebody's
guess. The Dictionary records 7 principle senses for the noun theory;
of these, the first 2 are obsolete, and the 7th is for combining forms
such as theory-neutral or theory-making. The last main sense, sense 6
(whose first citation is from 1792) is the one giving us grief here:
6 In loose or general sense: A hypothesis proposed as an explanation;
hence, a mere hypothesis, speculation, conjecture; an idea or set of
ideas about something; an individual view or notion.
However, sense 6 that's *not* the operative definition for theory as used
in number or automata theory, or in the theories of gravity, of relativity,
or of evolution. Instead, it's sense 4 (first cited in a 1638 example) that
applies here, usually in subsense 4a but sometimes in 4c:
4a A scheme or system of ideas or statements held as an explanation or
account of a group of facts or phenomena; a hypothesis that has been
confirmed or established by observation or experiment, and is
propounded or accepted as accounting for the known facts; a statement
of what are held to be the general laws, principles, or causes of
something known or observed.
4c A systematic statement of the general principles or laws of some
branch of mathematics; a set of theorems forming a connected system:
as the theory of equations, of functions, of numbers, of probabilities.
If our treatment of science and math in primary and secondary education in
the United States weren't in such sorry shambles, more Americans might
understand that *this* sort of theory isn't so much a loose notion as a
model that explains observed phenomena and predicts others, all subject
to empirical testing.
Which would be easier: fixing general science education in American public
schools, or adopting a term like evolutionary model? Although the second
may seem only a small measure compared with how serious the first is,
wouldn't it still be a good idea to attempt the second anyway?
Perhaps I've been listening too much to George Lakoff or Jeffrey Feldman
talking about the importance of word-choice in framing discourse and
debate. But I truly see this "theory"=="hypothesis" misunderstanding as
an unnecessary source of trouble, and think underplaying "theory" in
favor of something more readily apprehended by the layman might help.
--tom
Who, like me - believed God created the universe 15 billion years ago, used evolution rather than a production line to make humans - and pissed off and left us all alone like a crazed scientist, waiting for an unbiased experimental result ?
Why did he have to make it 10,000 years ago instantly filled with people and 2 million year old relics ?
EMail: 0110001101100010010000000110001101110010 0110000101111010011011100110000101110010 0010111001100011011011110110
damn AC's hiding their informative posts.
Darwin's famous book is called "The Origin of Species" and deals with how the different species came into existence, not how life came into existence. Abiogenisis is the study of the origin of life itself, a completely different field from evolution.
being vague is almost as cool as doing that other thing...
I am saddened that your "Christian" friends treated you that way. Souds like they were trying to guilt you into staying in the cult. Heinous and sick if you ask me.
Just remember that one of the basic tennents of Christianity is that mankind is imperfect and subject to what we will call wishy-washyness. Someone who declares themself a Christian, and then is caught doing things that are decidedly un-Christian, is only a living example of the doctrines of the Bible. Their actions after they do these un-Christian things reveal their strength of character and recognition of the ideals they portray as valuable to themselves. It is easy to point fingers and scream "hypocrite." It is much harder to acknowledge that all people are posessed of a nature that is fraugt with imperfections and a yearning to do what is right that is many times unfulfilled. It is even harder for people to acknowledge this knowledge in a deep and personal way.
Even more interesting is the fact that other people will reveal their character in their reaction to that transgressing person. In ohter words, what you think about someone else (especially someone else in an all too embarrasing human situaion) says more about yourself than it does about them.
When the only tool you have is a claw hammer every problem starts to look like the back of someone's skull.
If you apply some logic to this then I'm sure one question might pop into your head - Why is this so? Surely its not for lack of scientific proof. If we rely on science to create our template for truth, why would we ingnore it and futhermore, ignore it in favour of theories that imo have absolutely no substance or base in reality. This is not a matter which can be blamed on science because science has done and continues to do it's bit. Information is power and power is wealth and religion has produced some of the most powerful and wealthy people the world has ever seen. Think about the 'Gatekeepers'. There are many, many, reasons why science would be brought to it's knees; a knowledgable society is not one of them. This unforunate situation is something that has to be addressed more forcefully by the global scientific community. The media had portrayed science with a rather unfavorable image for a long time and because of this kids think its dumb. Personally, I'm hoping Toffler was right and that we'll come out of this brushing the dust off our jackets. Rant over.
Don't set your machine up so that you can't pull the plug.
ah ok, my bad. I see the assertion you are challenging. "Most Christians aren't really Christians." I agree, a little too broad and misguided.
I'd probably have been more comfortable if erroneus made two separate assertions:
1) Most Christians believe that they themselves are being good and true Christians.
2) Most non-Christians believe that Christians do not act the way that "true" Christians should act.
Again, totally unsupported and subjective. However, it adds in the point that everything is relative to the observer. Rather than everything being absolute as was originally asserted.
"1: The existence of God is proven (or disproven) definitively to every dead human being."
You're kidding, right? Because this would presuppose awareness, if not conscoiusness and self-awareness on the part of a human after death, for which you have zero - and I do mean zero - evidence. No one, not even you, can prove that a dead human being is anything more than compost.
Your argument starts off with an unprovable statement. A glib and clever-sounding one, to be sure, but unprovable.
"Win treats sysadmins better than users. Mac treats users better than sysadmins. Linux treats everyone like sysadmins."
The handy thing about natural selection is that eventually, everything will turn out alright. Just probably not in your lifetime.
That there is 52% of the Slashdot community that is modded as troll's?
The truth lies in peanut butter.
Creationists are a lot like zombies. Slow, but powerful and numerous. And they all want to eat our brains.
(bear with me here - but first, set aside your ideology, whatever it may be...)
The vast majority of atheists are pro-choice, yes? The vast majority of fundamentalist type Christians are pro-life, yes? If I am wrong in these, please say so.
If the atheist demographic practices abortion/contraception regularly, and/or prefers a heavily-involved career to childbirth and family? The progeny will comprise a smaller pool of humans than those born of those that believe in having large families and not even bothering with contraceptives (let alone abortion).
Note that "fittest" does not necessarily mean "most intelligent", or "what ideology I think is best", or anything beyond "most able to survive, reproduce, and therefore increase a given species' numbers".
This alone is either proof of natural selection at work - or it is proof that it is not, if you assume "fittest" to be "best" in more than just the reproductive aspect. It doesn't matter whose laws (natural or supernatural) you believe to be supreme here - it is a simple chain of causation that I would actually love to see someone try to refute, instead of merely recoiling in fear and anger and shouting "flamebait!".
Quo usque tandem abutere, Nimbus, patientia nostra?
It appears the 48% statistic given by slashdot and the MSNBC / Newsweek article may have been transcribed incorrectly by the journalist summarizing the data. According to the poll data tables (http://www.msnbc.msn.com/id/17875540/site/newswee k/) (see table 13) linked from the original article, the 48% is actually the number of people who said evolution is 'Well-supported.'
Also from the same table:
--39% think evolution is 'Not well supported.'
--13% 'don't know.'
But this doesn't change my opinion that it's still a rather poor poll question.
I was wondering why there was suddenly an influx of "double redundant posts" on slashdot.
being vague is almost as cool as doing that other thing...
About half of our country rejects evolution, some going so far as to say Creation is fact and the Earth is 10,000 years old. About half of our country voted for Bush. About half of our country is stupid. Makes sense. As long as the North kept the superior military and made the big decisions (the south just enough to defend itself,)I'd say we should split back up. As a bonus, the South would have to deal with Mexican immigration, and we could wipe our hands clean, blame everything on the South and try as hard as we can to clean up our image internationally. We'd definitely have to get props for giving these morons the ax.
Can you explain how modern communications, transportation, efficient industrial processes, satellites, computers, medicines, vaccines and treatments, the whole litany of technological accomplishments borne directly from scientific research are not beneficial? Your argument seems to be that since the application of our newfound understanding is sometimes flawed that the scientific process itself is somehow deficient. Or should we simply suppress any research results that might have negative application? Many have suggested that, but the problem is that a. you can't always tell and b. it might go both ways. Usually it does, and usually any applications are far more positive than negative. Otherwise we'd have discarded the scientific method a long time ago and tried something else.
... it is a problem with people. Science is a tool, nothing more, and it's people that use (or misuse) their tools.
Put it this way: the scientific method is nothing more than a way to figure out how the Universe works. That's it, that's all it is, all it ever meant to be. Science is the only pattern of thought the human race has ever invented (and we've tried a bunch!) that reliably determines fact from fiction. Some people perceive that as a threat, for reasons that only make sense if you wish to promulgate ignorance. As a civilization, we need that ability or all of the problems we are facing will never be solved because we'll all be dead. That's enough benefit to convince me, anyway.
It sounds like you are concerned about the applications of such knowledge. And that's fine, because there are a number of legitimate complaints that can be lodged against corporate and government misuse of scientific research. That is not a problem with science, however
The higher the technology, the sharper that two-edged sword.
Jesus is the only one on that list who fits his description of "shepherd" (Mohammad was merely a prophet and teacher, the rest are of course jokes). It's no great trick to assume the Christian world-view and then show that Christianity fits it best.
People are sheep, most of the time, but we also have those few flashes of non-sheepdom when we notice that our (human) shepherds are stepping outside of what our personal overriding principles dictate. For many religious people those principles are dogmatic, for the secular minded they are based in reason and ethics.
A little bit back on topic, is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?
I certainly would be, if it did, but it hasn't come to that. Many of these polls are poorly worded, and miss a lot of nuance, but they have been very consistent in showing that those who reject the concept of evolution entirely, do so in favor of creationism, not some other scientific theory.
When the options are:
(A) Evolution
(B) Creationism
(C) Both
(D) Other
almost no one chooses D (the popularity of the other ones is usually: B, then C, then A).
Calling the acceptance of evolution as the best supported theory a "belief" is the old tactic of repeating a strawman ad nauseam, in the hopes that people get tired of denying it every single time (kinda like calling atheism a religion).
sic transit gloria mundi
Yes. This is slashdot.
being vague is almost as cool as doing that other thing...
When I fist read the title I thought it meant "48% of American's refuse to evolve". I am not sure this erroneous misreading is actually that wrong after reading the storey.
I don't make predictions, and I never will.
Come on, who cares? Let people be ignorant. It's not like bringing people of below average intelligence or fundamentalist mindset into the scientific fold is going to make them valuable contributors. It'll just be a new type of ignorance to deal with. Let them be.
They vote, they help elect our leaders, they get on school boards, they affect what laws get enacted in our country.
Majority (noun): the greater part or number; the number larger than half the total.
Just in case there is any remaining confusion to have a majority you have to more that 50%. In the case in question you have a majority of Americans being non-Christian.
It's disturbing because you're defining intelligence in terms of whether someone accepts materialism and empiricism as the canonical, and only correct, avenue to gaining knowledge. It's almost as if you have never even heard of epistemology, and yet you're ready to call anyone dumb who has a different epistemological stance than you.
I am not impressed with the idea that all religious people are dumb, or that all people who reject evolution are dumb. My uncle was a Baptist minister and fairly fundamentalist in his beliefs, yet he had multiple graduate degrees in various subjects, played the organ well enough to participate in the occasional recital, was an avid reader, was a pretty good chess player (better than me, at least), and was virtually invincible at Trivial Pursuit. There are other people like that. To believe that all religious people or all creationists are dumb is itself to ignore the facts, ironically.
My guess would be the 75% of the users of the internet don't even know what Arpanet was (and that is was created as a weapon during the Cold War).
Probably way less than that. But ARPANET was primarily a way for researchers to share supercomputer power and research (and by no means was all of that used for military purposes) and as a part of the military's CCC structure. Really not a weapon per se, just an enhanced communications medium, and the benefits to the scientific community were legion long before it turned into the advertising medium now known as "The Internet".
Generally, when I can't find a good segue, I simply fall back on John Cleese's "And now for something completely different."
The higher the technology, the sharper that two-edged sword.
Something that jumped out at me when reading the article was that the subject pool was only 1,004 people. I will admit that I am no statistician, but 1000 people sounds quite a small number to represent almost 300 million people. The location of the people polled could have a drastic effect on the results. If you polled 1000 people living in the bible belt, the results would be vastly different than, say, someone in San Francisco or something. Anyway, correct me on this if I'm wrong on this, it's just that this little tidbit stuck out to me.
very insightful. I am curious though, what is your religious bais?
Who exactly was polled and how many were polled? Claiming 48% of Americans is just stupid. Did someone poll close to 150,000,000 Americans? I doubt it. Hey, I can come up with a "poll" that show that 80%+ of Americans support affirmative action. All I have to do is just poll mostly black communities. Heck, I can even come up with a poll that shows that XX%+ of Americans want the Mexican border open. I just have to poll mostly Hispanic communities.
/.ers responded to this FUD. I know many Christians that don't believe that 10,000 year old crap. I am one of them. I am a Christian and I believe the earth is very old and ... I believe that evolution is a natural part of the world/Universe.
/. users if they have ever had sex. 8 out of 10 said no. So I guess I can say from my "data" that 80% of /. users have never had sex?
I cannot believe how so many
Faith is faith and science is science. Many religious people can keep them separate.
Hey, I have a cool "poll". I asked 10
I personally hate when people do "polls" to try to push their agenda.
There are Muslims out there that believe if they die a martyr they get to go to "Paradise with 72 black eyed virgins". In Hinduism, people believe that when they die they will be reincarnated. Christians believe in life after death where you live for eternity with God when you accept Jesus as your saviour. Jews believe similar, though with out Jesus and they believe to live by laws passed down by God. There are religions where people think it is wrong to even kill an ant. Atheists believe that when they die, they are gone for ever and will just decompose.
So, my point is that there are many different beliefs in this world. It would be very easy for me to construct a "poll" to make any one of those belief systems look dumb. Get over it. There are billions of people and guess what? We have many different beliefs.
General, you are listening to a machine! Do the world a favor and don't act like one.
Religious zealots attack the Theory of Evolution because they think they understand it. The premises can be simplified (with requisite loss of meaning of course) to the point where the average uneducated person can poorly paraphrase its basic premises. Clearly, it disagrees with both of the two (yes, two) Genesis creation myths-- the one where "Man and woman, he created them," and the one with Adam created first, and Eve out of Adam's rib.
Take this person, and try to explain the Stern-Gerlach experiment, which first demonstrated the existence of quantum phenomena. I've had more physics professors explain it inadequately than explain it well. Try to explain the twin-slit photon experiment. Try to explain the non-local nature of quantum phenomena, or Heisenberg's Uncertainty Principle. Explain how a Feynman Path Integral works. I won't even touch the General Theory of Relativity.
The people who cannot accept the Theory of Evolution would launch a pogrom over the Second Law of Thermodynamics, if they understood it. Physics contains dozens of premises every one of which is much, much scarier than anything in biology. They pick on Evolution because they think they understand it. Once the Nazis twigged to Quantum Mechanics, they began clearing out the universities and filling the concentration camps. Don't think the Religious Right, were they smarter people, wouldn't do the same.
"Indeed, it is wise never to consider any form of electronic data as final." --Arnold Robbins
Execute people in the street? Gee - good thing those Religious freaks have never been a part of that huh?
I'm guessing this wing-nut statistic has a lot more to do with the fact that 34% of Americans self-identify as conservative or evangelical Christians.
In the part of the industrialized world that ISN'T crazy, (meaning - basically everywhere else in the West) it's a very different story.
.Robert
The issue is that "skepticism" towards the theory of evolution is emblematic of a rejection of science itself.
That person does not speak for most scientifically inclined people.
I can guarantee that as long as I live I will never assign a negative connotation to the word "skepticism" (I am of course going strictly by its Greek origin "skeptomai" - "to examine, consider").
sic transit gloria mundi
Every time someone tries to say, "Well, look, let's try to match our terminology to what the law says and the law calls it 'copyright infringement'" someone else starts shouting "IT'S THEFT AND I DON'T CARE WHAT THE LAW SAYS!" Regardless of whether it is "theft" or not, when one party says, hey, let's try to nail down our terms so we can communicate and the other refuses to do it, you're going to have a conflict. Guaranteed.
Anyway, I don't think it's so much that if you say things over and over they believe you, it's just that they get bored of hearing you say it over and over and if what you're talking about isn't that important to them they just let it go.
The higher the technology, the sharper that two-edged sword.
Well-supported Not well-supported Don't Know
Current Total 48% 39% 13%
Evangelical Protestants 25% 63% 12%
Non-Evangelical Protestants 57% 24% 19%
Catholics 58% 33% 9%
Agnostics/Atheists 73% 18% 9% From this information, it would appear as though 48% of Americans think evolution is BOTH well-supported AND well-accepted in the scientific community. (The question, of course, is terribly constructed because it conflates two potentially divergent beliefs.) 39% believe EITHER it's not well-supported by evidence OR it's not well-accepted in the scientific community, and it's easy to see how propaganda would make it easy to influence people on one of those two variables.
Certainly, it doesn't seem to support the proposition from TFA, that "Nearly half (48 percent) of the public rejects the scientific theory of evolution".
Is it possible MSNBC/Newsweek didn't get their facts straight? Or am I missing something?
"You're the retarded offspring of five monkeys having butt sex with a fish-squirrel."
Seriously though, I'm a believer (of evolution).
Will evolution dismiss the same 48%?
This is a great, concise statement of the legitimate basis for scientific theories, and the best I've seen in this thread at that.
People are not going to stop inventing, trading and banking simply because they disagree with someone else about a purely abstract idea.
Many inventions, especially in medicine, rely on the *fact* of evolution. So, though inventions will continue if everyone believed the Lord God created the Universe 10k years ago, and evolution is a deception of de debil, many things will *not* get invented. Life-saving things.
The rejection of the proven, objective epistemology of the scientific method will lead to ignorance and superstition.
I do now say people have to give up their faith. But I suggest they might want to give up their belief.
Microsoft is to software what Budweiser is to beer.
I cannot help but be reminded by what Alberto Moravio said:
"The ratio of literacy to illiteracy is constant, but nowadays the illiterates can read and write."
Alberto Moravia, The Observer, 1979
and while we're on the subject of Italians, let's never forget that Gore Vidal advised allowing the Bible Belt to teach fundamentalism and creationism on the basis that they would disappear within two generations.
Galileo could happily remain under house arrest in Florence while seafarers sucessfully discarded charts based on Ptolemaic systems and navigated the Earth using Galilean methods.
Why was Britain so succesful during the industrial revolution? It never allowed religion or ignorance to get in the way of making money using science.
Posts, MyBio or Sig, may contain satire, sarcasm, bolded nouns be sardonic or even witty & be Church of SD
Listen! Genesis is in NO WAY a basis for history! While it may have some moral basis in it's stories (i.e. Noah) the earlier in the Old Testament it is, the less reliable it will be. Why? Simply because of oral tradition. Most of the Bible as we know it were passed down by word of mouth until writing it down became a custom, creating the Torah.
Science is a good a right practice, from which we get things like the computer, the air conditioner, shampoo, etc. etc.
Don't be idiots. I, being a Christian myself, don't accept Genesis in it's entirety. It doesn't make sense, and unless God tells me what happened or simply to believe Genesis, I'll go on my way believing in what matters to me and my faith.
Britons Unconvinced on Evolution Did Humans Evolve? No, Say Americans
You are a stinking animal. Get over it. Love (the passionate one you feel in the first 5 years of meeting somebody) can directly be linked to hormons delivery in the brain. This 5 years periods can definitvely be traced to the divorce rate being higher at the end of it, and the drop off when that type of neurotransmitter drop down in level. As for the "longer" love I would not be surprised that there is a similar explanation based on neuron pathway created during those 5 years. Remmember the brain learn by repeating.
Yes this is all chemistry despite you prefering to think you have a soul and be a "higher" being than the rest of the animal, in reality you are a mamal and you simply go in a complexer "rut". Sorry to break it to you , you aren't "superior" and "chosen".
C. Sagan : A demon haunted world:
http://www.amazon.com/gp/product/0345409469/
visit randi.org
Only 48% think that? I thought it was a lot higher... I mean, there are a lot more stupid people than that :)
Depressing polls like this make me think that the evolutionary scenario portrayed in the movie "Idiocracy" is already happening. :-(
9/11 Eyewitnesses to Explosive WTC Demolition 1 of 2
"intentionally conceived without basis in reality" godS with a small g and a big S, as well as spiritS, ghostS, comes under multiple form and mythos of creation, and are ALL unproven if you use only logic and evidence gathered in the world. ONLY if you use faith and circular reasonning can you prove gods exists. Let me use 2 examples : can you prove the existence of shiva , brahama, and vishnou to a , say, western christian ? Can you prove the existence of the christian god to , say, a brahamist or an atheist ? If in BOTH case you can only bring them to an agreement of possibility, then the existence of what you believe in is 100% UNPROVEN and can really be qualified as imaginary from somebody not being in your faith.
C. Sagan : A demon haunted world:
http://www.amazon.com/gp/product/0345409469/
visit randi.org
Welcome to the new dark ages. now we have the inquisition with computers. instead of witches, we have terrorists.
burn the terrorist! he turned me into a newt!
im so ashamed we have let our country become what it has. and still it continues.
-.no
poke fun at christians... at least they're not executing people in public like it's civil.
Frankly after seeing my ex wife turn into a born again nut (and putting up for her drivel for almost 10 years), I'm willing to wager that most "Christians" would be all for stonings and public executions, only they don't have the guts to say it out loud.
Seven puppies were harmed during the making of this post.
Evolution implies natural selection, and with that many stupid people alive, i am starting to think there is ground to invalidate the evolution theory. I still have faith tho, hoping few hundread years will fix that.
This must be the 48% that also believe Abass Ayeni Dantate, a very wealthy Nigerian, has over $35 million waiting to be transferred directly to their bank accounts.
Warning: Could be fatal if taken seriously
In a pluralistic and democratic society, differences of opinion and belief should not only be tolerated tolerated but encouraged. Quite frankly, some of you staunch supporters of Darwin sound more fanatical than the biggest religious fanatics in the middle east. Get over it and live your own lives.
Jesus was a compassionate social conservative who called individuals to sin no more.
To which I said:
Which then caused this rant:
Which of course is based on even harder science.
Let's not turn Darwinism in to a new religion with its own close-minded zealots -- but if you're going to make claims, then don't be like your "opponents" -- back it up with science.
If you can't, don't just fall in to an apoplectic rage and begin spouting about how everyone else is wrong. You'll start to sound like one of those fundamentalists, with the only difference that you've got a poster of Darwin and an evolution fish on your car.
At this rate, with all the vitriol on this topic, it's only a matter of time before followers of the Flying Spaghetti Monster start beheading hostages... :-)
About 44% of US adults say, when polled, that they go to church once a week. About 20% actually show up. People thus self-report much higher levels of religion than they actually practice. Polled numbers should be derated according.
The 2001 National Survey of Religious Identification, the largest study on this in the last decade (113,000 respondents) came up with the following self-identified stats, for religions with 0.1% or more market share:
Major trends are that "Secular", "Islam", "Buddism" and "Hinduism" were all up over 100% since 1990.
It's kind of disappointing to see so many people assume that just because one does not believe in evolution, they're stupid or poorly educated. This certainly isn't the case, as a majority of those people are quite intelligent and do well in school and in the field as well. For example, I know of several Christian families that have home-schooled their kids, and while they've taught them of the principles of evolution, those kids do not believe that evolution is a proven fact. Yet all of these kids are quite smart, the younger ones having been taught advanced concepts like calculus and advanced physics in their early teens, while the older ones have been accepted to some pretty prestigious universities. And it's not just the home-schooled kids either. I've seen plenty of public-schooled kids who don't believe in evolution do the same. Granted this probably doesn't apply to everyone who disbelieves evolution, but there is enough of a majority that they can't be generalized in that manner.
And really, does the belief of whether evolution is a fact or not really affect much today? I mean, someone who disbelieves it is probably not going to encounter difficulties living his life, even as an intellectual. Whether evolution actually occurred or not doesn't affect the fact that humanity is here today.
But more importantly, this whole argument is really causing a lot of people to consider others "second class citizens" of a kind, just because they don't believe what everyone else does. Speaking only for the US here, our country was founded on the idea that people would be free to believe what they wanted to believe, whether it be a particular sect of Christianity, Mormonism, Buddhism, or even Scientology. Heck, people don't even have to believe in anything and that's just fine as well. (Not to say that the US is alone in this regard, as there are several other countries that follow this ideal as well.)
Let's not judge people's intelligences by what they believe . . .
Richard Dawkins made a great two part documentary for the BBC called "The Root Of All Evil?" His book "The God Delusion" is heavy going, but the doco is accessible by anyone. Is there a US TV network that is brave enough to show it? One point made in both is that the fundamentalists vote in their own, and they hold a belief that Armageddon is a good thing as it heralds the return of Jesus. You end up with a President who thinks it is good to blow up the world. Fundamentalist belief is not a harmless delusion.
There must be some clearly drawn definitions here, particularly on the meaning of the term "evolution". If we are discussing micro-evolution, or small changes of color, etc. within a given species, then science definitely does prove this true. No intelligent person, Christian or not, disputes this.
However, as regards the macro-evolution, or changes of basic structure between different biological phyla, such as the sequence of amoeba > fish > land animal > ape > man commonly taught in our textbooks and public schools, the case is quite different. There never has been incontrivertible fossil evidence proving this to be true. In fact, the fossil record has shown that the different basic forms of life appeared suddenly, and fully formed - take, for instance, the cambrian explosion.
If you desire to bring up the many "missing links" supposedly discovered of apes with tailbones, etc., I highly recommend you investigate the book "Icons of Evolution", written by an evolutionist, which gives, in detail, the accounts of every famous attempt at a missing link, and proves the findings either mistaken or outright faked.
I am a creationist, and believe that the Bible and Science must, in the end, agree. However, you must look over the historical record and ask yourself, between the two, which one has stayed fundamentally unchanged throughout centuries. If I lived in Newton's day, and based all of my beliefs on the infallibility of Newtonian mechanics, I would inevitably wind up making false conclusions, because Newton's theories were incomplete.
If I, today, base all of my beliefs on current scientific "consensus", I will also wind up making some false assumptions, because our theories are still incomplete, even if we won't find that out for another hundred years.
So, as the cutting edge of science is continually changing our assumptions about the world, all I can try to do is apply the new understandings that *have* been proven to what the Bible has always, and will always continue, to say.
Take, for instance, the issue of the age of Earth, and the perceived discrepancy between the geological record and the biblical account of a six day creation: on the surface, without trying to twist the written account into ridiculous claims of day-ages and such, there appears to be no solution. However, taking the tested and fundamentally proven theory of relativity into account, the possibility of two different measurements of time comes into play. This gives the possibility that both the six day creation (with some 7 to 10 thousand years following) and the astronomically-derived 13.7 billion year age of the universe are, in fact, correct. It just depends on your perspective. And, if you carefully read the beginning of Genesis, you will find that it actually claims that this was the account of the "Heavens and the Earth", connoting a Universal, not an Earth-based perspective of the account.
The bottom line is, the evolutionary account of universal development has not been conclusively proven, and until it is, both the creationist camp and the evolutionists are both exhibiting a great deal of faith to believe their respective creeds.
Because evolution is, in fact, a creed. I simply wish that evolutionists would have the intellectual balls to admit that their beliefs are simply that - beliefs. And they require at least as much faith as the beliefs of Christendom.
- Alex Wolaver
Can be skewed to how ever you want them to be.
What 'segment' of the population did they use? How accurate is that to the *entire* population? ( hint: its not, its all a numbers game. )
---- Booth was a patriot ----
Here: http://fast.info/god
"the absurdity of rejecting science while depending on it so heavily is just lost on these people."
Their contemptible level of superstition is armor against logic.
What this tells us is that in order to make headway against them, we need to relentlessly attack their nonsense with even more logic and evidence. This is not to convince the religious, who are only fit to be ruled the the Karl Roves of the world, but to sow resistance among the young and the freethinkers who are not American Taliban. Every person we can encourage to doubt religion is a small victory.
We can't change the ignorant masses, but the people who embrace science and technology are often in position to influence and rule lesser humans.
We shouldn't scorn what NeoCons do with the mob. We should learn from it.
"This post is an artistic work of fiction and falsehood. Only a fool would take anything posted here as fact."
"God is Light" -- the Bible
....
... at the end of the day, God is too big a concept for anyone to grasp anyway. Functionally, "all you need is love". Of course, that too is a bit abstract. So I would like to amend that to, "you have a friend in me".
So, according to it, mutations are caused by God.
And wasn't life created on the primordial earth by lightning?
Hahah, I'm just being playful. So take no offense.
And I wonder, has anyone thought up an experiment to prove or disprove God? That sure would be useful! But a God that responds to stimuli doesn't seem like an omnipotent will to me
Oh well
Have a swell day, random dude.
random underscore blankspace at ya know hoo dot comedy.
Science is a tool that lets us get useful, predictable results out of nature, and tells us something about how we interact with the Universe. By all intents and purposes, it's an extension of our fingers -- we can "touch" things with our minds, thanks to science, and know them through that.
Religion, on the other hand, is what allows us to keep on touching and knowing things without feeling the weight of the meaningless chaos and nothingness of the Universe bear down on us. For some people, science is their art, it's their skill, and they find solace in discovery.
But should that be the only avenue towards finding meaning for our lives? I think that would be a bit ethnocentric to conclude. Yet that's also not to say, anything and everything is acceptable, because we do have a society to maintain.
random underscore blankspace at ya know hoo dot comedy.
What's purple and commutes? An Abelian grape.
I think a good analogy would be to see life not as a tree, which would be a lot of ARBORtrary (haha, I'm here all night folks) boundaries, but to see it as a kind of river. It's a liquid force, trickling into places that yield to them.
... *want* to ~live~ so *badly*?
What's so amazing about life, though, when you get down to the core of it, is it's DRIVE. Why the hell has the universe produced such a thing, when it's paradoxically so blind to its existence? Actually, life seems more like fire than like water -- why why why does it
random underscore blankspace at ya know hoo dot comedy.
First off I'll say I believe in evolution, but I've also had years of advanced education. Some specifically geared towards evolution theories, genetics, geology and even some geared towards trying to actually understand what goes on durring 50-million years. Back to my point evolution is not an easy concept to grasp and I'd say 90% of those that believe in evolution have no grasp on how it actually works. For me I feel like I'm trying to explain to somebody how a microwave works to somebody who's never seen/heard of a microwave. They aren't going to believe it until you can actually show them a microwave (and then they hang you for witchcraft). Even the scientest themselves tend to get into alot of arguments on how evolution works because we can't exactly test it very well. I feel like trying to come up with a great theory of evolution is like trying to put together a million piece jigsaw puzzle with 500 pieces.
idiot, n.: A person dumb enough to accept fair tale creation myths written by people who thought the earth was flat, in lieu of science. People who ironically provide a constant reminder that we are nothing but psychotic apes. These wastes of carbon should not be allowed anywhere near a doctor, nor should they be allowed to use anything else that owes its existence to scintific discovery.
(%i1) factor(777353);
(%o1) 777353
I wasn't asked to participate in the survey, nor anyone I know. So the numbers represented here are in fact just random numbers that mean nothing. It's sad, but true. If you ask 100 nascar fans about nascar they'll 100% agree it's awesome, etc. nothing to see here guys, move along.
There's a ton of confusion as to what people mean when they say "evolution", and especially in a TV SURVEY!!!
Evolution happens. Species change to adapt to their surroundings. I believe in evolution.
But then to go to this "grand mal evolution", where everything in existence started from a single cell somewhere? That makes no sense to me. I think the various creation myths, including the Judeo-Christian version, make a lot more sense than "the single-cell that could".
Believe what you wish, there's no way to prove ANY theory about our beginnings or our end. I choose to believe God created us in seven days, simply because I believe God could do it. Why not?
But it's not like it causes my universe to shatter when people offer other views. Bring on the discussion! But please, can we elevate it beyond the level of some sound-bite grabbing survey?
"The large print giveth, and the small print taketh away" -- "Step Right Up", Tom Waits
this goes along with 70% of college freshman who do not understand compound interest and 1 in 3 highschool senior cannot find the pacific ocean on a map.
Ah, but there's a difference between what we see survival of the fittest as (sure, it exists amidst various breeds of animals) and animals actually creating new genetic material... as in, gaining systems of whatever, through many small modifications.
How evolution works itself does not seem to be a simple thing. Is it small tiny modifications (if so, then how would any small modifications last, since it'd just be extra random junk hanging around that does nothing), or is it more of a sudden one-generation-jump and you have eyesight, etc.
Even in the theory itself, there are a lot of mechanics that I think everyone would have to simply say, "We don't know."
Now my question is, why should evolutionists or creationists say that the other is stupid and unintelligent when both parties believe in things they can't prove? You can't prove, empirically, your mechanics of evolution, can you? We just recently had an article on the mechanics being rethought (well, the path the presumed mechanics took, anyways). So you're taking it sorta on faith (gasp, the evil word).
(of course, we all know that the real measure of intelligence is whether or not they use linux... *bites tongue*)
I don't understand how 'rational thinkers' believe only in a recent fad in science theorized by Charles Darwin. If you don't subscribe to this idea then you must be a 'Christian'.
I believe alien species came to this planet and crossed their genes with neanderthal 455,000 years ago so that we may work as slaves mining gold for their planet. Seriously. It doesn't seem harder to swallow to me than the idea that monkeys eventually 'evolved' enough to develop crude tools & then of course nano-technology; the obvious next step.
Does that make me a creationist? I guess so. But I doubt there is anything other than a not-so-well planned out conspiracy to maintain human enslavement in the bible. If you look thoroughly, and read ANYTHING by Sitchin, it is pretty obvious that Jehovah was an evil motherfucker and regarded humans as nothing more than cattle. Bad alien, bad! But brilliant geneticists.
Darwin is flat-world. In the future people will laugh hysterically at the idea that 52% believed in evolution.
Believe it.
Actually, evolution is an interpretation of facts observed in nature and is thus a theory.
No... Evolution is just the word we use to describe hereditory systems that change due to "survival of the fittest". Applied to the evolution of species it was only a theory as long as it was based on a theorized heereditory mechanism... when that mechanism (DNA) was then discovered, it became a fact.
Honestly, I'm not sure I can fully articulate my logic behind the previous "it takes far more faith to believe that a "deity" did not create human life" statement. There are so many years of deliberation behind coming to that conclusion that I really can't state it concisely here. I hope to be able to some day, but for now all I can do is encourage you to be unbiased, consider the evidence, and decide for yourself.
One book that helped me to weigh some of the scientific evidence available to us today is entitled, "Case for a Creator" by Lee Strobel. ( http://www.leestrobel.com/ )
Where I come from, this post's title is a joke on its own :)
Yes, we Canadians are comfortable with the fact that a large number of Americans are blissfully ignorant. On the other hand, you have more money and bigger businesses, evidence that intellect and wealth are not necessarily linked.
[/Sarcasm]
Jokes aside, religion seems far bigger in the states than it is up here in the freezing cold. That probably has a lot to do with it, as the theory of evolution goes directly against many religious writings. The preached nature of most popular religions makes such dilemmas difficult. Followers are told to blindly accept "the word of god" as law. Don't turn gay, don't eat pork, don't let women speak, and most importantly don't ask why things are the way they are! Many people can't adapt religion to reality... they don't even want to consider the fact that maybe evolution and "god" can coexist.
In the end, if the jesus freaks don't like evolution, I'm fine with it. They can run their own evolution-free colleges and teach whatever the hell they like; live their own lives and leave mine alone. The biggest reason why agnostics/atheists dislike religion is because they're always trying to push their version of reality on everyone else like it's they're goddamned Dreamhost resellers!
-Billco, Fnarg.com
People compartmentalize, so it's not surprising to find people who are otherwise intelligent but don't accept evolution, but OTOH there comes a point where denial is a form of stupidity or abnormaility. What if I was a college graduate who didn't accept gravity, or didn't accept that we're all going to die? At what point do you say that despite the degree I'm stupid?
People can have all the additional beliefs they want, but evolution (changing of species, creation of new species) is something that HAS to happen given that we're based on a changeable hereditory mechanism. Denying that the gene pool will change due to natural selection is like denying that the sea will come in.... I don't case how many degrees you have - that's just plain dumb.
You can't prove, empirically, your mechanics of evolution, can you?
;-)
The mechanics of evolution is just DNA and genetic inheretence, so I'd say it's pretty well proved!
Unless maybe you're denying that if I have more children that you then there'll be more copie of my DNA in our children's generation?
Speaking as a statistician, this poll bodes well for the bell curve, given the fact that half of all respondents (on average) are of above average intelligence, and the other half are below. So it does not surprise me that nearly half of the respondents articulated a faith in an invisible avenger, while a little more than half thought otherwise. I would be interested to see a t-test of correlation with the typical sociological questions asked in polls, such as geographic location, age, schooling, etc. This would better encourage me to finish reading such a loaded poll. And after reading the many responses to this post, it's no surprise that people who read this blog are inclined to fall into the "scientist" label. Speaking as an operant conditioner (i.e., a behaviorist), B.F. Skinner points out that we are products of our environment. But I am in both of the "nature vs. nurture" clans. Lemark posited that all life has the ability to pass on behavior through genes. That's not a shock to me, any more than the belief that our environment is remarkably responsible for our current thought processes. The term "social Darwinist" came from those politically bent toward the right, not from Darwin. Darwin never said "survival of the fittest." This is a common misnomer. What he actually said was those species which can best adapt to their environments do well enough to procreate, thus passing on their genes. He also never said that the genes passed on were superior to those of their predecessor, only that they were better suited for survivability in the current environment. Speaking as a theologian, I cannot. I am not one who believes in theology...call me agnostic. In fact, I agree with one's former comment that routinely bashing religion is to fan the flames of perpetuity for people who would be much better served to just forget about religion.
Love isn't just a noun, it's a verb. Too many people seem to lose touch with how deep the meaning of love can be.
Actually this brings up a deficiency in English. While English speakers usr "love" in various circumstances othe languages have different words for different meanings. For instance in Greek there are 7 different words that depending on the context English speakers would use the one word "love". In Chinese there are 5 different words. English words also can have different meanings depending on the context, heck the same spelling can be pronounced differently too and will then have a differnt meaning.
What a crazy language English is. If the plural of tooth is teeth then why isn't the plural of booth beeth? Or why do feet smell while noses run?
it's been suggested that relying upon Science requires no less faith than relying upon the Bible--I'm inclined to agree.
Science is testable and verifiable, I have yet to see how a belief in a "God" can do either. At least without using the Socratic method and drinking hemlock tea.
FalconShould there be a Law?
Why must you mock my belief system? I know that the Power Rangers are protecting us all!
Ah yes, the facts are everywhere. There's this planet, it has people on it, plants, bugs, fossilized bones in the ground, the bones have an isotope that can be measured, etc...
These things are undeniable. But, none of these things prove that either creation or evolution happened. And since none of us were there to see it happen, we are left with assumptions.
It's these assumptions that define the direction that people take to arrive at a conclusion. For example, you can either assume that the isotope in the bone has been decaying uniformly and at a constant rate and was thus formed millions of years ago. Or you can assume that the world was much different when created and suffered a cataclysmic worldwide flood, meaning the decay rate hasn't been uniform or constant.
So I think we'll be much better off the sooner everyone just realizes that it's not believing evolution that proves there's no God, it's believing there's no God that affirms a belief in evolution. Likewise, it's believing in God that produces a belief in creation.
Nobody is disputing facts. We just don't all share the same assumptions.
correctly postulated how human beings were genetically engineered from apes by visiting spacemen. It makes perfect sense.
This is a popular statement of Karl Popper's falsificationist philosophy of science. Falsification is known to be an inadequate demarcation criterion for what counts as science. No evidence can falsify any particular hypothesis, because we can always revise some belief other than the hypothesis.
Are you adequate?
Not only are there no other theories, this one is the master theory that ties virtually everything in the biological sciences together. It underpins and informs our understanding of all those many related fields. In laboratories around the world, day in and day out, its fundamental accuracy and applicability are proved again and again and again. No other theory ever developed has been so subjected to so many tests across so many application areas. Without it, we could never have made the advances we've made in molecular biology, in genetics, in physiology, in medicine--in dozens of related fields. If there's any model of our natural world that we know to work, it is this one.
--tom
Well, it's true.
If someone claims that 6+3 is 10, but when complain when you given them only $3 change when they pay you $10 for a $6 you know they were lying. You don't need to wax philosophical about people making their identities however they want. Most people who claim to be religious believers are liars in the same way that this hypothetical alternative mathematician is. So in answer to your question:
> Who the hell are you to decide what people "actually or truly believe"?
I'm happy to answer for myself - I'm just a regular guy who expects a modicum of consistency from the people around me. Don't you have a similar expectation too?
I should point out (as someone who was brought up Jewish) that Judaism is unique among religions for its lack of creed and indifference to what its practitioners (note I use the word practioner) believe.
Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
Actually, the evolution of complex organs has been researched for a long time now, and it has been found that yes, partial functionality (e.g. light-sensitive cells instead of a full-blown eye with retina and lens) is better than no functionality (no light sensitivity).
I suffer from attention surplus disorder.
Somebody with points please mod parent up.
Laissez lire, et laissez danser; ces deux amusements ne feront jamais de mal au monde. - Voltaire
For the Europeans, it was their acceptance of similar ideas that helped take them into the dark ages. And it was the slow rejection of such that helped lead them out of them.
I prefer the "u" in honour as it seems to be missing these days.
I'm not religious, but I do recognize that science is not the end-all-be-all, it needs to be complimented by philosophy
The irony is a "healthy" skepticism is the heart of science. Though it would be interesting to see how the question was asked, was it loaded such that it included the evolution of man? Many people, have a desire to be special, and being the exceptional case of decending directly from a higher power fills that need. For example I know a few religious biology majors who believe in evolution in all cases but people. It doesn't stop them from being intellgent productive scientists, they just have closed their mind to a specific case.
D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
Good points (especially if you take the emotion out ;-). One of your statements is particularly worthy of further consideration IMO: "...and that the scientific method is the most powerful tool we've ever built for ourselves in the entire history of our race..." Scientific method is essentially observation, hypothesis, prediction, and testing. For scientific method to work one has to be able to disprove/test the proposed theory, right? Take the big-bang theory for example, is it possible to even attempt to disprove the theory through testing? Perhaps down the road, but certainly not to the degree that it would take to confirm theory to fact. (btw, yes I understand the same argument applies to an intelligent design theory -- at that point you just have to decide for yourself)
related blog article I ran across you might be interested in:
http://hunstem.uhd.edu/HUNBlog/blogs/index.php?blo g=2&title=are_we_teaching_scientific_method_the_ri &more=1&c=1&tb=1&pb=1
there are some humans who still have small tails.
I prefer the "u" in honour as it seems to be missing these days.
That makes religious facts much more convenient. It doesn't take hard work to actually believe them, you can simply lean back and nod your head.
Oh but belief, as in faith in something, is hard, "you don't choose the things you believe in, they choose you". Once you have belief then things get easy, "It's that way because X wants it that way."
FalconShould there be a Law?
While I obviously don't agree with the outcome of the question, and it is straightforward to me. It is in truth, a compound question. It requires acceptance of both premises in order to provide a yes answer. Whereas disagreement with either statement could elicit a no. I'm just saying...
I really wish slashdot would try and stick to IT stories instead of worrying why I, and apparently 48% of Americans, don't believe the unproven* theorie of evolution.
I choose to believe what the Bible says, namely that God created man.
*I believe in evolution to the extent that it has been proven but no further. Because birds beaks vary depending on what type of food is available does not prove to me that single celled organisms eventually turned into walking, breathing human beings.
Nathan Friedly
48% of Americans believe that God is a freakish sadist who created a fake fossil record, fake embryology, fake comparative anatomy, fake mitochondrial DNA and fake molecular genetics to deliberately mislead his creations and to confound our attempts to understand the world that we live in. Because that what good (heavenly) fathers do: They fuck with their kids' heads.
There are two kinds of people: 1) those who start arrays with one and 1) those who start them with zero.
Ditto on your recommendation - unfortunately virtually no one on this thread who is an "evolutionist" will even visit the site and attempt to discuss even one point. They have already decided that Christians aren't smart and could not possibly have a competing idea or the ability to debate evolution in a credible way - now who is the narrowed minded ones? :-)
Sheep != Autopilot
The fact that the mind can perform autonomous functions without conscious input does not equate to sheep like behavior when it comes to philosophical beliefs.
I don't think it has and you exaggerate this assertion.
However, a belief that the creator of the magnificent universe would muddy itself and act in way of a tribal warlord (ie the lord is man of war) or command genocide and child rape, is in my mind, yes an indicator of either lack of intelligence or at least susceptibility to brain washing.
A belief that the world was flooded at short time ago when there is abundant geological evidence that it did not, proves something of ones intelligence or lack of critical thinking ability.
A belief that the creator of the great and small would feel threatened by a bronze age culture building a tall tower is... well indicator of someone who needs to believe in a bronze age god.
A few generations from now, society will be split into priests of high-tech and the masses, whose limited conception of science makes them beleive that a mobile phone of that time is magic. The priests will rule the world again and will send the masses to senseless crusades just to reduce their number to a level which is well-controllable.
Our country's science education could benefit more by including other, maybe lesser known or less supported, theories. It would be better for the students to look at the different alternatives and decide for themselves based on the evidence.
And what are these other scientific theories?
FalconShould there be a Law?
I've had a look. It's nonsense - the babblings of a lunatic.
What a long, strange trip it's been.
If you accept the stories, God made man in his image and also expects man to obey and worship him. To me this points to an egotistical God, so wouldn't it make sense for him to create something so improbable that it would in fact prove his existance, like the babelfish... though there's that whole faith requirement thing.
D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
Given the straightforward question, 'Is evolution well-supported by evidence and widely accepted within the scientific community?
/. would be more accurate. Assuming a reasonable sized population to get a reasonable probability.
If you answered "No" to that you're not rejecting, or supporting, evolution at all it. All you're doing is saying "No" to one of the two situations in question, evolution well-supported or accepted in the scientific community. This is simple logic here if one of them is false the whole statement is false.
If you asked the straight forward question, "Do you believe in evolution?" and then 48% of the responses said "No", then the title on
"To be is to do." --Socrates
"To do is to be." -- Aristotle
"Do-Be-Do-Be-Do..." --Sinatra
We may have to agree to disagree. 6+3 is demonstrably less than 10, while there is no such test for 'religiousness.' I completely agree that many religious people come off as hypocritical at best, liars at worse, I just think it's unfair (and, more to the point, outside of the scope of abilities you possess) to determine whether or not someone else holds true to their personal beliefs about their relationship with $DIETY. I don't believe I was waxing philosophical about self-created identities, and I don't think you've responded to my point of contention - how do you know whether someone else is "truly" or "actually" Christian?
Again, your comment implies you can judge who is "truly" or "actually" Christian, across the board. I reject the premise of your claim, and think that if someone says, "I am Christian," the only person they have to answer to is themselves. Now, as someone else in this thread noted (and I agreed) you could point out their hypocrisy and that they're not holding to their self-expressed value/judgment/etc system. I wouldn't have a problem with that, and I'd probably agree with you. I just really strongly feel this is, at least in part, an issue of people being able to choose their own identity.
Thanks for replying though. Sorry if (rereading my comment) I came off as an ass.
-Trillian
I always wondered why I hated half the people I meet... How can you not see evolution? Blinded by ignorance.
Every time I start to have faith in humanity, I ruin it by driving to work between 7 and 8 am.
And if the other 52% have evolved in the same fashion as micro-evolution, then you should find you are just a little less smarter than the other 48% since micro-evolution always results in loss of DNA or features (a mutation). Don't despair, I'll loan you a couple genes. :-)
the question evolution fails to answer and which makes it counterintuitive is "Where/How/When did it all start"
Eveolution DOES NOT try to answer how things, life, started. That is not it's purpose. Evolution seeks to explain how we got here and where we are headed. At least that's how I look at it.
FalconShould there be a Law?
DNA + "survival of the fittest" = evolution. It's not a theory - it's just a plain consequence of the the tautology "survival of the fittest" and the fact that we're based on a naturally varying chemical hereditory mechanism (DNA). If you don't understand that people who have more children leave more descendents, or that we're based on DNA, then, YES, you are stupid.
People have known for a very long time that people who have more children leave more descendants, and that attributes of the parents were often expressed in their children (even before there was a clear scientific explanation of why). And yet, countless brilliant people over thousands of years didn't really figure out what was going on. In fact, that the degree of speciation observed in nature is completely explainable by those two things is very surprising if you come at it without the benefit of modern scientific knowledge and philosophy. You may recall that this was a pretty big deal when the pieces started falling together, even for people who didn't have any particular objections to the possibility (religious or otherwise). For most of history, correct understanding of or belief in evolution has had zero correlation with intelligence, and to claim that after such a short timespan it now has a 100% correlation is kind of ignoring the culture we live in and the time that fundamental philosophical shifts always take to sink in.
You can say that evolution is true, and you can say that poor acceptance of it is, among other things, a worrying aspect of our educational system, and should be addressed. I'll agree with you there. But that doesn't mean that all, or even most, of the people who reject evolution are stupid (or at least, not any more so than most people who believe in evolution).
And it is disturbing to define intelligence, not by "a modicum of knowledge and rational analysis capability" as you misleadingly say, but by one's conclusions about a single empirical fact, disregarding all other opinions about all other subjects, as well as the means by which the conclusion was reached, the importance attached to it, and so on -- you're just going to throw all that out and reduce it to a single true/false question? That isn't intelligence, or if it is, then the bar is bizarrely and arbitrarily low...
I am the man with no sig!
The vatican gets it, but I guess the people who don't get it are the same people who think that being religious and being pro any kind of war can mix.
Unfortunately as some think the Vatican is Devil's spawn, this wouldn't work for them. Actually it may reinforce their belief.
FalconShould there be a Law?
Here's the deal: stop saying that America is the greatest nation on Earth, the most advanced nation on Earth, the home of the free, the home of the brave, or any of that other bullshit, and MAYBE people will stop pointing out that every one of those claims is a baldfaced lie.
What do they take on faith?
it is easier to believe than an external being creating life in its full form
What created that being?
FalconShould there be a Law?
The mechanics of evolution is just DNA and genetic inheretence, so I'd say it's pretty well proved! ;-)
Inherited features by definition existed in previous generations. This by no means proves that new features arise, a requirement of evolution.
Natural selection is sound, observable and demonstrable in theory and practice. However it is the mechanism by which certain traits within a population become predominant, not how new features form. New features require the addition of genetic code, which although there is evidence consistent with this, is far from being proven to the standard of natural selection. Not even close to gravity etc.
http://marriedmansexlife.com/
If you can't produce a single observable, reproducable fact for macro-evolution without a lot of explaination then shut up.
No need to round. The concept of an "average inteligence" has no specific numerical value. Therefore there is no one who is exactly average. You are either above or below.
Don't confuse 1) The Theory of Evolution with 2) The Theory of Common Decent and 3) the various theories of the Origin of Life. The first two are well proven with lots of data from many disciplines. They, like Newton's Law, will probably be refined in the years to come. The third has vary little evidence to say one way vs. another.
Don't confuse evidence with "faith".
Do you really have a better theory? Supported by the vast amount of evidence already gathered? Able to make useful predictions in bio-genetics and paleontology?
Darwin started out a Creationist. He stopped being one because Creationism kept making wrong predictions.
Everyone is entitled to his own opinions, but not his own facts.
The condescending arrogance of your statement is overwhelming. True scientists believe in evidence. If you follow the evidence, leaving out hypothesis and conjecture, you will find the majority of factual evidence does not support evolution. I am not suggesting that the "48%" have arguments based in fact, but in this case the evidence is on their side.
WStonestreet
Religion and Christianity are not in any way against science. In fact there are many Christian institutions that are at the forefront of medical science. Science is about observing, hypothesizing, and testing. It's just a fancy variation of applying logic. Some of the greatest scientific minds of the last several hundreds of years were people of faith. Belief in God does not stifle real scientific progress.
The theory of evolution does not attempt to explain the origin of the universe, and therefore neither threatens nor is threatened by a belief in a "Creator." There are aspects of the theory such as natural selection that are self-evident. Where the schism begins is with the age of the earth and the origins of species. Faith is not equivalent to stupidity. There is naturally a stubborn aspect to it, but it is not baseless ignorance. Therefore, when people refuse to accept what our current testing methods seem to indicate, it is not out of some mental inferiority, as many high-minded folks love to believe, but rather out of necessity.
Was it wrong to believe round when everyone said flat? Was it wrong to believe heliocentric when everyone said geocentric? Looking through history, science is never really "right" or "wrong," but more like "as far as we can tell right now." So what is wrong with holding out for better testing methods? It is completely irrelevant for either "side" to flame the other. So try to be the bigger person and stop the hate.
Seriously, these are the kinds of things that embarrass me when I talk with my foreign friends.
Just to be clear, not too many on /. will be willing to discuss this topic soberly, openly and with facts. Talking about narrow mindedness and inflexibility! Everytime we ask for facts, the response so far has been "RTFM", meaning, they can't recall any particular fact or reasonable train of thought by which they can support macro-level evolutionary processes but they can certainly quote the names of all the other smart guys who can write a bunch of stuff.
Loved your post.
"When religion builds an airplane,"
... http://www.adherents.com/people/pw/Wright_Brothers .html
Religion cannot build an airplane, and science cannot explain a Creator. They are mutually exclusive. Because some one believes in one, doesn't mean they can't believe in the other, even if you don't understand this.
And, just so you realize this: From
Orville and Wilbur Wright: The Wright Brothers were the sons of a minister for the United Brethren Church. So much for ignorant fundamentalists.
Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
All I did was explain the particular way the bible defines the word "faith", and the relationship of this term to a presupposition common to Christianity?
Moderate on the quality of discussion, not whether you agree or not. The GP's statement regarding faith is not circular reasoning when the terms are understood in their context, even if the presuppositions are illogical.
Or perhaps it's my sig you don't like? For the benefit of those without wget, it pulls a few lines from Darwin's "The Descent of Man"
At some future period, not very distant as measured by centuries, the civilised races of man will almost certainly exterminate, and replace, the savage races throughout the world. At the same time the anthropomorphous apes, as Professor Schaaffhausen has remarked (18. 'Anthropological Review,' April 1867, p. 236.), will no doubt be exterminated. The break between man and his nearest allies will then be wider, for it will intervene between man in a more civilised state, as we may hope, even than the Caucasian, and some ape as low as a baboon, instead of as now between the negro or Australian and the gorilla.
Darwin's own work proclaims him to be in favour of racial genocide. He was guite clear. You ought have no need to suppress this information.
http://marriedmansexlife.com/
I'm not confusing those. But Darwinists need a materialist Origin of Life scenario. And I don't see any. And I'll make a prediction. None will be found. This isn't based on ignorance. This is based on what science knows about about single-celled life.
Good post, btw.
Except for ending slavery, the Nazis, communism, & securing American independence, war has never solved anything.
"An alarmingly high number of individuals responded that they believe the earth is only 10,000 years old, and that a deity created our species in its present form at the start of that period." Why is that alarming? If the same number agreed with the author instead of disagreed with him, I suppose it would cease to be alarming.
Actually it is not the fittest that survive. DNA + procreation + "survival of the survived" is the correct formula.
Why don't we just get Kent Hovind out of jail and make him Secretary of Education and get it over with? I mean, the way scientific ignorance is celebrated, hell even encouraged, in America you might as well.
Correction on the news: Americans are ok at math, but slashdotters don't RTFA.
From RTFA: 48% don't believe in evolution, and 82% consider themselves christians.
48% is, of course, not a majority, but 82% is.
*sigh* Of course you're right. That's what you get from posting very very late at night..
I hereby retract all my earlier statements and claim the exact opposite. All previous mistakes must now be considered null and void, and the universe must shape itself to accommodate this new reality.
-- Language is a virus from outer space.
I think you should change your post or maybe you read quickly or something.. or maybe I am bad at math, could you explain how 6+2 = more than 10? A millennia is 1k years not 1 million.
Mystery #1: how on earth Americans can have been fooled by Bush, not just once but twice, the second time ignoring four years' worth of evidence of what an evil fuck he is...
Everything I needed to know about life, I learnt from Blake's Seven
Storm
IIRC, the article brought that up. They figured that there's still a social stigma attached to the term atheist, and those 3% might be willing to admit to not believing, but not willing to accept the label. It could also include people who have religious beliefs that aren't focused on a discrete supreme being, in which case atheist might be technically correct (i.e. someone doesn't believe in any sort of god), but wrong in connotation, since atheist is usually interpreted to mean that one has no religious beliefs whatsoever.
On a related note, NPR has a long-running series called "This, I Believe," in which people (some famous, some not) submit brief essays about some belief (religious, philosophical, or otherwise) and, if selected, read their essay on the air. Penn Gillette (of Penn & Teller) spoke about not just being an atheist -- atheists just don't believe in God -- but going beyond atheism, and specifically believing that there is no God. It's a subtle difference, but his view on it is that this is our only shot, so you'd better do things right in this life, because you don't get another chance to fix it after you die.
I think you misunderstand the point of science. You don't need to believe in science. It just is. That's the cool thing about it!
Science could quite easily explain a Creator, if such a thing existed and there was evidence to support it. However, all the facts point to this not being the case.
I think a large part of the misunderstanding, if it can be called that, is that the way your proposition is phrased begs the question. To say that I "believe that a diety did not create human life" presupposes that I believe in a diety, which I don't. It also shifts the burden of proof to someone (me) who is not making a claim. I am not making an assertion that a diety did not create human life. You can always assert the hand of God, evolution or no. Saying "God did it" or for that matter "God did not do it" are not, strictly speaking, provable claims, and I am not making either one of them.
And before you say "So you're saying atheism is logically untenable?" let me clarify by saying that the statement "God does not exist" is just as logically untenable as saying "Ghosts do not exist," or similar statements about Bigfoot, UFOs, whatever. In any case, I am not making the assertion that God doesn't exist, only saying that I have no faith that he does. Similarly, I am not making the bold assertion that there are no ghosts, anywhere in the universe, but I can honestly say that I see no reason to think that they exist. Stricly speaking, saying "there is no ESP" is logically unprovable, but we know that what people mean when they say that is that they see no reason to believe in the phenomenon. I don't believe in God in the same way I don't believe in leprechauns.
It's just that, to me, the existence of life does not prove God, I don't find Christian theology convincing, and science is known to be a productive, useful way of looking at the world, at least so far as explaining, predicting, and exploiting physical phenomenon. Science doesn't tell you why you should be a good person, but that isn't what it's for.
Anyway, back to your point, I've read much on the "it takes more faith to be an atheist" line of argument, and though it may be convincing to those who already have faith in God, it doesn't map well to what atheists actually believe. Usually when I encounter a person using that argument, most of their effort is spent in building up this edifice of belief they think I must have to be an atheist, and trying to get me to admit to it so they can use their canned arguments to knock it down. I don't think the outlooks are easy to reconcile, and they never really understand me. To them, I must by definition have a creed (though a wrong one) and it's that creed they are trying to pin down. But I don't have a creed per se, and atheism is not a belief system. I defer to science because it works where other mental models have failed. Science seeks to explain the natural world in terms of the natural world, which to me seems to make a bit of sense. What's more, evolutionary theory is profitably used in a variety of fields, including that of antibiotic research.
Regardless on our views on man's ultimate origins, the science behind evolutionary theory is so sound that it has practical applications today. The fight against AIDs, H5N1 (avian flu), and other diseases would be impossible without the mental model of evolutionary theory. It works. Deferring to what works doesn't somehow become blind faith in a non-god solution just because (some!) religious people are uncomfortable with evolutionary theory.
You say that if evolution is a linear process then ....
And that is where you go wrong. It ain't a process. Human beings need to think that way but evolution isn't some kind of system that you can analyse, it is just a name for observed data.
But ultimately it is random, claiming you should see evolution every two hundred years because of the law of averages is such complete and utter nonsense because that just ain't how it works. It would be like saying that if you flip a coin 100 times it should land on its side 2 times. While you can calculate this in theory, in practice the flipped coin may not land on its side if you flip it from now until the sun blows up. Then again, it may land on its side every single time.
But we are seeing evolution, humans with less and less hair. Bacteria that are resistent to drugs. Bacteria that thrive in human created toxic enviroments that never existed before.
But you go right on believing that some magic dude created it all. That explains it all, except, were did HE come from?
And then there is another thing, if you were a god, would you hand design everything, try to figure it all out in advance how all those species would live together in a changing world OR would you just "create" evolution and plant a tiny seed and sit back and what happens.
Evolution does NOT deny the existence of a god.
MMO Quests are like orgasms:
You may solo them, I prefer them in a group.
I know the earth is flat because the National Geographic has a map showing the same. You can go off the edge!
"Praise the lord, pass the ammo."
NOT
America rather consistently loses wars against third-world countries. Very impressive, and definitely great. Then they criticize the rest of the world for not being stupid enough to get on board for the big defeat. So America is simultaneously weak (for losing), stupid (for going to war in the first place), and petty (for getting mad at nations run by rational, literate people).
I think you're ignoring a rather important point here. America tends to "lose" wars to seemingly inferior opponents, because America (by which I mean the American public, collectively), for better or worse, doesn't really want to do the kind of nastiness that would be required to win decisively.
E.g., it's a lot easier to win wars if you don't care about what you do to the enemy civilian population. In the extreme case, you just kill everyone and take over an empty country. (This is pretty feasible, without anything so uncouth as actual death squads, with biological weapons, some chemical weapons, or certain types of nuclear weapons.)
I'm not sure that I would poke fun at the U.S. for "losing" per se; that's sort of like complaining that a truck full of guys with machine guns get over-run by a mob, because they're unwilling to just start shooting into the crowd. It's less a "loss" in the military sense than it is a quasi-surrender; an admission that victory cannot be attained without doing things that are considered beyond the pale.
So while there's certainly ample room to criticize the U.S.'s military adventures (but before you do -- realize it's not new; the U.S. has a long history of going on bloody little expeditions every once in a while when there isn't a 'real' war going on), the U.S. "losses" in battle are more reflective of the limits on U.S. commitment and conduct than they are on any actual military factors.
"Ladies and gentlemen, my killbot features Lotus Notes and a machine gun. It is the finest available."
New features require the addition of genetic code
Genes don't code for features - they are much lower level than that (creating proteins, controlling expression, etc), so putting existing genees in novel combinations also makes a unique individual (why you share features from your parents but have you own unique features too). Nowadays we can sequence DNA and see these changes directly.
The nature of evolution is necessarily to modify what has gone before in some incremental way rather than creating brand new features, but a few million generations of incremental changes (longer legs, shorter neck, more hair, etc, etc) will still create something very different (incl. new species) from the original. Old structures such as gills get repurposed into new functions such as ears as behavior and habitat changes... Legs shrink and almost disappear to turn a walking animal into a slithering snake, etc, etc. Thinking in terms of "new features" is really a wrong way to look at it - that may be the cumulative effect of millions of evolutionary steps if you look at the end points, but it's not how evolution actually occurs; evolution occurs by incrementally changing *existing* features.
The problem with your remark is that there is no evidence to the contrary. God might have created the world 10,000 years ago exactly in accordance of our present scientific view of what the world was like 10,000 years ago. Or five minutes ago, or five seconds ago, or five seconds from now. There is no scientific evidence that the world has existed for any specified length of time. What we actually have with the theory of evolution is a least-complexity explanation of the various phenomena we observe. This least-complexity explanation posits a multi-billion year timeline to the effect that the universe presently appears as if such a time frame unfolded. This claim does not stand in contradiction to the claim that God created the earth 10,000 years ago in exact accordance to what our least-complexity explanation (the theory of evolution) suggests the world looked like at that time.
Amusingly, to me at least, the average scientist is more in the wrong on this point than the average creationist. A least-complexity explanation is not equivalent to an assertion that the explanation actually took place. If God happens to have an extremely solopsistic sense of humor, it still wouldn't make evolution incorrect as the least-complexity reduction of God's little fit of wool-pulling on humanity at large to create a world complete with fossils, hypothetical genetic lineages, and receding galaxies.
After all, the super rich can't stand to own anything that looks really new. It's like that in universes everywhere. Hey, Slarty, I need a universe ASAP, 10,000 years tops, but make it look old, really old. Fossils, major extinctions, contintents that mesh together, all that shit. And pay attention to detail this time. Those mice are smarter than you think.
triggered by the dumping of waste by the individuals Fod and Gather. They were later punished by seeing their only son being nailed to a wooden structure.
Evolution may otherwise be described as "survival of the fittest". In reality this means that being fit for one environment probably makes you unfit for another. Place a polar bear in Africa and it will perish from heat, place a lion on Greenland and it will die from the cold.
And being fit for survival may also be represented by adaptability. Many animals aren't able to adapt themselves to large variations in climate. Humans are adapting very well, especially since we are the only animal that actually both build our own dwellings to keep out the worst parts of the climate and also are able to construct clothing that allows us to endure climate that we wouldn't have been able to survive otherwise.
The human body is in it's unprotected state only fit to survive in regions around the equator.
Evolution is otherwise best studied through bacteria. They are able to adapt themselves to the various poisons we throw at them. Several strands of bacteria that earlier were killed off with most drugs have today developed a resistance to most. A more cruel study has to be the black death that actually occured several times from the middle ages up to the 18th century. The first time it occured it was very bad and killed a large number of people. However those who got sick and survived or never got sick even though they were exposed there was a gene that prospered and resulted in the fact that the coming generations were less likely to get infected. Since not everyone got exposed to the black death there were survivors that lacked the gene. It may also be that the gene were a dominant gene, which means that only one copy of it was needed to provide sufficient protection. That resulted in the ability of the plauge to strike again, but with lesser effect each time since the gene were protecting a larger part of the population.
An interesting fact is that humans are likely to be the first speices of Earth that actually is able to propagate beyond the realms of the earth. Unfortunately we are at the same time wasting resources on things that aren't actually profitable in the long run.
Since we still don't know everything about everything (and probably never will) there is always some room left for religion. Most religions are based on part fiction and part reality. Most stories in the Bible (and other scripts) have a reality base, the problematic thing is to know how it has been edited. What has been added and what has been removed? Is the story describing a real event or is it a fiction thrown in to tell the listener/reader some good moral lesson?
From the bible it is known that the new testament comes in four variations, each with a different angle. This is all and well, but it also shows us that even if the basic story is the same it also proves to us that there are information losses and alternations on the way. It is also known that there are other scripts that didn't make it into the bible. Who was to decide what was the right script to enter the bible? Is that decision valid today? The victorious writes the history, so there is always the risk that Judas wasn't the traitor that he was written to be.
Another thing is that a lot of the stories in the old testament may have been passing from mouth to mouth before they were written down. This in turn means that they slowly has changed content before they were written on paper. Even translations from earlier versions of a language using modern references can cause loss of information or misconceptions. There is a translation that were saying that it was hard to put a camel through the eye of a needle. Later language analysis has revealed that the translation shouldn't have been a 'camel' but a 'rope'. In the end it really didn't matter since both translations still works for the goal of proving something hard. What this really indicates is that it is likely that there
If builders built buildings the way programmers wrote programs, then the first woodpecker would destroy civilization.
For all those non-sience majors, the cell principle simply states that:
1. The cell is the fundamental unit of life
2. All living organisms are made up of cells
3. All cells come from pre-exisitng cells
According to the cell principle, evolution is scientifcally and biologically impossible.
Do you even understand what the definition of species is? Two groups of animals are considered as a separate species if they can't successfully interbreed.
The way new species are created isn't by some magic or anything different than normal incremental change... there just becomes a point where the DNA has diverged due to those accumulated tiny incremental steps that the two groups of animals can no longer viably mate (even if they wanted to, which is unlikely).
There are animals around us in absolutely every stage of speciation you can imagine. Just to pick one, lions and tigers are close to becoming separate species... they can currently still interbreed, but in the wild they do not and therefore they will carry on diverging. Or how about horses and donkeys - just past the point of speciation - they can breed, but the offspring (mules) cannot, so they (horses, donkeys) have therefore permanently diverged into new species.
I don't know why so many people get hung up on the creation of new species as if it were something different from any other type of incremental change... I can only assume it's because people don't even realize that speciciation is just the loss of ability to interbreed.
Care to define your terms? If you mean that "Darwinists need an Origin of Life that excludes all non-physical influences", I'd dispute that. I'm living with one.
I definitely agree that finding the definitive source of life will be nigh impossible (unless someone took pictures). Single celled life don't leave much in the way of fossils. Bacteria swap genes and have a high mutation rate which makes it harder to determine ancestry billions of years ago.
However, it's much easier to demonstrate a common ancestry for complex life on Earth. Mutations in highly conserved DNA sequences, plus fossil records that show that species change over time, geographic distribution of species, and shared "mistakes" in the "designs" of species, all support the Theories of Common Descent and (Macro) Evolution.
Unfortunately, people conflate the theories, (I used to, but not saying you do) and justify their belief in the Creation as done by Jesus Christ, simply because scientists haven't proven it all the way back to the big bang. Which is utterly foolish. Since their religious belief is centered on the Bible being 100% accurate, they incorrectly believe that all of the Theory of Evolution etc. falls apart if scientists can't prove the Origin of Life.
Everyone is entitled to his own opinions, but not his own facts.
You're obviously well educated on this subject. I have to admit that as a former atheist, and a relatively new Christian, I still struggle with many of the issues in these threads. However, I do try to "keep the faith" and I believe that God honors that commitment. I'm not going to tell you that God literally speaks to me, because quite frankly he doesn't, that's just not how it works. Perhaps my testimony can shed some more light on my perspective: http://dvdrsmth.blogspot.com/ I've neglected the content for quite some time, but hope you find it worthwhile.
His conjectures and studies (late 1830's) began long before his daughter died (early 1851), but his daughter's death undoubtedly affected his perception of God. Thanks for the link.
Everyone is entitled to his own opinions, but not his own facts.
I am from Germany, and as many Europeans we love to laugh at stupid (or obese, or warmongering, or undemocratic, ...) Americans. But when you look at us, we are not far behind in all of those fields. And the EU itself could actually be called less democratic than Washington (I don't know of any studies for comparison, but trust me, Brussels is VERY undemocratic). Stupid people is an international problem!
Neither the person you replied to, nor you have a clue when it comes the criteria for a valid scientific theory or why science models reality only with theories and never with "facts".
Btw, please do not make statements about what has or has not been done in a lab. You look as clumsy as Behe when he was confronted in court with a whole pile of publications and books which he claimed did not exist.
And I repeat: you show no clue about concepts of theory, falsifiability, testability of reproducibility. All concepts of course which alternatives of evolution theory eagerly dismiss.
see a Text Widget
"I reject the reality and substitute my own."
If you allow people to say I am X, for any X, you're devaluing the English language in the sense that you strip all meaning from "I am". You can agree to disagree in the sense that it's your choice if you want to accept debased coin. But I think language is more useful if when someone says "I am a Christian" I now actually know more about that person than the fact that they've just said "I am a Christian".
> how do you know whether someone else is "truly" or "actually" Christian?
On a case-by-case basis. If someone claims to believe in an omniscient God then I'd expect them to act like they're being watched, even when they believe no person is watching them. If they claim to believe in eternal damnation for sinners, I'd expect them never to sin. If they claim to believe good people go to heaven I'd expect them to be cheerful about the death of loved ones. If they believe that human blastocysts are individual people I'd expect them to risk the life of a child on order to save a dozen such embryos on a petri dish. And so on.
But remember I am 'agreeing to disagree'. You seem to have a higher tolerance for hypocrisy than me but I can't really claim that you are incorrect to be so tolerant.
Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
Nor do they even tell the right story.
Lurking underneath these things is the literacy metaphor. Actual literacy is a fundamental skill needed to function in our society. People backing various forms of "literacy" use this as a metaphor, and then proceed to abuse the metaphor by conflating a fundamental skill with being able to repeat a bunch of facts.
It's not that facts are unimportant -- far from it. But the reason that creationism is able to take hold is that while people know the basic facts of evolution they lack the epistemological skills to understand, use, or criticize those facts. So the situation is actually worse than the numbers suggest, because it is not enough to believe in evolution because you are told it is so. That is not "literacy". You have to understand it and see how the theory applies.
It is tempting to brand creationists as idiots and crackpots, but really they aren't worse than people who believe in evolution, but without any better reason than somebody told them that that's the way it is.
All theories, scientific or otherwise, explain. The power of scientific theories lies specifically in their limited ability to explain. By working with theories that do not automatically explain everything, science is forced over and over to try to disprove each theory in special cases. Scientific theories are like bones: the way the body creates strong bones is that bones that are stressed form micro fractures. The body repairs those fractures with material that is stronger. Likewise a paper that says, "natural selection predicts such and so and by golly we saw it" has less value than one in which the unexpected is found, especially at this point where evolution represents scientific consensus. It's not that anybody expects natural selection to be disproven given its current track record. But its power to spur advances in knowledge would be crippled if the facts always looked consistent with the theory.
One thing we are not taught in school until college (or possibly graduate school) is how to deal with ideas sufficiently complex that they aren't automatically obviously consistent with every observation we can make. Even where we believe in something that is well tested and reasonably certain, like natural selection or democracy, it is possible to believe the theory in a simplistic way. Such superficial belief in a strong theory doesn't empower a person more than if he accepted an inferior theory like creationism or theocracy.
Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
Did you remember that quote from Civ IV or am I the only one.
Though I believe their translation of the quote (used for discovering fascism) was, "The great masses of the people will more easily for a big lie, than for a small one"
-- Political fascism requires a Fuhrer.
I honestly thought this was an April Fools post...
-ubuntu others as you would have others ubuntu you.
Creating life in a lab would not support evolution, but creationism, correct? Instead, observing life evolve from one form to another would support evolution, and that is done all of the time.
No data, no cry
I'll see your URL with this one... http://tinyurl.com/23vr4y I'd raise ya, but my last few hands have been pretty crummy.
Do you think they've manufactured more than 144,000 stickers?
I am all for the school system teaching creationism as the real truth. Within the diverse traditions of Hinduism, creation of the universe and life itself is generally believed to have occurred due to the will of a supreme consciousness or intelligence, often referred to as Brahman.
"Never say Never."
Please, the fact that Pasteur figured out that spontaneous generation was wrong does nothing to refute evolutionary theory. One reoccurring theme amongst these fools is that just because you can take quotes out of context from the bible and thrash them about, they believe that's an appropriate response to anything.
They understand less about the scientific method than a cow understands about the inside of church.
Faster! Faster! Faster would be better!
Let's see. They say (buried at the end) that "In conducting the poll, Princeton Survey Research Associates International interviewed 1,004 adults aged 18 and older." They don't say how the poll was conducted, but it was probably by phone. They don't say where these people were, though if they were spread evenly geographically, it's easy to miss the cities, which is where the majority of the population is (and where the majority of liberals are).
Also, they claim the poll "has a margin of error of plus or minus 4 percentage points for questions based on all registered voters and plus or minus 6 percentage points for results based on registered Republicans and Republican leaners." 4% is pretty big as it is, but if it's greater for Republicans, that implies that there's some sort of bias based on political affiliation. An intentionally skewed sample would account for this.
This poll is meaningless. But that won't stop Newsweek from trumpeting it all over the SCLM.
In other words, you know not of what you speak. But thanks for playing.
If you get put off by the weight and size of Gould's magnum opus, read some his collections (The Panda's Thumb and others).
Faster! Faster! Faster would be better!
"Might I ask, is that necessary for science? Because if so, it sort of contradicts what you've said."
Yes, it is necessary for science to accept there is a reality. It doesn't have a preconceived idea about how that reality is or should be, however. Nor does it claim to have found the ultimate reality; science only postulates the closest approximation of observational reality, nothing more, nothing less.
I don't see how that contradicts anything he said.
People arguing against science on the grounds that all things are based on those beliefs of the scientists, effectively deny that there would be a reality outside what which people believe. Thus, they argue, belief in god or belief in science is on equal grounds.
This reasoning is solipsistic in nature; all reality is only part of ones' one mind (or belief). Two counterarguments can be given for this reasoning:
The first one is, that people who say that, don't actually follow what they preach, and thus show a high degree of hypocrisy within the context of their worldview. Even you (or posters of the same ilk before) do not really act as if no reality outside yourself exist (well, maybe if you're a particlar case of a sociopath). You *argument* as if you do (like with your speedometer example), but in a practical sense, you are well aware that if you see a wall, there is a reality of that wall, and that wall is not something you just happen to believe in. (If you truelly belief there is no wall where observation tells you there is one; please run through it, and thus prove that it was only imaginary).
The second point is, that using that defense, it is impossible to explain how science would make any progress - nay - have ANY change not conforming to the 'general wisdom' at all. If science is just about 'believing' stuff, just like believing in God, then how do you explain that science proved the earth wasn't flat, while, during that time, the general belief was that it WAS flat. Or that the Earth wasn't the center of our solarsystem, when all people during that time (including the majority of the scientists) believed it was.
If science couldn't observe something what constitutes a reality, outside ones' belief, then science would have concluded that Earth was the center, because that was the general accepted belief during that time.
Both points indicate a severe weakness in the claim that science is just what scientists 'believe'. In contrast, the 'belief' in God (as described in the bible) has no means of establishing anything about the reality outside ones' (the believers') belief.
--- "To pee or not to pee, that is the question." ---
I worked at a research company that did polls like this. I had to do the cold calls, myself. The dirty secret that polling companies don't want anyone to know about is this:
Nobody responds to polls but lonely old ladies!
And guess what? In the 1920s, hardly any women got good educations. Almost everyone was ignorant the world outside their towns.
This poll does not represent America. It represents only our most lonely and senile citizens.
A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
I can't believe this little article has pulled so many slashdotter's chain. What difference does it make what people believe? AFAIC this article has no business on a tech forum. These kinds of polls can get different results on any given day in any given place. Give it a rest!
Heard any good sigs lately?
Personally if I was teaching a class on evolution I would never use this word "adapt", becasue it is misleading.
A better way to explain evolution:
-Organism's DNA can randomly change into most anything.
-What's good, survived, and is only a small fraction of what DNA can mutate into.
Let's say one of your sperm's DNA was altered in a way that when you produced a child, he or she was sexually attracted to rocks.
This child goes around humping rocks of course, but more importantly they are not have sex with other people and are not passing on their genes. Their liniage dies out right away.
Another way to explain evolution of life would be to say:
Think of a factory that takes random raw materials and puts them together. 99.9% or more of the time you get random blobs of shit that are useless, but very rarely now and then you get something in a shape of a spoon or something that's actually useful.
I think the way people exlpain evolution is usually not very strait forward and is the reason why so many people don't get it.
-On another note, I think a lot of people just want to believe in a higher power and afterlife despite the fact that they thoroughly understand evolution.
This could be because it's comforting or because it's merely genetic and the reason so many people are religious is because the religious mind has an evolutionary advantage.
Ah gotta go bak to mah trailer now ur mah still's gonna blow up!
I killed da wabbit -Elmer Fudd
Tell that to Wile E. Coyote!
"However, all the facts point to this not being the case."
All the facts you as you believe them. Just because you don't accept facts outside the realm of your senses doesn't make them false. Once upon a time, white men didn't believe in the existence of gorillas, even though there was experiential evidence from outside the realm of white man's experience.
Eventually, they experienced the gorilla for themselves, and believed. Same will happen with the Creator.
Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
"Two groups of animals are considered as a separate species if they can't successfully interbreed."
Actually, this is false statement, and typical of Evolutionists. A lion and tiger are separate species, and yet, there are clear examples of them breeding. Same with Horses and Donkeys (Mule). How about Wolf and Dog?
So, your first statement is a lie or a deliberate misstatement of fact. And they call us creationists ignorant. Sheesh
You see, ignorance has little or nothing to do with Evolution and Creationism. Both sides can have ignorant people, as you just proved.
Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
Except that Evolution cannot explain certain unchanging species, because the reality is, if Evolution is true, then these species would HAVE to have changed, substantially.
7 0124-sharks-photo.html
http://news.nationalgeographic.com/news/2007/01/0
http://en.wikipedia.org/wiki/Coelacanth
Evolution cannot explain LACK of change in a SEA of change, because Evolution requires change, and the LACK thereof is very hard to explain. Of course Evolution doesn't really address lack of change, because it cannot, it just marks it as an "exception". Enough "exceptions" and the theory becomes less likely.
Another exception is the Cambrian (and Pre Cambrian) explosion.
"The question of how so many immense changes occurred in such a short time is one that stirs scientists. Why did many fundamentally different body plans evolve so early and in such profusion? Some point to the increase in oxygen that began around 700 million years ago, providing fuel for movement and the evolution of more complex body structures. Others propose that an extinction of life just before the Cambrian opened up ecological roles, or "adaptive space," that the new forms exploited. External, ecological factors like these were undoubtedly important in creating the opportunity for the Cambrian explosion to occur. "
So, here we have circular logic of Evolution. To prove evolution, they assume evolution. They cannot explain this "explosion" in fauna via normal evolutionary models, so they make a huge bunch of assumptions(guesses), all of which presuppose evolution.
Of course, there is no other explanation that evolutionists accept for it. Again, another "exception", whereby the theory doesn't explain the explosion, without first accepting the theory. Slow steady changes doesn't explain it, so they modify the theory to include periods of rapid changes without any facts to actually support two types of evolution (fast, slow).
"Scientists have also long been puzzled by its abruptness, and the apparent lack of obvious predecessors to the Cambrian fauna. Three questions in particular are of importance currently: I) is the "explosion" real?; II) what does it tell us about the origin and possible evolution of animals? and III) what were its causes?"
To claim that all creationists are ignorant (not knowing the facts) is a huge lie. I was once a Evolutionist, until I started reading the SCIENCE behind it. I once blindly accepted it as "Fact" until I read example after example of exceptions and holes in the "fossil record". And there are plenty of them.
Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
The definition of species (can't interbreed) I gave you is the modern evolutionary one. The old classifications were based on external chanracteristics and are functionally meaningless. The interbreeding definition of species makes sense becuase once the DNA of two groups (formerly same species) has diverged beyond the point of them being able to interbreed then there is no going back - the DNA can no longer be mixed and therefore the newly branched species will now evolve indpendently. Correpondingly, if two populations of the same species have genetically diverged, but NOT beyond the point of being able to interbreed, then there is still a chance that they may interbreed and remix the DNA.
Lions and Tigers can interbreed (and have healthy young), therefore - by definition - they are the same species, despite looking a bit different (just as dachshunds and pitbulls are also the same species as each other, despite looking and behaving different).
Mules are (generally) sterile, so the combined DNA can't be further mixed and the interbreeding has therefore effectively failed. Actually it's more subtle than that because *sometime* a horse/donkey mix (M=mule, F=hinny) can breed, so really it's more accurate to say that horse/donkey is currently - right nbw - in the process of forming two seperate species.
Wolf and (all breeds of) dog are able to interbreed.
It's interesting how you think this is a word game rather than having anything substantive to say, or any response to the fact that I've just explained how trivial the creation of new species is. Oh well.
I find this thread and the commentary on it amusing. First the survey question "Is evolution well-supported by evidence and widely accepted within the scientific community?" If that was really the survey question then all you can really conclude is that Newsweak has a really lousy survey designer working with them. Here's a better way to do it. Question 1) Is evolution well-supported by evidence? Question 2) Is evolution widely accepted with the scientific community? It is perfectly feasible to answer no to question 1 and yes to question 2. All it requires is a belief that the evidence does not support evolution very well and that most scientists are wrong about believing it. I'm surprised that the self-congratulatory people that frequent Slashdot missed this elementary error on Newsweak's part. Or perhaps it wasn't an error. Maybe they were after circulation rather than a deep probe of the issue.
The LAND of the free. Like the Land Before Time, only without the dinosaurs, and with more restrictions on everything (including, but not limited to, eating each other).
https://www.eff.org/https-everywhere
I don't mind my country of origin getting called out for being the home of millions of people who lazily and habitually defer to the loudest voice in the room, rather than take a moment to form their own opinion.
And I don't mind the actions of my government being loudly decried as arrogant, clumsy, and in some cases: motivated by genuine corruption.
Nor do I mind when religious zealots of any nation are criticized for allowing a narrow set of dogma and ritual dictate their entire world view.
What I DO mind:
I resent statements that begin with "Americans are...", "Americans believe...", and "America thinks..."
The United States consists of roughly THREE HUNDRED MILLION PEOPLE spread (thinly!) from one North American coast to another. I live in the northeastern USA. I have more in common with my friends in Quebec than I do with Texans, Floridians, or even West Virginians. And I guarantee you there are plenty of Austin, Texas residents who take issue with being lumped in with the entire state. Or even their neighbors.
The U.S. is a very big place, brimming with brilliant, vibrant and insightful individuals whose eyes are pointed right out into the big bright world outside. It's a country born out of a vast cultural confluence -- constantly in flux not only as one moves across state lines, but year to year, as well.
Please keep in mind that there are many of us in the U.S. who DO understand the significance of an established peer-approved scientific theory, who DON'T believe that might always makes right, and -- believe it or not -- even hold onto a thick immutable optimism that our homeland might one day come around.
This is what is wrong with this country. People with no respect for other peoples beliefs. What does it matter if you believe in evolution or not. Those who do believe shouldn't be labeled as atheists and the ones that don't believe shouldn't be labeled as ignorant. I believe in natural selection, but only to a point where the species doesn't change from a rabbit to a prarie dog or vice versa or that there was a prarie rabbit common ancestor that they share. The concept is ridiculous to me at best. My faith in that all time number one best selling book whose name is forbidden around here because of its ability to incite flame wars among the most docile of posters tells me that evolution is wrong. That is my belief, and anyone who wishes to challenge my belief, come on, i'm willing to die for what I believe. How about you?
That will be the animal that voted for Bush in the last two elections.
Sad, very sad. Could it be Christian extremists could be more extreme than Muslim extremists?
Not that that's a bad thing, as long as you understand it is in fact a fairy tale.
I'm Roman Catholic, and a scientist. I was trained in Catholic educational institutions by (largely Catholic) scientists. Those two things do not need be at odds. The Benedictines didn't take us aside and say "You know, nice job on the genetics final, but just between us marines, we all know Darwin and Mendel are patently evil and full of it."
Once we got it straight that much of the religion is a set of myths that do serve explain the character of deeper truths, we're cool with that. I don't believe in Kronos, but I do understand that his story explains something about the behaviour and nature of time on a nuanced level that is not to be taken literally, but deepens and broadens your understanding of it.
Believing in the values the church espouses (and by the church I mean the church at large, not the simply bureaucracy) is hardly a bad thing. I don't believe Adam and Eve and Cain and Abel were historical figures, but that their stories explain a lot about who we are as humans. I don't worship John Steinbeck, but East of Eden was inspiring and easily a better read than Genesis.
I can't prove one way or the other if we have a life after death. It doesn't matter while we're here. We're here to make the most of what we can do in this world. People who truly understand what religion tells us aren't doing it out of a fear of what comes next or promise of a reward. They're doing it because it makes the world work.
It is not necessary to invent a particular afterlife in order to feel good even about Pascal's wager, as Pascal's wager was never necessary, it was merely a way to counter the extreme positions some can take about the existence of God.
In my tradition, the agreed mythology is that we'll be on clouds, withe white robes and halos, barefoot, harps and all. My aunt Alice will get to meet Jimmy Stewart, and I can play harmonica to Einstein's fiddle. But I'm not living my life in expectation that that's what will or must or needs to happen. It would be peachy if does.
It would be equally peachy if what remains after I go is simply the effect of my life on this earth. That's all I'll ever ask or expect.
"Win treats sysadmins better than users. Mac treats users better than sysadmins. Linux treats everyone like sysadmins."
Land of the free. Guaranteed freedom of speech. Press freedom. US 23rd (beats Jamaca Woooohooo!) http://www.rsf.org/article.php3?id_article=11715
Engineering is the art of compromise.
Am I disturbed by foolish behavior of fools?
I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
"There's no reason not to provide child molestors with psychiatric treatment."
True in principle, in as far as people who commit crimes due to mental illnesses deserve treatement.
"After all, they are quite clearly mentally ill."
Well, that would actually depend on the historical context (and the society in which it happens). I know it's not a popular thing to say, but it just so happens I recently read in a scientific magazine about homosexuality (including what we now would call pedophilia) which actually shows that it was rather common, accepted and often seen as beneficial (also for and by the youngster) in ancient times and in different cultures (ancient -greek, -roman, -japanese culture, etc.) Just to show that 'quite clearly mentally ill' is not quite as clear; it's rather a fairly recent view we have of it (which, according to the article, started only in the 17th century in Europe), which has primarily to do with how our current society views it, not (inherently) on the behaviour itself. I'm not debating the value (or lack thereof) of those other viewpoints, but the least one should acknowledge is, that 'quite clearly', in different times or in other cultures it wasn't considered a mental illness at all.
Just to caution you about making broad statements which would imply a universal truth which isn't universal at all.
"Half the problem with western criminal justice systems is that they think punishment is enough, and never try to actually correct the behaviour."
True. Though in all honesty, I don't think the Russian/chinese/japanese/etc. justice systems do much better, and, in fact, often are worse.
"And I suggest hanging George Bush in order to protect the Iraqi people."
I'm actually hoping you use hyperbole, here. At the point where the USA/Iraq is at now, and without knowing who would replace Bush, it is doubtful anything drastic would change for the iraqi people. In any case, it's highly unlikely that it would actually protect Iraqis, if you look at it in a practical sense.
"World War 2 was caused by the fact that Germany was imposed with crippling war reparations after World War 1, and suffered under terms of surrender that were destroying their entire society. That's why the US had the sense to help rebuild Germany and the rest of Europe after WW2 (that, and the fact that it served as a form of workfare to keep Americans employed, since Marshall plan dollars had to be spent on American goods). "
Largely true. And, of course, because they feared the growing influence of communism in europe, and thought this would also be a way to combat it. That said, the marshallplan did help europe back then, we should acknowledge that too, whatever the reasons were. (Not that it serves as an excuse to try to quench EU-criticism of the USA today).
"Rabid nationalism and prejudice have never caused anything more serious than a civil protest or a rally. War is about economics -- period."
I have to disagree with that one. Certainly, in most wars, economics have played a part, but it's certainly not the only cause or reason why countries fought eachother. For instance, I think it has as much to do with simply the ego's of monarchs (and later on, dictators) which ruled the european countries for the majority of warridden times in Europe. Also, there have been wars where whole tribes were exterminated as an act of revenge (or the showing of supremacy), where, after the victory, they just went back, and did no effort to economically benefit from that victory.
Ofcourse, most of the time, there is an economical aspect in it, and one would be a fool to claim otherwise. However, rabid nationalism (or chauvinism) is much more dangerous in getting countries to fight eachother than you seem to imply.
"It's caused by the fact that Americans are a) stupid, b) gullible, and c) religious zealots."
This is, again, a rather dubious claim, because it's too broad a statement. Americans are just like any other people, at least in essence. Yo
--- "To pee or not to pee, that is the question." ---
You know, when I was typing all that into the text box, I had it formatted by point and paragraph, but apparently I haven't figured out how to use the text editor thing yet...
I asked a dear friend who's much smarter than I on the subject of evolution to help articulate my perspective (sorry this got posted 2x, the first was basically unreadable without proper formatting):
Paradigms shift all of the time. Hundreds of years ago, it was the common consensus that the solar system revolved around the earth. The science textbooks changed and a new paradigm entered the scene. The beliefs of science are in constant flux. If the world lasts, a thousand years from now, our progeny will scorn our shallow understanding of the world. Compared to eternity future, we are but still at the beginning, playing with the dust and pebbles of the universe while thinking we are doing something grand.
Evolution is a paradigm that is in grievous trouble.
Fred Hoyle of the British Academy of Science and mathematician Chandra Wickramasinghe decided to calculate the probability of life coming into existence anywhere in the universe. Their results? Utterly impossible. They gave it all the time in the universe, but time plus chance produces nothing!
Francis Crick, Noble Prize winner for his discovery of DNA, also attempted to calculate the probability that life sprang into existence spontaneously. His results? Utter impossible. Instead of jumping into the arms of God, Crick decided to propagate the theory of genetic panspermia. In sum, his theory propounded that life on earth was seeded by benevolent and mighty aliens. Their work made life possible through the path of evolution. The problem? Crick merely delayed the impossible, casting it back on a continuous regression of aliens.
Stephen J. Gould, one of the greatest defenders of evolution, was also troubled by issues that he saw within evolution. As a result, he came up with the theory of punctuated equilibrium. He postulated that there were sudden leaps in evolution that left no transitional forms. If only he had made one massive leap, he would have ended up where theists are today.
Are these the actions of men that believe that the evolutionary paradigm is secure?
While the defenders of evolution are resorting to new and stunning conjecture to cover the nakedness of evolution, intelligent design has been seeking to topple the entire infrastructure.
The simple design of a mousetrap is irreducibly complex, no one part of the mousetrap makes sense without all of the other pieces. The evolution of a species or a single organ is also irreducibly complex. Take for example the eye. The eye is composed of mechanisms that are entirely reliant upon one another for the eye to function at all. If evolution is true, each part of the eye evolved over time and accrued in aggregate form. Unfortunately, the individual parts of the eye do not promote the survivability of the animal. They may actually impede its survivability. Over millions of years, the evolutionist would have us believe that the portions of the eye accrued until we had a complete and functional organ.
Another stake in the heart of evolution is the absence of transitional forms. Darwin predicted that this would be the downfall of his theory. Nothing has been found. Frauds have been created such as Piltdown man, Java man and a host of other oddities found to be made out of bits of extinct pigs, apes, etc., but nothing definitive has been offered to support the claims of evolution. If nothing else, our excavations should lead us to conclude that life was more complex and varied in the past than it is at present. This concurs with the concept of entropy.
The third law of thermodynamics is at odds with evolution. Time and chance lead to a loss of genetic information, the accretion of deleterious and deadly mutations. Per the evolutionary model, the very environment that may have produced the earliest protein chain is the same environment that would wipe it out in the next second. Life and entropy teach us that life is fragile.
The fossil record has yielded no evidence for evolution. Fossil beds contain a mixture of
Everyone respects the Americans of the 18th and 19th centuries, and the half of twentieth century. Nowadays though, you'd have trouble finding enough honesty, compassion, integrity, intelligence, honour, creativity, or even basic human decency in the entire nation to fill a thimble. Americans produce very little of worth (most Americans work in the service industry or in management, both fields that produce no value of any kind), and what they do produce is grossly overshadowed by the destruction that America wreaks all over the world.
When you get down to brass tacks, the US is little better than places like Iran and Syria -- full of irrational, violent, stupid, cowardly, close-minded religious zealots. And the handful of good people that America has left are despised by the rest for being "liberal elitists" (no matter how humble or conservative they might actually be).
No, I didn't RTFA (although I've seen enough excerpts in people's posts), BUT doesn't the poll question ask about evolution theory being accepted "... in the scientific community"? The poll doesn't say anything about what you believe about evolution theory, it asks what you think scientists think about evolution theory, and whether the theory of evolution is well supported by scientists. It would be pretty judgmental to think that all Americans are part of the scientific community. It's a poor poll, no matter which way you slice it. However, it looks bad when nobody actually reads the question and instead rant and rave about how Americans don't believe in evolution, and we're all going to hell, and our children are going to grow up stupid...
Red is difficult. Nearly all red dyes fade. Red also tends to be unhealthful; ever notice that we're up to #40 on red food color in the US?
Black is best. Blue tends to be better than green. Red is terrible.
An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
I bring this up because a lot of creationists seem to like to shroud their ideas in the rigor of mathematics without bothering to define their terms or even explain how the inherently mathematical models they're using apply to the situation. I'll generally chalk it up to ignorance on the parts of most of the people who bring up statements that they've read on the Internet like "Evolution violates the second law of thermodynamics!" but I know that there are a few people out there like Dembski who are educated enough to know better who are clearly bringing up scary-sounding math in order to lend their ideas a bit of undeserved credibility. I just haven't found a better way of dealing with it than simply taking people to task over it. So please, if you can, venture a little bit into this topic. Challenge #1: I plant a seed. It grows into a tree. Violation of the laws of thermodynamics? If not, please explain how the mechanisms in evolution differ.
That's an awfully big if. What makes you think that you're not simply presenting a false dilemma?
An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
Rather, it's about Revolution.
Ignorant people are easier to manipulate.
They are less likely to question the acts of their government.
They are less likely to cause problems.
It made me think immediately of Adam from the Mythbusters:
"I reject reality and substitute my own."
So do 48% of Americans.
So, basically, one cannot think up something on his own and is necessarily the follower of someone?
Everyone's a sheep. Modern neuroscience pretty much confirms that most of us run on autopilot most of the time.
Yeah, most of the time, like when I take a crap or that I pick my nose, I'm on autopilot, big whoop. If we're on autopilot most of the time, what do you mean by most of the time (55%? 98%?) and then, what goes on when we're not on "auto-pilot"?
Anyways, all you americans are kind of losing it with evolution and global warming. We, the reasonable people of Europe, are not into stupid retarded debates/clashes like this.
You just got troll'd!
"Observations are trivial truths, and such truth only exists for the observing individual."
;-) can hardly be disputed (well, unless purely philosophically).
I don't think this is actually true, as it would dispute the notion that there is any reality outside that which an individual observes. It's just that we can't say anything about it, unless it is observed (which is where the xians get it wrong)...but on itself, it's not dependend on the observation of an individual. 'Observing' is a dual concept: for it to do so, you need an observer and something to observe. Clearly, you are (half) right: if you don't have the observer, there can't be an observation. But, clearly there has to be a reality to be observed too, because if there was nothing to observe, no observation would be possible neither.
Say, in its simplest form, I see a wall. When I try to go through it, I bump my head. Does that mean the truth of the existance of that wall only exist to me, as an indivual, who observed it? If so, it would be difficult to argue how that would be the case, if all other individuals (even blindfolded) would hit that wall (which is supposed to be only there by *my* observation of it).
Since they are all (other) individuals, some of which can't even observe the wall untill they hit it, one would statistically expect that at least some didn't hit anything if the wall was only there through my personal observation.
Unless ofcourse, one would claim the wall didn't start to be truelly there untill the moment I observed it, but it was a reality from that moment on. Such a reasoning is solipsistic in nature however, and leads to a lot of other contradictions.
In any pragmatical sense, I think we all know there *is* a reality out there, which exist independend of the observer. The *form* in which it is observed may vary, the explanation/interpretation of the observation may vary, the question what is the best approximation of that observable truth may vary... but the fact that there IS a 'truth out there'
--- "To pee or not to pee, that is the question." ---
The Holly Inquisition ideas resonated with Keppler and Galileo, that is why they researched and presented idease based in observed evidence.
....
Er....
Wait a minute
IANAL but write like a drunk one.
"To demonstrate the difference, I'll make a theory that all objects have a tendency to move towards their natural position in space, which in the hammers case happens to be Earth's center; the hammer falling fits this theory, but does it prove it ?"
:-)
If your theory would have fitted every observation thusfar (and better then any other theory), you would actually have a claim that it is 'proven' (with the notion that no theory is ever *absolutely* proven, ofcourse, but that would be more of a semantic interpretation about what constitutes 'proof'. No (absolute) proof of *anything* can be given, not even Descartes' "I think, therefor I am". The concept 'proof', thus, must be viewed in a pragmatic sense, as most humans understand and use it. Much like legal terms, it would be more like 'proof beyond reasonable doubt' rather than absolute proof - which is a purely imaginary, philosophical concept).
But, well, actually, it doesn't fit the theory, because, if you take that same hammer to the moon, it falls towards the center of the moon. If the natural tendency of a hammer is to move to its 'natural position in space', and Earth's center is that natural position for hammers (dixit yourself), the hammer should 'fall' away from the moon towards Earth.
I believe an astronaut already did that actual thing (releasing a feather and a hammer), and since the hammer did not fall towards earth, your theory does not fit the observed reality.
--- "To pee or not to pee, that is the question." ---
10% are classiied as ethnic minorities.
You get out of London or other major mixed areas and see nothing but natives.
IANAL but write like a drunk one.
And decreassing.
Most people in Europe do not go to church at all (only 25% do in the UK) and according to a study done a couple of years ago, the more "atheist" countries in the world where South Korea, Japan and the UK (countries where curiously the bio sicences are porgressing quite fast).
And so on.
You really leave in a fantasy world if you think the UE and the US are very similar.
They share some comon traits, but in most others the difference could not be starker.
IANAL but write like a drunk one.
.... is that religious people are ordered to conform with authority.
And many do, as evidencied by the painful lack of accountability demanded by the religiou right in the US when they get their man in office.
IANAL but write like a drunk one.
Some randomness in the physics of the Univers ensures that not everything id pre-determined, not even when the Universe exploded.
But still, your statemnt is mostly correct, life has no intrinsinc meaning and we have to make the best out of this turth instead of deluding ourselves with religious nonsense.
IANAL but write like a drunk one.
Biological labs all around the world make a living out of it actually.
And what about selective breeding?
The history of the AIDS virus is well known and the reports of how th virus has evolved is well documented.
Resistence to killer agents (insecticide, antibiotics) is a well known pehomenon, firmly rooted in evolution theory.
IANAL but write like a drunk one.
"An animal does not adapt."
;-)
This too, is subtly wrong. An animal can (in varying degrees) adapt to it's surroundings, but that adaptive behaviour on itself isn't hereditary (well, unless one is still a believer of Lamarckism
"and the different ones either are already adapted or are not already adapted at the moment they're born"
This too is subtly wrong. The term 'adapted' makes only sense if you're talking about an organism in relation to its environment. Since the environments in which an organism lives can change, it is not necessarily true that an organism is adapted or not the moment they are born.
To give an example: say, a bird on an island gets born with a bigger beak. That beak makes it more difficult to catch flies, but easier to eat seeds. Now, is that bird (more) adapted, or not? The question can not be answered without knowing the environment in which it lives, but even then it is possible that, due to drought, for instance, the environment changes. So the bird may be born in an environment which makes it a disadvantage to have a big (or small) beak, but live (and prosper) in the changed environment where he lives his life.
There is no such thing as a predetermined 'adapted or not', since adaptation has always to be seen in relation to the (changing) environment in which the organism will live.
All by all, you made good points, though. It shows why ID is extremely unlikely, unless 'the creator' didn't know anything about what he was doing and his work isn't anything better then what a blind force like evolution would come at.
--- "To pee or not to pee, that is the question." ---
Now you just have the cold hard truth.
48% Are basically ignorant fundamentalist christian wankers who deserve all the hatred us non-ignorant right minded people have for you, and the problems your insane belief systems cause in the rest of the world.
The world would be a better place isf the 48% were removed from existence. Ill then happily buy the remaining (semi)sane 52% a beer.
Greetings from Australia, an ally that now grows to hate you ever more as you elect wankers into your government. Of course, you did let the current one steal the job, and the reason he got away with it was because of these knuckledragging creationists and all their money.
Of course the same type of fundamentalist christian arseholes got a foot in the door of our government as well.
I reckon we get them all in a tower, ive got a pilots license, and God knos (he's my God)they should be the ones who cop the end result of their hatred from the Eastern faiths, not us normal people, or as turn out to be when they go hate mongering, their "buffer".
Death to 48% of America
p.s. im a reformed catholic, i woke up to the fact its all about money, power and abusing small children.
We'll see who gets the last laugh once Xenu returns!
"The point the parent was so logically trying to make is that we cannot possibly know the purpose of omnipotent, omniscient God."
The point of the parent poster was, that this doesn't matter. *Omnipotent* actually wants to say he is completely ALL powerful, he can do ANYTHING, he has an INFINITE number of possibilities to arive to whatever goal he wants to arrive.
Therefor, whatever purpose God wanted to achieve, he could have achieved it by other means, without involving any suffering - unless the suffering was the endgoal itself, in which case the proclaimed 'love' he has for us is either false, or is a very sadistic, twisted kind of love.
Now, one could argue that when god said 'love' he meant something like 'hate' or 'spite', but that's only semantic wordplay. If he really meant the reverse of what he said, being omnipotent, he should have known how humans interpreted those terms, and thus he could as wel have chosen the right terms. If he intentionally didn't use the right terms, he was already proving he wasn't all that benevolent and good in the sense that we think about being benevolent and good. And if He isn't benevolent and good, why would anyone want to believe in him, unless out of fear, perhaps?
"Parents often cause "pain" on the part of their children to re-inforce a behavioral standard. This does not need to constitute spanking, because even a "time-out" can be considered very "painful" to a young child. However, you would not consider a parent who is trying to guide their child toward adulthood as not loving their child. Rather, the parent who never disciplines their child and never re-directs their immaturity is the one who hates their child because they do not want them to grow up to be well-adjusted adults who are mentally prepared to face the world."
This is all a very interesting analogy, with one major difference: parents are no omnipotent beings. In fact, you actually make the case that God isn't either omnipotent, or isn't loving/caring. Say, using your example, parents are omnipotent and love their children. Being omnipotent, they can choose whatever they want to guide their child, including options where the child is guided, WITHOUT hurting it, or - to counter any further semantics about the term 'hurt' - where the child does not experience the guidence as hurtfull or painful.
Now, if a parent had those oportunities, but STILL went for the option to guide his child in a way that it hurts the child, would you call those parents 'loving'? If the guidance can be arrived at with or without causing pain (which an omnipotent being would be able to), then obviously, a parent not wanting to cause pain to their child would with the latter option.
"Who are you to tell God that His way is the wrong way or that He is not loving? Can we even be totally sure that we completely understand what love really is?"
As said before, this doesn't matter. Whatever his goals or intentions or reasonings are, if he's omnipotent and omniscient he should know how WE feel about things, also in regard to what we consider love and pain. He still had the choice to not let us suffer in the sense that WE experience suffering. A god as you would have it, lacks anything what *we* would consider empathy, love, pain, suffering, etc. If he lacks those feelings - even in the presumed 'limited' manner as we experience them - he can't be omnipotent and omniscient.
All this would also lead to another contradiction, since another important tenent in christian belief is that 'we were created in his image'. In that case, it is difficult to believe he has no understanding about what love/pain/suffering/caring means to us. That, or he doesn't care about it.
Your mistake is trying to point out that we can't possibly know what an omnipotent being has in store for us, while the point rather is that it doesn't matter what he has in store for us (or what the endgoal is); as an *omnipotent* being, he could have chosen a way to reach that goal in a way we didn't need to suffer as
--- "To pee or not to pee, that is the question." ---
Something that may help your understanding of America: it's rather heterogeneous. The 48% result is a perfect example. Taking what one group says or does and extrapolating to the entire population just doesn't work well. That goes for education, beliefs, fears, diet, etc. With that in mind, I'd like to address your points (and often make the same dumb generalizations). Your biblical quotes really are taken literally by some, but they are ignoring the context and metaphor just as you are. Same mistake, different conclusions. I agree Americans are a fearful lot. Sad, really. Humans biologically cannot assess risk very well (tons of studies on that). Americans have avoided real tragedy for so long, we have developed an allergic reaction to dangers that are trivial. On the other hand, we aren't scared to fail. From our lack of social programs (healthcare, etc) to the wars we get burned by, we take risks seen as insane by others. So I'll accept irrational, but not always cowards. Generally, Islam has not concerned itself with evolution until very recently for unrelated reasons. A comparison there is rather silly. Frequent disbelief of scientists is real, and also rather silly. However, there are several instances that disbelief is even worse in Europe. Take GM foods for example. Or labor economics. Our murder rate is unforgivable. However, extrapolating the actions of a few to call us all monsters is rather poor logic. We are a diverse bunch, and that includes having wide distribution with a statistical tail with too many violent, amoral people. It also includes a large number of overly moralistic people on the other end (who seem to overlap the anti-evolutionary crowd). It sucks. But we prefer it to making everyone act and think the same way. There are two parts to war: smashing and holding. Smashing we can do. We can level countries very easily. Holding, we have a bit more trouble. Ironically, it's because we place limits on the smashing. Any civilian loss of life is unacceptable. But historically, one you'd smashed your way into a territory, they rule was you devastate (or threaten to devastate) the population. Kill a soldier and an entire village would be killed. Now that's against policy. So the result is a guerrilla war. Eventually America will get tired and go home and everyone knows it. If winning were the only thing that matters, as you seem to think, America could do it. If we are too cowardly, it's being to cowardly to level cities (thank goodness). Oh, we do a pretty good job of messing up the neighborhood while we are there, but nothing of the systematic of scale of wars historically. I worry about anti-intellectualism (notice I at least spelled it correctly). Drives me crazy. But we don't have a monopoly. But your faux-intellectualism isn't much better. And finally, there is a lot in common between America and Iran. If it weren't for historical screw-ups, I believe we could actually be quite friendly. As it is, we are genuine enemies of each other (for silly reasons, but enemies none the less). Unlike your obsession with imagining America as your enemy.
The world is made by those who show up for the job.
...this was posted before 4/1, wasn't it..
Evolution, in the sense of molecules to man, requires an input of information. When you make an amoeba, that thing has a lot of information stored in it. When you give that amoeba the ability to consume food, that's more information. When you give it the ability to reproduce by dividing, there is a lot more information that has to be input. DNA and RNA are really little more than information on how the cell, and the organism overall, is supposed to act. Information theory basically says that the information of a system can not increase without an outside influence, and the second law of thermodynamics says that as time goes on, order tends towards disorder. Evolution, however, requires the opposite on both counts. That is what I mean when I say that macroevolution flies in the face of those two theories. The reason that the seed acts like it does is that the information for that tree is already in the seed. The seed effectively runs on a program that says "Do this, then do this, then do this." That's information. The cells are programmed to divide like that. Actually, I think it isn't a big if. There are inherently two choices: 1. We got here through some method that doesn't involve outside influence. 2. Some intelligent entity made us. There really aren't any other choices. Therefore, the 'if' isn't very big. It's going to be one or the other.
I just wish these people would also reject the science behind internal combustion so they'd stay the off the road when I'm driving.
Fellow true believers, there are no cars in the Bible, stop using the tools of the devil!
It is by the juice of the coffee bean that thoughts acquire speed, the teeth acquire stains. The stains become a warning
... I have to object to such moronic, uninformed and insiduous statement.
The catholic church is far more complex than what you think you know about it. In many countries around the world it is the only organization that brings some hope and help to the poorest of the poorest, the most ardent Catholics normally have very little to give to the Church, so your idiotic portrayal can be debunked with ease.
Having said that many people in the hierarchy make the best out of it for personal gain, but when I compare the unashamed money making activities of other "churches" (for lack of better name) in the US, the Catholic church is quite a decent institution in comparision, the people making money out of it at least pretend to be pious, all the preachers of markeeting one sees in the US in the other hand, oh dear me.
IANAL but write like a drunk one.
YOu don't have to pay for any of the services offered by the Catholic church.
If you do, then you are in the presence of a corrupt priest who should be reported to his superiors.
If you want to speak your mind do so informed. Tha catholic church, like any human institution, hast its share of good and bad people, but institutionally speaking it is not geared towards collecting money, as so many US religious institutions seem to be (perhaps because it is based nowadays mostly in poor countries, where people have little or nothing to give).
Speaking your mind based in misinformation and misunderstading is the worst kind of abuse of such freedom.
IANAL but write like a drunk one.
Well, actually, no there isn't. On the other hand, here's a bit of evidence to consider for conventional geology:
Take oil companies. Finding oil is a very important and high-stakes issue for them. Literally hundreds of billions of dollars are riding on it. When the chips are down and they need to find the most likely spots to drill - what kind of geology do they use? Flood geology, or mainstream? Which one actually delivers the goods?
Let's assume the Earth is only a few thousand years old. Where did the oil come from? Was it created in the ground with the rest of the Earth? If so, is there a way to predict where it might be found? Or perhaps it really did form from dinosaurs, but about 10,000 times faster than any chemist believes it could? Either way you look at it, a young Earth would imply some very interesting scientific questions to ask, some interesting (and potentially extremely valuable) research programs to start. How come nobody's actually pursuing such research programs?
If "Young Earth" geology actually fits the facts better, how about some of the believers pool their money and invest in looking for oil or valuable minerals? They don't have to do all the development and extraction themselves, they can settle for a percentage of the gross. It'd still be a wonderful investment. How about you start such a venture?
PHEM - party like it's 1997-2003!
So far so good.
Let's pretend I know something about information theory. Can you show your work on this? I think you're missing a very important variable: energy. Before coming back to this, you may want to reread the second law of thermodynamics. You've presented a very touchy-feely version of it, but not a complete or entirely accurate one. It's great for giving people a basic understanding of how thermodynamics works, but it falls flat on its face for what you're trying to do.
Let's try another exercise: We start with a bowl of salt water sitting in the sun. A week later later, the water has evaporated and the salt has formed lovely crystals in the bottom of the pot. Those salt crystals are highly ordered. What happened, thermodynamically speaking?
The point here is that given a flow of energy it's possible to separate systems into high and low entropy parts. That's how life does its thing. That's how living things keep from dissolving into disorderly piles of goo. It's also what allows DNA to accumulate information and complexity. Any system that takes energy as an input and is capable of reproducing itself with modification can very easily accumulate new information. For example, which strand of pseudo-DNA contains more information:
1) ACTGTGTATCGGGC
2) ACTGTGTATCGGGCCGGGCA
Clearly, version 2 does. There are known mechanisms for this type of change to happen in DNA, so clearly that sort of change doesn't violate the laws of thermodynamics. So, what gives?
Fundamentally what gives is, evolution violates the popular science version of the second law of thermodynamics, and it violates the hand waving versions of "information theory" people put up on web sites, but it doesn't cause any trouble for actual thermodynamics or actual information theory. If you think otherwise, I strongly suggest running the numbers. Any argument that uses thermodynamics and or information theory should be expressible mathematically. The problem is, creationist web tracts tend not to want to define their terms, because if they did, it would be obvious that they were equivocating by using words like "information" fast and loose and not according to the rules of the formal systems they're invoking.
So essentially you're suggesting the "evolution or magic" dilemma. I'm suggesting that even if evolutionary theory as it stands is wrong, there may be any number of other naturalistic explanations that still explain our observations and don't involve intelligent action. Cer
An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
Would that be the same 48% that voted for Bush?
Evolutionary theory does not address how life itself came about. Abiogenesis is a distinctly different field. But even so, life exists--we know that already. It's a bit odd to posit that something that has already happened is impossible. We may not know the agency (Hoyle was a fan of panspermia, for example) but that life exists indicates that life can come into existence.
Again, life exists, so I'd temper the "utter impossible" assessments. Considering that we, along with the men whose assessments you're trumpeting, don't know exactly how life came about, I'd take their calculations with an ounce of salt. You might be overestimating how impossible something is when it's actually just improbable. Shuffle one deck of cards, and the probability of coming out with any particular arrangement is one over a 68-digit number. Two decks of cards? One over a 166-digit number. It is trivially easy to do things at your dining-room table that are mind-staggeringly improbable. That's the problem with trying to assess the probability of something that already happened--it may have been improbable, but now it's a fait accompli, so it no longer makes sense to say it's impossible.
This is false, and is a deliberate mischaracterization by creationists of what Gould wrote. I'm sorry you were duped by this, but you might want to do an internet search for creationism and quote-mining. Here is a good link where you can read what Gould actually thought about those transitional fossils that you've been told he thought didn't exist. Again, I'm sorry you were lied to. It's hard enough to have a conversation about this complex of a subject without some creationist authors basically lying about what some scientist did or didn't say.
I'd love to, primarily because it's one of the most frequently explained examples of how complex structures can evolve piece by piece. Wikipedia has a good article on the subject, and if you search around there are others. I've read good explanations by Dawkins, and others. Even PBS has a decent article. Basically any light-sensetive cell would give an organism an advantage over his competitors, and over time any further advantages would accrue as they develop. You are underestimating the power of accumulated changes.
There are many articles covering transitional fossils. They are real, we have thousands of them, and they can be easily viewe
Well, if one disagrees that evolution is a much more likely, and in turn harder to disprove, theory, as opposed to creationism, then by all rights one WOULD BE an idiot! There is a lot of solid science out there that points in the direction of evolution as the most likely explanation for the origin of species. The amount of faith that I have to have in comprehending the gist of what evolutionists are trying to prove is almost nil. A lot of it is just common sense applied to an observable phenomenon. Compare that to the hate and fear-mongering religious wackos who are just trying to protect their source of income by keeping the wool pulled over their flock's (sheep) eyes. Is it any wonder that atheist intellectuals who view the world through thought and reason scoff at the religious addicts and their superstitions? Go sell your snake oil somewhere else Sister Christian. Just because some of us are too smart and level headed to buy your elixir doesn't mean we don't have the cajones to stand up and fight for what we don't believe in.
Given the totality of time and space surely such an event as the combination of millions of proteins becomes statistically probable e.g. above 0 (although not much) unless there is some process that would actually prevent this from happening (like magnets repelling each other). Just like monkeys and typewriters... which, incidentally, doesn't seem to work with real monkeys http://www.wired.com/culture/lifestyle/news/2003/0 5/58790
Time flies like an arrow. Fruit flies like a banana.
If there was justice in the world, doctors would refuse to give flu shots to people who don't believe in evolution. They'd let those who don't believe in evolution suffer the awful consequences of their ignorance.
(Note: this is comedy, not my actual opinion.)
Honestly, though, I detest the lack of gratitude. That people will simultaneously reap the benefits of scientific thought and attack science and scientists.
Education is the silver bullet.
"A mutation for an improved organ is also present in cells for other organs."
Yes, but that's because the DNA for that improved organ has its origin in the spermcel or eggcell (well, the mutation of their DNA, that is), comming from a parent organism. In the case of hive-insects, where the egg of the mutated-and-better-adapted worker-ant comes out, there is no way that infertile worker could be the parent to transmit his mutation throughout any other offspring. Thus, there is no parent - which is different with the analogy of the organs you gave. The right analogy would be, that a sudden mutation hits the organ (say, the heart) itself, and it starts working better (and thus, is beneficial).
But then the same problem arises; it's not possible for the mutation of the heart-organ, beneficial as it might be for the whole organism, to pass the mutation to any offspring, because it's *only a mutation happening in sperm and eggcells* which can provide the mechanism of transmitting a mutuation to any offspring. The mutation of the heart doesn't suddenly transfer, nor does it infuse itself into the DNA of the spermcell.
So, the main problem remains. To give a clear example of what I mean; let's say the ancestors of those ants were more simple, less specialised. At a certain moment, in the DNA of a queen-egg, there occurs a mutation; this mutuation turns out to be beneficial - say, the worker-ant develops an enzym which is far more efficient in providing digestable nutrients from raw food, for instance. Now, that ant lives its life, then dies...since workers are unfertile, they don't mate with the queen, and they don't pass on their beneficial mutation.
So how the heck did those specialised ants come to be, and how do they (the next generation) keep existing in the next hive(s)?
--- "To pee or not to pee, that is the question." ---
Apparently there was a bit of ignorance on my part of where the information on information theory that I was referring to came from. It falls under information theory, but is more specifically called the 'law of conservation of information.' It was coined by a man named Medawar "to describe the weaker claim that deterministic laws cannot produce novel information." A man named Tellgren claims that it is mathematically invalid, Dembski disagrees, and the mathematical proofs thereof are all above and beyond my capacity for understanding. It basically states that in a closed system, there can be no increase in information without an outside influence. According to Rudolf Clausius, "The entropy of an isolated system not in equilibrium will tend to increase over time, approaching a maximum value at equilibrium." What definition of the second law are you using that gives my point trouble? As far as energy is concerned: energy is only useful when it is focused. You can put a bull in a china shop and generate a ton of energy, but nothing good can come of it. I've seen people in pools expend huge amounts of energy to get to shore and fail because they didn't know how to focus it (they made it out ok). You can take the pieces of a clock, put them in a bag and shake it for eternity and it'll never actually come together to make the clock. You can put a frog in a blender and expose it to a lot of energy, but no life will come of it. With the salt crystals: That's how salt comes together; it just won't happen any other way in normal circumstances. However, the same is not so for DNA. There is no particular order that the 4 nucleotides have to go in. The fact that they do go the way they do for whatever animal or organism we're talking about is just because that's how they're programmed to form, not because there's any particular force that makes them form that way. Besides, although the sequence AGCAGCAGCAGCAGC is very ordered, there's really nothing that you can do with it. You need a huge amount of variety to make DNA that will accomplish anything, and if even a few nucleotides are in the wrong place, the results could very well be disastrous. If I'm defining my terms incorrectly or being less than forthcoming, please be aware that it is not intentional. However, as opposed to just telling me that I'm using them incorrectly, show me the right way and why. Nowhere in my two choices did I mention evolution. I specifically made it in the form of whether or not there is an outside influence of any kind, as would exist in the presence of a deity of some kind. I also object that you refer to the second of the two forms as "magic." I don't think evolution is possible, but I'm not going to insult your intelligence by calling it magic or stupid or retarded or anything like that. I've been saying that I disagree with it for X reason. As far as other things instead of evolution: why is it so offensive to you that a deity created the world? If he did, then he couldn't possibly have violated the laws of physics or thermodynamics. He created them. He is outside of them, not subject to them. If you are fundamentally different from what you create, you aren't subject to it. I hypothesize this: Around 6,000 years ago, God created the world and everything in it. He created it with the appearance of age, although I don't think He created it with the appearance of millions or billions of years. He created it in six literal days, with the light being created before the earth, which is why we can see stars that are so far away. Most fossils were formed during the flood, as well as a lot of major land-masses. As far as the big bang: Scientists view the universe as a big clock that is slowly winding down. As they rewind it to see how it formed, they reach the point where it actually started but don't know it and drive on to where it becomes this little infinitely dense point. The point never existed, but they don't know that they rewound farther than they should have.
The point here is that while selection could be called deterministic, the input to it is random. Even if deterministic systems can't create new information (and I suppose I'll tend to agree barring somebody pointing out where I'm wrong), the random mutations that drive much of natural selection are decidedly not deterministic. I suppose that one could say, philosophically, that the entire universe is predetermined and pre-loaded with all the information we need, but I'm excluding that point for the moment. I know that if I say that too loudly, MarxistHacker42 will show up. Natural selection is essentially a filter for a huge amount of information being pumped in into it in the form of mutated and crossed over genetic material.
That's a much better definition. The part you're missing is the phrase isolated system. Life is not, by any stretch, an isolated system. It constantly takes in energy and keeps its localized entropy low. Once you start doing that, all bets are off and the whole thermodynamics argument goes out the window. Self-replicating systems are essentially machines whose job it is to take in energy and high-entropy inputs and create low-entropy output. It is also worth remembering that the second law is probabilistic in nature. It's possible to violate the second law on very small scales (cold regions of molecules allowing a net flow of heat to warmer regions of molecules), although extremely unlikely for macroscopic violations to happen. In short, tiny violations of the second law can and do occur on the molecular level.
These are all fine aphorisms, but they really don't address the topic at hand. Natural selection is the focusing mechanism. When one mutates DNA (or produces novel sequences through sexual reproduction), one is throwing your proverbial clock parts into a bag. The difference here is that natural selection filters those results and can actually end up with a clock. Let's modify the experiment for the moment: Imagine you shake that bag around and there's a little person inside. Whenever two pieces hit one another, that person decides whether they've gone into useful positions or not. If they have, he holds them together. If not, they go on shaking. Eventually, you'll find gears meshing and find some interesting mechanical mini-contraptions in your bag. All you put in was raw material and random shaking, but a simple filter ("if the pieces fit together, keep them") ends up producing interesting results.
Likewise, if some DNA randomly gets copied (and this happens very regularly), the environment will filter the results. Many times, it does so by killing the mutant. More often, nothing noti
An interesting anagram of "BANACH TARSKI" is "BANACH TARSKI BANACH TARSKI"
The parent post clearly didn't fit these requirements. Sure, the parent's opinions and beliefs may be different from many here at
Well, I guess we have to go from first principles. There are two scenarios here:
1/ One of the eggs that a Queen lays contains a mutation that provides some benefit. The egg hatches, and the resultant worker - or soldier or whatever, scurries away being more efficient or capable at doing something. It would need to be highly beneficial because it needs to have the direct affect of keeping the Queen alive. However, a single individual (in a hive) has little overall effect on an entire hive. Unless it did something like produce a digested bit of food that, when fed to the Queen, made her lay more eggs per volume of food intake, or something. Eventually, this worker dies, and the hive is back to where it was.
2/ The mutation occurs in an egg that is destined to be a Queen. Now here is the trick. The mutation gives cause for the new Queen to on-lay eggs of her own, and these eggs develop into a new type of individual. It's a subtle thing you see. The mutation may be such that every 3rd egg develops into a soldier (rather than all eggs developing into workers). A soldier may simply be a worker with a bigger set of mandibles. This then leads the hive to be successful - and perhaps more successful than neighbouring hives without the mutation.
The Queen then lays an egg that develops into a new Queen, and so the mutation will be passed onto subsequent hives.
In summary, the mutation (in such a situation), has to occur in an egg that develops into a Queen. The Queen's offspring are the ones that will determine the success of the mutation. The Queen is therefore simply a delivery device.
Of course, there may be mutations that give the Queen added benefits, such as egg laying ability, or whatever.
so, your definition fits the theory you're trying to prove. How convenient. Circular, but convenient.
It is funny how Environmentalists call all sorts of animals "different species" when in reality they are not, just to get "endangered" label attached.
Oh, that is a different classification? So, on the one hand, they are the "same" on the other hand they are "Different".
Call me back when Evolutionists and Environmentalists can agree on a common definition that can be applied to both.
Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
I am explaining to you how animals with different DNA evolve. Call them teletubbies rather than species if you prefer.
The point is just that new species are trivial to create - and are being created all around us right now. Lion/Tiger are almost divereged - soon to be new species. Horse/Donkey are in the process of diverging right now. Man/Chimpanzee diverged quite recently and are now separate species.
Modern DNA sequencing makes denying the evidence rather, uh, stupid. Darwin (pre DNA) had a theory. Darwin + DNA = proof.
New species creation:
1) Red teletubbies group #1 evolve and become purple
2) Red teletubbies group #2 evolve seperately (maybe they live on their own island) and become orange
3) Purple and orange teletubbies can't successfully breed ----> Now they are separate teletubbies (since no more DNA mixing)
4) Purple teletubbies continue to evolve and maybe become tall and hairy
5) Orange teletubbies continue to evolve and maybe become short with a long tail
6) Creationist realizes that the tall hairly purple teletubbies are a different species from the short orange ones with the long tail, and falls out of his tree
is anyone else disturbed that unwavering belief in the theory of evolution has become a litmus test for intelligence?
An unwavering belief in the theory of evolution is not a litmus test for intelligence, however Is evolution well-supported by evidence and widely accepted within the scientific community?', some 48% of Americans said 'No' is an issue of just plain ignorance.
Your average man of the street generally has no particular need to study the details of physics electromagnetism or chemistry element theory nor biology evolution. He does not need an unwavering belief in any of them. But any most minimal highschool education absolutely must inform of the fact that these things *ARE* all established beyond any reasonable doubt and that they *ARE* all considered the accepted and established foundations of all work in the fields of physics chemistry and biology by effectively 100% of all degreed professionals working in those fields.
According to Newsweek magazine figures there are approximately 480,000 degreed earth and life scientists in the US on the "pro-evolution" side vs approximately 700 against. That works out to 99.85% or so. For any reasonable highschool education, 99.85% rounds off to "ALL OF THEM".
The average person does not need to understand elements, the average person does not particularly need to "beleive" in elements. However it is inexcusable ignorance to be unaware of the FACT that elements are effectively the indisputed established truth and foundation of all work in related fields of science.
The average person does not need to understand evolution, the average person does not particularly need to "beleive" in evolution. However it is inexcusable ignorance to be unaware of the FACT that evolution is effectively the indisputed established truth and foundation of all work in related fields of science.
The very reason that evolution is accepted by about 99.85% of everyone who ever gets any college education and degree in any area of the earth and life sciences is because in the course of that education they study the subject and they study the evidence and the arguments and counter arguments, and they come to the conclusion that the evidence is overwhelming and conclusive, and that none of the counter arguments hold up. And as this very poll shows, many if not most of the students entering any of these fields goes in initially believing the exact opposite. Almost all of those students doing in are Christian, and many of them are deeply religious and devout Christians. Some of them even go into the field for the explicit purpose of tearing down all this "evolution nonsense". And virtually without exception they all come out of that education convinced by the evidence. Even the deeply religious most devout Christians who enter the field with the intent of tearing down evolution almost without exception come out having learned and having been convinced of evolution. Just as one taking a chemistry course would come out convinced about elements. The they do not all magically become atheists. They realize that there is no conflict between God and evolution. They simply accept evolution as God's mechanism for the diversity of life. Just as they accept optics as the mechanism for producing rainbows, and nuclear fusion for creating light for the earth.
You don't need to believe evolution any more than you need to believe elements, but you have been either lied to or horribly misled if you have the impression that there is any genuine scientific controversy or doubt around evolution. There is a public relations controversy over evolution, and there is political controversy over evolution, but scientifically the number of biologists against evolution is approximately equal to the number of astronomers who claim the sun is powered by electricity, and that number is only slightly higher than the number of geologists in the Flat Earth Society.
-
- - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
They have already decided that Christians aren't smart and could not possibly have a competing idea or the ability to debate evolution in a credible way
Wow are you out of touch with reality.
The majority of Christians *are* smart, reasonable, generally rational people. And the majority of Christians in the world are on the evolution side. And (at least in the western world) the overwhelming majority of "evolutionists" are Christians.
So you are making this bizarre delusional statement that the MAJORITY of Christians in the world (evolutionists) "have already decided that Christians aren't smart".
Who the hell do you think these "Christian hating evolutionists" are? Almost all of them ARE Christians!
There is public controversy over evolution. There is political controversy over evolution. But there is no genuine scientific controversy over evolution. According to Newsweek magazine figures there are approximately 480,000 degreed earth and life scientists in the US on the evolution side, and approximately 700 against. 99.85% or so. For all practical purposed EVERYONE who has bothered to study the subject and get a degree is absolutely convinced by the overwheling absolutely conclusive evidence. And that includes extremely bright dedicated deeply religious devout Christian students who went into the field to tear down this "evolution nonsense"... virtually 100% of them who actually study the subject are convinced. Optics is the mechanism that produces rainbows, nuclear fusion is the mechanism for the sun to produce light for the earth, evolution is the mechanism that produces the diversity of life on earth, a rotating moving earth orbiting the sun is the mechanism for dividing the light from the dark (day from night) and the seasons on earth, and NONE of those mechanisms in any way denies or conflicts with God. Gos does not cease to exist because optics explains the mechanism of rainbows. God does not cease to exist because the earth moves. Yet there are and were people with the hubris to tell God how He is and is not permitted to run His Creation. People who had the hubris to tell God He was forbidden to have chosen the earth orbiting the sun as His mechanism for the solar system. The very same kind of people today the hubris to tell God He is forbidden to have chosen evolution as His mechanism for the diversity of life. The majority of Christians on earth accept God and evolution.
The US is pretty much the only developed country where that percentage dips much below 50%. The only developed country ranking below the US is accepting evolution is Turkey... and Turkey isn't even a Christian country. All of the major developed Christian countries have higher acceptance of evolution than the US. It really *IS* the majority of Christians on earth who have obtained a at least a minimally adaquate biology education to understand and accept evolution. There is no genuine scientific challenge or doubt over evolution. It's just that far far too many US highschools provide a pathetic-to-nonexistant education in biology to avoid the hassle of some damn ignorant Yahoo throwing a hissyfit disruption over evolution education.
The average member of the general public does not need to understand or even believe element theory in chemistry to get by in general life, and the average member of the general public does not need to understand or even believe evolution theory in biology to get by in general life, but any minimally educated highschool graduate damn well better know the FACT that elements are considered the very foundation of the entire field of chemistry and for all work by all professionals in the field of chemistry and that those professionals EFFECTIVELY UNANIMOUSLY consider it to be supported by overwhelming irrefutable evidence, and any minimally educated highschool graduate damn well better know the FACT that evolution is considered the very foundation of the entire field of biology and for all work by all professionals in the field of biology and that those prof
- - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
This is my sig. There are many like it but this one is mine.
Claims like that demonstrate the failure of scientists and the media to communicate science to the general public. Like so many others who think Earth (or life) represents an impossible increase in "order", you think you understand entropy but you don't.
Learn what thermodynamics actually says. Google for "fermi thermodynamics site:amazon.com". Some (not much) calculus required.
As opposed to the supreme arrogance of believing we're God's favorite creature?
You can view atheism as arrogance, but that says more about you than about atheism. Most regard it as humbling to be a cousin of both chimpanzees and drosophila, all of us children of stardust and chaos rather than children of God.
And no scientist should ever tell you that we're the top tier of existence, because that presumes we're the only and/or most advanced civilization in the universe/multiverse, which is far from certain.
Dude, you can make a huge post by copy-pasting some of the popular creationist propaganda and from 10 feet distance from my screen, it'll actually look like a response if I'm not wearing my glasses, but upon closer inspection, it's simply not in any meaningful way a response to what *I* wrote.
How are we ever to have a real discussion on this subject when all the creationists do is keep spouting already-refuted propaganda? The creationists fall into two groups: the ones who are simply ignorant and the ones who aren't ignorant, but do whatever they can to keep the first group ignorant.
Whichever way you look at it, trying to attack a theory in favour of one that states that everything was just put there the way it is now has nothing whatsoever to do with science or reality.
see a Text Widget